Antibody-oligonucleotide conjugate and use thereof
By using engineered antibodies and triple-linker linkers for site-specific conjugation, the problems of low delivery efficiency and low purity of antibody oligonucleotide conjugates in muscle tissue were solved, achieving a highly efficient DMPK gene inhibition effect and demonstrating significant pharmaceutical potential.
Patent Information
- Application Number
- PCT/CN2025/104859
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-19
- Filing Date
- 2025-06-27
- Publication Date
- 2026-01-22
AI Technical Summary
In the prior art, antibody oligonucleotide conjugates are inefficient and have low purity when delivered to muscle tissue, and the linkers are not stable enough in plasma, making it difficult to effectively target and inhibit the expression of the DMPK gene.
The engineered antibody was site-directedly conjugated with a three-linker linker, which is more stable in plasma. The linker was conjugated with oligonucleotides through click chemistry, which improved the affinity for the target and the efficiency of muscle delivery.
It significantly improves the delivery efficiency and purity of antibody oligonucleotide conjugates in muscle tissue, and can achieve 40% DMPK gene knockdown inhibition at high doses, showing better pharmaceutical potential.
Smart Images

Figure CN2025104859_22012026_PF_FP_ABST
Abstract
Description
Antibody oligonucleotide conjugates and uses thereof TECHNICAL FIELD
[0001] The present application belongs to the technical field of molecular biology, and specifically relates to an antibody oligonucleotide conjugate and a preparation method and application thereof. BACKGROUND
[0002] Transferrin receptor (TfR) is a type II transmembrane glycoprotein and also a glycoprotein expressed on the cell surface, which is cross-linked by disulfide bond by two homodimeric subunits with a size of about 90 kDa. TfR is composed of 760 amino acids and participates in the transport of iron ions in the form of a dimer (180 kDa). Two kinds of transferrin receptors are known in the human body: transferrin receptor 1 (TfR1) and transferrin receptor 2 (TfR2). The former is mainly expressed on cancer cells, muscle cells and endothelial cells of the blood-brain barrier, and the latter is mainly expressed on hepatocytes. Transferrin receptor is one of the most widely targeted receptors for the development of targeted diagnosis and treatment.
[0003] RNA interference (RNAi) is a process for effectively silencing or inhibiting the expression of a target gene, which is achieved by selectively inactivating the corresponding mRNA of the target gene through double-stranded RNA (dsRNA). RNA interference is activated by double-stranded RNA transported into the cytoplasm of the cell. The silencing mechanism can cause the degradation of target mRNA induced by small interfering RNA (siRNA) or short hairpin RNA (shRNA), or the inhibition of specific mRNA translation induced by small RNA (miRNA).
[0004] Using TfR1 antibody as a delivery system, the delivery of drugs to TfR1 high-expression tissues can be achieved without affecting the absorption of iron ions. Using TfR1 antibody oligonucleotide conjugate, targeting muscle cells, selective silencing or inhibition of target genes has the opportunity to treat genetic diseases of muscle, such as myotonic muscular dystrophy.
[0005] Chinese patents CN109715805B and CN111655268A describe a form of antibody oligonucleotide conjugate. The differences between the present invention and the prior art include: 1) the present application uses an engineered antibody, rather than a natural antibody, as a carrier, which is beneficial to improve the coupling efficiency and the yield of the target product; 2) the present application uses a linker different from CN109715805B and CN111655268A, the linker of the present patent is more stable in plasma, and the specific two-step site-specific coupling method significantly improves the purity of the target product; 3) the antibody oligonucleotide conjugate of the present application significantly improves the affinity to the target, improves the delivery efficiency of the muscle, and has the opportunity to obtain more excellent pharmaceutical effects. SUMMARY
[0006] One of the purposes of the present application is to provide an antibody oligonucleotide conjugate capable of adjusting the expression level of DMPK in cells, subjects, said DMPK is a gene encoding DM1 protein kinase, said antibody oligonucleotide conjugate is used to selectively and effectively knock down the expression of DMPK gene.
[0007] Another purpose of the present application is also to provide a preparation method of an antibody oligonucleotide conjugate for adjusting a gene related to muscular dystrophy (for example, DM1).
[0008] Another purpose of the present application is also to provide a method of treating muscular atrophy or use in the preparation of a medicament for treating muscular atrophy using the antibody oligonucleotide conjugate of the present application.
[0009] The first aspect of the present application provides a linker for connecting an antibody or an antigen binding fragment to an oligonucleotide, said linker has 3 linkers, two of which are used to covalently connect to said antibody or antigen binding fragment at the same time, and the third linker is used to covalently connect to the 3' or 5' end of said oligonucleotide.
[0010] Further, said linker has the following general formula:
[0011] wherein R1 and R2 are independent groups, R1 is a functional group that can selectively react with cysteine, R2 represents a functional group that can undergo click chemistry reaction with an azido group, n1 represents the number of carbon atoms, n1 is any integer between 1-10; n2 represents the number of PEG, n2 is any integer between 1-20.
