Rnas with reduced ribosomal frameshift expression products
By using m5C and s2U in mRNA, ribosomal frameshifts and immunogenicity are minimized, ensuring efficient protein expression and cost-effective production.
Patent Information
- Application Number
- PCT/EP2025/070923
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-19
- Filing Date
- 2025-07-21
- Publication Date
- 2026-01-22
AI Technical Summary
Existing mRNA modifications, such as N1-methylpseudouridine, cause ribosomal frameshifts and increased immunogenicity, leading to potential adverse effects and inefficiencies in protein expression and production costs.
Incorporation of modified nucleosides like 5-methylcytidine (m5C) and 2-thiouridine (s2U) into mRNA, optimized to minimize frameshift mutations while maintaining translation efficiency and reducing immunogenicity.
The optimized mRNA formulation significantly reduces ribosomal frameshifts, enhances translation fidelity, and lowers immunogenicity, improving therapeutic efficacy and economic feasibility.
Smart Images

Figure IMGF000011_0001 
Figure IMGF000012_0001 
Figure IMGF000012_0002
Abstract
Description
[0001] New PCT-Patent Application Ethris GmbH Vossius Ref.: AJ2720 PCT S3 RNAs with reduced ribosomal frameshift expression products The present invention relates to nucleic acids and compositions comprising nucleic acids modified to comprise nucleoside modifications that reduces and / or essentially eliminates the amount of (m)RNA frameshift translation products compared to mRNA modified to comprise ribosomal frameshift causing nucleosides such as N1-methylpseudouridine (N1mΨ). More particularly, the invention pertains to RNA comprising m5C and s2U nucleosides. These compositions include specific carriers and therapeutic agents suitable for various medical applications. Background of the Invention It has been proven by several reports that some nucleotide modifications optimize the codons to render the mRNA GC-rich and minimize U content, which is an effective way to eliminateRNA immunogenicity (M. Al-Saif et al., 2012; S. Vaidyanathan et al., 2018).Among different tested modifications, 100% N1-methyl-Pseudouridine substitution of Uridine (m1Ψ), developed by Katalin Karikó´s team (Karikó K., 2022), led to discovery of highly effective Covid-19 vaccines. This discovery won the Nobel prize for medicine and physiology in 2023 which demonstrates the potential for modifying nucleotides in mRNA development. Little is known about how ribonucleotide modifications affect protein synthesis, particularly for translation of therapeutic in vitro transcribed mRNAs. Recently, it has been demonstrated that incorporation of N1-methylpseudouridine (N1mΨ) into mRNA results in +1 ribosomalframeshifts in vitro (Mulroney et al. 2023). The same authors also reported cellular immunityin mice and humans to +1 frameshifted peptide products from the BNT162b2 vaccine mRNA. The reported +1 ribosome frameshift was attributed to N1mΨ-induced ribosome stalling during in vitro transcribed mRNA translation, occurring at ribosome slippery sites, specific sequences of nucleotides in messenger RNA (mRNA) that can cause the ribosome to shift its reading frame during translation. Although cellular immunity in mice and humans to +1 frameshifted products was also reported after vaccination, there were no adverse consequences reported associated with the mRNA- based SARS-CoV-2 vaccines in humans so far. Summary of the Invention The invention provides nucleic acids and compositions where replacement of N1mΨ with a passive modification that does not cause ribosomal frameshift mutations / ribosomal frameshifting such as s2U / m5C at different ratios is shown to avoid mistranslation. This is of the highest interest for pathogen vaccination, tumor vaccination, treatment of autoimmune diseases or any other disease where exogenous RNA needs to be expressed as standard mRNA modified with frameshift causing modifications may cause significant off-target immunization or protein activity. The present invention further relates to a pharmaceutical composition comprising an RNA of the invention. Accordingly, the present invention further provides for a composition comprising: a) One or more RNA of the invention; and b) a carrier, wherein said carrier comprises: i. an ionizable lipid and / or an ionizable lipidoid;ii. optionally one or more helper lipid(s); and iii. optionally one or more pharmaceutically acceptable excipient(s) or diluent(s). The present inventors have surprisingly found that the nucleoside modifications herein provided, including the nucleic acids and compositions comprising such nucleic acids cause a significant reduction of protein frameshift mutations / ribosomal frameshift. This could not have been foreseen and as already mentioned above, has drastic and advantageous effects, inter alia, on the amount of full-length protein generated, on the amount of nucleic acid and / or composition to be administered, potential side effects, and the like. Thus, the herein provided compositions are particularly advantageous and give rise to new clinical situations, by e.g., reducing the amount of potential side effects and / or the amount of agent to be employed. The enclosed examples illustratively detail the frameshift reduction / avoidance of the nucleosides / nucleic acids / agents / active agents / active ingredients of the invention. In particular, Example 1 illustratively shows that an mRNA modified with m5C and s2U does not cause frameshift mutation. Accordingly, the present inventors have surprisingly shown that ribosomal frameshift mutations can be avoided by partial substitution with m5C or m5C combined with s2U, while a high translation efficiency and / or a reduced immunogenicity is maintained. This reduced frameshift mutation is highly surprising when compared to the known nucleoside modifications used on mRNA formulations of the state of the art, such as lipid nanoparticle- based mRNA vaccines, in particular Comirnaty® or Spikevax® contain N1mΨ, which has been shown to generate ribosomal frameshift mutations. To increase the safety profile of future RNA therapies it is thus necessary to find new mRNA modifications that do not cause frameshift mutations and also provide the mRNA with reduced immunogenicity. The technical problem is the provision of means and methods to reduce or avoid ribosome stalling and / or to reduce or avoid ribosomal frameshifting during translation, while maintaining a translation efficiency and low immunogenicity. The present invention solves the above problems with the embodiments of the invention. As mentioned above and while not wanting to be bound by any theory, it is believed that the present invention achieved advantageous results by providing formulations that effectively reduce or essentially avoid ribosomal stalling or ribosomal frameshift mutations while maintaining a high translation efficiency. In the context of therapeutic mRNA design, the present invention recognizes that the ideal mRNA construct achieves a balanced combination of four critical features: high protein expression, low frameshift error rates during translation, low immunogenicity and ideally a lower modification rate. While various strategies have been proposed to modify mRNA to enhance one or more of these attributes, the invention disclosed herein emphasizes a cost- efficient and functionally optimized solution. Specifically, the invention provides for mRNA molecules that are modified only to the minimal extent necessary to simultaneously satisfy these criteria. Excessive incorporation of modified nucleosides, such as pseudouridine or N1- methylpseudouridine, while beneficial for reducing immune activation, may lead to diminishing returns in terms of protein expression, frameshift products during translation or may unnecessarily increase production costs due to the high expense of modified nucleotide reagents. Therefore, the invention discloses and claims an optimized modification scheme wherein the percentage of modified nucleosides is minimized while still achieving high translational output, minimal frameshift propensity, and a substantially reduced innate immune response. This approach not only improves therapeutic efficacy but also significantly enhances the economic feasibility of large-scale mRNA therapeutic production. In particular, the invention relates to the embodiments as recited in following items: 1. An RNA molecule comprising modified nucleosides, wherein the modified nucleosides reduce or do not cause ribosome stalling and / or reduce or do not cause ribosomal frameshifting during translation, preferably while maintaining translation efficiency. 2. The RNA molecule according to item 1, wherein the modified nucleosides are selected from a) 5-methylcytidine (m5C) and / or 2-thiouridine (s2U) or; b) 5-methylcytidine (m5C) and / or pseudouridine (ΨU); and / or c) N1-methyl-pseudouridine (N1mΨU), wherein the RNA comprises 1 to 99% N1mΨU. The RNA molecule of according to item 1 or 2, wherein: a) the RNA molecule comprises a combination of unmodified and modified nucleosides and wherein at least 5% of its cytidine nucleosides are m5C, and / or at least 0.05% of its uridine nucleosides are s2U, and / or b) The RNA molecule includes both unmodified and modified nucleosides, with at least one type of nucleoside (adenine (A), guanine (G), cytidine (C), or uridine (U)) having a mixture of modified and unmodified forms. The RNA molecule according to anyone of items 1 to 3, wherein the modified nucleosides are distributed across regions of the RNA that are known to be prone to ribosomal frameshift mutations during translation. The RNA molecule according to any one of item 1 to 4, wherein: a) between 0.1 % and 20% of the uridines are s2U, between 0.5% and 20%, preferably between 0.1% and 10%, more preferably between 0.5% and 5%, between 0.7% and 4%, between 1% and 3%, most preferably about 1% or 3%; and / or b) between 5% and 99% of the cytidines are m5C, preferably wherein between 5% and 95%, between 5% and 90%, between 5% and 85%, between 5% and 80%, between 5% and 75%, between 5% and 70%, between 5% and 65%, between 5% and 60%, between 5% and 55%, between 5% and 50%, more preferably between 10 % and 50%, between 15 % and 40%, more preferably between 20% and 50%, between 20 % and 40%,more preferably 30% to 37% , most preferably about 33% of the cytidines are m5C, optionally wherein the percentage of m5C in the RNA molecule is based on optimization studies identifying the most effective distribution of modifications for maintaining translation fidelity; c) between 5% and 99% of the uridines are N1mΨU, preferably wherein between 5% and 95%, between 5% and 90%, between 5% and 85%, between 5% and 80%, between 5% and 75%, between 5% and 70%, between 5% and 65%, between 5% and 60%, between 5% and 55%, between 5% and 50%, more preferably between 10 % and 50%, between 15 % and 40%, more preferably between 20% and 50%, between 20 % and 40%, most preferably about 38% of the uridines are N1mΨU, optionally wherein the percentage of N1mΨU in the RNA molecule is based on optimization studies identifying the most effective distribution of modifications for maintaining translation fidelity. The RNA molecule according to item 5, wherein: a) between 0.25% and 4.5% of the uridines are s2U and / or wherein between 20% to 40% of the cytidines are m5C, more preferably about 3% of the uridines are s2U and / or wherein about 33 % of the cytidines are m5C, or b) wherein between 0.25% and 4.5% of the uridines are s2U and / or wherein between 20% to 40% of the cytidines are m5C, more preferably about 1% of the uridines are s2U and / or wherein about 33 % of the cytidines are m5C, or c) wherein between 80% and 100% of the uridines are pseudouridine and / or wherein between 80% to 100% of the cytidines are m5C, more preferably about 100% of the uridines are pseudouridine and / or wherein about 100% of the cytidines are m5C, or d) wherein between 20% to 95%, between 30% and 90%, preferably between 60% to 85%, more preferably 63% to 83%, most preferably about 83 % of the cytidines are m5C., and wherein all nucleotides A, G and U are not modified. 7. The RNA molecule according to item 1 to 6, wherein the RNA molecule comprises a gradient of modified nucleosides from 5’ to 3’, preferably wherein the RNA molecule comprises more modified nucleosides in the 5’ region and gradually less modified nucleosides towards the 3’ region. 8. The RNA molecule according to item 7, wherein up to 99% of nucleosides in the 5' region are modified nucleosides, and wherein the percentage of modified nucleotides is decreasing to 50% to 25% in the 3' region, thereby enhancing translational initiation and fidelity. 9. The RNA molecule according to anyone of items 1 to 8, further comprising sequence modifications to avoid motifs known to predispose the RNA molecule to induce frameshift mutations and / or ribosome stalling, thereby synergistically reducing frameshift occurrences. 10. The RNA molecule according to anyone of items 1 to 9, wherein the sequence modifications are selected from elimination or alteration of nucleotide repeats or sequences prone to ribosomal frameshifting during translation, and wherein the modified nucleosides and the sequence modifications result in a further reduction of ribosomal frameshifting thereby reducing frameshift mutations. 11. The RNA molecule according to item 10, wherein the sequence modifications are selected from elimination or alteration of polypurine tracts or polypyrimidine tracts. 12. The RNA molecule according to anyone of items 9 to 11, wherein the sequences prone to ribosomal frameshifting during translation are in the form of XXX XXY, X XXY Z, X XXX YZ, X XXY YYZ, where the ribosome slips forward by one nucleotide, and wherein X, Y and Z are independently a different and any nucleotide (A, U, G, or C or any modified nucleoside thereof). 13. The RNA molecule of any one of items 1 to 12, wherein the RNA molecule further comprises sequence modifications that adjust or remove sequences known to form secondary structures that can interfere with the ribosomal scanning process, thereby enhancing translational accuracy. 14. The RNA molecule of any one of items 1 to 13, wherein the RNA molecule is an mRNA and / or wherein the RNA molecule encodes one or more peptides and / or proteins, preferably wherein the one or more peptides and / or proteins are for therapeutic, diagnostic, or industrial uses. 15. Use of the RNA of any one of items 1 to 14, for avoiding and / or reducing ribosome stalling and / or for reducing or avoiding ribosomal frameshifting. 16. The RNA of any one of items 1 to 14, for use as a medicament. 17. The RNA of any one of items 1 to 14, for use in the treatment or prevention of a disease associated with a deficient expression or lack of expression of the protein and / or peptide encoded by the RNA. 18. A pharmaceutical composition comprising the RNA molecule of any one of items 1 to 14, and a pharmaceutically acceptable carrier. 19. A vaccine comprising the RNA molecule of any one of items 1 to 14, and a pharmaceutically acceptable carrier. 20. The pharmaceutical composition of item 18, or the vaccine of item 19, wherein the RNA molecule exhibits no or reduced ribosomal frameshifting, thereby reducing or avoiding frameshift mutations during translation, optionally wherein the RNA molecule exhibits an improved safety profile of the RNA-based therapy, optionally wherein said ribosomal frameshifting, preferably during translation, is reduced compared to an mRNA with the same sequence and wherein 100% of uridines are 100% N1-Methylpseudouridine. 21. A method for reducing or avoiding ribosomal frameshifting and / or reducing or avoiding ribosomal frameshift mutations in a protein and / or a peptide, preferably while maintaining translation efficiency, the method comprising the step of introducing a specific modification to the nucleosides of a RNA molecule and / or introducing modified nucleosides into a RNA resulting in a modified RNA. 22. The method according to item 21, wherein the modified nucleosides are introduced during RNA synthesis, e.g. ex-vivo or in vitro transcription. 23. The method according to item 21 or 22, wherein said specific modification or modified nucleosides is / are selected from the group consisting of nucleosides with reduced ribosome stalling, preferably a nucleoside selected from m5C, s2U, pseudouridine (ΨU), and / or N1-methyl-pseudouridine (N1mΨU).. 24. The method according to any one of items 21 to 23, wherein the RNA is as defined in any one of items 1 to 14. 25. An artificial bicistronic or polycistronic RNA molecule coding for two or more functional peptides and / or proteins in each of frame 1 and / or 2, frame 2 and / or 3, frame 1 and / or 3, or frame 1, 2 and / or 3, characterized in that the RNA comprises one or more nucleoside(s) able to cause a ribosomal frameshift that causes a frame transition, wherein the RNA sequence contains one or more slippery site(s) for each frame transition required to express said two or more peptides and / or proteins. 26. The RNA according to item 25, characterized in that the RNA is engineered to produce two or more proteins and / or peptides from a single transcript. 27. The RNA according to anyone of the previous items wherein the RNA is: Non-coding RNA (ncRNA) and / or messenger RNA (mRNA), preferably mRNA. 28. The RNA according to any of the previous items 25 to 27 wherein frameshift-causing nucleoside is selected from a nucleoside that causes ribosome stalling, preferably a nucleoside selected from Pseudouridine (ΨU), N6-methyladenosine (m6A), 5- iodouridine, Inosine (I), 2'-O-methylation (2'-O-Me), 5-hydroxymethylcytosine (hm5C), N1-methyladenosine (m1A), N7-methylguanosine (m7G), 3-methylcytidine (m3C), Wybutosine (yW), and / or N1-methyl-Pseudouridine, most preferably N1-methyl- Pseudouridine or 5-iodouridine. 29. The RNA according to any of the previous items, wherein: a) the N1-methyl-Pseudouridine modification enhances RNA stability and translation efficiency, and / or b) each slippery site facilitates ribosomal frameshifting to access different reading frames for encoding distinct peptides and / or proteins, and / or c) the slippery site comprises a nucleotide sequence of the form XXX XXY, X XXY Z, X XXX YZ, X XXY YYZ, wherein X, Y, and Z represent any nucleotide, and / or d) the engineered sequence allows for controlled expression ratios of the encoded proteins, and / or e) the encoded proteins include functional domains necessary for a multimeric protein complex formation. 30. The RNA according to any of the previous items, wherein: a) the RNA is synthesized using in vitro transcription techniques, and / or b) encoded proteins are designed for therapeutic, diagnostic, or industrial applications, and / or c) the encoded proteins and / or peptides include enzymes, structural proteins, or regulatory peptides and / or proteins necessary for metabolic or cellular functions, and / or d) wherein the encoded proteins and / or peptides include vaccine antigens for eliciting an immune response or combinations of one or more vaccine antigens and / or further adjuvant proteins / peptides, and / or e) the encoded proteins and / or peptides are reporter peptides or reporter proteins, preferably fluorescent or luminescent markers for use in imaging and tracking studies, and / or f) the encoded proteins and / or peptides are designed to be secreted or retained within specific, organs, tissues, or cellular compartments. 31. The RNA according to any of the previous items, wherein: a) the presence of N1-methyl-Pseudouridine reduces immune recognition and enhances translational fidelity, and / or b) the RNA is formulated into a delivery vehicle suitable for in vivo administration, such as lipid nanoparticles, and / or c) The RNA according to any of the previous items, wherein the slippery site sequence is optimized for the host organism's ribosomal machinery, and / or d) the RNA is designed to express proteins with post-translational modifications, and / or e) the RNA sequence includes codon optimization for the intended host organism to maximize expression levels. 32. The RNA according to any of the previous items, wherein: a) the RNA includes regulatory elements such as untranslated regions (UTRs) that modulate translation initiation and efficiency, and / or b) the RNA includes elements that enhance nuclear export and cytoplasmic localization for efficient translation. The RNA according to any of the previous items, wherein the slippery site is located at a specific position within the RNA to ensure precise frameshifting during translation. Use of one or more nucleoside(s) able to cause a ribosomal frameshift to express two or more peptides and / or proteins from a single RNA molecule by a (partial) frame transition, preferably wherein the RNA is the RNA of any of the previous items. A method for producing an artificial bicistronic or polycistronic RNA, comprising the steps of incorporating into the RNA sequence and engineering a single slippery site for each additional frame to be translated, thereby enabling the RNA to produce two or more proteins from a single transcript, preferably wherein the RNA in any of the previous items, preferably wherein the RNA is a non-coding RNA or mRNA, preferably a non-coding RNA expressing a peptide (ncPEPs) or mRNA, optionally wherein the engineering of the slippery site comprises introducing a modified nucleoside selected from Pseudouridine (ΨU), N6-methyladenosine (m6A), 5-methylcytidine (m5C), Inosine (I), 2'-O-methylation (2'-O-Me), 5-hydroxymethylcytosine (hm5C), N1-methyladenosine (m1A), N7- methylguanosine (m7G), 3-methylcytidine (m3C), Wybutosine (yW), and / or N1-methyl- Pseudouridine, most preferably N1-methyl-Pseudouridine. A composition for use in the treatment and / or prevention of a disease or disorder, the composition comprising: a) an RNA according to the invention; and b) a carrier, wherein said carrier comprises: i. an ionizable lipid and / or an ionizable lipidoid; ii. optionally one or more helper lipid(s); and iii. optionally one or more pharmaceutically acceptable excipient(s) or diluent(s); optionally wherein said composition, remains localized at the site of administration and / or essentially does not exhibit systemic distribution throughout the patient's body. A composition for use in the treatment and / or prevention of a disease, the treatment comprising local administration of the composition, the composition comprising: (a) an RNA according to the invention; and (b) a carrier, wherein said carrier comprises: i. an ionizable lipid and / or an ionizable lipidoid; ii. optionally one or more helper lipid(s); and iii. optionally one or more pharmaceutically acceptable excipient(s) and / or diluent(s); optionally wherein said composition has a prolonged retention at the site of administration; and / or wherein said therapeutic agent exerts its effect at the site of administration by prolonged retention at the site of administration. The composition for use according to item 36 or 37, wherein the carrier is a lipid nanoparticle (LNP), a lipidoid nanoparticle (LiNP), a liposome, a micelle, an emulsion, an Nanostructured Lipid Carrier (NLCs), or a Lipid-Drug Conjugate (LDC), preferably an LNP or an LiNP, and / or wherein the agent is formulated as a lipid nanoparticle (LNP), a lipidoid nanoparticle (LiNP), a liposome, a micelle, an emulsion, an Nanostructured Lipid Carrier (NLCs), or a Lipid-Drug Conjugate (LDC), preferably as an LNP or as an LiNP. The composition for use or the cosmetic composition according to item 38, wherein said ionizable lipidoid is a compound of formula (b-I): formula (b-I), preferably wherein the variables a, b, p, m, n and R1Ato R6Aare defined as follows: a is 1 and b is an integer of 2 to 4,or a is an integer of 2 to 4 and b is 1, p is 1 or 2, m is 1 or 2, n is 0 or 1, m+n is ≥ 2, and R1Ato R6Aare independently of each other selected from hydrogen, -CH2-CH(OH)-R7A, -CH(R7A)-CH2-OH, -CH2-CH2-(C=O)-O-R7A, - CH2CH2(C=O)-NH-R7A, or -CH2-R7A, wherein R7Ais selected from C3-C18 alkyl or C3-C18 alkenyl having one C-C double bond, a protecting group for an amino group, -C(NH)-NH2, a poly(ethylene glycol) chain, and a receptor ligand; wherein at least two residues among R1Ato R6Aare a group selected from -CH2- CH(OH)-R7A, -CH(R7A)-CH2OH, -CH2CH2(C=O)-O-R7A, -CH2CH2(C=O)-NH-R7A, or -CH2R7A,wherein R7Ais selected from C3-C18 alkyl or C3-C18 alkenyl having one C-C double bond; and wherein one or more of the nitrogen atoms comprised or contained in the compound of formula (b-I) are protonated to provide a compound carrying one or more positive charges. 40. The composition for use or the cosmetic composition according to item 39, wherein R1Ato R6Aare independently of each other selected from -CH2-CH(OH)-R7A, -CH2-CH2- (C=O)-O-R7A, -CH2CH2(C=O)-NH-R7A, wherein R7Ais defined as in item 38. 41. The composition for use according any one of items 38 to 40, wherein said ionizable lipidoid comprises or consists of a compound of formula (b-V): 42. The composition for use or the cosmetic composition according to any one of items 38 to 40, wherein said ionizable lipidoid comprises or consists of a compound of formula (b-VII) or a compound of formula (b-VIII), preferably a compound of formula (b-VII): 43. The composition for use or the cosmetic composition according to any one of items 38 to 42, wherein said ionizable lipidoid is a compound of formula (b-V) and preferably: a) is an R isomer of the compound of formula (b-V), and / or b) is present at a molar ratio of about 22 mol% to about 65 mol%, preferably about 34 mol% to about 52 mol%, more preferably about 36 mol% to about 50 mol%, and most preferably about 43.1 mol%. 44. The composition for use or the cosmetic composition according to any one of items 38 to 43, wherein said one or more helper lipid(s) are selected from the group consisting of a) to c): a) a phospholipid; b) a sterol; and / or c) a stealth lipid. The composition for use or the cosmetic composition according to item 44, wherein said composition comprises said ionizable lipid and / or said ionizable lipidoid, said phospholipid, said sterol, and said stealth lipid, preferably at a molar ratio of about 8.0 : about 5.3 : about 4.4 : about 0.9. The composition for use or the cosmetic composition according to item 44 or 45, wherein said phospholipid: a) is selected from phosphocholine (PC) or phosphoethanolamine (PE), preferably PC; b) has a carbon chain length of about 14 to about 18, most preferably about 16; and / or c) is present in a molar ratio of about 10 mol% to about 45 mol%, preferably about 18 mol% to about 39 mol%, more preferably about 24 mol% to about 33 mol%, and most preferably about 28.5 mol%. The composition for use according to any one of items 44 to 46, wherein said sterol: a) is cholesterol; and / or b) is present at a molar ratio of about 12 mol% to about 38.5 mol%, preferably about 15 mol% to about 32 mol%, more preferably about 19 mol% to about 29 mol%, and most preferably about 23.7 mol%. The composition for use according to any one of items 44 to 47, wherein said stealth lipid: a) is glycerolipid-based or PE lipid-based; b) has a carbon chain length of about 14 to about 18, most preferably about 14; c) comprises polyethylene glycol (PEG), and wherein said PEG has a molar mass of about 2000 to about 5000 Daton, most preferably about 2000 Dalton; and / or d) is present molar ratio of about 1.5 mol% to about 7 mol%, preferably about 3 mol% to about 6 mol%, more preferably about 4 mol% to about 5 mol%, and most preferably about 4.7 mol%. The composition for use according to any one of items 44 to 48, wherein: a) the phospholipid is preferably a phospholipid with a carbon chain length of about 12 to about 18, more preferably phospholipid with a carbon chain length of about 16, most preferably DPPC; b) the sterol is cholesterol; and / or c) the stealth lipid is a PEGylated lipid, preferably a PEGylated lipid with a molar mass of the PEG chain between about 2000 to about 5000 Dalton, more preferably a PEGylated lipid with a molar mass of the PEG chain of about 2000 Dalton, most preferably the PEGylated lipid is DMG-PEG2000. 