[0012] Further, R1 is:
[0013] R2 is dibenzo cyclooctyne or bicyclo[6,1,0]nonyne.
[0014] Further, the linker has the following structure:
[0015] Further, the 3rd linker of the linker is connected to the oligonucleotide through a click chemistry reaction.
[0016] The second aspect of the present application also provides an antibody-oligonucleotide conjugate comprising the above linker, further comprising an antibody or antigen-binding fragment capable of binding to human transferrin receptor, and an oligonucleotide capable of hybridizing to a DMPK target sequence.
[0017] Further, the oligonucleotide has a sense strand and an antisense strand, the sense strand has 80% or more, preferably 85% or more, further preferably 90% or more, and more further preferably 95% or more of identity to SEQ ID NO: 1 (GACAUUCCUCGGUAUUUAA); and the antisense strand has 80% or more, preferably 85% or more, further preferably 90% or more, and more further preferably 95% or more of identity to SEQ ID NO: 2 (UUAAAUACCGAGGAAUGUCUU).
[0018] Further, the oligonucleotide is provided with an azido linker at the terminal end, the azido linker is connected to a 6-amino-1-hexanol linker, and the 6-amino-1-hexanol linker is covalently connected to the oxygen atom of the phosphate molecule at the 3' or 5' end of the sense strand or the antisense strand of the oligonucleotide.
[0019] Further, the antibody or antigen-binding fragment comprises a heavy chain and a light chain, wherein the light chain has at least 80% identity, preferably at least 85%, further preferably 90%, more further preferably 95%, and most preferably 99% identity to a sequence selected from any one of SEQ ID NO: 3, 5, 7, and 9; and the heavy chain has at least 80% identity, preferably at least 85%, further preferably 90%, more further preferably 95%, and most preferably 99% identity to a sequence selected from any one of SEQ ID NO: 4, 6, 8, and 10.
[0020] Further, the antibody or antigen-binding fragment is an engineered cysteine-containing polypeptide fragment, wherein the engineering comprises mutating a specific amino acid to cysteine, the position of the mutation is 239 (S239C) on the heavy chain, 298 (S298C) on the heavy chain, 327 (A327C) on the heavy chain, or inserting a cysteine after 238 (S238i) on the heavy chain.
[0021] Further, the method comprises a site-directed conjugation process, which comprises: reducing the site of conjugation of the cysteine residues on the antibody or antigen binding fragment and interchain disulfide bonds, oxidizing the interchain disulfide bonds, linking a tri-adapter linker to the cysteine, and finally conjugating with an oligonucleotide comprising N3 to form an antibody oligonucleotide conjugate.
[0022] The third aspect of the present application also provides the use of the conjugate described above for preparing a pharmaceutical composition for treating muscle atrophy or myotonic muscular dystrophy.
[0023] The present application has the following beneficial effects: 1) the present application uses an engineered antibody, which is beneficial to improve the coupling efficiency and the yield of the target product; 2) the tri-adapter linker of the present application is more stable in plasma, and the specific two-step site-directed conjugation method can significantly improve the purity of the target product; 3) the antibody oligonucleotide conjugate of the present application significantly improves the affinity to the target, improves the delivery efficiency of the muscle, and has the opportunity to obtain more excellent pharmaceutical effects; 4) the antibody oligonucleotide conjugate of the present application can effectively inhibit the expression of the DMPK gene in an ex vivo experiment, and the highest knockdown inhibition effect can reach 40% at a high dose. BRIEF DESCRIPTION OF DRAWINGS
[0024] Figure 1 is a distribution detection result of DAR1 and DAR2 antibody oligonucleotide conjugates in the quadriceps muscle and liver of mice according to the embodiments of the present application.
[0025] Figure 2 is a target gene silencing efficiency detection result of DAR1 and DAR2 antibody oligonucleotide conjugates in the quadriceps muscle and liver of mice according to the embodiments of the present application.
[0026] Figure 3 is a synthesis route of the tri-adapter linker CGBS-0013 according to the embodiments of the present application.
[0027] Figure 4 is a tri-adapter linker conjugation process flowchart according to the embodiments of the present application.
[0028] Figure 5 is a target gene knockdown result chart of an antibody oligonucleotide conjugate in human rhabdomyosarcoma cells according to the embodiments of the present application. DETAILED DESCRIPTION
[0029] In order to make the technical problems to be solved by the present application, the technical solutions and beneficial effects more clear and explicit, the present application will be further described in detail below in combination with the drawings, embodiments and implementation schemes. It should be understood that the specific embodiments described herein are only used to explain the present application and do not limit the present application.
[0030] The antibody oligonucleotide conjugate for use in modulating DMPK expression in a subject is capable of selectively knocking down expression of a DMPK gene, the conjugate comprising: a) an antibody or antigen binding fragment capable of binding to a human transferrin receptor, b) an oligonucleotide molecule capable of hybridizing to a DMPK target sequence.
[0031] Further, the oligonucleotide molecule has a sense strand and an antisense strand, the sense strand having more than 80% identity, preferably more than 85%, further preferably more than 90%, and more further preferably more than 95% identity to SEQ ID NO: 1; the antisense strand having more than 80% identity, preferably more than 85%, further preferably more than 90%, and more further preferably more than 95% identity to SEQ ID NO: 2.
[0032] In some embodiments, the nucleic acid sense strand and / or antisense strand comprises partially unmodified nucleotides.
[0033] In some embodiments, the nucleic acid sense strand and / or antisense strand comprises modified nucleotides, the modified nucleotides comprising: deoxynucleotides, nucleotide mimics, abasic nucleotides (denoted as X, Ab in the present application), 2’-modified nucleotides, 3’ to 3 linkage (inverted) nucleotides (denoted as invdN, invN, invn, invX, invAb in the present application), nucleotides comprising non-natural bases, bridged nucleotides, peptide nucleic acids (PNA), 2’,3’-seco nucleotide mimics (unlocked nucleobase analogs, denoted as NUNA in the present application), locked nucleotides (denoted as NLNA or 10NLNA in the present application), 3’-O-methoxy (2’ internucleosidic linkage) nucleotides (denoted as 3’-OMen in the present application), 2’-F-arabino nucleotides (denoted as NfANA in the present application), 5’-Me, 2’-fluoro nucleotides (denoted as 5Me-Nf in the present application), morpholino nucleotides, phosphonovinyl deoxyribonucleotides (denoted as vpdN in the present application), phosphonovinyl-containing nucleotides, and phosphonocyclopropyl-containing nucleotides (cPrpN). Specifically, more than one modification can be incorporated in a single polynucleic acid molecule or even in a single nucleotide thereof. The polynucleic acid molecule sense strand and antisense strand can be synthesized and / or modified by methods known in the art. The modification at one nucleotide is independent of the modification at another nucleotide.
[0034] In some embodiments, the oligonucleotide molecule is linked to a linker.
[0035] Specifically, the linker is an azido linker.
[0036] Specifically, the linker is coupled to the 5’ end of the sense strand.
[0037] Preferably, the linker is a C6 linker. Further preferably, the C6 linker is a 6-amino-1- hexanol linker. Further preferably, the 6-amino-1-hexanol linker is used for covalent attachment to an azido group.
[0038] In some embodiments, the anti-transferrin receptor antibody or antigen binding fragment that can bind to human transferrin receptor comprises at least one heavy chain and one light chain, the light chain having at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to a sequence selected from any one of SEQ ID NOs: 3, 5, 7, and 9. In some embodiments, the heavy chain region has at least 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to a sequence selected from any one of SEQ ID NOs: 4, 6, 8, and 10.
[0039] In some embodiments, the anti-transferrin receptor antibody or antigen binding fragment comprises at least one heavy chain and one light chain, wherein the heavy chain and light chain comprise the following sequences:
[0040] a) the light chain comprises SEQ ID NO: 3 and the heavy chain comprises SEQ ID NO: 4
[0041] b) the light chain comprises SEQ ID NO: 5 and the heavy chain comprises SEQ ID NO: 6
[0042] c) the light chain comprises SEQ ID NO: 7 and the heavy chain comprises SEQ ID NO: 8
[0043] d) the light chain comprises SEQ ID NO: 9 and the heavy chain comprises SEQ ID NO: 10.
[0044] In some embodiments, the anti-transferrin receptor antibody comprises a variable light chain (VL) region and a variable heavy chain (VH) region, wherein the VL region comprises a LCDR1 sequence of SEQ ID NO: 11 (QASQNIHPHVA); a LCDR2 sequence of SEQ ID NO: 12 (SASRLQR); and a LCDR3 sequence of SEQ ID NO: 13 (QSSGAIANYGGT).
[0045] In some embodiments, the VH region comprises a HCDR1 sequence of SEQ ID NO: 14 (GFSLQNWYMI); a HCDR2 sequence of SEQ ID NO: 15 (FMHNDGTTYFASWAKG); and a HCDR3 sequence of SEQ ID NO: 16 (YGGSNSGADL).
[0046] In some embodiments, the anti-transferrin receptor antibody comprises a humanized antibody or antigen-binding fragment thereof, or a chimeric antibody or antigen-binding fragment thereof, or a multispecific antibody or antigen-binding fragment thereof. In some embodiments, the anti-transferrin receptor antibody comprises an IgG-scFv, a nanobody, a BiTE, a diabody, a DART, a TandAb, a scDiabody, a scDiabody-CH3, a triabody, a minibody, a microbody, a TriBi minibody, a scFv-CH3 KIH, a Fab-scFv-Fc KIH, a Fab-scFv, a scFv-CH-CL-scFv, a F(ab')2, a F(ab')2-scFv2, a scFv-KIH, a Fab-scFv-Fc, a tetravalent HCAb, a scDiabody-Fc, a diabody-Fc, a tandem scFv-Fc, or an intrabody.
[0047] In some embodiments, the anti-transferrin receptor antibody comprises an IgG1 framework. Alternatively, in some embodiments, the anti-transferrin receptor antibody can comprise an IgG2 framework. In some cases, the IgG2 framework is an IgG2b framework. Alternatively, in some embodiments, the anti-transferrin receptor antibody comprises an IgG4 framework.