50. The composition for use according to any one of items 38 to 49, wherein said composition further comprises a triblock copolymer as component (p) preferably wherein said triblock copolymer comprises about one poly(propylene oxide) block and about two poly(ethylene oxide) blocks. 51. The composition for use according to any one of items 38 to 50, wherein said one or more therapeutic agent(s) is / are a) an anionic therapeutical substance and / or b) a nucleic acid, preferably an RNA, more preferably an mRNA, and if an mRNA is present, optionally or additionally a miRNA, and / or an siRNA, even more preferably an mRNA, most preferably an mRNA comprising an open reading frame (ORF) encoding one or more polypeptide(s). 52. The composition for use according to item 51, wherein said nucleic acid is a non-coding RNA such as an RNA able to produce a microRNA or wherein said nucleic acid is an mRNA comprising an ORF encoding one or more polypeptides, preferably wherein said one or more polypeptide(s) are one or more functional protein(s) and / or one or more antigen(s). 53. The composition for use according to item 52, wherein said one or more antigen(s) is / are selected from the group consisting of a viral antigen, a bacterial antigen, a cancer and / or tumor associated antigen, and an allergen. 54. The composition for use according to any one of items 51 to 53, wherein the mRNA comprises one or more features selected from the group consisting of the following: a) a CAP, preferably an anti-Reverse Cap Analog (ARCA) at its 5’ end,b) a 5’-untranslated region (5’-UTR) upstream of the ORF encoding said one ormore polypeptide(s), c) a 5’-UTR comprising an elongated Kozak sequence (GCCACCAUG; SEQ IDNO: 44) upstream of the initiation codon of the ORF,d) a 5’-UTR comprising proximately upstream of an initiation codon of the ORFany one of the following sequences: i. GGGAGACGCCACC (SEQ ID NO:11), ii. GAAGCGCCACC (SEQ ID NO:12), iii. GGGACGCCACC (SEQ ID NO:13), iv. GGGAGACTGCCACC (SEQ ID NO:14), v. GAAGCTGCCACC (SEQ ID NO:15), vi. GGGACTGCCACC (SEQ ID NO:16). e) a 3’-untranslated region (3’-UTR) downstream of the ORF encoding said one ormore polypeptide(s), and f) a 3’-UTR sequence downstream of the ORF encoding said one or morepolypeptide(s) selected from: i. GAAUU, and ii.CCTCGCCCCGGACCTGCCCTCCCGCCAGGTGCACCCACCTGCAAT AAATGCAGCGAAGCCGGGA (SEQ ID NO:26 or 8).55. The composition for use according to any one of items 51 to 54, wherein the mRNA is aproduct of in-vitro transcription (IVT).56. The composition for use according to any one of items 51 to 55, wherein the mRNA comprises a polyadenylation (poly(A)) tail downstream of the ORF encoding said one or more polypeptide(s). 57. The composition for use according to any one of items 51 to 56, wherein the mRNA comprises one or more modified nucleosides. 58. The composition for use according to any one of items 51 to 57, wherein the one or more modified nucleosides are selected from the group consisting of the following: 2-thiouridine, 4′-thiouridine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2- thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy- pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-iodo-uridine, 5-methoxyuridine, 2′-O-methyluridine, 5- iodocytidine, 5-methylcytidine, N1-methyladenosine, pseudouridine, and N6-methyladenosine, preferably wherein the RNA contains less than 100% N1-methylpseudouridine or wherein the RNA does not contain N1-methylpseudouridine. 59. The composition for use according to any one of items 38 to 58, wherein the composition is to be administered to a patient in need thereof. 60. The composition for use according to any one of items 38 to 59, wherein said site of administration comprises a tissue, an organ, and / or an anatomical region, preferably said solid tissue, organ, and / or anatomical region is a solid tissue, organ and / or anatomical region, more preferably said solid tissue, organ, and / or anatomical region is selected from the group consisting of the lungs, the nose, the heart, the brain, the spleen, the lymph nodes, the bones, the tendons, the skeletal muscles, joints, the stomach, the small intestine, the large intestine, the kidneys, the bladder, the breast, the testes, the ovaries, the uterus, the spleen, the thymus, the brainstem, the cerebellum, the spinal cord, the eye, the ear, the tongue, the skin and / or tumors present in said solid tissues, organs and / or anatomical regions. 61. The composition for use according to any one of items 38 to 60, further comprising one or more stabilizing agent(s), adjuvant(s), and / or immunomodulator(s). 62. The composition for use according to any one of items 38 to 61, wherein said therapeutic agent or carrier is encapsulated within a hydrogel or a biocompatible matrix. 63. A method for preventing, treating, and / or ameliorating a disease, wherein the method comprises administering an effective amount of the composition as defined in any one of items 36 to 62 to a subject. 64. Use of a composition as defined in any one of items 36 to 62 in the manufacture of medicament for the prevention, treatment, and / or amelioration of a disease. 65. The composition for use according to any one of items 36 to 62, the method of treatment according to item 63, or the use of the composition according to item 64, wherein the prevention of said disease comprises prevention by immunization, even more preferably in the prevention by local or systemic immunization. 66. The composition for use according to any one of items 36 to 62 or item 65, the method of treatment according to item 63 or item 65, or the use of the composition according to item 64 or 65, wherein said disease is selected from: genetic mutations, autoimmune diseases, metabolic imbalances, neurodegenerative disorders, degenerative disorders of the joints, arthrosis, arthritis, bone fractures, non-union fractures, solid tumor diseases (including soft tissue tumors, tumors of the heart, the lungs, the liver, the spleen, the kidneys, the brain, the oral cavity, the intestine, the skin, the pancreas, the prostate gland, the mammary glands, the ovaries, the urinary bladder, the bones (including osteosarcoma, chondrosarcoma, Ewing sarcoma)), tumors of the pleural and the peritoneal cavity, lung diseases including lung autoimmune diseases and ciliopathies, bone fractures or lesions thereof, tendon fractures or lesions thereof, joint infections, ligament ruptures, resistant Staphylococcus Aureus (MRSA) and / or Multidrug resistant Tuberculosis), viral infections, preferably a viral infection, more preferably a viral infection selected from Influenza (Flu), respiratory syncytial virus (RSV) Hepatitis A, Hepatitis B, Hepatitis C, Human Papillomavirus (HPV), Measles, Mumps, Rubella, Polio, Rabies, Varicella (Chickenpox), Shingles (Herpes Zoster), Rotavirus, Yellow Fever, Smallpox, Japanese Encephalitis, Tick-Borne Encephalitis (TBE), Dengue Fever, West Nile Virus, Chikungunya Virus, Ebola Virus, Marburg Virus, Human Immunodeficiency Virus (HIV), a coronavirus infection (including COVID-19), most preferably a coronavirus infection. 67. The composition for use according to any one of items 36 to 62 or item 65 or 66, the method of treatment according to any one of item 63 or item 65 or 66, or the use of the composition according to any one of items 64 to 66, wherein said composition is to be administered to one or more solid tissue(s), solid organ(s) and / or solid anatomical region(s), preferably wherein said one or more solid tissue(s), solid organ(s) and / or solid anatomical region(s) are selected from the group consisting of the lungs, the nose, the heart, the brain, the spleen, the lymph nodes, the bones, the tendons, the skeletal muscles, the joints, the stomach, the small intestine, the large intestine, the kidneys, the bladder, the breast, the testes, the ovaries, the uterus, the spleen, the thymus, the brainstem, the cerebellum, the spinal cord, the eye, the ear, the tongue, the skin and / or tumors present in said one or more solid tissue(s), solid organ(s) and / or solid anatomical region(s). 68. The composition for use according to any one of items 36 to 62 or any one of items 65 to 67, the method of treatment according to any one of item 63 or any one of items 65 to 67, or the use of the composition according to any one of items 64 to 67, wherein the subject to be treated is a mammal, preferably a human. 69. The composition for use according to any one of items 36 to 62 or any one of items 65 to 68, the method of treatment according to any one of item 63 or any one of items 65 to 68, or the use of the composition according to any one of items 64 to 68, wherein said composition is to be administered via intravenous, intradermal, subcutaneous, intramuscular, intratumoral injection, topical application, nasal delivery such as intranasal delivery, inhalation, preferably aerosol delivery, more preferably aerosol delivery with nebulizers, metered-dose inhalers (MDIs), or dry powder inhalers (DPIs). 70. A method of inducing an immune response in a subject, which comprises administering to said subject an effective amount of the composition as defined in or according to any one of items 36 to 62 or any one of items 65 to 69. 71. A method of immunizing a subject against a pathogen, which comprises administering to said subject an effective amount of an mRNA vaccine in a pharmaceutical composition, wherein said pharmaceutical composition comprises the composition as defined in or according to any one of items 36 to 62 or any one of items 65 to 69. 72. The method according to item 71, wherein said mRNA vaccine is administered via intravenous, intradermal, subcutaneous, intramuscular, or intratumoral injection. 73. The composition for use according to any one of items 36 to 62 or any one of items 65 to 69, or the method according to any one of items 70 to 72, wherein said pharmaceutically acceptable excipient or diluent further comprises a biodegradable or bioresorbable material, facilitating gradual release and local persistence of said therapeutic agent at the site of interest. 74. The composition for use according to any one of items 36 to 62, any one of items 65 to 69 or item 73, or the method according to any one of items 70 to 73, wherein said therapeutic agent is encapsulated within a biocompatible microneedle patch or implantable device, facilitating controlled and / or sustained release of said therapeutic agent at the site of interest. 75. The composition for use according to any one of items 36 to 62, any one of items 65 to 69 or item 73 or 74, or the method according to any one of items 70 to 74, wherein said mRNA further comprises a self-amplifying mRNA (saRNA) molecule, enabling enhanced protein or antigen production at the site of interest. 76. The composition for use according to any one of items 36 to 62, any one of items 65 to 69 or any one of items 73 to 75, or the method according to any one of items 70 to 75, wherein said one or more mRNA molecules comprise an ORF encoding CFTR, Erythropoietin (EPO), Factor VIII, Factor IX, Chimeric Antigen Receptor (CAR) T-cell, Survivin (BIRC5) or a dominant-negative form thereof, P53, Vascular Endothelial Growth Factor (VEGF), Insulin, SARS-CoV-2 Spike protein, Alpha-synuclein, Dystrophin, Glucocerebrosidase (GCase), a cytokine such as Interleukin-2 (IL-2), Interleukin-10 (IL-10), Interleukin-12 (IL-12), an interferon, Interferon-alpha (IFN-α), Interferon-beta (IFN-β), Interferon-gamma (IFN-γ), interferon lambda (IFNλ), such as interferon lambda 1 (IFN-λ1, also known as IL-29), IFN-λ2 (also known as IL-28A), IFN- λ3 (also known as IL-28B), and / or IFN-λ4, human interferon lambda 1 (hIFNλ1), Tumor Necrosis Factor-alpha (TNF-α), Granulocyte-macrophage colony-stimulating factor (GM-CSF), a primary ciliary dyskinesia protein or factor such as DNAH5, DNAH11, CCDC39, DNAI1, CCDC40, CCDC103, SPAG1, ZMYND10, ARMC4, CCDC151, DNAI2, RSPH1, CCDC114, RSPH4A, DNAAF1 (LRRC50), DNAAF2 (KTU), LRRC6, C21orf59, CCDC65 (DRC2), CCNO, DNAAF3, DNAH1, DNAH8, DNAL1, DRC1 (CCDC164), DYX1C1, DNAAF5 (HEATR2), HYDIN, MCIDAS, NME8 (TXNDC3), RSPH3, RSPH9, or FOXJ1, preferably wherein said one or more mRNA molecules comprise an ORF encoding interferon lambda 1 (IFNλ1), more preferably human interferon lambda 1 (hIFNλ1). 77. An RNA molecule comprising modified nucleosides, wherein the modified nucleosides are selected from: a) 5-methylcytidine (m5C) and / or 2-thiouridine (s2U); or (b) 5-methylcytidine (m5C) and / or pseudouridine (ΨU); and / or b) N1-methyl-pseudouridine (N1mΨU), wherein the RNA comprises 1 to 99% N1mΨU. 78. The RNA molecule of item 77, wherein the RNA molecule comprises a combination of unmodified and modified nucleosides and wherein at least 5% of its cytidine nucleosides are m5C, and / or at least 0.05% of its uridine nucleosides are s2U. 79. The RNA molecule according to 77 or 78, wherein: between 0.1 % and 20% of the uridines are s2U, between 0.5% and 20%, preferably between 0.1% and 10%, more preferably between 0.5% and 5%, between 0.7% and 4%, between 1% and 3%, most preferably about 1% or 3%; and between 5% and 99% of the cytidines are m5C, preferably wherein between 5% and 95%, between 5% and 90%, between 5% and 85%, between 5% and 80%, between 5% and 75%, between 5% and 70%, between 5% and 65%, between 5% and 60%, between 5% and 55%, between 5% and 50%, more preferably between 10 % and 50%, between 15 % and 40%, more preferably between 20% and 50%, between 20 % and 40%,more preferably 30% to 37% , most preferably about 33% of the cytidines are m5C. 80. The RNA molecule according to any one of claims 77 to 79, wherein: between 1% and 3% are s2U; and 30% to 37%, most preferably about 33% of the cytidines are m5C. Furthermore, the present invention relates to the following items: 1. An RNA molecule comprising modified nucleosides, wherein the modified nucleosides reduce or do not cause ribosome stalling and / or reduce or do not cause ribosomal frameshifting during translation, preferably while maintaining translation efficiency. 2. The RNA molecule according to item 1, wherein the modified nucleosides are selected from 5-methylcytidine (m5C) and / or 2-thiouridine (s2U). 3. The RNA molecule of according to item 1 or 2, wherein: a) the RNA molecule comprises a combination of unmodified and modified nucleosides and wherein at least 5% of its cytidine nucleosides are m5C, and / or at least 0.05% of its uridine nucleosides are s2U, and / or b) The RNA molecule includes both unmodified and modified nucleosides, with at least one type of nucleoside (adenine (A), guanine (G), cytidine (C), or uridine (U)) having a mixture of modified and unmodified forms. 4. The RNA molecule according to any one of item 1 to 3, wherein: a) between 0.5 % and 20% of the uridines are s2U, preferably between 0.5% and 10%, more preferably between 1% and 5%, most preferably about 3 %; and / or b) between 5% and 99% of the cytidines are m5C, preferably wherein between 5% and 95%, between 5% and 90%, between 5% and 85%, between 5% and 80%, between 5% and 75%, between 5% and 70%, between 5% and 65%, between 5% and 60%, between 5% and 55%, between 5% and 50%, more preferably between 10 % and 50%, between 15 % and 40%, between 20 % and 40% of the cytidines are m5C, optionally wherein the percentage of m5C in the RNA molecule is based on optimization studies identifying the most effective distribution of modifications for maintaining translation fidelity; and / or c) between 0.25% and 4.5% of the uridines are s2U and / or wherein between 20% to 40% of the cytidines are m5C, more preferably between about 3 % of the uridines are s2U and / or wherein about 33 % of the cytidines are m5C. 5. The RNA molecule according to anyone of items 1 to 4, further comprising sequence modifications to avoid motifs known to predispose the RNA molecule to induce frameshift mutations and / or ribosome stalling, thereby synergistically reducing frameshift occurrences, wherein the sequence modifications are selected from elimination or alteration of nucleotide repeats or sequences prone to ribosomal frameshifting during translation, and wherein the modified nucleosides and the sequence modifications result in a further reduction of ribosomal frameshifting thereby reducing frameshift mutations. 6. The RNA molecule according to item 5, wherein the sequence modifications are selected from elimination or alteration of polypurine tracts or polypyrimidine tracts, and / or wherein the sequences prone to ribosomal frameshifting during translation are in the form of XXX XXY, X XXY Z, X XXX YZ, X XXY YYZ, where the ribosome slips forward by one nucleotide, and wherein X, Y and Z are independently a different and any nucleotide (A, U, G, or C or any modified nucleoside thereof). 7. The RNA molecule of any one of items 1 to 6, wherein the RNA molecule is an mRNA and / or wherein the RNA molecule encodes one or more peptides and / or proteins, preferably wherein the one or more peptides and / or proteins are for therapeutic, diagnostic, or industrial uses. 8. Use of the RNA of any one of items 1 to 7, for avoiding and / or reducing ribosome stalling and / or for reducing or avoiding ribosomal frameshifting, preferably while maintaining translation efficiency. 9. The RNA of any one of items 1 to 7, for use as a medicament. 10. The RNA of any one of items 1 to 7, for use in the treatment or prevention of a disease associated with a deficient expression or lack of expression of the protein and / or peptide encoded by the RNA. 11. A pharmaceutical composition comprising the RNA molecule of any one of items 1 to 7, and a pharmaceutically acceptable carrier. 12. A method for reducing or avoiding ribosomal frameshifting and / or reducing or avoiding ribosomal frameshift mutations in a protein and / or a peptide, preferably while maintaining translation efficiency, the method comprising the step of introducing a specific modification to the nucleosides of a RNA molecule and / or introducing modified nucleosides into a RNA resulting in a modified RNA. 13. The method according to item 12, wherein the modified nucleosides are introduced during RNA synthesis, e.g. ex-vivo or in vitro transcription. 14. The method according to item 12 or 13, wherein said specific modification or modified nucleosides is / are selected from the group consisting of nucleosides with reduced ribosome stalling, preferably a nucleoside selected from m5C and / or s2U. 15. The method according to any one of items 12 to 14, wherein the RNA is as defined in any one of items 1 to 7. In one aspect, the invention provides an RNA molecule comprising modified nucleosides, wherein the modified nucleosides reduce or do not cause ribosome stalling and / or reduce or do not cause ribosomal frameshifting during translation, preferably while maintaining translation efficiency. In one aspect, the invention provides an RNA molecule comprising modified nucleosides, wherein the modified nucleosides reduce or do not cause ribosome stalling and / or reduce or do not cause ribosomal frameshifting during translation compared to the ribosome stalling or ribosomal frameshifting caused by N1-methyl-pseudouridine, preferably while maintaining translation efficiency and / or low immunogenicity. The terms “RNA molecule” and “RNA” can be used interchangeably herein. As used herein “modified nucleosides” and “nucleoside modification” may be used interchangeably, in particular a modified nucleoside refers to a modified form of a nucleoside and can comprise a nucleoside modification. For example, a nucleoside comprising a nucleoside modification is a modified nucleoside. The terms N1mΨ, N1mΨU, mΨU, mΨ, and the like can be used interchangeably herein. These terms refer to N1-methylpseudouridine. The terms ΨU and Ψ can be used interchangeably herein. These terms refer to pseudouridine. Ribosome stalling can occur during translation, where the ribosome temporarily halts or slows down as it synthesizes a protein. This can lead to or increase the likelihood of frameshift mutations during translation. Furthermore, ribosome stalling can negatively affect the efficiency and fidelity of translation. Ribosomal frameshifting can occur during translation where the ribosome shifts from one reading frame to another while synthesizing a protein. For example, the ribosome can skip a single base resulting in a +1 or -1 reading frame. This shift can result in the production of an alternative protein from the same RNA, e.g. mRNA. The alternative protein may be functional or not, e.g. the alternative protein function may be disrupted by a premature stop codon and / or result in a protein lacking the biological activity the correctly translated protein has (or result in a protein with reduced biological activity compared to the biological activity of the correctly translated protein). Both cases may be referred to as “mutation” since the original peptide / protein will be altered. A premature stop codon can be an adverse mutation, a frameshift resulting in an alternative peptide / protein, or an additional protein from the same mRNA may however be a desired / intended mutation. In a preferred embodiment, the RNA molecule of the present invention is a mRNA. Accordingly, the invention provides an mRNA molecule comprising modified nucleosides, wherein the modified nucleosides reduce or do not cause ribosome stalling during translation and / or reduce or do not cause ribosomal frameshifting during translation. The terms “reduce or do not cause ribosome stalling” and / or “reduce or do not cause ribosomal frameshifting” are understood to refer to events during translation. Thus, the term can likewise refer to “reduce or do not cause ribosome stalling during translation” and / or “reduce or do not cause ribosomal frameshifting during translation”. Generally, it is preferred herein that the RNA molecule of the invention does not comprise modified nucleosides except those modified nucleosides that are explicitly mentioned herein. For example, when it is disclosed herein that “between 0.1 % and 20% of the uridines are s2U” and / or that “between 5% and 99% of the cytidines are m5C” it is preferred that the other uridine and / or cytidine residues in the RNA molecule are not modified or are unmodified and that all nucleosides A and G in the RNA molecule are not modified / unmodified. As another example, when it is disclosed herein that “between 5% and 99% of the uridines are N1mΨU” it is preferred that the other uridine residues in the RNA molecule are not modified or are unmodified and that all nucleosides A and G in the RNA molecule are not modified / unmodified. It is envisaged herein that the RNA molecule provided herein, can – in addition to the modified nucleosides that are explicitly mentioned herein – comprise modified nucleosides. For example, if an RNA molecule is disclosed herein to comprise s2U or to solely comprise s2U it may, in addition, comprise other modified uridine residues, such as N1mΨU. If the RNA molecule is disclosed herein to comprise solely a modified nucleoside (e.g. s2U as sole modified uridine), a minute amount or level of other modified nucleoside (e.g. other modified uridine residues) may be present in the RNA molecule, provided that thereby the essential characteristics of the RNA molecule remain unchanged, i.e. that the RNA molecule has essentially the same characteristics / properties as the same RNA molecule, but without the minute amount or level of other modified nucleosides. Generally, the terms “A” and “adenosine”, “G” or “guanosine”, “U” or “uridine” and / or “C” or “cytidine”, respectively, can be used interchangeably herein. The terms “A” and “adenosine”, “G” or “guanosine”, “U” or “uridine” and / or “C” or “cytidine” as used herein refer to unmodified nucleosides, unless it is differently stated. The term “reduce or do not cause ribosome stalling during translation” and / or “reduce or do not cause ribosomal frameshifting during translation” can mean that the level of ribosome stalling and / or ribosomal frameshifting is (essentially) the same compared to unmodified RNA (e.g. as a reference the same RNA as the RNA of the invention may be used, except that the s2U and / or m5C modified nucleosides are absent, specifically are replaced by unmodified U and / or C nucleosides or as a reference an RNA may be used consisting only of unmodified nucleosides). “essentially” can mean ± 20 %, 10 %, 5 % or less, e.g.4 %, 3 %, 2 %, 1 % or less. In one aspect, this may relate to do not cause ribosome stalling during translation and / or do not cause ribosomal frameshifting during translation. When the ribosome stalling during translation and / or ribosomal frameshifting during translation is reduced, this may mean that the level of ribosome stalling and / or ribosomal frameshifting is reduced compared to modified RNA (e.g. as a reference the same RNA as the RNA of the invention may be used, except that the U and / or C nucleosides are modified with other modifications than and / or in addition to the s2U and / or m5C modified nucleosides, e.g. for example the uridine may be modified with N1methylpseudouridine (N1methylpseudouridine). As used herein, the term “translation efficiency” may mean that the translation level is (essentially) the same compared to unmodified RNA (e.g. as a reference the same RNA as the RNA of the invention may be used, except that the s2U and / or m5C modified nucleosides are absent, specifically are replaced by unmodified U and / or C nucleosides or as a reference an RNA may be used consisting only of unmodified nucleosides) and / or compared to modified RNA (e.g. as a reference the same RNA as the RNA of the invention may be used, except that the U and / or C nucleosides are modified with other modifications than and / or in addition to the s2U and / or m5C modified nucleosides, e.g. for example the uridine may be modified with N1methylpseudouridine (e.g.100 % N1-methylpseudouridine)). As used herein “maintaining translation efficiency” means that the RNA of the present invention is translated with an efficiency comparable to that of other RNA comprising modified nucleosides (such as 100 % N1-methylpseudouridine) or compared to unmodified RNA. The “translation efficiency” may mean “increased translation level” compared to modified RNA (e.g. as a reference the same RNA as the RNA of the invention may be used, except that the U and / or C nucleosides are modified with other modifications than and / or in addition to the s2U and / or m5C modified nucleosides, e.g. for example the uridine may be modified with pseudouridine, N1-methylpseudouridine, 5-methylcytidine, 5-methoxyuridine or any combinations there (e.g. modification with 100 % N1-methylpseudouridine)) or compared to unmodified RNA. “increased” can mean + 20 %, 10 %, 5 % or more. The terms “reduced immunogenicity” may mean that the immunogenicity of the RNA of the present invention comprising modified nucleosides is reduced compared to an RNA comprising no modified nucleosides and / or comprising different modified nucleosides. Immunogenicity can e.g. be measured by cytokine secretion e.g. IL-6, INF-alfa, INF-beta, IP10 and / or MCP-1. The RNA molecule of the present invention may comprise modified nucleosides. In one aspect, the invention provides an RNA molecule, wherein the modified nucleosides are selected from: a) 5-methylcytidine (m5C) and / or 2-thiouridine (s2U); and / or (b) 5-methylcytidine (m5C) and / or pseudouridine (ΨU); and / or b) N1-methyl-pseudouridine (N1mΨU), wherein the RNA comprises 1 to 99% N1mΨU. As mentioned above, modified nucleosides are advantageous to reduce the immunogenicity of the RNA, e.g. when used in therapy. Preferably the modified nucleosides are selected from 5-methylcytidine (m5C) and / or 2-thiouridine (s2U). These have the advantage that they reduce the immunogenicity of the RNA. The RNA of the present invention preferably comprises the modified nucleosides 5-methylcytidine (m5C) and 2-thiouridine (s2U). In combination, the