[0048] In some embodiments, the anti-transferrin receptor antibody or antigen-binding fragment thereof further comprises a heavy chain constant region (CH) or a portion thereof, preferably the CH is from a human IgG1, preferably the CH is a mutated human IgG1, further preferably the mutation is a LALA mutation and a LR mutation.
[0049] In some embodiments, the anti-transferrin receptor antibody or antigen-binding fragment thereof comprises a half-life extension molecule, such as an Fc fragment of an immunoglobulin or human serum albumin (HSA).
[0050] In some embodiments, the anti-transferrin receptor antibody or antigen-binding fragment thereof comprises an engineered cysteine for conjugation of an oligonucleotide. The engineering comprises mutating a particular amino acid to cysteine at position 239 (S239C), position 298 (S298C), or position 327 (A327C) on the heavy chain (all amino acid positions according to Kabat), or inserting a cysteine after a particular amino acid at position 238 (S238i) on the heavy chain (all amino acid positions according to Kabat).
[0051] In some embodiments, the engineered cysteine residue is used for conjugation to the polynucleic acid molecule.
[0052] In some embodiments, the cysteine residue is located within the Fc domain of the anti- transferrin receptor antibody or antigen binding fragment thereof.
[0053] In some embodiments, the ratio of the polynucleic acid molecule to the anti-transferrin receptor antibody or antigen binding fragment thereof is about 1:1, 2:1, 3:1, or 4:1.
[0054] Further, the oligonucleotide molecule conjugate further comprises a linker connecting the anti-transferrin receptor antibody or antigen binding fragment thereof to the oligonucleotide molecule, the linker comprising 3 linkers.
[0055] Further, the linker comprising 3 linkers has the following structure:
[0056] wherein, R1, R2 are independent groups, R1 represents a functional group that can selectively react with cysteine, R2 represents a functional group that can undergo click chemistry reaction with azido group, n1 represents the number of carbon atoms, n2 represents the number of PEG.
[0057] Further, R1 has the following structure:
[0058] Further, R2 represents a group that can undergo click chemistry reaction with azido, including: dibenzocyclooctyne (DBCO), bicyclo[6,1,0]nonyne (BCN).
[0059] Further, n1 represents the number of carbon atoms, n1 is taken from any integer between 1-10.
[0060] Further, n2 represents the number of PEG, n2 is taken from any integer between 1-20.
[0061] In some embodiments, the linker is a trifunctional linker, which can be specifically the structure in Table 1.
[0062] Table 1 Typical tri-linker linker structure
[0063] In some embodiments, the linker has the following structure:
[0064] In some embodiments, the maleimide functional group in the linker can be replaced by sulfone, cyano, 4-vinylpyridine and other groups that can selectively react with sulfhydryl.
[0065] In some embodiments, the dibenzocyclooctyne (DBCO) in the linker can be replaced by bicyclo[6,1,0]nonyne (BCN).
[0066] In some embodiments, the linker has the following structure,
[0067] In some embodiments, the linker has the following structure,
[0068] In some embodiments, the linker has the following structure,
[0069] In some embodiments, the linker has the following structure,
[0070] In some embodiments, the linker has the following structure,
[0071] In some embodiments, the linker has the following structure,
[0072] In some embodiments, the antibody oligonucleotide conjugate provided by the present application has the following structure, wherein a represents an antibody, b represents a nucleic acid,
[0073] Preferably, in some embodiments, the antibody oligonucleotide conjugate has the following structure:
[0074] The second aspect of the present application provides a method for preparing an antibody oligonucleotide conjugate using a site-directed coupling technique.
[0075] Specifically, the site-directed coupling technique is achieved by introducing specific chemical functional groups on the antibody or oligonucleotide.
[0076] Further, the specific functional groups are capable of specifically reacting with and binding to the linker, thereby achieving the coupling between the antibody and the oligonucleotide.
[0077] Preferably, the specific functional groups are cysteine residues on the antibody or N3 linkers on the oligonucleotide.
[0078] Further, the site-directed coupling technique also includes the use of a tri-linker linker in the operation.
[0079] Further, the site-directed coupling technique process includes: first coupling the target site of the cysteine residue on the antibody and reducing the inter-chain disulfide bond, then oxidizing the inter-chain disulfide bond, then linking the tri-linker linker to the cysteine, and finally conjugating with the N3 oligonucleotide to form the antibody oligonucleotide conjugate.
[0080] The application also provides a use of the antibody oligonucleotide conjugate for preparing a pharmaceutical composition for treating muscle atrophy or myotonic muscular dystrophy.
[0081] The application is further described below through specific examples.