positive effect on immunogenicity is increased. Accordingly, the invention provides an mRNA molecule comprising the modified nucleosides 5-methylcytidine (m5C) and 2-thiouridine (s2U), optionally, wherein the modified nucleosides reduce or do not cause ribosome stalling during translation and / or reduce or do not cause ribosomal frameshifting during translation. The modified nucleosides can be present at different percentages. When referring to a percentage of modified nucleosides, the percentage of modified nucleosides in relation to the total number of nucleosides of the same kind (i.e. A, G, C, or U, respectively) in the RNA is meant. For example, in an RNA comprising 50% m5C, 50% of total C nucleosides are unmodified C nucleosides and 50% are m5C nucleosides. In some embodiments, the RNA comprises at least about 5%, such as about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% of m5C nucleosides. In a preferred aspect, the C nucleosides of the total C nucleosides that are not m5C nucleosides are not modified or are unmodified, i.e. are cytidine. In some embodiments, the RNA comprises at least about 0.05%, such as about 0.5%, about 1%, about 2%, about 3%, about 4%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% of s2U nucleosides. In some embodiments, a) the RNA molecule comprises at least about 5% m5C and at least 0.05% or 0.5% s2U. In some embodiments, the RNA molecule comprises a combination of unmodified and modified nucleosides, wherein at least 5% of its cytidine nucleosides are m5C, and / or at least 0.05% of its uridine nucleosides are s2U, and / or b) The RNA molecule includes both unmodified and modified nucleosides, with at least one type of nucleoside (adenine (A), guanine (G), cytidine (C), or uridine (U)) having a mixture of modified and unmodified forms. In some embodiments, the RNA molecule comprises between about 0.1 % and 20%, preferably between 0.1% and 10%, more preferably between 0.5% and 5%, between 0.7% and 4%, between 1% and 3%, most preferably about 1% or 3%. The RNA molecule may comprise between 0.1 % to about 20%, or between about 0.5% and about 20%, such as about 0.1 %, 0.2 %, 0.3 %, 0.4 %, 0.5%, 0.6 %, 0.7 %, 0.8 %, 0.9 %, about 1%, 1.1 %, 1.2 %, 1.3 %, 1.4 %, about 1.5%, 1.2 %, 1.3 %, 1.4 %, 1.5 %, about 2%, 2.1 %, 2.2 %, 2.3 %, 2.4 %, about 2.5%, 2.6 %, 2.7 %, 2.8 %, 2.9 %, about 3%, about 3.5%, about 4%, about 4.5%, about 5%, about 5.5%, about 6%, about 6.5%, about 7%, about 7.5%, about 8%, about 8.5%, about 9%, about 9.5%, about 10%, about 10.5%, about 11%, about 11.5%, about 12%, about 12.5%, about 13%, about 13.5%, about 14%, about 14.5%, about 15%, about 15.5%, about 16%, about 16.5%, about 17%, about 17.5%, about 18%, about 18.5%, about 19%, about 19.5%, or about 20% s2U. In a preferred embodiment, the RNA molecule comprises between about 0.5% and about 10% s2U. In a more preferred embodiment, the RNA molecule comprises between about 1 % and about 5% s2U. In the most preferred embodiment, the RNA comprises about 3% s2U. In a preferred aspect, the U nucleosides of the total U nucleosides that are not s2U nucleosides are not modified or are unmodified, i.e. are uridine. In a preferred aspect, the A nucleosides comprised in the RNA of the present invention are not modified or are unmodified, i.e are adenosine. In a preferred aspect, the G nucleosides comprised in the RNA of the present invention are not modified or are unmodified, i.e. are guanosine. In a more preferred aspect, the A and G nucleosides are not modified or are unmodified. In some embodiments, the RNA molecule comprises between about 5% and about 100%, such as about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% m5C. In a preferred embodiment, the RNA molecule comprises between about 10% and about 50% m5C. In a more preferred embodiment, the RNA molecule comprises between about 15% and about 40% m5C, more preferably between 20% and 50%. In the most preferred embodiment, the RNA comprises between about 20% and about 40% m5C, specifically between about 30% to 37%. In a preferred embodiment the RNA comprises less than 100% m5C, e.g. less than 95 %, or less than 90 %. As mentioned above it is preferred that the RNA comprises both, m5C and 2sU. Accordingly in a preferred embodiment the RNA molecule comprises between the values indicated above, i.e. between about 0.1 % and 20%, or between about 0.5% and about 20%, preferably between 0.1% and 10%, more preferably between 0.5% and 5%, between 0.7% and 4%, between 1% and 3%, such as about 0.1 %, 0.2 %, 0.3 %, 0.4 %, 0.5%, 0.6 %, 0.7 %, 0.8 %, 0.9 %, about 1%, 1.1 %, 1.2 %, 1.3 %, 1.4 %, about 1.5%, 1.2 %, 1.3 %, 1.4 %, 1.5 %, about 2%, 2.1 %, 2.2 %, 2.3 %, 2.4 %, about 2.5%, 2.6 %, 2.7 %, 2.8 %, 2.9 %, most preferably about 1% or 3%, about 3.5%, about 4%, about 4.5%, about 5%, about 5.5%, about 6%, about 6.5%, about 7%, about 7.5%, about 8%, about 8.5%, about 9%, about 9.5%, about 10%, about 10.5%, about 11%, about 11.5%, about 12%, about 12.5%, about 13%, about 13.5%, about 14%, about 14.5%, about 15%, about 15.5%, about 16%, about 16.5%, about 17%, about 17.5%, about 18%, about 18.5%, about 19%, about 19.5%, or about 20% s2U and between about 5% and about 100%, more preferably between 20% and 50%, between 20 % and 40%, more preferably 30% to 37%, such as about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 31 %, about 32 %, about 33 %, about 34 %, about 35%, about 36 %, about 37 %, about 38 %, about 39 %, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% m5C. When m5C is used as sole modified cytidine (i.e. all other nucleotides A, G and U are not modified and / or no other modified cytidine is present in the RNA molecule) it is envisaged that between 20% to 95%, between 30% and 90%, preferably between 60% to 85%, more preferably between about 63% to about 83%, e.g. about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70 %, 71 %, 72 %, 73 %, 74 %, 75 %, 76 %, 77 %, 78 %, 79 %, 80 %, 81 %, 82 %, 83 %, 84 %, 85 %, most preferably about 83% of the cytidines are m5C. In a further preferred embodiment, between about 0.25% and about 5% of the uridines are s2U and / or between about 20% to about 40% of the cytidines are m5C, more preferably about 1 to 4.5 %, most preferably about 3 % of the uridines are s2U and / or about 30 to 35 %, more preferably about 33 % of the cytidines are m5C. In a further preferred embodiment, between 0.25% and 4.5% of the uridines are s2U and / or between 20% to 40% of the cytidines are m5C, more preferably about 3% of the uridines are s2U and / or about 30 to 35 %, more preferably about 33 % of the cytidines are m5C. In a further preferred embodiment, between 0.25% and 4.5% of the uridines are s2U and / or between 20% to 40% of the cytidines are m5C, more preferably about 1% of the uridines are s2U and / or about 30 to 35 %, more preferably about 33 % of the cytidines are m5C. In this context, preferably the C nucleosides (of the total C nucleosides) that are not m5C nucleosides are not modified or are unmodified, i.e. are cytidine, and / or the U nucleosides (of the total U nucleosides) that are not s2U nucleosides are not modified or are unmodified, i.e. are uridine, and / or the A and G nucleosides are not modified or are unmodified, i.e. are adenosine and guanosine. In a preferred aspect, the A nucleosides are not modified or are unmodified, i.e. adenosine. In preferred aspect, the A and G nucleosides are not modified or are unmodified, i.e are adenosine and guanosine. In some embodiments the RNA molecule comprises: a) between 0.5 % and 20% of the uridines are s2U, preferably between 0.5% and 10%, more preferably between 1% and 5%, most preferably about 3 %; and / or b) between 5% and 99% of the cytidines are m5C, preferably wherein between 5% and 95%, between 5% and 90%, between 5% and 85%, between 5% and 80%, between 5% and 75%, between 5% and 70%, between 5% and 65%, between 5% and 60%, between 5% and 55%, between 5% and 50%, more preferably between 10 % and 50%, between 15 % and 40%, between 20 % and 40% of the cytidines are m5C, optionally wherein the percentage of m5C and / or s2U in the RNA molecule is based on optimization studies identifying the most effective distribution of modifications for maintaining translation fidelity. Optimization studies for identifying the most effective distribution of modifications for maintaining translation fidelity are provided in the appended examples. In particular the +1 frameshift luciferase mRNA provided in the example can be used to detect feasible percentages of m5C and s2U for maintaining the translation fidelity. In a preferred embodiment, the A and G nucleosides in the RNA of the present invention are not modified nucleosides, i.e. are Adenosin and Guanosin. In one aspect, the RNA molecule provided herein comprises between about 80% and 100% pseudouridine (i.e. between about 80% and 100% of the uridines are pseudouridine), such as about 80 %, 81 %, 82 %, 83 %, 84 %, 85 %, 86 %, 87 %, 88 %, 89 %, 90 %, 91 %, 92 %, 93 %, 94 %, 95 %, 96 %, 97 %, 98 %, 99 %, or 100 % of the uridines are pseudouridine, optionally wherein the percentage of pseudouridine in the RNA molecule is based on optimization studies identifying the most effective distribution of modifications for maintaining translation fidelity. The RNA molecule provided herein may comprise modified nucleosides in addition to pseudouridine, e.g. s2U and / or m5C as disclosed herein. The corresponding definitions and explanations apply mutatis mutandis in this context / aspect. Specifically, the RNA molecule may comprise, in addition to pseudouridine, m5C. For example, the RNA molecule provided herein may, in addition to pseudouridine, comprise between about 80% and 100% m5C (i.e. between about 80% and 100% of the cytidines are m5C), such as about 80 %, 81 %, 82 %, 83 %, 84 %, 85 %, 86 %, 87 %, 88 %, 89 %, 90 %, 91 %, 92 %, 93 %, 94 %, 95 %, 96 %, 97 %, 98 %, 99 %, or 100 % of the cytidines are m5C. If pseudouridine and m5C is used (i.e. both are present in the RNA molecule), it is preferred that they are present / are used in the same percentages, e.g.80 % pseudouridine and 80 % m5C, or 100 % pseudouridine and 100 % m5C, and so on. Pseudouridine preferably is used as sole modified nucleoside (i.e. all nucleotides A, G and C are not modified and / or no other modified uridine is present in the RNA molecule). In one aspect, the RNA molecule provided herein comprises between 5% and 99% N1mΨU (i.e. between 5% and 99% of the uridines are N1mΨU), preferably wherein between 5% and 95%, between 5% and 90%, between 5% and 85%, between 5% and 80%, between 5% and 75%, between 5% and 70%, between 5% and 65%, between 5% and 60%, between 5% and 55%, between 5% and 50%, more preferably between 10 % and 50%, between 15 % and 40%, more preferably between 20% and 50%, between about 20 % and about 45 %, between about 20 % and about 40%, such as about 20 %, 21 %, 22 %, 23 %, 24 %, 25 %, 26 %, 27 %, 28 %, 29 %, 30 %, 31 %, 32 %, 33 %, 34 %, 35 %, 36 %, 37 %, 38 %, 39 %, 40 %, 41 %, 42 %, 43 %, 44 %, 45 %, most preferably about 38% of the uridines are N1mΨU, optionally wherein the percentage of N1mΨU in the RNA molecule is based on optimization studies identifying the most effective distribution of modifications for maintaining translation fidelity. The RNA molecule provided herein may comprise modified nucleosides in addition to N1mΨU, e.g. s2U and / or m5C as disclosed herein. The corresponding definitions and explanations apply mutatis mutandis in this context / aspect. N1mΨU preferably is used as sole modified nucleoside (i.e. all nucleotides A, G and C are not modified and / or no other modified uridine is present in the RNA molecule. In preferred aspect, the RNA molecule provided herein does not contain a frameshift-causing nucleoside and / or a nucleoside that causes ribosome stalling, preferably does not contain a nucleoside selected from Pseudouridine (ΨU), N6-methyladenosine (m6A), 5-iodouridine, Inosine (I), 2'-O-methylation (2'-O-Me), 5-hydroxymethylcytosine (hm5C), N1- methyladenosine (m1A), N7-methylguanosine (m7G), 3-methylcytidine (m3C), Wybutosine (yW), and / or N1-methyl-Pseudouridine, more preferably does not contain Pseudouridine and / or N1-methyl-Pseudouridine, most preferably does not contain N1-methyl-Pseudouridine. The RNA molecule of the present invention may comprise modified nucleosides in a gradient. This means that the number of modified nucleosides can increase or decrease starting from the 5’ region to the 3’ region of the RNA and vice versa. It is preferred that the gradient starts at the 5’ end and decreases towards the 3’ end. Accordingly, in some embodiments the RNA molecule comprises a gradient of modified nucleosides from 5’ to 3’, preferably wherein the RNA molecule comprises more modified nucleosides in the 5’ region and gradually less modified nucleosides towards the 3’ region. In some embodiments up to 99% of nucleosides in the 5' region are modified nucleosides, and wherein the percentage of modified nucleotides is decreasing to 50% to 25% in the 3' region, thereby enhancing translational initiation and fidelity. The RNA of the present invention can further be modified to avoid sequences motifs in the RNA that are known to predispose the RNA molecule to induce frameshift mutations and / or ribosome stalling. This can avoid the occurrence of frameshift during translations. These modifications include deletions or alterations of RNA sequence that are prone to frameshifting. This can be for example repetitive RNA sequence or sequence that is known to induce ribosomal frameshifts. Such sequences may be referred to as slippery sites. Mulroney et al. 2023 identified exemplary sequences that may induce ribosomal frameshifts. Accordingly, in some embodiments the modified nucleosides are distributed across regions of the RNA that are known to be prone to ribosomal frameshift mutations during translation. In some embodiments the RNA molecule further comprises sequence modifications to avoid motifs known to predispose the RNA molecule to induce frameshift mutations and / or ribosome stalling, thereby synergistically reducing frameshift occurrences. In some embodiments the sequence modifications are selected from elimination or alteration of nucleotide repeats or sequences prone to ribosomal frameshifting during translation, and wherein the modified nucleosides and the sequence modifications result in a further reduction of ribosomal frameshifting thereby reducing frameshift mutations. For example, the sequence prone to ribosomal frameshifting may be altered without changing the reading frame and without changing the resulting amino acid from a codon. However, also a codon may be changed as such the resulting amino acid does not interfere with the resulting protein’s function. The sequences prone to ribosomal frameshifting are polypurine tracts or polypyrimidine tracts. Accordingly in some embodiments the RNA molecule may comprise further sequence modifications that are selected from elimination or alteration of polypurine tracts or polypyrimidine tracts. Furthermore, sequences prone to ribosomal frameshifting during translation may be in the form of specific nucleoside repetitions. These sequences may be independent of the nucleoside identity, i.e. independent of A, U, G, or C is the repeated nucleoside, but the pattern as such may be crucial. Thus, in some embodiments the sequences prone to ribosomal frameshifting during translation may be in the form of XXX XXY, X XXY Z, X XXX YZ, X XXY YYZ, wherein X, Y, and Z may independently be any nucleotide selected of A, U, G, C or a modified nucleoside thereof. For example, applying the above patterns to nucleosides, an exemplary sequence prone to ribosomal frameshifting during translation may be AAA AAU or UUU UUC and so on. A further sequence prone to ribosomal frameshifting may be in the form of UUUCX or UUUU or UUUX or UUUC, herein X may be any nucleotide selected of A, U, G, C or a modified nucleoside thereof and wherein U and C may be modified nucleosides. Accordingly, in some embodiments the sequences prone to ribosomal frameshifting during translation are in the form of XXX XXY, X XXY Z, X XXX YZ, X XXY YYZ, where the ribosome slips forward by one nucleotide, and wherein X, Y and Z are independently a different and any nucleotide (A, U, G, or C or any modified nucleoside thereof). Furthermore, secondary structures may interfere with translation. Accordingly, in some embodiments the RNA molecule further comprises sequence modifications that adjust or remove sequences known to form secondary structures that can interfere with the ribosomal scanning process, thereby enhancing translational accuracy. As mentioned above, the RNA molecule of the invention preferably is a mRNA. Accordingly, the RNA molecule can be an mRNA and / or encode one or more peptides and / or proteins, preferably wherein the one or more peptides and / or proteins are for therapeutic, diagnostic, or industrial uses. Exemplary peptides and / or proteins for therapeutic, diagnostic, or industrial uses can be selected from the list of: CFTR, Erythropoietin (EPO), Factor VIII, Factor IX, Chimeric Antigen Receptor (CAR) T-cell, Survivin (BIRC5) or a dominant-negative form thereof, P53, Vascular Endothelial Growth Factor (VEGF), Insulin, SARS-CoV-2 Spike protein, Alpha-synuclein, Dystrophin, Glucocerebrosidase (GCase), a cytokine such as Interleukin-2 (IL-2), Interleukin-10 (IL-10), Interleukin-12 (IL-12), an interferon (including, but not limited to interferon-alpha (IFN-α), interferon-beta (IFN-β), interferon-gamma (IFN-γ), and / or interferon lambda (IFNλ), such as interferon lambda 1 (IFN-λ1, also known as IL-29; (preferably human interferon lambda 1 (hIFNλ1), IFN-λ2 (also known as IL-28A), IFN-λ3 (also known as IL-28B), and / or IFN-λ4), Tumor Necrosis Factor-alpha (TNF-α), Granulocyte-macrophage colony- stimulating factor (GM-CSF), a primary ciliary dyskinesia protein or factor such as DNAH5, DNAH11, CCDC39, DNAI1, CCDC40, CCDC103, SPAG1, ZMYND10, ARMC4, CCDC151, DNAI2, RSPH1, CCDC114, RSPH4A, DNAAF1 (LRRC50), DNAAF2 (KTU), LRRC6, C21orf59, CCDC65 (DRC2), CCNO, DNAAF3, DNAH1, DNAH8, DNAL1, DRC1 (CCDC164), DYX1C1, DNAAF5 (HEATR2), HYDIN, MCIDAS, NME8 (TXNDC3), RSPH3, RSPH9, or FOXJ1. The invention also provides a use of the RNA of the invention for avoiding and / or reducing ribosome stalling and / or for reducing or avoiding ribosomal frameshifting. The RNA of the present invention is particularly useful since it reduces or avoids ribosome stalling and / or ribosomal frameshifting during translation and at the same time reduces immunogenicity. Thus, the RNA of the present invention is advantageous to use as a medicament, e.g. for vaccination. Accordingly, the invention provides the RNA of the present invention for use as a medicament. The invention also provides the RNA of the present invention for use in the treatment or prevention of a disease associated with a deficient expression or lack of expression of the protein and / or peptide encoded by the RNA. Furthermore, the invention provides a method of treatment comprising administering the RNA of the present invention to a subject in need thereof. The invention also provides a method for reducing or avoiding ribosomal frameshifting and / or reducing or avoiding ribosomal frameshift mutations / frameshifting in a protein and / or a peptide, preferably while maintaining translation efficiency, the method comprising the step of introducing a specific modification to the nucleosides of an RNA molecule and / or introducing modified nucleosides into an RNA resulting in a modified RNA. In some embodiments the modified nucleosides are introduced during RNA synthesis, e.g. ex-vivo or in vitro transcription. In some embodiments the specific modification or modified nucleosides is / are selected from the group consisting of nucleosides with reduced ribosome stalling, preferably a nucleoside selected from m5C and / or s2U. In some embodiments the RNA used in the method for reducing or avoiding ribosomal frameshifting of the present invention is the RNA provided by the present invention. Accordingly, all features described herein in context of the RNA of the present invention apply mutatis mutandis to the method for reducing or avoiding ribosomal frameshifting of the present invention, in particular all features referring to modified nucleosides such as the features defining certain percentages of modifications defined above. The method may be in vitro or ex vivo or in vivo. In one aspect the term “reducing or avoiding ribosomal frameshifting and / or reducing or avoiding ribosomal frameshift mutations / frameshifting” can refer to “reducing or avoiding ribosomal frameshifting and reducing or avoiding ribosomal frameshift mutations / frameshifting”, e.g. “reducing or avoiding ribosomal frameshifting thereby reducing or avoiding ribosomal frameshift mutations / frameshifting”. The invention further provides a pharmaceutical composition comprising the RNA molecule of the present invention and a pharmaceutically acceptable carrier. In a preferred embodiment, the RNA molecule comprise in the pharmaceutical composition exhibits no or reduced ribosomal frameshifting, thereby reducing or avoiding frameshift mutations during translation, optionally wherein the RNA molecule exhibits an improved safety profile of the RNA-based therapy. The features discussed herein in the context of the composition of the invention, such as pharmaceutical composition, apply mutatis mutandis to the pharmaceutical composition comprising the RNA molecule of the present invention and a pharmaceutically acceptable carrier. It is envisaged and preferred herein that the RNA molecule provided herein exhibits no or reduced ribosomal frameshifting, preferably no or reduced ribosomal frameshifting during translation, thereby reducing or avoiding frameshift mutations, optionally wherein the RNA molecule exhibits an improved safety profile of the RNA-based therapy, optionally wherein said ribosomal frameshifting, preferably during translation, is reduced compared to an mRNA with the same sequence and wherein 100% of uridines are 100% N1-Methylpseudouridine. The term “the RNA molecule provided herein exhibits no or reduced ribosomal frameshifting, thereby reducing or avoiding frameshift mutations during translation” as used herein is meant that when the RNA molecule provided herein exhibits no or reduced ribosomal frameshifting preferably it exhibits (or there is) no or reduced ribosomal frameshifting during translation. The term “exhibit” means that the RNA molecule is capable of has the capacity to reduce frameshifting, preferably during translation. Said frameshifting is reduced to a reference RNA molecule, e.g. reduced compared to an RNA (preferably mRNA) with the same sequence (i.e. identical nucleoside sequence and identical length), but different or additional modified nucleosides. Preferably, frameshifting is reduced compared to an RNA with the same sequence, wherein 100% of uridines are N1- Methylpseudouridine. The reference RNA molecule may comprise N1-Methylpseudouridine as sole modified nucleoside (i.e. all nucleotides A, G and C are not modified and / or no other modified uridine is present in the reference RNA molecule) or it may comprise the same or substantially the same modified nucleosides as the RNA molecule provided herein (except N1- Methylpseudouridine) and, in addition N1-Methylpseudouridine as defined above. As mentioned above, the present invention provides compositions (such as pharmaceutical compositions, vaccines (e.g. a vaccine comprising the RNA molecule provided herein, and a pharmaceutically acceptable carrier) and cosmetic compositions) and their uses in the local delivery of agents (such as therapeutic agents or active agents). Accordingly, in the context of the present invention, when referring to a “composition” this may also refer to the herein provided (pharmaceutical) composition for use as a medicament (also referred to as “pharmaceutical composition” herein) and / or to the herein provided cosmetic compositions. Generally, all definitions and specifications relating to a “composition” (or accordingly a pharmaceutical composition) may apply to all such compositions (i.e., to pharmaceutical compositions and cosmetic compositions) herein. Herein, “pharmaceutical composition” and “therapeutic composition” may be used interchangeably. Further, the terms “composition” and “formulation” may be used interchangeably herein. Accordingly, the present invention provides for a (pharmaceutical) composition for use in the treatment of a disease and / or prevention of a disease, the treatment comprising administration of the composition, the composition comprising: a) one or more therapeutic agent(s); and b) a carrier, wherein said carrier comprises: i. an ionizable lipid and / or an ionizable lipidoid;ii. optionally one or more helper lipid(s); and iii. optionally one or more pharmaceutically acceptable excipient(s) or diluent(s); wherein one or more of the following apply: - a reduced amount of the composition or of the therapeutic agent is to be administered to achieve a similar therapeutic effect compared to the same therapeutic agent formulated in a composition that causes ribosomal frameshift, - the patient has less side-effects compared to the same therapeutic agent formulated in a composition that causes ribosomal frameshift, - In the context of the present invention, contacting a subject / a tissue / an organ with either a pharmaceutical or cosmetic composition may be referred to as “treating a subject / a tissue / an organ”, accordingly, the terms “treat”, “treatment”, and the like may refer to both therapeutic and cosmetic application / administrations / compositions and the like. As used herein, the terms “treatment” and “to treat” preferably mean therapy. Therapy in the sense of the present invention includes therapeutic treatments, such as acute treatments of diseases, as well as prophylactic / preventive treatments, such as an immunisation with a vaccine. Accordingly, in the context of the present invention, at least about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% of the protein and / or peptides expressed by said one or more RNA molecules are the canonical protein and / or peptide, as quantified by a method selected from the group consisting of western blot, HPLC, mass spectrometry, combinations of HPLC and mass spectrometry, and combinations thereof. It is herein preferred that only about 5 %, 4 %, 3 %, 2 %, or less, preferably about 1% or less, more preferably about 0.9 %, 0.8 %, 0.7 %, 0.6 %, 0.5 %, 0.4 %, 0.3 %, 0.2 %, 0.1% or less, even more preferably about 0.09 %, 0.08 %, 0.07 %, 0.06 %, 0.05 %, 0.04 %, 0.03 %, 0.02 %, 0.01% or less, even more preferably less than about 0.01% of the proteins translated from the RNA of the invention are ribosomal frameshift products after about 10 hours after administration, after about 9 hours, 8 hours, 7 hours, 6 hours, 5 hours, 4 hours, 3 hours, or, 2 hours, preferably 6 hours after administration. As mentioned above, means and methods to assess whether e.g., about 0.01% of the proteins expressed is not the canonical protein, western blot, HPLC, mass spectrometry, or combination thereof. For agents comprising a nucleic acid (such as mRNA) In other words, if an RNA of the invention does not cause frameshift mutations if e.g. about, 6 %, 5 %, 4 %, 3 %, 2 %, or less, preferably about 1% or less, more preferably about 0.9 %, 0.8 %, 0.7 %, 0.6 %, 0.5 %, 0.4 %, 0.3 %, 0.2 %, 0.1% or less, even more preferably about 0.09 %, 0.08 %, 0.07 %, 0.06 %, 0.05 %, 0.04 %, 0.03 %, 0.02 %, 0.01% or less, even more preferably less than about 0.01% of the (amount of the) expressed therapeutic peptide or protein is not the canonical protein or peptide coded by the RNA of the invention, after local administration of the composition (such as intradermal, subcutaneous, submucosal, intramuscular, or intratumoral injection, mucosal delivery, aerosol delivery, or topic application), e.g. after about 10 hours after administration, after about 9 