[0082] Example 1. Expression and purification identification of antibodies containing different cysteine mutation sites
[0083] The gene information corresponding to the antibody sequence was synthesized by a chemical method and cloned into a pTT5 vector. After extracting the transfection plasmid, the plasmid containing the nucleic acid sequence of the expressed antibody was transiently transfected into ExpiCHO cells, which were cultured in a shaking flask at 37°C in an 8% CO2 environment. The cell culture supernatant was collected on the fourteenth day for purification. The cell liquid was centrifuged (10000 rpm, 4°C, 30 min), the supernatant was collected, and filtered with a 0.45 μm filter to obtain a clear filtrate, which was used to capture the target protein by Protein A affinity. The filler was MabSelect SuRe Lx. After washing and elution with appropriate buffers, the eluted fractions were combined and the buffer was replaced with a final preparation buffer. Among them, the binding buffer was 0.02M Tris-HCl 0.15M NaCl, pH 7.5; the elution buffer was 0.05M NaAc, pH 3.5; and the final buffer was 0.05M NaAc, pH 6.5. After antibody purification, the supernatant concentration was determined using A280, and the antibody purity was analyzed by SEC-HPLC. The obtained antibody sequence information and expression are shown in Tables 2 and 3.
[0084] Table 2 Antibody sequence information
[0085] Table 3 Antibody expression
[0086] Except for S298C, the expression amount of the remaining mutant antibodies did not decrease significantly compared with the original antibody (wt), and the expression amount of A327C was the highest.
[0087] Example 2. Coupling efficiency of cysteine mutant antibodies and SMCC-siRNA
[0088] The antibody was buffer exchanged into 25 mM Tris buffer (pH 8) and concentrated to 10 mg / mL. To this solution, 100 equivalents of DTT in the same buffer was added and incubated at room temperature for 16 hours. The reaction was then buffer exchanged by ultrafiltration into 2 mM EDTA in 25 mM Tris buffer (pH 7.5) and 20 equivalents of DHAA was added and reacted at room temperature (RT) for 2 hours. The resulting reaction mixture was desalted to remove excess DHAA and combined with SMCC-siRNA (0.8 equivalents) and reacted at 22 °C for 1 hour. The reaction mixture was analyzed by analytical SAX column chromatography (chromatographic conditions are shown in Table 4) and the ratio of antibody oligonucleotide conjugate to unreacted antibody and siRNA was determined by peak area of the chromatogram. The coupling efficiency results are shown in Table 5. As can be seen from Table 5, different cysteine mutation sites significantly affect the coupling efficiency of antibody to SMCC-siRNA, with S239C mutant antibody forming DAR1 with the highest efficiency.
[0089] Table 4 Anion exchange chromatography method (SAX)
[0090] Table 5 Comparison of coupling efficiency of different cysteine mutant antibodies to SMCC-siRNA
[0091] Example 3. Activity of antibody oligonucleotide conjugates
[0092] To compare the in vivo activity of both DAR1 and DAR2 antibody oligonucleotide conjugates, mouse TfR1 antibody and anti-mouse DMPK oligonucleotide were conjugated and tested in mice, the experimental design and doses are shown in Table 6. All antibody oligonucleotide conjugates were obtained using the mouse version of the cysteine mutant antibody described in Example 1, TIB-219-S239C, and anti-DMPK siRNA. The conjugation process is described in Example 2, the antibody sequence used to synthesize the antibody oligonucleotide conjugates in the experiment is shown in Table 7, and the DMPK siRNA sequence used is shown in Table 8.
[0093] Table 6 Study of two antibody oligonucleotide conjugates in knocking down DMPK in mice
[0094] Table 7 Antibody sequence of anti-mouse TfR1
[0095] Table 8 siRNA sequence design of DMPK
[0096] Modification description: m = 2'-O-methyl; i2F = 2'-fluoro; * = phosphorothioate linkage; / = phosphodiester bond linkage.
[0097] Mice were dosed with PBS control and antibody oligonucleotide conjugates via intravenous injection and animals were euthanized at 7 and 14 days, respectively, and plasma and various tissue samples including the quadriceps, liver were harvested and stored at -80°C after overnight treatment with RNA later. Comparative qPCR assays were used to determine mRNA knockdown in target tissues. Total RNA was extracted from tissues, reverse transcribed and mRNA levels were quantified using TaqMan qPCR with appropriately designed primers and probes. GADPH was used as an internal RNA loading control and results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the GADPH Ct value was calculated (ACt) and then further normalized to the PBS control group by taking the second difference (ΔΔCt).
[0098] Pharmacokinetic experiments were performed using SL-PCR to analyze siRNA concentrations in plasma and tissues. Plasma and various tissue samples including the quadriceps, liver were harvested and stored in liquid nitrogen. Tissues were homogenized and after digestion with proteinase K, supernatant samples were diluted and analyzed by SL-PCR.
[0099] The results show that antibody oligonucleotide conjugates achieve more muscle siRNA distribution with higher siRNA concentrations in the quadriceps than in the liver and that DAR1 molecules show better muscle tissue enrichment than DAR2 antibody oligonucleotide conjugates (Figure 1). Antibody oligonucleotide conjugates also show target gene knockdown in the quadriceps but not in the liver. DAR1 molecules show stronger target gene knockdown than DAR2 antibody oligonucleotide conjugates (Figure 2).
[0100] Example 4. Synthesis of tri- linker linker
[0101] The results from in vitro and in vivo experiments support that DAR1 molecules have the highest target affinity, in vivo distribution, and target gene knockdown efficiency. Although existing engineered antibodies and SMCC linkers can meet the requirements, the stability of the SMCC linker is not good and the proportion of the target product DAR1 is low, so a tri- linker linker is developed to improve the yield of the conjugation process
[0102] The tri- linker linker is obtained by chemical synthesis, and CGBS-13 is used in this embodiment, and the synthesis route (Figure 3) is as follows:
[0103] To a solution of C220302A-E01 (6.30 g, 43.09 mmol, 1.0 eq) in DMF (230 mL) was added C220302A-E05 (23.00 g, 86.19 mmol, 2.0 eq) and PBS (110 mL). The mixture was stirred at 15-18 °C for 7 hours. HPLC showed the reaction was complete. The mixture was quenched with 0.2% aqueous TFA (500 mL) and purified by prep-HPLC to give C220302A-E02 (11.9 g, 61.4% yield, 97.59% purity) as a white solid. NMR data were: 1 H NMR (400 MHz, DMSO-d6) δ 8.19 (d, J = 7.6 Hz, 1H), 7.91 (s, 1H), 7.00 (s, 4H), 4.08 (td, J = 8.8, 4.8 Hz, 1H), 3.61 (s, 1H), 3.59 (s, 2H), 3.57 (s, 1H), 2.96 (m, J = 12.8 Hz, 2H), 2.45-2.35 (m, 2H), 2.33-2.25 (m, 2H), 2.07 (s, 1H), 1.61 (m, J = 12.8 Hz, 1H), 1.55-1.46 (m, 1H), 1.32 (d, J = 3.2 Hz, 2H), 1.22 (d, J = 7.6 Hz, 3H).
[0104] To a solution of C220302A-E02 (11.90 g, 26.54 mmol, 1.0 eq) in DCM (600 mL) was added EDCI (6.10 g, 31.84 mmol, 1.2 eq) and HOSu (3.40 g, 29.19 mmol, 1.1 eq). The mixture was stirred at 15-18 °C for 15 hours. HPLC showed the reaction was complete. The mixture was diluted with MTBE (1 L) to give the crude product as a white solid, which was filtered and dried. The crude product was used directly in the next step without purification. To a solution of C220302A-E04 (crude) in DMF (119 mL) was added C220302A-E06 (4.0 g, 15.13 mmol, 0.57 eq) and PBS (119 mL). The mixture was stirred at 15-18 °C for 1 hour. HPLC showed the reaction was complete. The mixture was quenched with 0.2% aqueous TFA (500 mL) and purified by prep-HPLC to give C220302A-E03 (1.70 g, 9.2% yield, 97.68% purity) as a colorless oil.
[0105] To a solution of C220302A-E03 (1.70 g, 2.44 mmol, 1.0 eq) in DMF / ACN (17 mL / 17 mL) was added C220302A-E07 (675 mg, 2.44 mmol, 1.0 eq), NMI (401 mg, 4.89 mmol, 2.0 eq) and TCFH (1.03 g, 3.67 mmol, 1.5 eq). The mixture was stirred at 16-18 °C for 1 h. HPLC showed the reaction was complete. The mixture was quenched with 50 mM NH4OAc (100 mL) and purified by prep-HPLC to give compound C240311A-001 (1.02 g, 43.8% yield, 96.98% purity) as yellow oil. NMR data were: 1 H NMR (400 MHz, DMSO-d6) δ 8.05 (d, J = 8.0 Hz, 1H), 7.89 (q, J = 5.2 Hz, 2H), 7.71 - 7.56 (m, 3H), 7.48 (m, J = 14.0 Hz, 3H), 7.41 - 7.28 (m, 3H), 7.00 (s, 4H), 5.04 (d, J = 14.0 Hz, 1H), 4.13 (dd, J = 13.6, 8.4 Hz, 1H), 3.66 - 3.56 (m, 5H), 3.47 (d, J = 5.4 Hz, 10H), 3.42 (d, J = 2.4 Hz, 1H), 3.40 (s, 1H), 3.36 (s, 1H), 3.22 - 3.14 (m, 2H), 3.10 (dd, J = 14.0, 7.6 Hz, 1H), 3.00 - 2.88 (m, 3H), 2.46 - 2.38 (m, 2H), 2.30 (t, J = 7.2 Hz, 2H), 2.16 (t, J = 6.4 Hz, 2H), 1.87 - 1.75 (m, 2H), 1.60 - 1.38 (m, 2H), 1.36 - 1.26 (m, 2H), 1.23 - 1.07 (m, 2H).