hours, 8 hours, 7 hours, 6 hours, 5 hours, 4 hours, 3 hours, or, preferably 2 hours, e.g. as quantified / assessed / determined by a method selected from the group consisting of qPCR, HPLC, mass spectrometry, combinations of HPLC and mass spectrometry. Vice versa, if a composition does not remain localized at the site of administration and / or if a composition essentially does exhibit systemic distribution throughout the patient's body, or if a composition does not have prolonged retention at the site of administration or if a (therapeutic or cosmetic) agent does not exert its effect at the site of administration by prolonged retention (of the agent or the composition) at the site of administration of the composition, e.g. about 2 %, 3 %, 4 %, 5 %, 6 %, 7 %, 8 %, 9 %, 10%, or more, preferably about 1% or more, more preferably about 0.1%, 0.2 %, 0.3 %, 0.4 %, 0.5 %, 0.6 %, 0.7 %, 0.8 %, 0.9 %, or more, even more preferably about 0.01%, 0.02 %, 0.03 %, 0.04 %, 0.05 %, 0.06 %, 0.07 %, 0.08 %, 0.09 %, or more, even more preferably more than about 0.01% of the (amount of the) (therapeutic or cosmetic) agent reaches / can be detected / assessed / determined in (systemic) circulation after local administration of the composition (such as intradermal, subcutaneous, submucosal, intramuscular, or intratumoral injection, mucosal delivery, aerosol delivery, or topic application), e.g. after about 10 hours after administration, after about 9 hours, 8 hours, 7 hours, 6 hours, 5 hours, 4 hours, 3 hours, or, preferably 2 hours, e.g. as quantified / assessed / determined by a method selected from the group consisting of qPCR, HPLC, mass spectrometry, combinations of HPLC and mass spectrometry. The relative values indicated above (e.g. about 10%, 9 %, 8 %, 7 %, 6 %, 5 %, 4 %, 3 %, 2 %, or less, preferably about 1% or less, more preferably about 0.9 %, 0.8 %, 0.7 %, 0.6 %, 0.5 %, 0.4 %, 0.3 %, 0.2 %, 0.1% or less, even more preferably about 0.09 %, 0.08 %, 0.07 %, 0.06 %, 0.05 %, 0.04 %, 0.03 %, 0.02 %, 0.01% or less, even more preferably less than about 0.01% of the (amount of the) (therapeutic RNA for the compositions of the invention and / or about 2 %, 3 %, 4 %, 5 %, 6 %, 7 %, 8 %, 9 %, 10%, or more, preferably about 1% or more, more preferably about 0.1%, 0.2 %, 0.3 %, 0.4 %, 0.5 %, 0.6 %, 0.7 %, 0.8 %, 0.9 %, or more, even more preferably about 0.01%, 0.02 %, 0.03 %, 0.04 %, 0.05 %, 0.06 %, 0.07 %, 0.08 %, 0.09 %, or more, even more preferably more than about 0.01% of the (amount of the) (therapeutic or cosmetic) agent for reference compositions) refer to the amount of the (therapeutic or cosmetic) agent detected / assessed / determined in (systemic) circulation (or the amount the agent reaches in (systemic) circulation relative to the total administered amount of the agent). If the therapeutic agent is administered in multiple doses (e.g. in subsequently administered 2, 3, or 4 doses) the determination of the relative values will take into account the respective administered (total) amount of the agent (or the (total) amount of the translated gene product (protein) in case of mRNA / DNA)). For example, if the therapeutic agent is administered in subsequent 3 doses with time interval of 2 hours, the amount of the (therapeutic or cosmetic) agent detected / assessed / determined in (systemic) circulation (or the amount the agent reaches in (systemic) circulation) may be determined e.g.2 hours after each administration relative to the then total administered amount of the agent. In other words, if a “composition remains localized at the site of administration” and / or if a “composition essentially does not exhibit systemic distribution throughout the patient's body”, or if a “composition has a prolonged retention at the site of administration”, e.g. about 10%, 9 %, 8 %, 7 %, 6 %, 5 %, 4 %, 3 %, 2 %, or less, preferably about 1% or less, more preferably about 0.9 %, 0.8 %, 0.7 %, 0.6 %, 0.5 %, 0.4 %, 0.3 %, 0.2 %, 0.1% or less, even more preferably about 0.09 %, 0.08 %, 0.07 %, 0.06 %, 0.05 %, 0.04 %, 0.03 %, 0.02 %, 0.01% or less, even more preferably less than about 0.01%, more preferably below detection limit, of the (amount of the) ((ionizable) lipidoid or (ionizable) lipid reaches / can be detected / assessed / determined in (systemic) circulation after local administration of the composition (such as intradermal, subcutaneous, submucosal, intramuscular, or intratumoral injection, mucosal delivery, aerosol delivery, or topic application), e.g. after about 10 hours after administration, after about 9 hours, 8 hours, 7 hours, 6 hours, 5 hours, 4 hours, 3 hours, or, preferably 2 hours, e.g. as quantified / assessed / determined by a method selected from the group consisting of HPLC, mass spectrometry, combinations of HPLC and mass spectrometry, preferably LC-MC / MS. It may however be preferred herein that the carrier is a lipid nanoparticle (LNP), a lipidoid nanoparticle (LiNP), a liposome, a micelle, an emulsion, an Nanostructured Lipid Carrier (NLCs), or a Lipid-Drug Conjugate (LDC), preferably an LNP or an LiNP, and / or that the agent is formulated as a lipid nanoparticle (LNP), a lipidoid nanoparticle (LiNP), a liposome, a micelle, an emulsion, a Nanostructured Lipid Carrier (NLCs), or a Lipid-Drug Conjugate (LDC), preferably as an LNP or as an LiNP. Accordingly, in the context of the present invention, when referring to a nanoparticle / a particle / a complex / a LiNP / a LNP / or the like herein, this refers to specific embodiments of the carrier comprised in the herein provided composition. Generally, any definition relating to an LNP may also refer to an LiNP, and vice versa, with the exception that an LNP at least comprises one ionizable lipid and an LiNP comprises at least one ionizable lipidoid. An aspect of the invention relates to a pharmaceutical composition comprising a nucleic acid (such as an RNA or an mRNA) of the invention, an nucleic acid (such as an RNA or an mRNA, a vaccine vector of the invention, or an nucleic acid (such as an RNA or an mRNA) vaccine of the invention, and a pharmaceutically acceptable carrier, excipient, or diluent. The (m)RNA or the mRNA vaccine of the invention can advantageously be combined in the pharmaceutical composition with further components and / or compounds which ease delivery of the mRNA to the target cells or the target tissue and / or which increase its stability. One possibility in this regard is the formation of the RNA into liposomes or nanoparticles with suitable substances such as those described herein and, e.g. in EP3013964B1, which is incorporated herein in its entirety. In particular, the mRNA or the mRNA vaccine of the invention might be formulated with liposomes, to generate lipoplexes or with subsequent generations of lipid nanocarriers, such as lipid nanoparticles (LNPs), lipidoid nanoparticles (LiNPs), nanostructured lipid carriers, and / or cationic lipid–nucleic acid complexes. In some embodiments, the nucleic acid of the invention can be delivered systemically or to target cells and / or target tissues in vivo, ex-vivo and / or in vitro using LNPs or LiNPs. LNPs and LiNPs can be distinguished from other carriers due to their small size, their homogenous size distribution and their structure and are especially suited for immunization of a subject. The skilled person knows method for the production of LNPs and LiNPs. The production of LNPs or LiNPs involves a combination of lipids or lipidoids, such as phospholipids, cholesterol, and other specialized lipids, which are mixed together in a solvent, such as an alcohol. This mixture is then subjected to a process called nanoprecipitation, which involves rapidly mixing the lipid solution with a non-solvent, such as a nucleic acid dissolved in water, under controlled conditions of temperature, pressure, and stirring rate. During this process, the lipids self- assemble into complex nanoscale structures, which trap and protect the therapeutic nucleic acids of the invention inside. The nanoparticles may also be further modified with various surface coatings, such as polyethylene glycol (PEG), to improve their stability and reduce their tendency to be cleared by the immune system. The herein provided compositions may further comprise one or more stabilizing agent(s), adjuvant(s), and / or immunomodulator(s). Such stabilizing agents may be defined as anywhere herein above or below, preferably the stabilizing agent may be a triblock polymer (i.e., component (p)) as defined anywhere herein. Generally, stabilizing agents (such as Cholesterol, Polyethylene Glycol, poloxamer) may help stabilize the composition (such as stabilize the lipid bilayers and improve the structural integrity of nanoparticles). In the context of the present invention, adjuvants may comprise for example CPG oligonucleotides, in particular in the context of herein provided vaccine compositions. The LiNPs may comprise as component (a) an mRNA, an ionizable lipid or an ionizable lipidoid and optionally helper lipids as defined below. Optionally, the LiNPs may comprise as component (p) a triblock copolymer which contains one poly(propylene oxide) block and two poly(ethylene oxide) blocks as described above. The surfactant in the context of the present invention may be a non-ionic surfactant, optionally at least one nonionic surfactant selected from the group of fatty alcohol ethoxylates, fatty acid ethoxylates, block copolymers of ethylene oxide and propylene oxide, alkylphenol ethoxylates or oligomers of alkylphenol ethoxylates, fatty acid esters of sorbitol, ethoxylated fatty acid esters of sorbitol, fatty acid esters of glycerol, ethoxylated castor oil and ethoxylated vitamin E, preferably wherein the surfactant is selected from the list consisting of poloxamer 188 (P188), poloxamer 338 (P338), poloxamer 407 (P407), Tween-20, Tween-80, BRIJ35, tyloxapol, VitE-PEG1000, and / or Kolliphor EL. Preferably, the surfactant is a (tri)block copolymer of ethylene oxide and propylene oxide, more preferably a poloxamer, even more preferably poloxamer selected from the list consisting of: poloxamer 188, 338, and / or 407, most preferably poloxamer 188 (i.e., P188). As component (a), the nanoparticles contained in the pharmaceutical composition of the invention, for example in the form of a formulation for intramuscular delivery, intranasal delivery or for aerosol delivery, may comprise a mRNA coding for a tumoral, a viral or a bacterial antigen. The nanoparticles in the pharmaceutical composition may further comprise an ionizable lipid or an ionizable lipidoid. It will be understood that this encompasses the possibility that the nanoparticles comprise a combination of different ionizable lipids, a combination of different ionizable lipidoids, or a combination of one or more ionizable lipids and one or more ionizable lipidoids. The nanoparticles used in the context of the present invention typically comprise an mRNA (a) and as the ionizable lipid or as the ionizable lipidoid (b) a cationic lipid or cationic lipidoid, in the form of a mixture of these components. The pharmaceutical composition or the mRNA vaccine according to the invention optionally comprises a LiNP comprising an ionizable lipidoid of formula (b-I): R2AR4AR1A N {CH2 (CH2)a N [CH2 (CH2)b N]p}m [CH2 (CH2)a N]n R6AR3AR5A(b-I), wherein the variables a, b, p, m, n and R1Ato R6Aare defined as follows: a is 1 and b is an integer of 2 to 4; or a is an integer of 2 to 4 and b is 1, p is 1 or 2, m is 1 or 2; n is 0 or 1 and m+n is ≥ 2; and R1Ato R6Aare independently of each other selected fromhydrogen; -CH2-CH(OH)-R7A, -CH(R7A)-CH2-OH,-CH2-CH2-(C=O)-O-R7A, or -CH2-R7A; wherein R7Ais selected from C3-C18 alkyl or C3-C18 alkenyl having one C-C double bond; a protecting group for an amino group; -C(NH)-NH2; a poly(ethylene glycol) chain; and a receptor ligand; provided that at least two residues among R1Ato R6Aare a group -CH2-CH(OH)-R7A, -CH(R7A)-CH2OH, -CH2CH2(C=O)-O-R7, - CH2CH2(C=O)-NH-R7Aor -CH2R7wherein R7is selected from C3-C18 alkyl or C3-C18 alkenyl having one C-C double bond; and wherein one or more of the nitrogen atoms contained in the compound of formula (b-I) are protonated to provide a compound carrying a positive charge. Accordingly, the composition according to the present invention, may comprise an ionizable lipidoid, wherein said ionizable lipidoid is a compound of formula (b-I): formula (b-I), preferably wherein the variables a, b, p, m, n and R1Ato R6Aare defined as follows: a is 1 and b is an integer of 2 to 4,or a is an integer of 2 to 4 and b is 1, p is 1 or 2, m is 1 or 2, n is 0 or 1, m+n is ≥ 2, and R1Ato R6Aare independently of each other selected from hydrogen, -CH2-CH(OH)-R7A,-CH(R7A)-CH2-OH, -CH2-CH2-(C=O)-O-R7A, -CH2CH2(C=O)-NH-R7A,or -CH2-R7A, wherein R7Ais selected from C3-C18 alkyl or C3-C18 alkenyl having one C-C double bond, a protecting group for an amino group, -C(NH)-NH2, a poly(ethylene glycol) chain, and a receptor ligand; wherein at least two residues among R1Ato R6Aare a group selected from -CH2- CH(OH)-R7A, -CH(R7A)-CH2OH, -CH2CH2(C=O)-O-R7A, -CH2CH2(C=O)-NH-R7A, or -CH2R7A, wherein R7Ais selected from C3-C18 alkyl or C3-C18 alkenyl having one C-C double bond; and wherein one or more of the nitrogen atoms comprised or contained in the compound of formula (b-I) are protonated to provide a compound carrying one or more positive charges. In this context, R7Amay be preferably selected from C8-C16 alkyl or C8-C18 alkenyl having one C-C double bond, and more preferably from C8-C12 alkyl or C8-C12 alkenyl having one C-C double bond and most preferably from C10-C12 alkyl or C10-C12 alkenyl having one C- C double bond. Moreover, it is generally preferred herein that the ionizable lipidoid has a structure according to formula (IVb) or (IVc): R1-NR2-CH2-(CH2)a-NR3-CH2-(CH2)b-NR4-CH2-(CH2)a-NR5-R6(IVb), R1-NR2-CH2-CH2-NR3-CH2-CH2-CH2-NR4-CH2-CH2-NR5-R6(IVc), wherein a, b, and R1to R6are defined as anywhere herein above and wherein one or more of the nitrogen atoms indicated in formula (IVc) may be protonated to provide a cationic lipidoid. Optionally, the cationic lipidoid formula (b-I) comprises at least two residues among R1Ato R6A, optionally at least three residues among R1Ato R6A, or at least four residues among R1Ato R6Aare a group selectedfrom -CH2-CH(OH)-R7A, -CH(R7A)-CH2-OH, -CH2-CH2-(C=O)-O-R7A, -CH2-CH2-(C=O)-NH-R7Aand -CH2-R7A, wherein R7A is selected from C3-C18 alkyl or C3-C18 alkenyl having one C-Cdouble bond. Optionally, the ionizable lipidoid comprised in the herein provided composition may be an ionizable lipidoid according to formula (b-I), wherein R1Ato R6Aare independently of each other selected from -CH2-CH(OH)-R7A, -CH2-CH2-(C=O)-O-R7A, -CH2CH2(C=O)-NH-R7A, wherein R7Ais defined as herein above or below. In accordance with an optional embodiment, the compound of formula (b-I) is a compound of formula (b-Ib), and the ionizable lipidoid comprises or consists of a lipidoid compound of the following formula (b-Ib), wherein R1Ato R6Aare defined as in formula (b-I), including preferred embodiments thereof; or a protonated form thereof wherein one or more of the nitrogen atoms indicated in formula (b- Ib) are protonated to provide a compound carrying a positive charge. Thus, in a accordance with a particularly preferred embodiment, the ionizable lipidoid comprises or consists of a lipidoid of the above formula (b-Ib) or a protonated form thereof, and R1Ato R6Aare independently selected from hydrogen and -CH2-CH(OH)-R7A, wherein R7Ais selected from C8-C18 alkyl and C8-C18 alkenyl having one C-C double bond, provided that at least two residues among R1Ato R6Aare -CH2-CH(OH)-R7A, more preferably at least three residues among R1Ato R6A, and still more preferably at least four residues among R1Ato R6Aare -CH2-CH(OH)-R7A, wherein R7Ais selected from C8-C18 alkyl and C8-C18 alkenyl having one C-C double bond. In the context of the present invention formula (b-I) and formula (b-1) are interchangeable. In certain embodiments, the mRNA vaccine, or the pharmaceutical composition according to the invention comprises a LiNP nanoparticle comprising a cationic lipidoid of formula (b-V) and / or formula (b-VII): The present inventors have surprisingly found that certain ionizable lipidoids to be employed in the context of the present invention are particularly biodegradable, which may be particularly useful. Accordingly, in certain embodiments, the composition comprises an ionizable lipidoid, wherein said ionizable lipidoid comprises or consists of a compound of formula (b-VII) or a compound of formula (b-VIII), preferably a compound of formula (b-VII): formula (b-VIII) In the context of the present invention and without being bound be theory, the terms “cationic lipidoid”, “ionizable lipidoid”, and “lipidoid” are interchangeable. Similarly, the term “cationic lipid” and “ionizable lipid” are interchangeable herein. The herein provided composition, wherein said ionizable lipidoid is a compound of formula (b- V) and preferably: a) is an R isomer of the compound of formula (b-V), and / or b) is present at a molar ratio of about 22 mol% to about 65 mol%, preferably about 34 mol% to about 52 mol%, more preferably about 36 mol% to about 50 mol%, and most preferably about 43.1 mol%. The LiNP of the pharmaceutical composition may comprise one or more helper lipid(s) as described in the following. In particular, the herein described agents and reagents for delivering and / or introducing the mRNA into a target cell or a target tissue and the herein described lipids and lipidoids may be combined with one or more (e.g., two, three or four) further lipid(s) (like, for example, cholesterol, DPPC, DOPE and / or PEG-lipids (e.g. DMPE-PEG, DMG-PEG2000)). These further lipids may support the desired function of the therapeutic agents and the lipidoids (support and / or increase the delivery and / or introduction of RNA into the cell or tissue and improve transfection efficiency, respectively) and function as respective “helper lipids”. Particular examples of such “helper lipids” are cholesterol, DPPC, DOPE and / or PEG-lipids (e.g., DMPE-PEG, DMG-PEG (e.g., DMG-PEG2000). The further lipids (e.g., “helper lipids”) may also be part(s) of the herein disclosed complexes / particles. The skilled person is readily in the position to prepare complexes / particles in accordance with the invention. Examples of further lipids (e.g., “helper lipids”) are also known in the art. The skilled person is readily in the position to choose suitable further lipids (e.g., “helper lipids”) and ratios of the cationic lipidoid(s) and the further lipids (e.g. “helper lipids”). Such ratios may be molar ratios of [1-4 : 1-5], [3-4 : 4-6], [about 4 : about 5], [about 4 : about 5.3] of cationic lipidoid(s) : further lipid(s), (the narrower ranges are preferred). For example, the cationic lipidoid may be combined with three further lipids, like DPPC, cholesterol, and DMG-PEG2000, preferably at a molar ratio of ~8.0 : ~5.3 : ~4.4 : ~0.9, respectively, or, more particularly, 8.00 : 5.29 : 4.41 : 0.88, respectively. Preferably, the lipidoids according to formula (b-I), (b-Ib), (b-V), (b-VI) and (b-VII) are as described above and used with helper lipids DPPC and cholesterol and PEG-lipid DMG- PEG2000 at the molar ratios 8.00:5.29:4.41:0.88 for formulating lipidoid nanoparticles. In some embodiments, the mRNA vaccine, or the pharmaceutical composition according to the invention comprises a LiNP comprising the following components: a) a (m)RNA according to the invention, b) a cationic lipidoid of formula (b-I), (b-Ib) (b-V), (b-VI), (b-VII) or (b-VIII), and c) one or more helper lipid(s), optionally selected from: c1) DPPC, and / or c2) cholesterol, and / or c3) PEG-lipid DMG-PEG2000, optionally, components b), and c1-c3), are present, optionally component b) and c1)-c3) are at the molar ratios of about 8.0: about 5.3: about 4.4: about 0.9, respectively, optionally, the LNP comprises a triblock copolymer which contains one poly(propylene oxide) block and two poly(ethylene oxide) blocks as component (p) as defined above in vehicles. Accordingly, the compositions in accordance with the present invention may preferably comprise: a) one or more therapeutic agent(s) and / or one or more active agent(s); and b) a carrier, wherein said carrier comprises: i. an ionizable lipid and / or an ionizable lipidoid; ii. optionally one or more helper lipid(s); and iii. optionally one or more pharmaceutically acceptable excipient(s) or diluent(s); wherein the one or more (therapeutic and / or active) agent(s) may be defined as anywhere herein above or below, wherein the carrier may be defined as anywhere herein above or below. Accordingly, said ionizable lipid and / or said ionizable lipidoid may be defined as anywhere herein above or below. Accordingly, said one or more helper lipid(s) may be as defined anywhere herein above or below. Accordingly, said one or more pharmaceutically acceptable excipient(s) or diluent(s) may be defined as anywhere herein above or below. A composition in which the R-isomer of formula (b-V), i.e., formula (b-VI) is formulated with the lipids DPPC and cholesterol and PEG-lipid DMG-PEG2000 at the molar ratios 8.00 : 5.29 : 4.41 :0.88 is also referred herein as “Formulation I” or LF92. A composition in which the lipidoid of formula (b-VII) is formulated with the lipids DPPC and cholesterol and PEG-lipid DMG- PEG2000 at the molar ratios 8.00 : 5.29 : 4.41 : 0.88 is also referred herein as “Formulation II”. In some embodiments the LiNPs in the pharmaceutical composition of the invention comprises Formulation I and / or Formulation II. In some embodiments, the LiNP comprises Formulation I and / or Formulation II. The cationic lipidoid to mRNA ratios in the LiNP is controlled in terms of the mole ratio of nitrogen atoms of the cationic lipidoid (N) to phosphate groups in the mRNA (P) (N / P ratio). The other lipid components are calculated according to the target molar lipid proportions relative to the cationic lipidoid as discussed above, and may be for example 8.00 : 5.29 : 4.41 : 0.88 for cationic lipidoid, DPPC, cholesterol and PEG-lipid DMG-PEG2000, respectively. In some embodiments, the final N / P ratio of a cationic lipidoid having formula (b-I), (b-Ia), (b-V), (b-VI) and / or (b-VII) to one phosphate group of mRNA molecule, is preferably 4 to 44, preferably 4 to 16, more preferably 8 nitrogen atoms of a cationic lipidoid having formula (b-I), (b-Ia), (b-V), (b-VI) and / or (b-VII), per one phosphate group of the mRNA molecule. The lipid or lipidoid nanoparticles contained in the suspension formulation and in the aerosol in accordance with the invention preferably have a Z-average diameter in the range of 10 to 500 nm, more preferably in the range of 10 to 250 nm, still more preferably 20 to 200 nm. The indicated particle diameter is the hydrodynamic diameter of the particles, as determined by dynamic light scattering (DLS). Measurements are generally carried out at 25 °C. The polydispersity index of the nanoparticles contained in the suspension formulation and in the aerosol in accordance with the invention is preferably in the range of 0.05 to 0.4, more preferably in the range of 0.05 to 0.2. The polydispersity index can be determined by dynamic light scattering (DLS). Measurements are generally carried out at 25 °C In some embodiments, the compositions comprise a pharmaceutically acceptable carrier and / or an adjuvant. For example, the adjuvant can be alum, Freund’s complete adjuvant, a biological adjuvant or immunostimulatory oligonucleotides (such as CpG oligonucleotides). The pharmaceutically acceptable carriers (vehicles) useful in this disclosure are conventional. Remington’s Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compositions, and additional pharmaceutical agents. In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol, or the like as a vehicle. For solid compositions (for example, powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate. Optionally an mRNA vaccine of the invention is administered intramuscularly. Optionally an mRNA vaccine of the invention is administered intramuscularly, intradermally, subcutaneously by needle or by gene gun, or electroporation. Optionally, an mRNA of the invention, a vector of the invention, a pharmaceutical composition of the invention, or a vaccine of the invention is administered via the respiratory system. In some embodiments the administration is in a form which allows administration to the respiratory system via inhalation, nebulization, via a spray or droplets, e.g., a nasal spray or nasal droplets. The pharmaceutical composition may comprise a vehicle solution and / or a pharmaceutical acceptable carrier. The vehicle solution and / or the pharmaceutically acceptable carriers may include, but are not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The carrier and composition can be sterile, and the formulation suits the mode of administration. The composition can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. The composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, and magnesium carbonate. Any of the common pharmaceutical carriers, such as sterile saline solution or sesame oil, can be used. The medium can also contain conventional pharmaceutical adjunct materials such as, for example, pharmaceutically acceptable salts to adjust the osmotic pressure, buffers, preservatives and the like. Other media that can be used with the compositions and methods provided herein are normal saline and sesame oil. In the context of the present invention the term “pharmaceutical acceptable carrier” may be used synonymously with the term “pharmaceutically acceptable excipient or diluent”. Accordingly, the herein provided compositions generally comprise a carrier, wherein said carrier comprises:i. an ionizable lipid and / or an ionizable lipidoid;ii. optionally one or more helper lipid(s); andiii. optionally one or more pharmaceutically acceptable excipient(s) or diluent(s) (i.e., alsoreferred herein as “pharmaceutical acceptable carrier”. Accordingly, in the context of the present invention the carrier may optionally comprise one or more pharmaceutical acceptable carrier(s). As mentioned above, the carrier in the present invention may be a lipid nanoparticle (LNP), a lipidoid nanoparticle (LiNP), a liposome, a micelle, an emulsion, an Nanostructured Lipid Carrier (NLCs), or a Lipid-Drug Conjugate (LDC), preferably an LNP or an LiNP. Accordingly, for example said LNP may comprise one or more pharmaceutically acceptable excipient(s) or diluent(s). In the context of the present invention the carrier (i.e., for example the LNP or LiNP) may further be comprised in one or more pharmaceutically acceptable excipient(s) or diluent(s), which may be defined as anywhere herein above or below. Such pharmaceutically acceptable excipient(s) or diluent(s) may also be herein referred to as “vehicle solution” or as “pharmaceutically acceptable carrier”. The vehicle solution and / or the pharmaceutically acceptable carrier may comprise a triblock copolymer which contains one poly(propylene oxide) block and two poly(ethylene oxide) blocks. Preferably, the triblock copolymer is an A-B-A triblock copolymer which contains one poly(propylene oxide) block B of formula (p-1): (p-1)wherein s is an integer of 15 to 67, preferably 20 to 40, and two poly(ethylene oxides) blocks A of formula (p-2): wherein r is, independently for each block, an integer of 2 to 130, preferably 50 to 100, and more preferably 60 to 90. More preferably, the triblock copolymer has the following structure: wherein r and t are independently of each other integers of 2 to 130, preferably 50 to 100, and more preferably 60 to 90, and s is an integer of 15 to 67, preferably 20 to 40. Most preferably, Poloxamer P188 is used as the triblock copolymer. The vehicle solution and / or carrier may comprise the triblock copolymer dissolved therein. However, as will be appreciated by the skilled reader, this does not exclude the possibility that a certain amount of the copolymer molecules is adsorbed to the lipid or lipidoid nanoparticles which are contained in the composition and will be considered component (p) of the LNPs / LiNPs. Preferably, the composition for intramuscular administration or for aerosol formation comprises the triblock copolymer at a concentration of 0.05 to 5 % w / v (i.e. gram per 100 mL) preferably 0.1 to 2 %, based on the total volume of the composition. In addition to the triblock copolymer, other excipients may be present in the vehicle solution. Preferably, the vehicle solution further comprises at least one of sucrose and NaCl, more preferably sucrose and NaCl. The pharmaceutical formulation in accordance with the invention can be conveniently prepared e.g. by a method including adding the triblock copolymer to a suspension comprising a vehicle solution and the lipid or lipidoid nanoparticles, or including adding the lipid or lipidoid nanoparticles to a vehicle solution comprising the triblock copolymer. In the context of the present invention, the (therapeutic or active) agent or carrier may be encapsulated within / comprised in a hydrogel or a biocompatible matrix. Accordingly, the herein provided LiNP / LNP may be encapsulated within / comprised in a hydrogel or a biocompatible matrix. As mentioned above, the herein provided (pharmaceutical or cosmetic) compositions are particularly useful as they result in the local retention of the (therapeutic or active) agents comprised therein. Accordingly, in particular in the context of the herein provided pharmaceutical compositions this may be advantageous to e.g., cause expression of a therapeutically relevant mRNA at the local site of administration, and thereby for example reduced accumulation thereof in undesired off-target tissues or organs, such as the liver. Accordingly, in some embodiments the present invention provides for the means and methods for vaccination / immunization (using the herein provided composition). Accordingly, the present invention, inter alia, provides methods for the generation of systemic immunization through localized expression. In particular, the invention provides a mRNA vaccine comprising the carrier as described above. Accordingly, the present invention provides for a method of immunizing a subject which comprises administering to said subject an effective amount of an mRNA vaccine in a pharmaceutical composition, wherein said pharmaceutical composition comprises the composition as defined anywhere herein above or below, preferably immunizing a subject against a pathogen, against a cancer antigen, or a self- antigen. Optionally an mRNA used in the invention comprises an RNA sequence of SEQ ID NO: 3 or 4. Accordingly, the invention provides in one aspect an RNA or DNA sequence as defined in any one of SEQ ID NOs: 1-4. There is also provided according to the invention an isolated RNA or the complement thereof comprising a sequence of SEQ ID NO:3 or 4, or an RNA sequence which has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% nucleotide identity over its entire length with the RNA sequence of SEQ ID NO: 3 or 4. Advantageous immunogenic properties (for example, increased antibody response and / or increased breadth of immune response) may also be provided with mRNA immunogens encoding tethered coronavirus spike protein receptor binding domains. According to the invention there is also provided an isolated mRNA encoding a polypeptide comprising an amino acid sequence of a coronavirus spike protein receptor binding domain (RBD) linked at its C-terminal end directly, or by a linker amino acid sequence of up to 10 amino acid residues, to an amino acid sequence of a transmembrane domain.Optionally a nucleic acid, RNA or mRNA of the invention is a product of in-vitro transcription(IVT). Optionally a nucleic acid, RNA or mRNA of the invention comprises a polyadenylation (poly(A)) tail downstream of an open reading frame (ORF) encoding the polypeptide. Optionally a nucleic acid, RNA or mRNA of the invention comprises one or more modified nucleosides selected from any of the following: 2-thiouridine, 4′-thiouridine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1- methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio- dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy- pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, 5-iodo-uridine, 2′-O-methyl uridine, 5-methylcytidine,5-iodo-cytidine, N1-methyladenosine, N6-methyladenosine.Optionally the one or more modified nucleosides comprise a 1-methylpseudouridine (N1mψU) modification. Optionally the one or more modified nucleosides comprise at least one N1- methylpseudouridine (N1mψU) modification. Optionally the one or more modified nucleosides are 5-iodouridine and 5-iodocytidine. Optionally at least 50% of the uridines in the ORF have been modified. Optionally at least 50% of the uridines in the ORF have been modified to N1mψU. Optionally, 5 to 50% of the uridine nucleotides are 5-iodouridine and 5 to 50% of the cytidine nucleotides are 5-iodocytidine. Optionally, 5 to 50% of the uridine nucleotides are 2-thiouridine and 5 to 50% of the cytidine nucleotides are 5-methylcytidine. There is also provided according to the invention an mRNA vaccine vector comprising an mRNA of the invention. There is also provided according to the invention a nucleic acid, RNA or mRNA vaccine, which comprises a nucleic acid, RNA or mRNA of the invention, or a nucleic acid, RNA or mRNA vaccine vector of the invention, encapsulated in a lipid nanoparticle (LNP). There is further provided according to the invention a pharmaceutical composition comprising a nucleic acid, RNA or mRNA of the invention, a nucleic acid, RNA or mRNA vaccine vector of the invention, or a nucleic acid, RNA or mRNA vaccine of the invention, and a pharmaceutically acceptable carrier, excipient, or diluent. There is also provided according to the invention a nucleic acid, RNA or mRNA of the invention, nucleic acid, RNA or a mRNA vaccine vector of the invention, a nucleic acid, RNA or mRNA vaccine of the invention, or a pharmaceutical composition of the invention, for use as a medicament. There is further provided according to the invention a nucleic acid, an RNA or an mRNA of the invention, a nucleic acid, an RNA or an mRNA vaccine vector of the invention, a nucleic acid, an RNA or an mRNA vaccine of the invention, or a pharmaceutical composition of the invention, for use in the prevention, treatment, or amelioration of a coronavirus infection. There is also provided according to the invention use of a nucleic acid, an RNA or an mRNA of the invention, a nucleic acid, an RNA or an mRNA vaccine vector of the invention, a nucleic acid, an RNA or an mRNA vaccine of the invention, or a pharmaceutical composition of the invention, in the manufacture of a medicament for the prevention, treatment, or amelioration of a coronavirus infection. There is also provided according to the invention a method of inducing an immune response to a coronavirus in a subject, which comprises administering to the subject an effective amount of an mRNA of the invention, an mRNA vaccine vector of the invention, an mRNA vaccine of the invention, or a pharmaceutical composition of the invention. There is also provided according to the invention a method of immunizing a subject against a coronavirus, which comprises administering to the subject an effective amount of a nucleic acid, an RNA or an mRNA of the invention, an mRNA vaccine vector of the invention, a nucleic acid, an RNA or an mRNA vaccine of the invention, or a pharmaceutical composition of the invention. Optionally a method of the invention comprises administering to the subject a nucleic acid, an RNA or an mRNA of the invention, a nucleic acid, an RNA or an mRNA vaccine vector of the invention, a nucleic acid, an RNA or an mRNA vaccine of the invention, or a pharmaceutical composition of the invention, as part of a prime boost regimen. Optionally the coronavirus is a beta-coronavirus. Optionally the beta-coronavirus is a lineage B or C beta-coronavirus. Optionally the beta-coronavirus is a lineage B beta-coronavirus. Optionally the lineage B beta-coronavirus is SARS-CoV or SARS-CoV-2. Optionally the lineage C beta-coronavirus is MERS-CoV. Optionally the beta-coronavirus is a variant of concern (VOC). Optionally the beta-coronavirus is a SARS-CoV-2 VOC. Optionally the beta- coronavirus is a SARS-CoV-2 beta, gamma, delta, or omicron VOC. Optionally the subject is a human subject. There is also provided according to the invention a method of inducing an immune response to a coronavirus in a subject, which comprises administering to the subject an effective amount of an mRNA of the invention, a vector of the invention, a pharmaceutical composition of the invention, or a vaccine of the invention. There is also provided according to the invention a method of immunizing a subject against a virus, which comprises administering to the subject an effective amount of an mRNA of the invention, a vector of the invention, a pharmaceutical composition of the invention, or a vaccine of the invention. An effective amount is an amount to produce an antigen-specific immune response in a subject. Optionally, the method comprises administering an effective amount of an mRNA of the invention, a vector of the invention, a pharmaceutical composition of the invention, or a vaccine of the invention to a subject that has previously been seroconverted with an mRNA, a vector, a pharmaceutical composition or a vaccine, coding or comprising a full-length spike protein of a coronavirus. Optionally, the coronavirus is a Sarbecovirus. Optionally, the mRNA of the invention, the vector of the invention, the pharmaceutical composition of the invention or the vaccine of the invention comprises or consist of any one of SEQ ID NOs: 1-4. There is further provided according to the invention an (m)RNA of the invention, a vector of the invention, a pharmaceutical composition of the invention, or a vaccine of the invention, for use as a medicament. There is further provided according to the invention an (m)RNA of the invention, a vector of the invention, a pharmaceutical composition of the invention, or a vaccine of the invention, for use in the prevention, treatment, or amelioration of a coronavirus infection. There is also provided according to the invention use of an mRNA of the invention, a vector of the invention, a pharmaceutical composition of the invention, or a vaccine of the invention, in the manufacture of a medicament for the prevention, treatment, or amelioration of a coronavirus infection, including long covid. Optionally the coronavirus is a beta-coronavirus.Optionally the beta-coronavirus is a lineage B or C beta-coronavirus.Optionally the beta-coronavirus is a lineage B beta - coronavirus.Optionally the lineage B beta -coronavirus is SARS-CoV or SARS-CoV-2. Optionally the lineage C beta -coronavirus is MERS-CoV. Optionally an immune response is induced against more than one lineage B beta-coronavirus. Optionally an immune response is induced against SARS-1 and SARS-2 beta-coronavirus. Optionally an immune response is induced against SARS-1 and MERS beta-coronavirus. Optionally an immune response is induced against SARS-2 and MERS beta-coronavirus. Optionally an immune response is induced against SARS-1, SARS-2, and MERS beta-coronavirus. Optionally the beta- coronavirus is a variant of concern (VOC). Optionally a VOC such as lineage B1.248 (Brazil P1 lineage) VOC or lineage B1.351 (South Africa) VOC. Optionally the beta-coronavirus is a SARS-CoV-2 beta, gamma, or delta VOC. Optionally the beta-coronavirus is a SARS-CoV-2 beta VOC. Optionally the beta-coronavirus is a SARS-CoV- 2 gamma VOC. Optionally the beta-coronavirus is a SARS-CoV-2 delta VOC. Optionally the beta-coronavirus is a SARS-CoV-2 alpha VOC. Optionally the beta-coronavirus is a SARS- CoV-2 omicron VOC. Optionally the beta-coronavirus is SARS-CoV-2 omicron BA.1.Optionally the beta-coronavirus is a SARS-CoV-2 omicron BA.2. It can readily be determined whether an immune response has been induced to a beta- coronavirus using methods well-known to the skilled person. For example, a pseudotype neutralization assay as described in the example below may be used. Optionally the subject is a human subject. Said one or more polypeptide(s) (encoded by said mRNA) are not particularly limited however may for example be growth factors, Copper Peptides, or Cytokines. Preferred growth factors may for example be Epidermal Growth Factor (EGF) for stimulating skin growth and wound healing or Fibroblast Growth Factors (FGFs) to promote dermal fibroblasts proliferation and enhance skin elasticity. Preferred peptides may be Copper Peptides which may regenerate skin tissue by stimulating collagen production or Palmitoyl Pentapeptide-4 (i.e., Matrixyl) to reduce wrinkles and improve skin texture. In this context, Cytokines may preferably be Interleukins specifically modified to regulate inflammatory responses in the skin. Said mRNA may preferably be an mRNA encoding antioxidants or growth factors that can be produced endogenously at the site of application to enhance skin appearance and health. Said (one or more) mRNA (molecules) may also comprise an ORF encoding a protein, specifically a therapeutic protein, such as CFTR, Erythropoietin (EPO), Factor VIII, Factor IX, Chimeric Antigen Receptor (CAR) T-cell, Survivin (BIRC5) or a dominant-negative form thereof, P53, Vascular Endothelial Growth Factor (VEGF), Insulin, SARS-CoV-2 Spike protein, Alpha-synuclein, Dystrophin, Glucocerebrosidase (GCase), a cytokine such as Interleukin-2 (IL-2), Interleukin-10 (IL-10), Interleukin-12 (IL-12), an interferon (including, but not limited to interferon-alpha (IFN-α), interferon-beta (IFN-β), interferon-gamma (IFN-γ), and / or interferon lambda (IFNλ), such as interferon lambda 1 (IFN-λ1, also known as IL-29; (preferably human interferon lambda 1 (hIFNλ1), IFN-λ2 (also known as IL-28A), IFN-λ3 (also known as IL-28B), and / or IFN-λ4), Tumor Necrosis Factor-alpha (TNF-α), Granulocyte-macrophage colony- stimulating factor (GM-CSF), a primary ciliary dyskinesia protein or factor such as DNAH5, DNAH11, CCDC39, DNAI1, CCDC40, CCDC103, SPAG1, ZMYND10, ARMC4, CCDC151, DNAI2, RSPH1, CCDC114, RSPH4A, DNAAF1 (LRRC50), DNAAF2 (KTU), LRRC6, C21orf59, CCDC65 (DRC2), CCNO, DNAAF3, DNAH1, DNAH8, DNAL1, DRC1 (CCDC164), DYX1C1, DNAAF5 (HEATR2), HYDIN, MCIDAS, NME8 (TXNDC3), RSPH3, RSPH9, or FOXJ1. Preferably said (one or more) mRNA (molecules) may comprise an ORF encoding interferon lambda 1 (IFNλ1), more preferably human interferon lambda 1 (hIFNλ1). Preferably, the above protein, specifically the therapeutic protein, is a human protein. For example, CFTR may be human CFTR, Erythropoietin (EPO) may be human EPO, Factor VIII may be human Factor VIII, and so on. Exemplary sequences of an mRNA and DNA (molecules) comprising an ORF encoding human interferon lambda 1 (hIFNλ1) are shown in any one of SEQ ID NOs: 41, 42 or 43. SEQ ID NO: 42 is preferred herein. In accordance with the above, said one or more mRNA(s) may comprise an ORF encoding human interferon lambda 1 (hIFNλ1), preferably wherein said ORF comprises a nucleic acid sequence according to SEQ ID NO: 41,42 or 43 or a variant thereof having about 90% / 91% / 92% / 93% / 94% / 95% / 96% / 97% / 98% / 99% / 100% sequence identity to the nucleic acid sequence of SEQ ID NO: 41,42 and 43, respectively and wherein said variant sequence encodes functional hIFNλ1. (m)RNA (molecules) comprising an ORF encoding interferon, specifically interferon lambda, more specifically interferon lambda 1, most preferably human interferon lambda 1 (hIFNλ1) may be for use in the treatment or prevention of diseases or disorders, such as a viral-induced disorder, including a viral-induced respiratory disorder. The disease may be COPD, asthma, such as virus-driven exacerbation of chronic respiratory diseases like asthma, and / or a respiratory virus infection, e.g. seasonal and / or emerging virus infection. The virus which causes said viral-induced respiratory disorder is selected from the group consisting of rhinovirus, influenza virus, parainfluenza virus, metapneumo virus, respiratory syncytial virus, adenovirus and corona virus. The virus which causes said viral-induced respiratory disorder may a virus which enters cells via the ACE2 receptor and may be SARS- CoV, SARS-CoV-2 or HCoV-NL63. In this context, it is preferred that the mRNA is to be locally administered, in particular by delivery / local administration into the respiratory system, preferably wherein said delivery / local administration into the respiratory system is inhalation and / or (through) a nasal spray or aerosol. The inhalation may be inhalation of an aerosol comprising the mRNA. Accordingly, the present invention provides for a composition for use in the treatment and / or prevention of a disease or disorder, the treatment comprising local administration of the composition, the composition comprising: a) one or more therapeutic agent(s); and b) a carrier, wherein said carrier comprises: i. an ionizable lipidoid; ii. one or more helper lipid(s); and iii. one or more pharmaceutically acceptable excipient(s) or diluent(s); wherein said one or more therapeutic agent(s) are one or more mRNA(s), wherein said ionizable lipidoid is a lipidoid according to any one of formulas (b-VII), (b- V), or (b-VIII), preferably according to formula (b-VII), even more preferably the (R)- enantiomer of a compound according to formula (b-VII), and wherein one or more of the following apply: - a reduced amount of the composition or of the therapeutic agent is to be administered to achieve a similar therapeutic effect compared to the same therapeutic agent formulated in a composition that does not have prolonged retention at the site of administration; mRNA-based vaccines trigger an immune response after the synthetic mRNA which encodes viral antigens transfects human cells. The cytosolic mRNA molecules are then translated by the host’s own cellular machinery into specific viral antigens. These antigens may then be presented on the cell surface where they can be recognized by immune cells, triggering an immune response. The structural elements of a vaccine vector mRNA molecule are similar to those of natural mRNA, comprising a 5’ cap, 5’ untranslated region (UTR), coding region (for example, comprising an open reading frame encoding a polypeptide of the invention), 3’ UTR, and a poly(A) tail. The 5′ UTR (also known as a leader sequence, transcript leader, or leader RNA) is the region of an mRNA that is directly upstream from the initiation codon. This region is important for the regulation of translation of a transcript. In many organisms, the 5′ UTR forms complex secondary structure to regulate translation. The 5′ UTR begins at the transcription start site and ends one nucleotide (nt) before the initiation sequence (usually AUG) of the coding region. In eukaryotes, the length of the 5′ UTR tends to be anywhere from 100 to several thousand nucleotides long. The differing sizes are likely due to the complexity of the eukaryotic regulation which the 5′ UTR holds as well as the larger pre-initiation complex that must form to begin translation. The eukaryotic 5′ UTR may contain a Kozak consensus sequence (ACCAUG (initiation codon underlined), which contains the initiation codon AUG. An elongated Kozak sequence may be used: GCCACCAUG (initiation codon underlined). The 5′ and 3′ UTR elements flanking the coding sequence profoundly influence the stability and translation of mRNA, both of which are critical concerns for vaccines. These regulatory sequences can be derived from viral or eukaryotic genes and greatly increase the half-life and expression of therapeutic mRNAs. For example, a 5’UTR of an mRNA of the invention may comprise, with an initiation codon of the mRNA, a Kozak consensus sequence, or an elongated Kozak sequence. Optionally a 5’UTR of an mRNA of the invention comprises immediately upstream of an initiation codon sequence anyone of the following sequences: GGGAGACGCCACC (SEQ ID NO:11), or GGGAGACUGCCACC (SEQ ID NO:14). Optionally, a 5’UTR of an mRNA of the invention comprises immediately upstream of an initiation codon sequence a T7, T3, SP6, or K11 polymerase binding domain, a minimal UTR and a Kozak sequence as follows: GGGAGACGCCACC (SEQ ID NO:11), GAAGCGCCACC (SEQ ID NO:12), GGGACGCCACC (SEQ ID NO:13), GGGAGACTGCCACC (SEQ ID NO:14), GAAGCTGCCACC (SEQ ID NO:15), or GGGACTGCCACC (SEQ ID NO:16). A 5′ cap structure is required for efficient protein production from mRNA. Various versions of 5′ caps can be added during or after the transcription reaction using a vaccinia virus cappingenzyme, or by incorporating synthetic cap or anti-reverse cap analogues (see Pardi et al.,supra). Anti-Reverse Cap Analog (ARCA) is a cap analog used during in vitro transcription forthe generation of capped transcripts. ARCA is modified in a way that ensures incorporation in the forward orientation only. Anti-Reverse Cap Analog (ARCA) is a modified cap analog in which the 3' OH group (closer to m7G) is replaced with –OCH3: Conventional Cap Analog: R=H, m7G(5’)pppG; ARCA: R=CH3, 3’-0-Me-m7G(5’)pppG Because of this substitution, the RNA polymerase can only initiate transcription with the remaining hydroxyl group thus forcing ARCA incorporation in the forward orientation. As a result, unlike transcripts synthesized with conventional cap analogs, 100% of the transcripts synthesized with ARCA at the 5' end are translatable leading to a strong stimulatory effect on translation. The 3’ UTR may comprise a sequence for generation of a restriction site when in a vector, such as GAAUU. Alternatively, a 3’ UTR that may be used is 3’ UTR of CYBA (CCUCGCCCCGGACCUGCCCUCCCGCCAGGUGCACCCACCUGCAAUAAAUGCAGCGA AGCCGGGA, SEQ ID NO:8 and 26. The poly(A) tail also plays an important regulatory role in mRNA translation and stability; thus, an optimal length of poly(A) must be added to mRNA either directly from the encoding DNAtemplate, by using poly(A) polymerase (see Pardi et al., supra) or ligation after in-vitrotranscription. The poly(A) may have a length of 90 A nucleotides (A90) or more, 100 A nucleotides (A100) or more, 110 A nucleotides (A110) or more, 120 A nucleotides (A120) or more, 130 A nucleotides (A130) or more, 150 A nucleotides (A150) or more, 180 A nucleotides (A180) or more, 190 A nucleotides (A190) or more. An example of a suitable length of poly(A) tail is poly(~A120). The poly(A) tail may be a segmented poly(A) tail, as disclosed in WO 2020074642 A1, which is herein incorporated by reference. Optionally the segmented poly(A) may have the structure A55-65-S-A55-65wherein S is a single nucleotide selected from C,G, T or U. Optionally the poly(A) have the structure: A55-65-N-S4-N-A55-65, wherein N is anucleotide that is not adenine, and wherein S4are four nucleotides selected from A, C, G, T orU. .Optionally, the segmented poly(A) is a poly(A) of SEQ ID NO:35, SEQ ID NO:36, SEQ IDNO:37, SEQ ID NO:38, SEQ ID NO:39, or SEQ ID NO:40 or SEQ ID NOs: 45-50 encoding the RNA equivalent). The codon usage additionally has an impact on protein translation. Replacing rare codons with frequently used synonymous codons that have abundant cognate tRNA in the cytosol is a common practice to increase protein production from mRNA. Enrichment of G:C content constitutes another form of sequence optimization that has been shown to increase steady-state mRNA levels in vitro and protein expression in vivo (see Pardi et al., supra).Two major types of RNA are currently studied as vaccines: non-replicating mRNA and virally derived, self-amplifying RNA. While both types of vaccines share a common structure in mRNA constructs, self-amplifying RNA vaccines contain additional sequences in the coding region for RNA replication, including RNA-dependent RNA polymerases. BNT162b2 vaccine construct comprises a lipid nanoparticle (LNP) encapsulated mRNA molecule encoding trimerised full-length SARS2 S protein with a PP mutation (at residue positions 986-987). The mRNA is encapsulated in 80 nm ionizable cationic lipid nanoparticles. mRNA-1273 vaccine construct is also based on an LNP vector, but the synthetic mRNA encapsulated within the lipid construct encodes the full-length SARS2 S protein. US Patent No. 10,702,600 B1 (ModernaTX) describes betacoronavirus mRNA vaccines, including suitable LNPs for use in such vaccines. An (m)RNA vaccine of the invention may be formulated in a lipid nanoparticle. mRNA vaccines have several advantages in comparison with conventional vaccines containing inactivated (or live attenuated) disease-causing organisms. Firstly, mRNA-based vaccines can be rapidly developed due to design flexibility and the ability of the constructs to mimic antigen structure and expression as seen in the course of a natural infection. mRNA vaccines can be developed within days or months based on sequencing information from a target virus, while conventional vaccines often take years and require a deep understanding of the target virus to make the vaccine effective and safe. Secondly, these novel vaccines canbe rapidly produced. Due to high yields from in vitro transcription reactions, mRNA productioncan be rapid, inexpensive, and scalable. Thirdly, vaccine risks are low. mRNA does not contain infectious viral elements that pose risks for infection and insertional mutagenesis. Anti-vector immunity is also avoided as mRNA is the minimally immunogenic genetic vector, allowing repeated administration of the vaccine. The challenge for effective application of mRNA vaccines lies in cytosolic delivery. mRNA isolates are rapidly degraded by extracellular RNasesand cannot penetrate cell membranes to be transcribed in the cytosol. However, efficient invivo delivery can be achieved by formulating mRNA into carrier molecules, allowing rapid uptake and expression in the cytoplasm. To date, numerous delivery methods have been developed including lipid-, polymer-, or peptide-based delivery, virus-like replicon particle, cationic nanoemulsion, naked mRNAs, and dendritic cell-based delivery (each reviewed inWang et al., supra). cationic lipid nanoparticle (LNP) delivery is the most appealing andcommonly used mRNA vaccine delivery tool. Exogenous mRNA may be highly immunostimulatory. Single-stranded RNA (ssRNA) molecules are considered a pathogen associated molecular pattern (PAMP) and are recognized by various Toll-like receptors (TLR) which elicit a pro-inflammatory reaction. Although a strong cellular and humoral immune response is desirable in response to vaccination, the innate immune reaction elicited by exogenous mRNA may cause undesirable side-effects in the subject. The U-rich sequence of mRNA is a key element to activate TLR(Wang et al., supra). Additionally, enzymatically synthesized mRNA preparations containdouble stranded RNA (dsRNA) contaminants as aberrant products of the in vitro transcription(IVT) process. dsRNA is a potent PAMP and elicits downstream reactions resulting in theinhibition of translation and the degradation of cellular mRNA and ribosomal RNA (Pardi et al.,supra). Thus, the mRNA may suppress antigen expression and thus reduce vaccine efficacy. Studies over the past decade have shown that the immunostimulatory effect of mRNA can be shaped by the purification of IVT mRNA, the introduction of modified nucleosides, complexingthe mRNA with various carrier molecules (Pardi et al., supra), adding poly(A) tails or optimizingmRNA with GC-rich sequence (Wang et al., supra). Chemical modification of uridine is acommon approach to minimize the immunogenicity of foreign mRNA. Incorporation ofpseudouridine (ψU) and N1- methylpseudouridine (N1mψU) to IVT mRNA prevents TLRactivation and other innate immune sensors, thus reducing pro-inflammatory signaling in response to the exogenous mRNA. Such nucleoside modification also suppresses recognitionof dsRNA species (Pardi et al., supra) and can reduce innate immune sensing of exogenousmRNA translation (Hou et al. Nature Reviews Materials, 2021).Any above and below mentioned RNA modification may, in the context of the present invention apply to the herein above detailed mRNA vaccines and