[0106] Example 5. Comparison of the coupling efficiency of cysteine mutant antibodies to N3-siRNA via tri- linker linkers
[0107] The conjugation of cysteine mutant antibody and N3-siRNA was performed using a site-directed conjugation process (Figure 4). Specifically, the antibody cysteine site-directed conjugation site and interchain disulfide bond were first reduced, then the interchain disulfide bond was oxidized and the reduced state of the cysteine mutant site was retained, then the trilinked linker ((R1)2-PEG-R2) (Table 1) was allowed to react with the antibody cysteine mutant site, and finally the N3-activated N3-siRNA (R3-siRNA) was conjugated to the antibody oligonucleotide conjugate through click chemistry. For the R3-siRNA used in this experiment, the N3-PEG4-NH-C6 conjugation handle was attached to the 5' end of the siRNA sense strand through a phosphodiester linkage on the terminal base, the single strand was fully assembled on solid phase using standard phosphoramidite chemistry and purified using HPLC, and then the purified and lyophilized single strand was used to duplicate the double-stranded siRNA at an equal molar ratio to generate the double-stranded siRNA. The azide-PEG4-NHS ester linker (CAS: 944251-24-5) was conjugated to the primary amine conjugation handle on the 5' end of the sense strand of the siRNA using standard chemical methods. The excess unreacted N3 linker was removed using a UF / DF step, and the resulting N3-PEG4-siRNA was released.
[0108] The antibody was buffer exchanged with 25 mM Tris buffer (pH 8) and concentrated to 10 mg / mL. To this solution, 100 equivalents of DTT in the same buffer were added and incubated at room temperature for 16 hours. The reaction was then buffer exchanged by ultrafiltration centrifugation into 2 mM EDTA in 25 mM Tris buffer (pH 8) and 20 equivalents of DHAA were added and reacted at room temperature (RT) for 2 hours. The resulting reaction mixture was desalted to remove excess DHAA and reacted with the linker (5 equivalents) at room temperature for 2 hours. After removing the excess linker by ultrafiltration centrifugation, 1.5 equivalents of N3-siRNA were added and reacted at room temperature for 16 hours. The reaction mixture was analyzed by analytical SAX column chromatography (Table 4) to determine the ratio of antibody siRNA conjugate to unreacted antibody and siRNA by peak area.
[0109] Table 9 Comparison of conjugation efficiency of different cysteine mutant antibodies with N3-siRNA
[0110] Different cysteine mutant sites significantly affected the conjugation efficiency of the antibody with N3-siRNA, with S239C having the highest DAR1 ratio. Compared with the SMCC-siRNA conjugation process in Table 5, the use of a trilinked linker significantly improved the DAR1 product ratio (70.47% vs 49.73%).
[0111] Example 6. Synthesis of antibody oligonucleotide conjugates with different length of tri- linker
[0112] To investigate whether different linker length has significant impact on conjugation efficiency, three different n1 and n2 length of tri-linker were selected, see Table 10, and DAR1 antibody oligonucleotide conjugates were synthesized using the conjugation process in Example 5. After the reaction was completed, the crude reaction mixture was purified by anion exchange chromatography (SAX) using AKTA Pure FPLC to isolate the fraction containing DAR1 antibody oligonucleotide conjugate, concentrated, and buffer exchanged with pH 7.4 PBS.
[0113] All three lengths of linker can effectively form antibody oligonucleotide conjugate, and the DAR1 product ratio of the three linkers is 69.00%, 59.23%, and 65.29%, respectively, which is significantly higher than the SMCC-siRNA conjugation process in Table 5. Among them, the conjugation efficiency of CGBS-0013 is the highest.
[0114] Table 10 Different length of tri-linker
[0115] Example 7. Synthesis of antibody oligonucleotide conjugates with different length of N3-siRNA
[0116] To compare the impact of different R3-siRNA on conjugation efficiency, shorter N3 linker was selected to conjugate to siRNA in this example. For the R3-siRNA used in this experiment, the 5' end of the sense strand of siRNA contains an N3-C1-NH-C6 conjugation handle, which is connected to the siRNA sense strand through the phosphodiester on the terminal base. The single strand is fully assembled on the solid phase using standard phosphoramidite chemistry and purified using HPLC, and then the purified and lyophilized single strand is used for double-stranded replication at an equal molar ratio to generate double-stranded siRNA. The azidoacetic acid NHS ester linker (CAS: 824426-32-6) is conjugated to the primary amine conjugation handle on the 5' end of the sense strand of siRNA using standard chemical methods. The UF / DF step is used to remove excess unreacted N3 linker, and the resulting N3-C1-siRNA is released. This N3-C1-siRNA is conjugated with the antibody to form DAR1 antibody oligonucleotide conjugate using the conjugation process in Example 5.
[0117] N3-C1-siRNA with shorter conjugation handle length can also effectively conjugate with the antibody to form antibody oligonucleotide conjugate, and the DAR1 product ratio is 63.00%.