to any other RNA to be employed as a therapeutic or active agent in the context of the herein provided composition. Other nucleoside chemical modifications include, but are not limited to, 5-methylcytidine (m5C), 5-methyluridine (m5U), N1-methyladenosine (m1A), N6- methyladenosine (m6A), 2-thiouridine (s2U), and 5-methoxyuridine (5moU) (Wang et al., supra).An RNA of the invention may comprise an mRNA. An mRNA of the invention, a pharmaceutical composition, or a vector of the invention may be provided as part of an mRNA vaccine. A Vector of the invention may comprise the corresponding DNA sequence encoding for the peptide (s) and or protein(s) of interest and optionally immediately upstream of an initiation codon sequence anyone of the following sequences: TAATACGACTCACTATA GGGAGACGCCACC (SEQ ID NO:17), AATTAACCCTCACTAAA GGGAGACGCCACC (SEQ ID NO:18), ATTTAGGTGACACTATA GAAGCGCCACC (SEQ ID NO:19), AATTAGGGCACACTATA GGGACGCCACC (SEQ ID NO:20), TAATACGACTCACTATA GGGAGA CTGCCACC (SEQ ID NO:21), AATTAACCCTCACTAAAGGGAGA CTGCCACC (SEQ ID NO:22), ATTTAGGTGACACTATAGAAG CTGCCACC (SEQ ID NO:23),AATTAGGGCACACTATAGGGA CTGCCACC (SEQ ID NO:24), orCGCGCCUAGCAGUGUCCCAGCCGGGUUCGUGUCGCC (SEQ ID NO:25). The above sequences may be placed upstream of the ATG of any of the mRNA sequences of the invention, including the full-length spike (SEQ ID NO:10). An mRNA, a pharmaceutical composition, a vector, or a vaccine, of the invention may comprise one or more modified nucleosides. The one or more modified nucleosides may be present in an RNA or mRNA of the invention, or in mRNA of a pharmaceutical composition, a vector, or a vaccine, of the invention. Optionally, at least one chemical modification is selected from, 2-thiouridine, 4′-thiouridine, 5- methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl- pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2- thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1- methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5- methoxyuridine, 5-Iodo-uridine, and 2′-O-methyl uridine. In some embodiments, the chemical modification is in the 5-position of the uracil. In some embodiments, the chemical modification is a not N1-methylpseudouridine. In some embodiments, the chemical modification is not a N1-ethylpseudouridine. For example, an RNA or mRNA of the invention, or mRNA of a pharmaceutical composition, a vector, or a vaccine, of the invention, may comprise one or more of the following modified nucleosides: 5-methylcytidine (m5C);5-methyluridine (m5U); N1-methyladenosine (m1A); N6- methyladenosine (m6A); 2-thiouridine (s2U); 5-methoxyuridine (5moU); 5-iodouridine; and 5- iodocytidine. In some embodiments 100% of the uracil of the whole mRNA have a chemical modification. In some embodiments, 100% of the uracil in the open reading frame has a chemical modification. In some embodiments, a chemical modification is in the 5-position of the uracil. In some embodiments, a chemical modification is not a N1-methylpseudouridine. In some embodiments, 100% of the uracil of the mRNA have m5C. In some embodiments, 5 to 50% of the uridine nucleotides are 5-iodouridine and 5 to 50% of the cytidine nucleotides are 5- iodocytidine. In some embodiments, 5 to 50% of the uridine nucleotides are 5-iodouridine and 5 to 50% of the cytidine nucleotides are 5-iodocytidine. In some embodiments, 5 to 50% of the uridine nucleotides are 2-thiouridine and 5 to 50% of the cytidine nucleotides are 5- methylcytidine. RNA or mRNA of the invention, or mRNA of a pharmaceutical composition, a vector, or a vaccine, of the invention, may contain from about 1% to about 100% modified nucleotides (or nucleosides) (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide (or nucleoside), i.e., any one or more of A, G, U or C) or any intervening percentage (e.g., from 1% to 20%, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to 100%, from 90% to 95%, from 90% to 100%, and from 95% to 100%). Any remaining percentage is accounted for by the presence of unmodified A, G, U, or C. Optionally RNA or mRNA of the invention, or mRNA of a pharmaceutical composition, a vector, or a vaccine, of the invention, comprises an RNA molecule in which the nucleic acid sequence of the molecule is the same as that recited in the respective SEQ ID, but with 100% of the ‘U’s replaced by a nucleoside that do not cause frameshifting. In some embodiments the RNA does not contain N1mψU. RNA vaccines of the invention may be co-administered with an immunological adjuvant, for example MF59 (Novartis), TriMix, RNActive (CureVac AG), RNAdjuvant (again reviewed inWang et al., supra).The herein provided composition may be administered by any means and methods that are (routinely) applied in the art, accordingly, any suitable route of administration may be used. Methods of administration, specifically systemic and / or local administration, include, but are not limited to, intravenous, intradermal, intramuscular, intraperitoneal, subcutaneous, submucosal, mucosal, vaginal, rectal, intranasal, inhalation or oral. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions. Injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described. Routes for local administration in general include, for example, topical administration routes but also intradermal, transdermal, subcutaneous, submucosal, mucosal, aerosol delivery, or intramuscular injections or intralesional, intracranial, intrapulmonal, intracardial, and sublingual injections, preferably mucosal or aerosol delivery. As used herein, “aerosol delivery” refers to the administration of a composition via the airway to the nasal cavities and / or the lung and can thus herein be used interchangeably with nasal and / or “pulmonary drug delivery” or the like. In the context of the pharmaceutical compositions, administration routes may depend on the disease to be treated and / or prevented. In general, the herein provided pharmaceutical compositions are particularly useful in the treatment and / or prevention of a variety of diseases, accordingly, such diseases are not particularly limited. Such diseases may be selected from: genetic mutations, autoimmune diseases, metabolic imbalances, neurodegenerative disorders, degenerative disorders of the joints, arthrosis, arthritis, bone fractures, non-union fractures, solid tumor diseases (including soft tissue tumors, tumors of the heart, the lungs, the liver, the spleen, the kidneys, the brain, the oral cavity, the intestine, the skin, the pancreas, the prostate gland, the mammary glands, the ovaries, the urinary bladder, the bones (including osteosarcoma, chondrosarcoma, Ewing sarcoma)), tumors of the pleural and the peritoneal cavity, lung diseases including lung autoimmune diseases and ciliopathies, bone fractures or lesions thereof, tendon fractures or lesions thereof, joint infections, ligament ruptures, resistant Staphylococcus Aureus (MRSA) and / or Multidrug resistant Tuberculosis), viral infections, preferably a viral infection, more preferably a viral infection selected from Influenza (Flu), respiratory syncytial virus (RSV) Hepatitis A, Hepatitis B, Hepatitis C, Human Papillomavirus (HPV), Measles, Mumps, Rubella, Polio, Rabies, Varicella (Chickenpox), Shingles (Herpes Zoster), Rotavirus, Yellow Fever, Smallpox, Japanese Encephalitis, Tick-Borne Encephalitis (TBE), Dengue Fever, West Nile Virus, Chikungunya Virus, Ebola Virus, Marburg Virus, Human Immunodeficiency Virus (HIV), a coronavirus infection (including COVID-19), rhinovirus, influenza virus, parainfluenza virus, metapneumo virus, respiratory syncytial virus, adenovirus, more preferably rhinovirus, influenza virus, parainfluenza virus, metapneumo virus, respiratory syncytial virus, adenovirus, Hepatitis C and coronavirus, more preferably a viral infection, even more preferably a coronavirus infection, influenza, or Hepatitis C infection, most preferably a coronavirus infection. Depending on the disease to be treated and / or prevented the pharmaceutical composition may be administered to one or more solid tissue(s), solid organ(s) and / or solid anatomical region(s), preferably wherein said one or more solid tissue(s), solid organ(s) and / or solid anatomical region(s) are selected from the group consisting of the lungs, the nose, the heart, the brain, the spleen, the lymph nodes, the bones, the tendons, the skeletal muscles, the joints, the stomach, the small intestine, the large intestine, the kidneys, the bladder, the breast, the testes, the ovaries, the uterus, the spleen, the thymus, the brainstem, the cerebellum, the spinal cord, the eye, the ear, the tongue, the skin and / or tumors present in said one or more solid tissue(s), solid organ(s) and / or solid anatomical region(s). Compositions may be administered in any suitable manner, such as with pharmaceutically acceptable carriers. Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Preparations for parenteral administration include sterile aqueous or nonaqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions, or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer’s dextrose, dextrose and sodium chloride, lactated Ringer’s, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer’s dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, antioxidants, chelating agents, and inert gases and the like. Administration can be accomplished by single or multiple doses. The dose administered to a subject in the context of the present disclosure should be sufficient to induce a beneficial therapeutic response in a subject over time, or to inhibit or prevent infection. The dose required will vary from subject to subject depending on the species, age, weight and general condition of the subject, the severity of the infection being treated, the particular composition being used and its mode of administration. An appropriate dose can be determined by one of ordinary skill in the art using only routine experimentation. The present disclosure includes methods comprising administering an RNA vaccine to a subject in need thereof. The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the disease, the particular composition, its mode of administration, its mode of activity, and the like. The mRNA vaccine is typically formulated in dosage unit form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the mRNA vaccine may be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective, prophylactically effective, or appropriate imaging dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts. The effective amount of the mRNA, as provided herein, may be as low as 20 pg, administered for example as a single dose or as two 10 pg doses. In some embodiments, the effective amount is a total dose of 20 μg-300 μg or 25 μg-300 μg. For example, the effective amount may be a total dose of 20 μg, 25 μg, 30 μg, 35 μg, 40 μg, 45 μg, 50 μg, 55 μg, 60 μg, 65 μg, 70 μg, 75 μg, 80 μg, 85 μg, 90 μg, 95 μg, 100 μg, 110 μg, 120 μg, 130 μg, 140 μg, 150 μg, 160 μg, 170 μg, 180 μg, 190 μg, 200 μg, 250 μg, or 300 μg. In some embodiments, the effective amount is a total dose of 20 μg. In some embodiments, the effective amount is a total dose of 25 pg. In some embodiments, the effective amount is a total dose of 50 μg. In some embodiments, the effective amount is a total dose of 75 μg. In some embodiments, the effective amount is a total dose of 100 μg. In some embodiments, the effective amount is a total dose of 150 μg. In some embodiments, the effective amount is a total dose of 200 μg. In some embodiments, the effective amount is a total dose of 250 pg. In some embodiments, the effective amount is a total dose of 300 μg. An mRNA vaccine described herein can be formulated into a dosage form described herein, such as an intranasal, intratracheal, or injectable (e.g., intravenous, intraocular, intravitreal, intramuscular, intradermal, intracardiac, intraperitoneal, and subcutaneous). Optionally, an mRNA vaccine is formulated in an effective amount to produce an antigen specific immune response in a subject. In some embodiments, the effective amount is a total dose of 1 μg to 1000 μg, 25 μg to 1000 μg, or 50 μg to 1000 μg. In some embodiments, the effective amount is a total dose of 100 μg. In some embodiments, the effective amount is a dose of 25 μg administered to the subject a total of two times. In some embodiments, the effective amount is a dose of 100 μg administered to the subject a total of two times. In some embodiments, the effective amount is a dose of 400 μg administered to the subject a total of two times. In some embodiments, the effective amount is a dose of 500 μg administered to the subject a total of two times. Optionally a dosage of between 10 μg / kg and 400 μg / kg of the mRNA vaccine is administered to the subject. In some embodiments the dosage of the mRNA is 1-5 μg, 5-10 μg, 10-15 μg, 15-20 μg, 10-25 μg, 20-25 μg, 20-50 μg, 30-50 μg, 40-50 μg, 40-60 μg, 60-80 μg, 60-100 μg, 50-100 μg, 80-120 μg, 40-120 μg, 40-150 μg, 50-150 μg, 50-200 μg, 80-200 μg, 100-200 μg, 120-250 μg, 150-250 μg, 180-280 μg, 200-300 μg, 50-300 μg, 80-300 μg, 100-300 μg, 40-300 μg, 50-350 μg, 100-350 μg, 200-350 μg, 300-350 μg, 320-400 μg, 40-380 μg, 40-100 μg, 100- 400 μg, 200-400 μg, or 300-400 μg per dose. In some embodiments, the mRNA vaccine is administered to the subject by intradermal or intramuscular injection. In some embodiments, the mRNA vaccine is administered to the subject on day zero. In some embodiments, a second dose of the mRNA vaccine is administered to the subject on day twenty-one. In a strategy called “prime-boost”, a first dose of the mRNA vaccine is given as a priming step, followed by a second dose as a booster. The prime-boost strategy aims to provide a stronger overall immune response. The boost may be administered at least a day, at least a week, or at least two, three, four, five, six, or seven weeks, or at least two, three, four, five, or six months after the primer. For example, the boost may be administered at least three weeks after the primer. The similarity between amino acid or nucleic acid sequences is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are. Homologs or variants of a given gene or protein will possess a relatively high degree of sequence identity when aligned using standard methods. Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith and Waterman, Adv. Appl. Math.2:482, 1981; Needleman and Wunsch, J. Mol. Biol.48:443, 1970; Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A.85:2444, 1988; Higgins and Sharp, Gene 73:237-244, 1988; Higgins and Sharp, CABIOS 5:151-153, 1989; Corpet et al., Nucleic Acids’Research 16:10881-10890, 1988; and Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A.85:2444, 1988. Altschul et al., Nature Genet. 6:119-129, 1994. The NCBI Basic LocalAlignment Search Tool (BLASTTM) (Altschul et al., J. Mol. Biol.215:403-410, 1990) is availablefrom several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. Sequence identity between nucleic acid sequences, or between amino acid sequences, can be determined by comparing an alignment of the sequences. When an equivalent position in the compared sequences is occupied by the same nucleotide, or amino acid, then the molecules are identical at that position. Scoring an alignment as a percentage of identity is a function of the number of identical nucleotides or amino acids at positions shared by the compared sequences. When comparing sequences, optimal alignments may require gaps to be introduced into one or more of the sequences to take into consideration possible insertions and deletions in the sequences. Sequence comparison methods may employ gap penalties so that, for the same number of identical molecules in sequences being compared, a sequence alignment with as few gaps as possible, reflecting higher relatedness between the two compared sequences, will achieve a higher score than one with many gaps. Calculation of maximum percent identity involves the production of an optimal alignment, taking into consideration gap penalties. Suitable computer programs for carrying out sequence comparisons are widely available in the commercial and public sector. Examples include MatGat (Campanella et al., 2003, BMC Bioinformatics 4: 29;), Gap (Needleman & Wunsch, 1970, J. Mol. Biol.48: 443-453), FASTA (Altschul et al., 1990, J. Mol. Biol.215: 403-410;), Clustal W 2.0 and X 2.0 (Larkin et al., 2007, Bioinformatics 23: 2947-2948) and EMBOSS Pairwise Alignment Algorithms (Needleman & Wunsch, 1970, supra; Kruskal, 1983, In: Time warps, string edits and macromolecules: the theory and practice of sequence comparison, Sankoff & Kruskal (eds), pp 1-44, Addison Wesley). All programs may be run using default parameters. For example, sequence comparisons may be undertaken using the “needle” method of the EMBOSS Pairwise Alignment Algorithms, which determines an optimum alignment (including gaps) of two sequences when considered over their entire length and provides a percentage identity score. Default parameters for amino acid sequence comparisons (“Protein Molecule” option) may be Gap Extend penalty: 0.5, Gap Open penalty: 10.0, Matrix: Blosum 62. The sequence comparison may be performed over the full length of the reference sequence. A polypeptide encoded by an RNA of the invention may include one or more conservative amino acid substitutions. Conservative amino acid substitutions are those substitutions that, when made, least interfere with the properties of the original polypeptide, that is, the structure and especially the function of the protein is conserved and not significantly changed by such substitutions. Examples of conservative substitutions are shown for example as follows where original residue is substituted by a conservative residue as follows: Ala by Ser, Arg by Lys, Asn by Gln or His, Asp by Glu, Cys by Ser, Gln by Asn, Glu by Asp, His by Asn or Gln, Ile by Leu or Val, Lys by Arg or Gln, Met by Leu or Ile, Phe by Met or Leu or Tyr, Ser by Thr, Thr by Ser, Trp by Tyr, Tyr by Trp or Phe, Val by Ile or Leu. Conservative substitutions generally maintain (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. The substitutions which in general are expected to produce the greatest changes in protein properties will be non-conservative, for instance changes in which (a) a hydrophilic residue, for example, serine or threonine, is substituted for (or by) a hydrophobic residue, for example, leucine, isoleucine, phenylalanine, valine or alanine; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, for example, lysine, arginine, or histidine, is substituted for (or by) an electronegative residue, for example, glutamate or aspartate; or (d) a residue having a bulky side chain, for example, phenylalanine, is substituted for (or by) one not having a side chain, for example, glycine. The term “broadly neutralizing immune response” is used herein to mean an immune response elicited in a subject that is sufficient to inhibit (i.e. reduce), neutralize or prevent infection, and / or progress of infection, of a virus within the coronavirus family. Optionally a broadly neutralizing immune response is sufficient to inhibit, neutralize or prevent infection, and / or progress of infection, of more than one type of beta-coronavirus (for example, SARS-CoV, and SARS-CoV-2). Optionally a broadly neutralizing immune response is sufficient to inhibit, neutralize or prevent infection, and / or progress of infection, of more than one type of beta- coronavirus within the same beta-coronavirus lineage (for example, more than one type ofbeta-coronavirus within the subgenus Sarbecovirus, such as SARS-CoV, SARS-CoV-2, andBat SL-CoV-WIV1). Optionally a broadly neutralizing immune response is sufficient to inhibit, neutralize or prevent infection, and / or progress of infection, of coronaviruses of different beta- coronavirus lineages, such as lineage B (for example, SARS-CoV, and SARS-CoV-2) and lineage C (for example, MERS-CoV). Optionally a broadly neutralizing immune response is sufficient to inhibit, neutralize or prevent infection, and / or progress of infection, of most or all different beta-coronaviruses. Optionally a broadly neutralizing immune response is sufficient to inhibit, neutralize or prevent infection, and / or progress of infection, of most or all different viruses of the coronavirus family. Optionally a broadly neutralizing immune response is sufficient to inhibit, neutralize or prevent infection, and / or progress of infection, of most or all variants of concern (VOCs) of SARS-CoV-2, including Beta, Gamma, Delta, Omicron (BA.1). Optionally a broadly neutralizing immune response is sufficient to inhibit, neutralize or prevent infection, and / or progress of infection, of SARS-CoV, WIV16, RaTG13, SARS-CoV-2, SARS- CoV-2 Beta, SARS-CoV-2 Gamma, SARS-CoV-2 Delta, SARS-CoV-2 Omicron (BA.1). The immune response may be a humoral and / or a cellular immune response. A cellular immune response is a response of a cell of the immune system, such as a B-cell, T-cell, macrophage or polymorphonucleocyte, to a stimulus such as an antigen or vaccine. An immune response can include any cell of the body involved in a host defense response, including for example, an epithelial cell that secretes an interferon or a cytokine. An immune response includes, but is not limited to, an innate immune response or inflammation. Optionally a polypeptide encoded by an mRNA of the invention induces a protective immune response. A protective immune response refers to an immune response that protects a subject from infection or disease (i.e. prevents infection or prevents the development of disease associated with infection). Methods of measuring immune responses are well known in the art and include, for example, measuring proliferation and / or activity of lymphocytes (such as B or T cells), secretion of cytokines or chemokines, inflammation, or antibody production. Optionally a polypeptide encoded by an mRNA of the invention is able to induce the production of antibodies and / or a T-cell response in a human or non-human animal to which the mRNA has been administered (for example, expressed from an administered mRNA vaccine). The present invention further relates to a kit comprising the RNA and / or the pharmaceutical composition as detailed herein above. Unless otherwise defined, all terms of art, notations and other scientific terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this invention pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a difference over what is generally understood in the art. The techniques and procedures described or referenced herein are generally well understood and commonly employed using conventional methodologies by those skilled in the art. As appropriate, procedures involving the use of commercially available kits and reagents are generally carried out in accordance with manufacturer-defined protocols and conditions unless otherwise noted. As used herein “subject” means an individual. In general, a subject in the sense of the invention can be a mammal, preferably a human. As used herein, the term “therapy” includes both therapy and prevention of a disease or condition in a subject, such as prevention via vaccination and immunization against one or more pathogen antigens and / or one or more tumoral and / or pathological antigens. The disclosures in context of the methods described herein are disclosed as the correspondinguses mutatis mutandis. The disclosures in context of the uses described herein are disclosedas corresponding methods mutatis mutandis.Concentrations, amounts, and other numerical data may be expressed or presented herein in a “range” format. It is to be understood that such a range format is used merely for convenience and brevity and thus should be interpreted flexibly to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. As an illustration, a numerical range of "150 mg to 600 mg" should be interpreted to include not only the explicitly recited values of 150 mg to 600 mg, but to also include individual values and sub-ranges within the indicated range. Thus, included in this numerical range are individual values such as 150, 160, 170, 180, 190, ..., 580, 590, 600 mg and sub-ranges such as from 150 to 200, 150 to 250, 250 to 300, 350 to 600, etc. This same principle applies to ranges reciting only one numerical value. Furthermore, such an interpretation should apply regardless of the breadth of the range or the characteristics being described. The term “about” when used in connection with a numerical value is meant to encompass numerical values within a range having a lower limit that is 10% smaller than the indicated numerical value and having an upper limit that is 10% larger than the indicated numerical value. It is envisaged that every concrete value herein can be used with the term about (e.g. when a value X% is disclosed, the term about X% likewise is disclosed). As used herein the terms “RNA molecule” and “RNA” can be used interchangeably. In the context of the present invention, a number of individual elements, characterizing features, techniques and / or steps are disclosed. It is readily recognized that each of these has benefit not only individually when considered or used alone, but also when considered and used in combination with one another. Accordingly, to avoid exceedingly repetitious and redundant passages, this description has refrained from reiterating every possible combination and permutation. Nevertheless, whether expressly recited or not, it is understood that such combinations are entirely within the scope of the presently disclosed subject matter. As used herein, the singular forms “a,” “an”, and “the” include the plural referents unless the context clearly indicates otherwise. The terms “include”, “such as”, and “the like” are intended to convey inclusion without limitation, unless otherwise specifically indicated. As used herein, the term “or” is generally employed in its usual sense including “and / or” unless the content clearly dictates otherwise. The term “and / or” means one or all of the listed elements or a combination of any two or more of the listed elements. As used herein, the term “comprising” also specifically includes embodiments “consisting of” and “consisting essentially of” the recited elements, unless specifically indicated otherwise. All publications, patent applications, patents, and patent documents referred to in this document are incorporated by reference herein in their entirety, as though individually incorporated by reference. In the event of inconsistent usages between this document and those documents so incorporated by reference, the usage in the incorporated reference(s) should be considered supplementary to that of this document; for irreconcilable inconsistencies, the usage in this document is authoritative. Embodiments of the invention are described below, by way of example only, with reference to the accompanying drawings in which: Figure 1: Schematic of Firefly luciferase Flag-wildtype (FLAG-WT) and FLAG Fluc +1 frame shift (Fluc+1FS) open reading frames (ORFs) used in mRNA constructs for different modifications. Figure 2: A) Luciferase activity for FLAG-WT mRNAs, B) Western blot for FLAG-WT Fluc six hours post-transfection. Figure 3: Luciferase activity using Fluc+1FS mRNAs, B) Western blot for Fluc+1FS mRNAs, six hours post-transfection. Figure 4: Luciferase activity of modified mRNAs vs controls mRNAs using WT Fluc and Fluc+1FS mRNAs measured 6 hours post transfection for 31ng / well and 250 ng / well. UM: Unmodified), UT: Untranslated. Figure 5: Western blot of modified mRNAs-expressed WT Fluc and Fluc+1FS 6 hours post- transfection. UM: Unmodified, UT: Untranslated. Figure 6: Cytokine assay data of IP-10 from cells supernatant for WT-Fluc 24h post transfection.Figure 7: Luciferase activity of modified mRNAs vs controls mRNAs for N1mΨU, ΨU and m5Cmeasured 6 hours post transfection for 31ng / well and 250 ng / well. UM: Unmodified), UT: Untranslated.
[0002] List of SEQ ID NOs: SEQ ID NO: Description1 FLAG-WT Fluc mRNA sequence (DNA)2 Fluc+1FS mRNA sequence (DNA)3 FLAG-WT Fluc mRNA sequence (RNA)4 Fluc+1FS mRNA sequence (RNA)5 mRNA sequence coding for 5’-GAAG-MinUTR-CT6 mRNA sequence coding for 5’-MinUTR-CT7 mRNA sequence of 5´CYBA UTR8 mRNA sequence of 3´CYBA UTR10 spike protein of CoV11 5’-UTR sequence of an mRNA of the invention (Min UTR C)12 DNA sequence coding for 5’-GAAG-MinUTR-CT13 DNA sequence coding for 5’-MinUTR-CT14 5’-UTR sequence in the vector of the invention (Min UTR CT)15 5’-UTR sequence in the vector of the invention (5’-GAAG-Min UTR CT)16 5’-UTR sequence in the vector of the invention (5’-GGGA-Min UTR CT)17. DNA sequence of T7 promoter + MinUTR-C +Kozak18. DNA sequence of T3 promoter + Min UTR-C + Kozak19. DNA sequence of SP6 promoter + Min UTR-C + Kozak20 DNA sequence of K11 promoter + Min UTR-C + Kozak21 DNA sequence of T7 promoter + Min UTR-CT + Kozak22 DNA sequence of T3 promoter + Min UTR-CT + Kozak23 DNA sequence of SP6 promoter + Min UTR-CT + Kozak24 DNA sequence of K11 promoter + Min UTR-CT + Kozak25 DNA sequence of 5´CYBA UTR26 DNA sequence of 3´CYBA UTR35 sequence of segmented polyA (1) (DNA)36 sequence of segmented polyA (2) (DNA)37 sequence of segmented polyA (3) (DNA)38 sequence of segmented polyA (4) (DNA)39 sequence of segmented polyA (5) (DNA)40 sequence of segmented polyA (6) (DNA)41 sequence of codon optimized hIFN-lambda142 sequence of mRNA coding for hIFN-lambda143 sequence of mRNA coding for hIFN-lambda1 (without 3’ UTR)44 Elongated Kozak sequence45 sequence of segmented polyA (1) (RNA)46 sequence of segmented polyA (2) (RNA)47 sequence of segmented polyA (3) (RNA)48 sequence of segmented polyA (4) (RNA)49 sequence of segmented polyA (5) (RNA)50 sequence of segmented polyA (6) (RNA) Examples Certain embodiments of the invention are described with reference to the following examples, which are intended for the purpose of illustration only and are not intended to limit the scope of the generality of the description hereinbefore. Example 1 - In vitro investigation of ribosomal frameshifting between 100% N1mΨU and partial s2U / m5C modified luciferase mRNA constructs Methods mRNA Synthesis and purification of mRNA constructs The mRNAs were produced via in vitro transcription according to standard protocols with the choice of NTP modification selected for the experiment using T7 RNA polymerase, incubation for two hours at 37°C, followed by DNAse I treatment and incubation for 45 min at 37°C, followed by precipitation and dephosphorylation. Notably, for the in vitro transcribed and dephosphorylated constructs of this study, ultrafiltration was performed. mRNA concentration The mRNA concentration was measured using a NanoDrop 2000c at 260nm using an extinction coefficient of 0.025 (µg / mL)-1cm-1. mRNA nucleoside QC analysis via HPLC Nucleoside analysis was performed to characterize the nucleoside composition and the extent of each modified nucleotide substitution of their corresponding canonical nucleotide in all mRNAs and reference constructs in scope of this study. Briefly, the workflow included mRNA digestion by nuclease P1 and FastAP, preparation of buffers, preparation of HPLC system, running the system, and data analysis. For quantification area under the curve (AUCs) of all single nucleotides were separately compared to premeasured standard curves. Cultivation and seeding of A-549 cells Human alveolar epithelial cells A-549 were cultivated in MEM + GlutaMAXTMmedium, supplemented with heat-inactivated 10 % FBS, without the addition of PenStrep. The cells were split when they reached approximately 80-90% confluency and seeded for expansion. The calculated cell density at 100% confluency was 100,000 cells / cm2. DPBS and 0.05% Trypsin-EDTA were used to detach the cells and trypsinization was stopped using an equal amount of supplemented medium.24 hours prior to transfection, the cells were counted using a Countess Cell Counter and seeded at a density of 20,000 cells / well in 96-well plates with supplemented medium. Assembling Lipofectamine® MessengerMax® / mRNA complexes For this study, 400 µL of each MessengerMAX® / mRNA complexes (MessengerMAX®:mRNA 1:1) were generated. Briefly, a stock of 2000 µL of diluted MessengerMAX® stock was prepared by taking 50 µL of original MessengerMAX® stock and diluting it with 1950 µL of optiMEM, followed by vortexing for 2 seconds. 200 µL of diluted mRNA stock was then prepared by taking 5 µL of 1 mg / mL mRNA stock and diluting it into 195 µL optiMEM, followed by pipette mixing of the sample. Each diluted sample was left to rest for 5 minutes at room temperature. To form 400 µL of MessengerMAX® / mRNA complexes, 200 µL of diluted MessengerMAX® were added to 200 µL of diluted mRNA stock and left for 5 minutes at room temperature. For the 250 ng / well dose group, 20 µL of MessengerMAX® / mRNA complexes was added to each well. For the 31 ng / well dose group, the MessengerMAX® / mRNA complexes stock was diluted 1:8 v / v and 20 µL were added to each well. Transfection of A-549 Cells Cells were transfected with Lipofectamine® MessengerMAX® 24 hours after seeding. Luminescence luciferase readout (plate reader) For the luciferase assay, cells were lysed in 110 µL of Triton X-100 lysis buffer at room temperature for 20 minutes while shaking on an orbital shaker. After lysis, 50 µL of the undiluted cell lysate was transferred to a white 96-well flat-bottom plate. Luciferase luminescence activity was measured using a Tecan plate reader (1000 ms integration time). The luciferase assay was performed for the sample collected six hours post-transfection. FLAG Western Blot For the western blot, cells were lysed 6h after transfection in 60 µL of M-PER™ buffer per well, supplemented with 1x DNase I and 1x protease inhibitor. The plate was incubated for 30 minutes at room temperature to ensure complete lysis. Per well, 15 µL of Bolt™ Sample Buffer and 6 µL of Bolt™ Sample Reducing Agent were added. The samples were heated for 10 minutes at 70°C and 350 rpm. A total sample volume of 20 µL was then applied to the gel for SDS-PAGE. SDS-PAGE was run for 40 minutes at 200 V using a Bolt Mini Gel Tank, a Bolt™ 4-12 Bis-Tris Plus 10-well gel, and Bolt™ MOPS SDS Running Buffer. Proteins were transferred to membranes using the TransBlot® Turbo™ Transfer System via semi-dry blotting. The blot was run for 30 minutes using the standard Bio-Rad program. Turbo Transfer Pack Mini 0.2 μm PVDF membranes were used. Membranes were incubated for 15 min in EveryBlot Blocking Buffer (Biorad) before adding primary antibody. Western blots were stained over night at 4°C with monoclonal ANTI-FLAG® M2-Peroxidase (HRP) antibody produced in mouse (Sigma-Aldrich® A8592) diluted 1:1,000 or 1:3,333 in EveryBlot Blocking Buffer. For detection of FLAG tag the membranes were incubated 2 min at RT in 10 mL Immobilon Classico Western HRP substrate. All signals were visualized using the ChemiDoc™ MP System. Results The purpose of this study was to investigate whether ribosomal frameshifts can be observed after the transfection of A-549 cells with luciferase mRNAs partly modified with s2U and m5C, compared to 100% N1mΨU modification. For that purpose, A-549 cells were transfected with six different in vitro transcribed mRNAs including (see Fig.1):• Unmodified,• mRNA partly modified with s2U and m5C,• mRNA modified with 100% N1mΨUcoding for either:• in-frame firefly luciferase labeled with FLAG-protein tag (FLAG-WT Fluc, SEQ IDNO:1),• or Fluc+1FS encoding for an N-terminal segment of firefly luciferase with FLAG-proteintag followed immediately downstream by a +1 frameshifted C-terminal segment of firefly luciferase, which renders a truncated inactive N-terminal firefly luciferase when translated normally in frame (SEQ ID NO: 2). An experimental overview is provided in Fig.1 mRNA purity and size The six mRNA constructs were analyzed via capillary electrophoresis with a Fragment Analyzer to check for purity as well as identity via length. mRNA purity was checked using electropherograms and gel data for the six mRNA constructs of this study. Gels showed one band at the expected size, and no other visible bands and no visible impurities. Thus, all mRNAs were of comparable quality. Analysis of nucleotides incorporation To analyze the nucleoside composition of each modified mRNA, they were analyzed via HPLC- based Nucleoside Analysis. Data on the incorporation level is summarized in Table 1 and proof that mRNA variants composed of N1mΨU were modified to 100% while mRNA partly modified with s2U / m5C were all modified in a comparable range of approx.33% (m5C) and approx.3% (s2U). Table 1 – mRNA types, modifications and modification rate. Protein translation and frame-shift activity The A-549 cells transfected with both modified mRNAs encoding for in-frame FLAG-WT Fluc produced equivalent level of the expected in-frame active protein, detected via equivalent luciferase signals and both showed higher luciferase activity (and thus protein level) compared to unmodified mRNA (Fig.2 (A) and (B)). Contrastingly, the transfection of A-549 cells with modified mRNA encoding for Fluc+1FS led to translation of the expected shorter in-frame product, but in case of 100% N1mΨU-modified mRNA, an additional band at higher molecular weight was also observed in the western blot. The additional band was associated to mistranslation from +1 ribosomal frameshifting as is in alignment with Mulroney et al. Furthermore, the Luciferase assay revealed a significant increase in signal for 100% N1mΨU-modified Fluc+1FS mRNA. Both, the additional western blot band as well as the increased luciferase activity were not detected for unmodified mRNA as well as partly s2U / m5C-modified mRNA (Fig.3 (A) and (B)) suggesting that no frameshift occurred. In conclusion, based on the western blot and luciferase activity data, +1 frameshifting events were observed in 100% N1mΨU modified mRNA, but not detectable with the unmodified and partial s2U / m5C-modification, showing a surprising advantage for partly s2U / m5C-modified mRNA vs. 100% m1ΨU modified mRNA. This is even more surprising as Mulroney et al.discloses that mRNA comprising two combinations of cytidine and uridine modifications (N1mΨU + m5C) are very poorly translated. Example 2 - Reporter assay for +1 ribosomal frameshift suppression with partially modified mRNA – Titration comparison Experimental Design: mRNAs encoding a firefly luciferase reporter with a +1 ribosomal frameshift element (Fluc+1FS) and a wild-type control construct (WT Fluc) were generated by in vitro transcription (IVT) using T7 RNA polymerase as described in Example 1. The IVT mix included ATP and GTP at standard concentrations, and co-transcriptional capping was achieved using anti- reverse cap analog (ARCA). Following IVT, mRNAs were purified by silica membrane-based spin column purification. Quality control analysis for all mRNAs done measuring polyA length, pre-peak and post-peak smear. To determine the actual incorporation rates of modified nucleotides, HPLC analysis of enzymatically digested mRNA was performed. For partial modification, CTP was replaced with 5-methylcytidine triphosphate (m5CTP), and the UTP was replaced with 2-thiouridine triphosphate (s2UTP) in amounts to provide between 32.7 and 36.3 for m5CTP and between 0.7 and 0.8% for s2UTP. Table 1. Tested modified mRNAs NTP substitutions Cell cultivation and transformation was done as in Example 1. In short: A-549 cells were seeded at a density of 20,000 cells per well in a 96-well plate. After 24 hours, cells were transfected with either WT Fluc or Fluc+1FS mRNA using Lipofectamine® MessengerMax™ at a dose of 758 ng / cm² (250 ng / well) and 95 ng / cm² (31 ng / well). Cells were lysed at 6- and 24-hours post-transfection for analysis. For the luciferase assay, cells were lysed in 50 µL x1 Triton lysis buffer at room temperature and transferred to a white 96-well flat bottom plate, then shaken for 30 min on an orbital planner shaker. After lysis, 50 µL of Luciferase assay substrate (made of a proteinase inhibitor cocktail tablet dissolved in 50 mL of Luciferase Buffer) was added to each cell lysate well. For luciferase activity measurement a Tecan plate reader was used. The Luciferase Assay read out was performed for 6 hours post-transfection. FLAG Western Blot was done as described in Example 1. In short, cells were lysed with M- Per buffer containing DNase I and protease inhibitors, incubated for 30 min at room temperature. Samples were mixed with Bolt™ Sample Buffer and Reducing Agent, heated at 70 °C for 10 min, and 20 µL was loaded per lane for SDS-PAGE. Proteins were separated on a 4–12% Bis-Tris gel for 40 min at 200 V using MOPS buffer. Proteins were transferred to PVDF membranes using the TransBlot® Turbo™ semi-dry system for 30 min and current at 1 A. Blocking, Antibody Incubation and detection was done as described in Example 1: Membranes were blocked for 10 min, then incubated overnight at 4 °C with HRP-conjugated anti-FLAG (1:1,000) and anti-Vinculin (1:10,000) antibodies. Membranes were cut at ~90 kDa, and the Vinculin part was incubated with secondary HRP-conjugated anti-rabbit antibody (1:20,000) for 1 h at room temperature. Membranes were treated with HRP substrate and signals were detected using the ChemiDoc™ MP System. Cytokine assay: To account for immunogenic response of cells, A-549 cells supernatant of transfected cells constructs were analyzed using experimental protocol following direction Millipore / Merck kit´s protocol for IL-&, IP-10 and MCP-1 using a MagPix device. Data analysis was performed by Belysa software. Results for IP-10 are shown in Fig.6. Results and Analysis: This study confirms that although the incorporation of N1mΨU leads to high target protein expression, this modification, even at low incorporation %, leads to +1 ribosomal frameshifting events. This effect was confirmed by Luciferase assay and western blotting, which demonstrated a direct correlation between % N1mΨU incorporation and extent of frameshifting. On the other hand, confirming the results in Example 1, frameshifting was not detected for mRNA comprising a combination of s2U and m5C. Especially low frameshift was detected As shown in Fig.4, measured as 6 hours post transfection, the m5C / s2U-modified wildtype (WT) Fluc mRNA yielded strong luminescence signals, indicating high translation efficiency. The Fluc+1FS mRNA with the same modification yielded luminescence levels at background levels, comparable to unmmodifed and the untransfected controls, indicating no frameshift translation products. Surprisingly, it was noted that the use of a combination of m5C / s2U in the modified mRNA led to a higher protein expression that a comparable modification with m5C alone (see Fig.4 at 6 hours, at 250 and 31 ng / well). Western blotting was performed on cell lysates using antibodies targeting the FLAG epitope and firefly luciferase as shown in Fig.5. WT Fluc-transfected cells displayed the expected band at the size corresponding to full-length in-frame luciferase. In contrast, no band corresponding to the +1 frameshifted out-of-frame translation product was detectable in cells transfected with Fluc+1FS mRNA modified with m5C / s2U. As a positive control, mRNAs fully substituted with N1mΨU (100% U substitution) showed clear evidence of +1 frameshifting: both elevated luminescence from Fluc+1FS and appearance of an out-of-frame protein band by Western blot. Unmodified mRNA showed no frameshifting and behaved similarly to the m5C / s2U-modified sample. mRNA comprising a reduced incorporation of N1mΨU showed reduced frameshift. Interestingly, it was also observed that when using m5C alone better expression could be accomplished for percentage of modification below 100 % and above 17%. In particulat high expression and low frameshift was observed for the range between about 17% m5C and about 83% m5C, especially when compared with 100% m5C for which a lower expression was observed (see Fig.4). Cytokine assay data of IL-6, IP-10, and MCP1 from cells supernatant for the above described mRNAs was also analyzed, low immunogenicity was observed for all mRNA except for ummodified mRNA (UM) and for 16% m5C, as shown in Fig.6.) A low immunogenic response was also observed for the tested range between 16% and 83% m5c. The results show that the combination of m5C / s2U have a very low immunogenicity comparable to N1-methyl-pseudouridine and a lower average immunogenicity than a corresponding m5c solo modification. Conclusion: These results demonstrate that partial incorporation of m5C and s2U at the levels of around 33% of cytidines and 1% of uridines, respectively, is sufficient to suppress +1 ribosomal frameshifting, resulting in accurate and efficient protein translation equivalent to unmodified mRNA. Good expression, with absent frameshift mutation could also be observed for 39%, 63% and 83% m5C. Example 3: Dose-response analysis of N1mΨU-induced frameshifting vs. ΨU and ΨU / m5C modified mRNA. Experimental Design: This study aimed to compare the effects of pseudoridine (ΨU) and m5C / ΨU combinations on translational fidelity, focusing on +1 ribosomal frameshifting as shown in Table 2 below. mRNAs were generated from luciferase reporter constructs encoding either: 1. WT Fluc, with the full luciferase coding sequence in-frame and C-terminal FLAG tag. 2. Fluc+1FS, in which a +1 frameshift element was inserted to cause a frameshift near the C-terminus, resulting in an out-of-frame FLAG-tagged product. IVT was performed to obtain mRNA containing ^100% ΨU, and combinations of 100% ΨU with 100% m5C, both compared to an mRNacompriing both m5c and s2U. Table 2 – Test mRNAs mRNAs were transfected into A-549 cells in 96-well format at doses ranging from 95 to 758 ng / cm². Cells were lysed at 6 and 24 hours for analysis. Luciferase activity was quantified using a dual-luciferase reporter assay. In parallel, Western blotting was performed using anti-FLAG antibodies to detect the presence of frameshifted translation products. Results and Analysis: mRNAs containing 100% N1mΨU exhibited a +1 ribosomal frameshifting as shown in Fig.7. However ΨU showed a very reduced frameshift as measured in luminescence and undetectable frameshifted protein in both tested mRNA amounts of 31ng / well and 250 ng / well(Fig.7). At 100% N1mΨU, frameshifting was pronounced, with high Fluc+1FS activity and clear out-of-frame FLAG tag detection. In contrast, mRNAs containing 33% m5C and 3%s2U showed strong WT Fluc expression but no detectable +1FS signal in luciferase activity(Fig.7b) or Western blot at any dose tested. They also showed results identical to unmodified mRNA. Western blotting was performed on cell lysates using antibodies targeting the FLAG epitope and firefly luciferase and equivalent results (not shown). WT Fluc-transfected cells displayed the expected band at the size corresponding to full-length in-frame luciferase. In contrast, no band corresponding to the +1 frameshifted out-of-frame translation product was detectable in cells transfected with Fluc+1FS mRNA modified with m5C / s2U. Surprisingly, an equivalent protein expression of the WT protein and a significant reduction in frameshift could be observed for 100% of ΨU and for the combination of 100%ΨU with 100% m5C compared to 100% N1mΨU. As a positive control, mRNAs fully substituted with N1mΨU (100% U substitution) showed clear evidence of +1 frameshifting: both elevated luminescence from Fluc+1FS and appearance of an out-of-frame protein band by Western blot. Unmodified mRNA showed no frameshifting and behaved similarly to the m5C / s2U-modified sample. Conclusion: This example confirms that N1mΨU incorporation leads to frameshifting, while ΨU alone or the combination of ΨU with m5C at high incorporation levels prevents or reduces such translational errors. These results further support the use of ΨU m5C / ΨU-modified mRNA for improved translational fidelity. References
[0003] APPLICATION SEQUENCES DNA sequence coding for wild type FLAG-Luciferase – FLAG-WTFluc – 1784 nt / bp (SEQ ID NO:1) GGGAGACGCCACCATGGGTGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACA AGGATGACGATGACAAGCTCGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATCCGCTG GAAGATGGAACCGCTGGAGAGCAACTGCATAAGGCTATGAAGAGATACGCCCTGGTTCCTGGAACAAT TGCTTTTACAGATGCACATATCGAGGTGGACATCACTTACGCTGAGTACTTCGAAATGTCCGTTCGGT TGGCAGAAGCTATGAAACGATATGGGCTGAATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCT CTTCAATTCTTTATGCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACAT TTATAATGAACGTGAATTGCTCAACAGTATGGGCATTTCGCAGCCTACCGTGGTGTTCGTTTCCAAAA AGGGGTTGCAAAAAATTTTGAACGTGCAAAAAAAGCTCCCAATCATCCAAAAAATTATTATCATGGAT TCTAAAACGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCACATCTCATCTACCTCCCGGTTT TAATGAATACGATTTTGTGCCAGAGTCCTTCGATAGGGACAAGACAATTGCACTGATCATGAACTCCT CTGGATCTACTGGTCTGCCTAAGGGTGTCGCTCTGCCTCATAGAACTGCCTGCGTGAGATTCTCGCAT GCCAGAGATCCTATTTTTGGCAATCAAATCATTCCGGATACTGCGATTTTAAGTGTTGTTCCATTCCA TCACGGTTTTGGAATGTTTACTACACTCGGATATTTGATATGTGGATTTCGAGTCGTCTTAATGTATA GATTTGAAGAAGAGCTGTTTCTGAGGAGCCTTCAGGATTACAAGATTCAAAGTGCGCTGCTGGTGCCA ACCCTATTCTCCTTCTTCGCCAAAAGCACTCTGATTGACAAATACGATTTATCTAATTTACACGAAAT TGCTTCTGGTGGCGCTCCCCTCTCTAAGGAAGTCGGGGAAGCGGTTGCCAAGAGGTTCCATCTGCCAG GTATCAGGCAAGGATATGGGCTCACTGAGACTACATCAGCTATTCTGATTACACCCGAGGGGGATGAT AAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTTTGAAGCGAAGGTTGTGGATCTGGATACCGGGAA AACGCTGGGCGTTAATCAAAGAGGCGAACTGTGTGTGAGAGGTCCTATGATTATGTCCGGTTATGTAA ACAATCCGGAAGCGACCAACGCCTTGATTGACAAGGATGGATGGCTACATTCTGGAGACATAGCTTAC TGGGACGAAGACGAACACTTCTTCATCGTTGACCGCCTGAAGTCTCTGATTAAGTACAAAGGCTATCA GGTGGCTCCCGCTGAATTGGAATCCATCTTGCTCCAACACCCCAACATCTTCGACGCCGGTGTCGCAG GTCTTCCCGACGATGACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGAGCACGGAAAGACGATG ACGGAAAAAGAGATCGTGGATTACGTCGCCAGTCAAGTAACAACCGCGAAAAAGTTGCGCGGAGGAGT TGTGTTTGTGGACGAAGTACCGAAAGGTCTTACCGGAAAACTCGACGCAAGAAAAATCAGAGAGATCC TCATAAAGGCCAAGAAGGGCGGAAAGATCGCCGTGTGATGACGAAGAGCCACCGGGCAATACGAGCTC AAGCCAGTCTCGCTAG GGGAGA (italics): T7 initiation domain C(Bold): Minimal UTR C GCCACC (underlined): Kozac sequence DNA sequence coding for FLAG-Luciferase +1 frameshift mutant – Fluc+1FS – 1794 nt / bp (SEQ ID NO:2) GGGAGACGCCACCATGGGTGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACA AGGATGACGATGACAAGCTCGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATCCGCTG GAAGATGGAACCGCTGGAGAGCAACTGCATAAGGCTATGAAGAGATACGCCCTGGTTCCTGGAACAAT TGCTTTTACAGATGCACATATCGAGGTGGACATCACTTACGCTGAGTACTTCGAAATGTCCGTTCGGT TGGCAGAAGCTATGAAACGATATGGGCTGAATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCT CTTCAATTCTTTATGCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACAT TTATAATGAACGTGAATTGCTCAACAGTATGGGCATTTCGCAGCCTACCGTGGTGTTCGTTTCCAAAA AGGGGTTGCAAAAAATTTTGAACGTGCAAAAAAAGCTCCCAATCATCCAAAAAATTATTATCATGGAT TCTAAAACGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCACATCTCATCTACCTCCCGGTTT TAATGAATACGATTTTGTGCCAGAGTCCTTCGATAGGGACAAGACAATTGCACTGATCATGAACTCCT CTGGATCTACTGGTCTGCCTAAAGGTGTCGCTCTGCCTCATAGAACTGCCTGCGTGAGATTCTCGCAT GCCAGAGATCCTATTTTTCGGCAATCAAATCATTCCGGATACTGCGATTTTAAGTGTTGTTCCATTCC ATCACGGTTTTGGAATGTTTACTACACTCGGATATTTGATATGTGGATTTCGAGTCGTCTTAATGTAT AGATTTGAAGAAGAGCTGTTTCTGAGGAGCCTTCAGGATTACAAGATTCAAAGTGCGCTGCTGGTGCC AACCCTATTCTCCTTCTTCGCCAAAAGCACTCTGATTGACAAATACGATTTATCTAATTTACACGAAA TTGCTTCTGGTGGCGCTCCCCTCTCTAAGGAAGTCGGGGAAGCGGTTGCCAAGAGGTTCCATCTGCCA GGTATCAGGCAAGGATATGGGCTCACTGAGACTACATCAGCTATTCTGATTACACCCGAGGGGGATGA TAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTTTGAAGCGAAGGTTGTGGATCTGGATACCGGGA AAACGCTGGGCGTTAATCAAAGAGGCGAACTGTGTGTGAGAGGTCCTATGATTATGTCCGGTTATGTA AACAATCCGGAAGCGACCAACGCCTTGATTGACAAGGATGGATGGCTACATTCTGGAGACATAGCTTA CTGGGACGAAGACGAACACTTCTTCATCGTTGACCGCCTGAAGTCTCTGATTAAGTACAAAGGCTATC AGGTGGCTCCCGCTGAATTGGAATCCATCTTGCTCCAACACCCCAACATCTTCGACGCCGGTGTCGCA GGTCTTCCCGACGATGACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGAGCACGGAAAGACGAT GACGGAAAAAGAGATCGTGGATTACGTCGCCAGTCAAGTAACAACCGCGAAAAAGTTGCGCGGAGGAG TTGTGTTTGTGGACGAAGTACCGAAAGGTCTTACCGGAAAACTCGACGCAAGAAAAATCAGAGAGATC CTCATAAAGGCCAAGAAGGGCGGAAAGATCGCCGTGTAATTAACATGATGACGAAGAGCCACCGGGCA ATACGAGCTCAAGCCAGTCTCGCTAG GGGAGA (italics): T7 initiation domain C(Bold): Minimal UTR C GCCACC (underlined): Kozac sequence RNA sequence coding for wild type FLAG-Luciferase – FLAG-WTFluc – 1784 nt / bp (SEQ ID NO:3) GGGAGACGCCACCAUGGGUGACUACAAAGACCAUGACGGUGAUUAUAAAGAUCAUGACAUCGAUUACA AGGAUGACGAUGACAAGCUCGAAGACGCCAAAAACAUAAAGAAAGGCCCGGCGCCAUUCUAUCCGCUG GAAGAUGGAACCGCUGGAGAGCAACUGCAUAAGGCUAUGAAGAGAUACGCCCUGGUUCCUGGAACAAU UGCUUUUACAGAUGCACAUAUCGAGGUGGACAUCACUUACGCUGAGUACUUCGAAAUGUCCGUUCGGU UGGCAGAAGCUAUGAAACGAUAUGGGCUGAAUACAAAUCACAGAAUCGUCGUAUGCAGUGAAAACUCU CUUCAAUUCUUUAUGCCGGUGUUGGGCGCGUUAUUUAUCGGAGUUGCAGUUGCGCCCGCGAACGACAU UUAUAAUGAACGUGAAUUGCUCAACAGUAUGGGCAUUUCGCAGCCUACCGUGGUGUUCGUUUCCAAAA AGGGGUUGCAAAAAAUUUUGAACGUGCAAAAAAAGCUCCCAAUCAUCCAAAAAAUUAUUAUCAUGGAU UCUAAAACGGAUUACCAGGGAUUUCAGUCGAUGUACACGUUCGUCACAUCUCAUCUACCUCCCGGUUU UAAUGAAUACGAUUUUGUGCCAGAGUCCUUCGAUAGGGACAAGACAAUUGCACUGAUCAUGAACUCCU CUGGAUCUACUGGUCUGCCUAAGGGUGUCGCUCUGCCUCAUAGAACUGCCUGCGUGAGAUUCUCGCAU GCCAGAGAUCCUAUUUUUGGCAAUCAAAUCAUUCCGGAUACUGCGAUUUUAAGUGUUGUUCCAUUCCA UCACGGUUUUGGAAUGUUUACUACACUCGGAUAUUUGAUAUGUGGAUUUCGAGUCGUCUUAAUGUAUA GAUUUGAAGAAGAGCUGUUUCUGAGGAGCCUUCAGGAUUACAAGAUUCAAAGUGCGCUGCUGGUGCCA ACCCUAUUCUCCUUCUUCGCCAAAAGCACUCUGAUUGACAAAUACGAUUUAUCUAAUUUACACGAAAU UGCUUCUGGUGGCGCUCCCCUCUCUAAGGAAGUCGGGGAAGCGGUUGCCAAGAGGUUCCAUCUGCCAG GUAUCAGGCAAGGAUAUGGGCUCACUGAGACUACAUCAGCUAUUCUGAUUACACCCGAGGGGGAUGAU AAACCGGGCGCGGUCGGUAAAGUUGUUCCAUUUUUUGAAGCGAAGGUUGUGGAUCUGGAUACCGGGAA AACGCUGGGCGUUAAUCAAAGAGGCGAACUGUGUGUGAGAGGUCCUAUGAUUAUGUCCGGUUAUGUAA ACAAUCCGGAAGCGACCAACGCCUUGAUUGACAAGGAUGGAUGGCUACAUUCUGGAGACAUAGCUUAC UGGGACGAAGACGAACACUUCUUCAUCGUUGACCGCCUGAAGUCUCUGAUUAAGUACAAAGGCUAUCA GGUGGCUCCCGCUGAAUUGGAAUCCAUCUUGCUCCAACACCCCAACAUCUUCGACGCCGGUGUCGCAG GUCUUCCCGACGAUGACGCCGGUGAACUUCCCGCCGCCGUUGUUGUUUUGGAGCACGGAAAGACGAUG ACGGAAAAAGAGAUCGUGGAUUACGUCGCCAGUCAAGUAACAACCGCGAAAAAGUUGCGCGGAGGAGU UGUGUUUGUGGACGAAGUACCGAAAGGUCUUACCGGAAAACUCGACGCAAGAAAAAUCAGAGAGAUCC UCAUAAAGGCCAAGAAGGGCGGAAAGAUCGCCGUGUGAUGACGAAGAGCCACCGGGCAAUACGAGCUC AAGCCAGUCUCGCUAG GGGAGA (italics): T7 initiation domain C(Bold): Minimal UTR C GCCACC (underlined): Kozac sequence RNA sequence coding for FLAG-Luciferase +1 frameshift mutant – Fluc+1FS – 1794 nt / bp (SEQ ID NO:4) GGGAGACGCCACCAUGGGUGACUACAAAGACCAUGACGGUGAUUAUAAAGAUCAUGACAUCGAUUACA AGGAUGACGAUGACAAGCUCGAAGACGCCAAAAACAUAAAGAAAGGCCCGGCGCCAUUCUAUCCGCUG GAAGAUGGAACCGCUGGAGAGCAACUGCAUAAGGCUAUGAAGAGAUACGCCCUGGUUCCUGGAACAAU UGCUUUUACAGAUGCACAUAUCGAGGUGGACAUCACUUACGCUGAGUACUUCGAAAUGUCCGUUCGGU UGGCAGAAGCUAUGAAACGAUAUGGGCUGAAUACAAAUCACAGAAUCGUCGUAUGCAGUGAAAACUCU CUUCAAUUCUUUAUGCCGGUGUUGGGCGCGUUAUUUAUCGGAGUUGCAGUUGCGCCCGCGAACGACAU UUAUAAUGAACGUGAAUUGCUCAACAGUAUGGGCAUUUCGCAGCCUACCGUGGUGUUCGUUUCCAAAA AGGGGUUGCAAAAAAUUUUGAACGUGCAAAAAAAGCUCCCAAUCAUCCAAAAAAUUAUUAUCAUGGAU UCUAAAACGGAUUACCAGGGAUUUCAGUCGAUGUACACGUUCGUCACAUCUCAUCUACCUCCCGGUUU UAAUGAAUACGAUUUUGUGCCAGAGUCCUUCGAUAGGGACAAGACAAUUGCACUGAUCAUGAACUCCU CUGGAUCUACUGGUCUGCCUAAAGGUGUCGCUCUGCCUCAUAGAACUGCCUGCGUGAGAUUCUCGCAU GCCAGAGAUCCUAUUUUUCGGCAAUCAAAUCAUUCCGGAUACUGCGAUUUUAAGUGUUGUUCCAUUCC AUCACGGUUUUGGAAUGUUUACUACACUCGGAUAUUUGAUAUGUGGAUUUCGAGUCGUCUUAAUGUAU AGAUUUGAAGAAGAGCUGUUUCUGAGGAGCCUUCAGGAUUACAAGAUUCAAAGUGCGCUGCUGGUGCC AACCCUAUUCUCCUUCUUCGCCAAAAGCACUCUGAUUGACAAAUACGAUUUAUCUAAUUUACACGAAA UUGCUUCUGGUGGCGCUCCCCUCUCUAAGGAAGUCGGGGAAGCGGUUGCCAAGAGGUUCCAUCUGCCA GGUAUCAGGCAAGGAUAUGGGCUCACUGAGACUACAUCAGCUAUUCUGAUUACACCCGAGGGGGAUGA UAAACCGGGCGCGGUCGGUAAAGUUGUUCCAUUUUUUGAAGCGAAGGUUGUGGAUCUGGAUACCGGGA AAACGCUGGGCGUUAAUCAAAGAGGCGAACUGUGUGUGAGAGGUCCUAUGAUUAUGUCCGGUUAUGUA AACAAUCCGGAAGCGACCAACGCCUUGAUUGACAAGGAUGGAUGGCUACAUUCUGGAGACAUAGCUUA CUGGGACGAAGACGAACACUUCUUCAUCGUUGACCGCCUGAAGUCUCUGAUUAAGUACAAAGGCUAUC AGGUGGCUCCCGCUGAAUUGGAAUCCAUCUUGCUCCAACACCCCAACAUCUUCGACGCCGGUGUCGCA GGUCUUCCCGACGAUGACGCCGGUGAACUUCCCGCCGCCGUUGUUGUUUUGGAGCACGGAAAGACGAU GACGGAAAAAGAGAUCGUGGAUUACGUCGCCAGUCAAGUAACAACCGCGAAAAAGUUGCGCGGAGGAG UUGUGUUUGUGGACGAAGUACCGAAAGGUCUUACCGGAAAACUCGACGCAAGAAAAAUCAGAGAGAUC CUCAUAAAGGCCAAGAAGGGCGGAAAGAUCGCCGUGUAAUUAACAUGAUGACGAAGAGCCACCGGGCA AUACGAGCUCAAGCCAGUCUCGCUAG GGGAGA (italics): T7 initiation domain C(Bold): Minimal UTR C GCCACC (underlined): Kozac sequence RNA / DNA sequence coding for membrane couple spike domain of SARS-COV- 2 (SEQ ID