[0118] Example 8. In vitro activity of antibody oligonucleotide conjugate
[0119] RD human rhabdomyosarcoma cell line (4201HUM-CCTCC00295) was cultured in DMEM (Gibco) containing 10% fetal bovine serum (Gibco). The antibody oligonucleotide conjugate was diluted to a maximum dose of 20 mM. The antibody oligonucleotide conjugate was added directly to the culture medium at a final concentration of siRNA of 200, 100, 10, 1 and 0.1 nM with or without LIPO3000 transfection. Cells were seeded onto 96-well culture plates at 6000 cells per well before dosing. The conjugate was added to the wells of the 96-well plate. PBS and vehicle groups were set up as negative controls. Cells were incubated at 37°C, 5% CO2for 72 h after dosing. Superscript III First-Strand Synthesis SuperMix TM IV CellsDirect TM cDNA synthesis kit (thermo) was used to synthesize first-strand cDNA directly from cell lysate, and TaqMan Human Gene Expression probes (Thermo Fisher) were used to evaluate cDNA samples by qPCR according to the manufacturer's instructions. %mRNA was calculated using the standard 2-ΔΔCT method, with PBS-treated cells set as 100% expression. All experiments were performed in duplicate.
[0120] The results of the in vitro activity study showed that the antibody oligonucleotide conjugate could enter the RD cell line under the condition of in vitro co-incubation without the assistance of lipofectamine, and exert a dose-dependent knockdown effect on the target gene. In terms of dosage, the antibody oligonucleotide conjugate could achieve a 50% knockdown effect at a concentration of 5.8 nM, and the maximum knockdown efficiency of the antibody oligonucleotide conjugate was about 40% (results as shown in Figure 5).
[0121] It should be understood that the above detailed description of the technical solutions of the present application by means of preferred embodiments is illustrative rather than limiting. Based on the description of the present application, those of ordinary skill in the art can modify the technical solutions described in the embodiments, or make equivalent substitutions for part of the technical features; and these modifications or substitutions do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application.
Claims
1. A linker for linking an antibody or antigen binding fragment to an oligonucleotide, the linker having three linkers, two of which are for covalent attachment to the antibody or antigen binding fragment, and the third linker for covalent attachment to the 3' or 5' end of the oligonucleotide.
2. The linker of claim 1, wherein, The linker has the following general formula: wherein R1 and R2 are independent groups, R1 is a functional group that can selectively react with cysteine, R2 represents a functional group that can undergo click chemistry with an azido group, n1 represents the number of carbon atoms, n1 is any integer between 1 and 10; n2 represents the number of PEG, n2 is any integer between 1 and 20.
3. The linker of claim 2, wherein, R1 is: R2 is dibenzocyclooctyne or bicyclo[6,1,0]nonyne.
4. The linker of claim 1, wherein, The linker has the following structure:
5. The linker of claim 1, wherein, The third linker of the linker is connected to the oligonucleotide through click chemistry.
6. An antibody oligonucleotide conjugate comprising the linker according to any one of claims 1-5, further comprising an antibody or antigen binding fragment that can bind to human transferrin receptor, and an oligonucleotide that can hybridize to a DMPK target sequence.
7. The conjugate according to claim 6, characterized in that, The oligonucleotide has a sense strand and an antisense strand, the sense strand has more than 80% identity, preferably more than 85%, further preferably more than 90%, more preferably more than 95% identity to SEQ ID NO: 1; the antisense strand has more than 80% identity, preferably more than 85%, further preferably more than 90%, more preferably more than 95% identity to SEQ ID NO:
2.
8. The conjugate of claim 6, wherein, The oligonucleotide is provided with an azido linker at the end, the azido linker is connected to a 6-amino-1-hexanol linker, and the 6-amino-1-hexanol linker is covalently connected to the oxygen atom of the 3' or 5' end phosphate molecule of the sense strand or the antisense strand of the oligonucleotide.
9. The conjugate of claim 6, wherein, The antibody or antigen binding fragment comprises a heavy chain and a light chain, wherein the light chain has at least 80% identity, preferably at least 85%, further preferably 90%, more preferably 95%, most preferably 99% identity to a sequence selected from any one of SEQ ID NO: 3, 5, 7, and 9; the heavy chain has at least 80% identity, preferably at least 85%, further preferably 90%, more preferably 95%, most preferably 99% identity to a sequence selected from any one of SEQ ID NO: 4, 6, 8, and 10.
10. The conjugate of claim 6, wherein, The antibody or antigen binding fragment is an engineered polypeptide fragment comprising cysteine, wherein the engineering comprises mutating a specific amino acid to cysteine, the position of the mutation is 239 in the heavy chain, 298 in the heavy chain, or 327 in the heavy chain, or inserting a cysteine after 238 in the heavy chain.
11. A method for preparing the conjugate according to any one of claims 6-10, the method comprising a site-directed coupling process, the site-directed coupling process comprising: coupling the site of the cysteine residue on the antibody or antigen binding fragment and reducing the interchain disulfide bond, oxidizing the interchain disulfide bond, linking the tri-linker linker to the cysteine, and finally conjugating with the N3 oligonucleotide to form the antibody oligonucleotide conjugate.
12. Use of a conjugate according to any one of claims 6-10 for the manufacture of a pharmaceutical composition for the treatment of muscular atrophy or myotonic muscular dystrophy.
Citation Information
Patent Citations
Bilaterally functionalized antibodies via cycloaddition
CN115243727A
Conjugates of antibodies and immune cell adapters
CN115768483A
Multifunctional antibody
CN117157107A