NO:10): GGGAGACGCCACCATGTTCGTGTTCCTGGTGCTGCTGCCTCTGGTGTCCAGCCAGTGTGTGAACCTGA CCACCAGAACACAGCTGCCTCCAGCCTACACCAACAGCTTTACCAGAGGCGTGTACTACCCCGACAAG GTGTTCAGATCCAGCGTGCTGCACTCTACCCAGGACCTGTTCCTGCCTTTCTTCAGCAACGTGACCTG GTTCCACGCCATCCACGTGTCCGGCACCAATGGCACCAAGAGATTCGACAACCCCGTGCTGCCCTTCA ACGACGGGGTGTACTTTGCCAGCACCGAGAAGTCCAACATCATCAGAGGCTGGATCTTCGGCACCACA CTGGACAGCAAGACCCAGAGCCTGCTGATCGTGAACAACGCCACCAACGTGGTCATCAAAGTGTGCGA GTTCCAGTTCTGCAACGACCCCTTCCTGGGCGTCTACTACCACAAGAACAACAAGAGCTGGATGGAAA GCGAGTTCCGGGTGTACAGCAGCGCCAACAACTGCACCTTCGAGTACGTGTCCCAGCCTTTCCTGATG GACCTGGAAGGCAAGCAGGGCAACTTCAAGAACCTGCGCGAGTTCGTGTTTAAGAACATCGACGGCTA CTTCAAGATCTACAGCAAGCACACCCCTATCAACCTCGTGCGGGATCTGCCTCAGGGCTTCTCTGCTC TGGAACCCCTGGTGGATCTGCCCATCGGCATCAACATCACCCGGTTTCAGACACTGCTGGCCCTGCAC AGAAGCTACCTGACACCTGGCGATAGCAGCAGCGGATGGACAGCTGGTGCCGCCGCTTACTATGTGGG CTACCTGCAGCCTAGAACCTTCCTGCTGAAGTACAACGAGAACGGCACCATCACCGACGCCGTGGATT GTGCTCTGGATCCTCTGAGCGAGACAAAGTGCACCCTGAAGTCCTTCACCGTGGAAAAGGGCATCTAC CAGACCAGCAACTTCCGGGTGCAGCCCACCGAATCCATCGTGCGGTTCCCCAATATCACCAATCTGTG CCCCTTCGGCGAGGTGTTCAATGCCACCAGATTCGCCTCTGTGTACGCCTGGAACCGGAAGCGGATCA GCAATTGCGTGGCCGACTACTCCGTGCTGTACAACTCCGCCAGCTTCAGCACCTTCAAGTGCTACGGC GTGTCCCCTACCAAGCTGAACGACCTGTGCTTCACAAACGTGTACGCCGACAGCTTCGTGATCCGGGG AGATGAAGTGCGGCAGATTGCCCCTGGACAGACAGGCAAGATCGCCGACTACAACTACAAGCTGCCCG ACGACTTCACCGGCTGTGTGATTGCCTGGAACAGCAACAACCTGGACTCCAAAGTCGGCGGCAACTAC AATTACCTGTACCGGCTGTTCCGGAAGTCCAATCTGAAGCCCTTCGAGCGGGACATCTCCACCGAGAT CTATCAGGCCGGCAGCACCCCTTGTAACGGCGTGGAAGGCTTCAACTGCTACTTCCCACTGCAGTCCT ACGGCTTTCAGCCCACAAATGGCGTGGGCTATCAGCCCTACAGAGTGGTGGTGCTGAGCTTCGAACTG CTGCATGCCCCTGCCACAGTGTGCGGCCCTAAGAAAAGCACCAATCTCGTGAAGAACAAATGCGTGAA CTTCAACTTCAACGGCCTGACCGGCACCGGCGTGCTGACAGAGAGCAACAAGAAGTTCCTGCCATTCC AGCAGTTTGGCCGGGATATCGCCGATACCACAGACGCCGTTAGAGATCCCCAGACACTGGAAATCCTG GACATCACCCCTTGCAGCTTCGGCGGAGTGTCTGTGATCACCCCTGGCACCAACACCAGCAATCAGGT GGCAGTGCTGTACCAGGACGTGAACTGTACCGAAGTGCCCGTGGCCATTCACGCCGATCAGCTGACAC CTACATGGCGGGTGTACTCCACCGGCAGCAATGTGTTTCAGACCAGAGCCGGCTGTCTGATCGGAGCC GAGCACGTGAACAATAGCTACGAGTGCGACATCCCCATCGGCGCTGGCATCTGTGCCAGCTACCAGAC ACAGACAAACAGCCCCAGACGGGCCAGATCTGTGGCCAGCCAGAGCATCATTGCCTACACAATGTCTC TGGGCGCCGAGAACAGCGTGGCCTACTCCAACAACTCTATCGCTATCCCCACCAACTTCACCATCAGC GTGACCACAGAGATCCTGCCTGTGTCCATGACCAAGACCAGCGTGGACTGCACCATGTACATCTGCGG CGATTCCACCGAGTGCTCCAACCTGCTGCTGCAGTACGGCAGCTTCTGCACCCAGCTGAATAGAGCCC TGACAGGGATCGCCGTGGAACAGGACAAGAACACCCAAGAGGTGTTCGCCCAAGTGAAGCAGATCTAC AAGACCCCTCCTATCAAGGACTTCGGCGGCTTCAATTTCAGCCAGATTCTGCCCGATCCTAGCAAGCC CAGCAAGCGGAGCTTCATCGAGGACCTGCTGTTCAACAAAGTGACACTGGCCGACGCCGGCTTCATCA AGCAGTATGGCGATTGTCTGGGCGACATTGCCGCCAGGGATCTGATTTGCGCCCAGAAGTTTAACGGA CTGACAGTGCTGCCTCCTCTGCTGACCGATGAGATGATCGCCCAGTACACATCTGCCCTGCTGGCCGG CACAATCACAAGCGGCTGGACATTTGGAGCTGGCGCCGCTCTGCAGATCCCCTTTGCTATGCAGATGG CCTACCGGTTCAACGGCATCGGAGTGACCCAGAATGTGCTGTACGAGAACCAGAAGCTGATCGCCAAC CAGTTCAACAGCGCCATCGGCAAGATCCAGGACAGCCTGAGCAGCACAGCAAGCGCCCTGGGAAAGCT GCAGGACGTGGTCAACCAGAATGCCCAGGCACTGAACACCCTGGTCAAGCAGCTGTCCTCCAACTTCG GCGCCATCAGCTCTGTGCTGAACGATATCCTGAGCAGACTGGACCCTCCTGAGGCCGAGGTGCAGATC GACAGACTGATCACAGGCAGACTGCAGAGCCTCCAGACATACGTGACCCAGCAGCTGATCAGAGCCGC CGAGATTAGAGCCTCTGCCAATCTGGCCGCCACCAAGATGTCTGAGTGTGTGCTGGGCCAGAGCAAGA GAGTGGACTTTTGCGGCAAGGGCTACCACCTGATGAGCTTCCCTCAGTCTGCCCCTCACGGCGTGGTG TTTCTGCACGTGACATATGTGCCCGCTCAAGAGAAGAATTTCACCACCGCTCCAGCCATCTGCCACGA CGGCAAAGCCCACTTTCCTAGAGAAGGCGTGTTCGTGTCCAACGGCACCCATTGGTTCGTGACACAGC GGAACTTCTACGAGCCCCAGATCATCACCACCGACAACACCTTCGTGTCTGGCAACTGCGACGTCGTG ATCGGCATTGTGAACAATACCGTGTACGACCCTCTGCAGCCCGAGCTGGACAGCTTCAAAGAGGAACT GGACAAGTACTTTAAGAACCACACAAGCCCCGACGTGGACCTGGGCGATATCAGCGGAATCAATGCCA GCGTCGTGAACATCCAGAAAGAGATCGACCGGCTGAACGAGGTGGCCAAGAATCTGAACGAGAGCCTG ATCGACCTGCAAGAACTGGGGAAGTACGAGCAGTACATCAAGTGGCCCTGGTACATCTGGCTGGGCTT TATCGCCGGACTGATTGCCATCGTGATGGTCACAATCATGCTGTGTTGCATGACCAGCTGCTGTAGCT GCCTGAAGGGCTGTTGTAGCTGTGGCAGCTGCTGCAAGTTCGACGAGGACGATTCTGAGCCCGTGCTG AAGGGCGTGAAACTGCACTACACATGATGAGAATT DNA / mRNA sequence coding for 5’-MinUTR-C (SEQ ID NO:11) GGGAGACGCCACC Underlined: Kozak DNA / mRNA sequence coding for 5’-MinUTR-CT (SEQ ID NO:12) GAAGCGCCACC Underlined: Kozak DNA / mRNA sequence coding for 5’-MinUTR-CT (SEQ ID NO:13) GGGACGCCACC Underlined: Kozak DNA / mRNA sequence coding for 5’-MinUTR-CT (SEQ ID NO:14) GGGAGACTGCCACC Underlined: Kozak DNA / mRNA sequence coding for 5’-MinUTR-CT (SEQ ID NO:15) GAAGCTGCCACC Underlined: Kozak DNA / mRNA sequence coding for 5’-MinUTR-CT (SEQ ID NO:16) GGGACTGCCACC Underlined: Kozak DNA sequence upstream of start codon – T7 + MinUTR-C + Kozak (SEQ ID NO:17):TAATACGACTCACTATAGGGAGA CGCCACCCursive: T7 Promoter Underlined: Kozak DNA sequence upstream of start codon – T3 + C (SEQ ID NO:18):AATTAACCCTCACTAAAGGGAGA CGCCACCCursive: SP6 Promoter Underlined: Kozak DNA sequence upstream of start codon – SP6 + C (SEQ ID NO:19):ATTTAGGTGACACTATAGAAG CGCCACCCursive: SP6 Promoter Underlined: Kozak DNA sequence upstream of start codon – K11 + C (SEQ ID NO:20):AATTAGGGCACACTATAGGGA CGCCACCCursive: T3 Promoter Underlined: Kozak DNA sequence upstream of start codon – T7 + CT (SEQ ID NO:21): TAATACGACTCACTATA GGGAGACTGCCACC Cursive: T7 Promoter Underlined: Kozak DNA sequence upstream of start codon – T3 + CT (SEQ ID NO:22): AATTAACCCTCACTAAAGGGAGACTGCCACC Cursive: T3 Promoter Underlined: Kozak DNA sequence upstream of start codon – SP6 + CT (SEQ ID NO:23):ATTTAGGTGACACTATAGAAG CTGCCACCCursive: SP6 Promoter Underlined: Kozak DNA sequence upstream of start codon – K11 + CT (SEQ ID NO:24):AATTAGGGCACACTATAGGGA CTGCCACCCursive: T3 Promoter Underlined: Kozak DNA / mRNA sequence of 5’ UTR CYBA -37 nt- (SEQ ID NO:25): CGCGCCUAGCAGUGUCCCAGCCGGGUUCGUGUCGCC DNA / mRNA sequence of 3´ UTR CYBA (SEQ ID NO:26): CCTCGCCCCGGACCTGCCCTCCCGCCAGGTGCACCCACCTGCAATAAATGCAGCGAAGCCGGGA DNA / mRNA sequence of segmented polyA (1) (SEQ ID NO: 35) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Sequence of codon optimized hIFN-lambda1 (SEQ ID NO: 41) ATGGCTGCTGCTTGGACAGTGGTGCTGGTCACACTGGTGCTGGGACTTGCTGTGGCTGGACCTGTGCC TACCAGCAAGCCTACCACAACAGGCAAGGGCTGCCACATCGGCAGATTCAAGAGCCTGTCTCCTCAAG AGCTGGCCTCCTTCAAGAAAGCCAGGGACGCCCTGGAAGAGAGCCTGAAGCTGAAGAACTGGTCCTGC AGCAGCCCTGTGTTCCCCGGCAATTGGGATCTGAGACTGCTGCAAGTGCGCGAGAGGCCTGTTGCTCT GGAAGCTGAACTGGCCCTGACACTGAAGGTGCTGGAAGCCGCTGCTGGACCCGCACTGGAAGATGTTC TGGATCAGCCTCTGCACACCCTGCACCACATTCTGAGTCAGCTGCAGGCCTGTATCCAGCCTCAGCCT ACAGCTGGCCCTAGACCTAGAGGCAGACTGCACCACTGGCTGCACAGACTGCAAGAGGCCCCTAAGAA AGAGAGCGCCGGCTGTCTGGAAGCCAGCGTGACCTTCAACCTGTTCAGACTGCTGACCCGGGACCTGA AATACGTGGCCGATGGCAATCTGTGCCTGCGGACATCTACACACCCCGAGAGCACATGABold: start and stop codons.mRNA coding for hIFN-lambda1 (SEQ ID NO: 42) GGGAGACGCCACCATGGCTGCTGCTTGGACAGTGGTGCTGGTCACACTGGTGCTGGGACTTGCTGTGG CTGGACCTGTGCCTACCAGCAAGCCTACCACAACAGGCAAGGGCTGCCACATCGGCAGATTCAAGAGC CTGTCTCCTCAAGAGCTGGCCTCCTTCAAGAAAGCCAGGGACGCCCTGGAAGAGAGCCTGAAGCTGAA GAACTGGTCCTGCAGCAGCCCTGTGTTCCCCGGCAATTGGGATCTGAGACTGCTGCAAGTGCGCGAGA GGCCTGTTGCTCTGGAAGCTGAACTGGCCCTGACACTGAAGGTGCTGGAAGCCGCTGCTGGACCCGCA CTGGAAGATGTTCTGGATCAGCCTCTGCACACCCTGCACCACATTCTGAGTCAGCTGCAGGCCTGTAT CCAGCCTCAGCCTACAGCTGGCCCTAGACCTAGAGGCAGACTGCACCACTGGCTGCACAGACTGCAAG AGGCCCCTAAGAAAGAGAGCGCCGGCTGTCTGGAAGCCAGCGTGACCTTCAACCTGTTCAGACTGCTG ACCCGGGACCTGAAATACGTGGCCGATGGCAATCTGTGCCTGCGGACATCTACACACCCCGAGAGCAC ATGATTCG Underlined: T7 Polymerase start domain + Minimal UTR C. GCCACC in cursive: Kozak Sequence. Bold: Start (ATG) and stop (TGA) codons. mRNA coding for hIFN-lambda1 (without 3’ UTR) (SEQ ID NO: 43) GGGAGACGCCACCATGGCTGCTGCTTGGACAGTGGTGCTGGTCACACTGGTGCTGGGACTTGCTGTGG CTGGACCTGTGCCTACCAGCAAGCCTACCACAACAGGCAAGGGCTGCCACATCGGCAGATTCAAGAGC CTGTCTCCTCAAGAGCTGGCCTCCTTCAAGAAAGCCAGGGACGCCCTGGAAGAGAGCCTGAAGCTGAA GAACTGGTCCTGCAGCAGCCCTGTGTTCCCCGGCAATTGGGATCTGAGACTGCTGCAAGTGCGCGAGA GGCCTGTTGCTCTGGAAGCTGAACTGGCCCTGACACTGAAGGTGCTGGAAGCCGCTGCTGGACCCGCA CTGGAAGATGTTCTGGATCAGCCTCTGCACACCCTGCACCACATTCTGAGTCAGCTGCAGGCCTGTAT CCAGCCTCAGCCTACAGCTGGCCCTAGACCTAGAGGCAGACTGCACCACTGGCTGCACAGACTGCAAG AGGCCCCTAAGAAAGAGAGCGCCGGCTGTCTGGAAGCCAGCGTGACCTTCAACCTGTTCAGACTGCTG ACCCGGGACCTGAAATACGTGGCCGATGGCAATCTGTGCCTGCGGACATCTACACACCCCGAGAGCAC ATGA Underlined: T7 Polymerase start domain + Minimal UTR C. GCCACC in cursive: Kozak Sequence. Bold: Start (ATG) and stop (TGA) codons. Elongated Kozak sequence (SEQ ID NO: 44) GCCACCAUG Possible generic forms of poly(A) DNA / mRNA sequence of segmented polyA (8) A -S-A Wherein S is a single nucleotide selected from C, G, T or U DNA / mRNA sequence of segmented polyA (9) A -N-S N-A Wherein N a nucleotide that is not adenine. Wherein S nucleotides are any nucleotide A, C, G, T or U.
Claims
New PCT-Patent Application Ethris GmbH Vossius Ref.: AJ2720 PCT S3 CLAIMS 1. An RNA molecule comprising modified nucleosides, wherein the modified nucleosides reduce or do not cause ribosome stalling and / or reduce or do not cause ribosomal frameshifting during translation, preferably while maintaining translation efficiency.
2. The RNA molecule according to claim 1, wherein the modified nucleosides are selected from: a) 5-methylcytidine (m5C) and 2-thiouridine (s2U); or (b) 5-methylcytidine (m5C) and / or pseudouridine (ΨU); or b) N1-methyl-pseudouridine (N1mΨU), wherein the RNA comprises 1 to 99% N1mΨU.
3. The RNA molecule of according to claim 1 or 2, wherein: a) the RNA molecule comprises a combination of unmodified and modified nucleosides and wherein at least 5% of its cytidine nucleosides are m5C, and / or at least 0.05% of its uridine nucleosides are s2U, and / or b) The RNA molecule includes both unmodified and modified nucleosides, with at least one type of nucleoside (adenine (A), guanine (G), cytidine (C), or uridine (U)) having a mixture of modified and unmodified forms.
4. The RNA molecule according to anyone of claims 1 to 3, wherein the modified nucleosides are distributed across regions of the RNA that are known to be prone to ribosomal frameshift mutations during translation.
5. The RNA molecule according to any one of claim 1 to 4, wherein: a) between 0.1 % and 20% of the uridines are s2U, between 0.5% and 20%, preferably between 0.1% and 10%, more preferably between 0.5% and 5%, between 0.7% and 4%, between 1% and 3%, most preferably about 1% or 3%; and / or b) between 5% and 99% of the cytidines are m5C, preferably wherein between 5% and 95%, between 5% and 90%, between 5% and 85%, between 5% and 80%, between 5% and 75%, between 5% and 70%, between 5% and 65%, between 5% and 60%, between 5% and 55%, between 5% and 50%, more preferably between 10 % and 50%, between 15 % and 40%, more preferably between 20% and 50%, between 20 % and 40%,more preferably 30% to 37% , most preferably about 33% of the cytidines are m5C, optionally wherein the percentage of m5C in the RNA moleculeis based on optimization studies identifying the most effective distribution of modifications for maintaining translation fidelity; c) between 5% and 99% of the uridines are N1mΨU, preferably wherein between 5% and 95%, between 5% and 90%, between 5% and 85%, between 5% and 80%, between 5% and 75%, between 5% and 70%, between 5% and 65%, between 5% and 60%, between 5% and 55%, between 5% and 50%, more preferably between 10 % and 50%, between 15 % and 40%, more preferably between 20% and 50%, between 20 % and 40%, most preferably about 38% of the uridines are N1mΨU, optionally wherein the percentage of N1mΨU in the RNA molecule is based on optimization studies identifying the most effective distribution of modifications for maintaining translation fidelity.
6. The RNA molecule according to claim 5, wherein: a) between 0.25% and 4.5% of the uridines are s2U and / or wherein between 20% to 40% of the cytidines are m5C, more preferably about 3% of the uridines are s2U and / or wherein about 33 % of the cytidines are m5C, or b) wherein between 0.25% and 4.5% of the uridines are s2U and / or wherein between 20% to 40% of the cytidines are m5C, more preferably about 1% of the uridines are s2U and / or wherein about 33 % of the cytidines are m5C, or c) wherein between 80% and 100% of the uridines are pseudouridine and / or wherein between 80% to 100% of the cytidines are m5C, more preferably about 100% of the uridines are pseudouridine and / or wherein about 100% of the cytidines are m5C, or d) wherein between 20% to 95%, between 30% and 90%, preferably between 60% to 85%, more preferably 63% to 83%, most preferably about 83% of the cytidines are m5C, and wherein all nucleotides A, G and U are not modified.
7. The RNA molecule according to claim 1 to 6, wherein the RNA molecule comprises a gradient of modified nucleosides from 5’ to 3’, preferably wherein the RNA molecule comprises more modified nucleosides in the 5’ region and gradually less modified nucleosides towards the 3’ region.
8. The RNA molecule according to claim 7, wherein up to 99% of nucleosides in the 5' region are modified nucleosides, and wherein the percentage of modified nucleotides is decreasing to 50% to 25% in the 3' region, thereby enhancing translational initiation and fidelity.
9. The RNA molecule according to anyone of claims 1 to 8, further comprising sequence modifications to avoid motifs known to predispose the RNA molecule to induce frameshiftmutations and / or ribosome stalling, thereby synergistically reducing frameshift occurrences.
10. The RNA molecule according to anyone of claims 1 to 9, wherein the sequence modifications are selected from elimination or alteration of nucleotide repeats or sequences prone to ribosomal frameshifting during translation, and wherein the modified nucleosides and the sequence modifications result in a further reduction of ribosomal frameshifting thereby reducing frameshift mutations.
11. The RNA molecule according to claim 10, wherein the sequence modifications are selected from elimination or alteration of polypurine tracts or polypyrimidine tracts.
12. The RNA molecule according to anyone of claims 9 to 11, wherein the sequences prone to ribosomal frameshifting during translation are in the form of XXX XXY, X XXY Z, X XXX YZ, X XXY YYZ, where the ribosome slips forward by one nucleotide, and wherein X, Y and Z are independently a different and any nucleotide (A, U, G, or C or any modified nucleoside thereof).
13. The RNA molecule of any one of claims 1 to 12, wherein the RNA molecule further comprises sequence modifications that adjust or remove sequences known to form secondary structures that can interfere with the ribosomal scanning process, thereby enhancing translational accuracy.
14. The RNA molecule of any one of claims 1 to 13, wherein the RNA molecule is an mRNA and / or wherein the RNA molecule encodes one or more peptides and / or proteins, preferably wherein the one or more peptides and / or proteins are for therapeutic, diagnostic, or industrial uses.
15. Use of the RNA of any one of claims 1 to 14, for avoiding and / or reducing ribosome stalling and / or for reducing or avoiding ribosomal frameshifting.
16. The RNA of any one of claims 1 to 14, for use as a medicament.
17. The RNA of any one of claims 1 to 14, for use in the treatment or prevention of a disease associated with a deficient expression or lack of expression of the protein and / or peptide encoded by the RNA.
18. A pharmaceutical composition comprising the RNA molecule of any one of claims 1 to 14, and a pharmaceutically acceptable carrier.
19. A vaccine comprising the RNA molecule of any one of claims 1 to 14, and a pharmaceutically acceptable carrier.
20. The pharmaceutical composition of claim 18, or the vaccine of claim 19, wherein the RNA molecule exhibits no or reduced ribosomal frameshifting, thereby reducing or avoiding frameshift mutations during translation, optionally wherein the RNA molecule exhibits an improved safety profile of the RNA-based therapy, optionally wherein said ribosomal frameshifting, preferably during translation, is reduced compared to an mRNA with the same sequence and wherein 100% of uridines are 100% N1- Methylpseudouridine.
21. The RNA according to anyone of the previous claims wherein the RNA is: Non-coding RNA (ncRNA) and / or messenger RNA (mRNA), preferably mRNA, a linear mRNA or a self-replicating mRNA.
22. The RNA according to any of the previous claims wherein the RNA does not contain a frameshift-causing nucleoside and / or a nucleoside that causes ribosome stalling, preferably a nucleoside selected from Pseudouridine (Ψ), N6-methyladenosine (m6A), 5-iodouridine, Inosine (I), 2'-O-methylation (2'-O-Me), 5-hydroxymethylcytosine (hm5C), N1-methyladenosine (m1A), N7-methylguanosine (m7G), 3-methylcytidine (m3C), Wybutosine (yW), and / or N1-methyl-Pseudouridine, most preferably N1-methyl- Pseudouridine.
23. The RNA according to any of the previous claims, wherein: a) the RNA is synthesized using in vitro transcription techniques, and / or b) encoded proteins are designed for therapeutic, diagnostic, or industrial applications, and / or c) the encoded proteins and / or peptides include enzymes, structural proteins, or regulatory peptides and / or proteins necessary for metabolic or cellular functions, and / or d) wherein the encoded proteins and / or peptides include vaccine antigens for eliciting an immune response or combinations of one or more vaccine antigens and / or further adjuvant proteins / peptides, and / or e) the encoded proteins and / or peptides are reporter peptides or reporter proteins, preferably fluorescent or luminescent markers for use in imaging and tracking studies, and / or f) the encoded proteins and / or peptides are designed to be secreted or retained within specific tissues or cellular compartments.
24. The RNA according to any of the previous claims, wherein: a) the presence of N1-methyl-Pseudouridine reduces immune recognition and enhances translational fidelity, and / or b) the RNA is formulated into a delivery vehicle suitable for in vivo administration, such as lipid nanoparticles, and / or c) The RNA according to any of the previous claims, wherein the slippery site sequence is optimized for the host organism's ribosomal machinery, and / or d) the RNA is designed to express proteins with post-translational modifications, and / or e) the RNA sequence includes codon optimization for the intended host organism to maximize expression levels.
25. The RNA according to any of the previous claims, wherein: a) the RNA includes regulatory elements such as untranslated regions (UTRs) that modulate translation initiation and efficiency, and / or b) the RNA includes elements that enhance nuclear export and cytoplasmic localization for efficient translation.
26. A composition for use in the treatment and / or prevention of a disease or disorder, the composition comprising: a) an RNA according to the invention; and b) a carrier, wherein said carrier comprises: i. an ionizable lipid and / or an ionizable lipidoid; ii. optionally one or more helper lipid(s); and iii. optionally one or more pharmaceutically acceptable excipient(s) or diluent(s); optionally wherein said composition, remains localized at the site of administration and / or essentially does not exhibit systemic distribution throughout the patient's body.
27. A composition for use in the treatment and / or prevention of a disease, the treatment comprising local administration of the composition, the composition comprising: (a) an RNA according to the invention; and (b) a carrier, wherein said carrier comprises: i. an ionizable lipid and / or an ionizable lipidoid; ii. optionally one or more helper lipid(s); and iii. optionally one or more pharmaceutically acceptable excipient(s) and / or diluent(s); optionally wherein said composition has a prolonged retention at the site of administration; and / orwherein said therapeutic agent exerts its effect at the site of administration by prolonged retention at the site of administration.
28. The composition for use according to claim 26 or 27, wherein the carrier is a lipid nanoparticle (LNP), a lipidoid nanoparticle (LiNP), a liposome, a micelle, an emulsion, an Nanostructured Lipid Carrier (NLCs), or a Lipid-Drug Conjugate (LDC), preferably an LNP or an LiNP, and / or wherein the agent is formulated as a lipid nanoparticle (LNP), a lipidoid nanoparticle (LiNP), a liposome, a micelle, an emulsion, an Nanostructured Lipid Carrier (NLCs), or a Lipid-Drug Conjugate (LDC), preferably as an LNP or as an LiNP.
29. The composition for use or the cosmetic composition according to claim 28, wherein said ionizable lipidoid is a compound of formula (b-I):formula (b-I), preferably wherein the variables a, b, p, m, n and R1Ato R6Aare defined as follows: a is 1 and b is an integer of 2 to 4,or a is an integer of 2 to 4 and b is 1, p is 1 or 2, m is 1 or 2, n is 0 or 1, m+n is ≥ 2, and R1Ato R6Aare independently of each other selected from hydrogen, -CH2-CH(OH)-R7A, -CH(R7A)-CH2-OH, -CH2-CH2-(C=O)-O-R7A, - CH2CH2(C=O)-NH-R7A, or -CH2-R7A, wherein R7Ais selected from C3-C18 alkyl or C3-C18 alkenyl having one C-C double bond, a protecting group for an amino group, -C(NH)-NH2, a poly(ethylene glycol) chain, and a receptor ligand; wherein at least two residues among R1Ato R6Aare a group selected from -CH2- CH(OH)-R7A, -CH(R7A)-CH2OH, -CH2CH2(C=O)-O-R7A, -CH2CH2(C=O)-NH-R7A, or -CH2R7A,wherein R7Ais selected from C3-C18 alkyl or C3-C18 alkenyl having one C-C double bond; and wherein one or more of the nitrogen atoms comprised or contained in the compound of formula (b-I) are protonated to provide a compound carrying one or more positive charges.
30. The composition for use or the cosmetic composition according to claim 29, wherein R1Ato R6Aare independently of each other selected from -CH2-CH(OH)-R7A, -CH2-CH2- (C=O)-O-R7A, -CH2CH2(C=O)-NH-R7A, wherein R7Ais defined as in claim 38.
31. The composition for use according any one of claims 29 to 30, wherein said ionizable lipidoid comprises or consists of a compound of formula (b-V):
32. The composition for use or the cosmetic composition according to any one of claims 28 to 31, wherein said ionizable lipidoid comprises or consists of a compound of formula (b-VII) or a compound of formula (b-VIII), preferably a compound of formula (b-VII):
33. The composition for use or the cosmetic composition according to any one of claims 28 to 32, wherein said ionizable lipidoid is a compound of formula (b-V) and preferably: a) is an R isomer of the compound of formula (b-V), and / or b) is present at a molar ratio of about 22 mol% to about 65 mol%, preferably about 34 mol% to about 52 mol%, more preferably about 36 mol% to about 50 mol%, and most preferably about 43.1 mol%.
34. The composition for use or the cosmetic composition according to any one of claims 29 to 33, wherein said one or more helper lipid(s) are selected from the group consisting of a) to c): a) a phospholipid; b) a sterol; and / or c) a stealth lipid.
35. The composition for use or the cosmetic composition according to claim 34, wherein said composition comprises said ionizable lipid and / or said ionizable lipidoid, saidphospholipid, said sterol, and said stealth lipid, preferably at a molar ratio of about 8.0 : about 5.3 : about 4.4 : about 0.
9.
36. The composition for use or the cosmetic composition according to claim 34 or 35, wherein said phospholipid: a) is selected from phosphocholine (PC) or phosphoethanolamine (PE), preferably PC; b) has a carbon chain length of about 14 to about 18, most preferably about 16; and / or c) is present in a molar ratio of about 10 mol% to about 45 mol%, preferably about 18 mol% to about 39 mol%, more preferably about 24 mol% to about 33 mol%, and most preferably about 28.5 mol%.
37. The composition for use according to any one of claims 34 to 36, wherein said sterol: a) is cholesterol; and / or b) is present at a molar ratio of about 12 mol% to about 38.5 mol%, preferably about 15 mol% to about 32 mol%, more preferably about 19 mol% to about 29 mol%, and most preferably about 23.7 mol%.
38. The composition for use according to any one of claims 34 to 37, wherein said stealth lipid: a) is glycerolipid-based or PE lipid-based; b) has a carbon chain length of about 14 to about 18, most preferably about 14; c) comprises polyethylene glycol (PEG), and wherein said PEG has a molar mass of about 2000 to about 5000 Daton, most preferably about 2000 Dalton; and / or d) is present molar ratio of about 1.5 mol% to about 7 mol%, preferably about 3 mol% to about 6 mol%, more preferably about 4 mol% to about 5 mol%, and most preferably about 4.7 mol%.
39. The composition for use according to any one of claims 34 to 38, wherein: a) the phospholipid is preferably a phospholipid with a carbon chain length of about 12 to about 18, more preferably phospholipid with a carbon chain length of about 16, most preferably DPPC; b) the sterol is cholesterol; and / or c) the stealth lipid is a PEGylated lipid, preferably a PEGylated lipid with a molar mass of the PEG chain between about 2000 to about 5000 Dalton, morepreferably a PEGylated lipid with a molar mass of the PEG chain of about 2000 Dalton, most preferably the PEGylated lipid is DMG-PEG2000.
40. The composition for use according to any one of claims 28 to 39, wherein said composition further comprises a triblock copolymer as component (p) preferably wherein said triblock copolymer comprises about one poly(propylene oxide) block and about two poly(ethylene oxide) blocks.
41. The composition for use according to any one of claims 28 to 40, wherein said one or more therapeutic agent(s) is / are a) an anionic therapeutical substance and / or b) a nucleic acid, preferably an RNA, more preferably an mRNA, and if an mRNA is present, optionally additionally a miRNA, and / or an siRNA, even more preferably an mRNA, most preferably an mRNA comprising an open reading frame (ORF) encoding one or more polypeptide(s).
42. The composition for use according to claim 41, wherein said nucleic acid is a non- coding RNA such as an RNA able to produce a microRNA or wherein said nucleic acid is an mRNA comprising an ORF encoding one or more polypeptides, preferably wherein said one or more polypeptide(s) are one or more functional protein(s) and / or one or more antigen(s).
43. The composition for use according to claim 42, wherein said one or more antigen(s) is / are selected from the group consisting of a viral antigen, a bacterial antigen, a cancer and / or tumor associated antigen, and an allergen.
44. The composition for use according to any one of claims 41 to 43, wherein the mRNA comprises one or more features selected from the group consisting of the following: a) a CAP, preferably an anti-Reverse Cap Analog (ARCA) at its 5’ end,b) a 5’-untranslated region (5’-UTR) upstream of the ORF encoding said one ormore polypeptide(s), c) a 5’-UTR comprising an elongated Kozak sequence (GCCACCAUG; SEQ IDNO: 44) upstream of the initiation codon of the ORF, d) a 5’-UTR comprising proximately upstream of an initiation codon of the ORFany one of the following sequences: i. GGGAGACGCCACC (SEQ ID NO:11), ii. GAAGCGCCACC (SEQ ID NO:12),iii. GGGACGCCACC (SEQ ID NO:13), iv. GGGAGACTGCCACC (SEQ ID NO:14), v. GAAGCTGCCACC (SEQ ID NO:15), vi. GGGACTGCCACC (SEQ ID NO:16). e) a 3’-untranslated region (3’-UTR) downstream of the ORF encoding said one ormore polypeptide(s), and f) a 3’-UTR sequence downstream of the ORF encoding said one or morepolypeptide(s) selected from: i. GAAUU, and ii.CCTCGCCCCGGACCTGCCCTCCCGCCAGGTGCACCCACCTGCAAT AAATGCAGCGAAGCCGGGA (SEQ ID NO:26 or 8).
45. The composition for use according to any one of claims 41 to 44, wherein the mRNA is aproduct of in-vitro transcription (IVT).
46. The composition for use according to any one of claims 41 to 45, wherein the mRNA comprises a polyadenylation (poly(A)) tail downstream of the ORF encoding said one or more polypeptide(s).
47. The composition for use according to any one of claims 41 to 46, wherein the mRNA comprises one or more modified nucleosides.
48. The composition for use according to any one of claims 42 to 47, wherein the one or more modified nucleosides are selected from the group consisting of the following: 2-thiouridine, 4′-thiouridine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2- thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy- pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-iodo-uridine, 5-methoxyuridine, 2′-O-methyluridine, 5- iodocytidine, , 5-methylcytidine, N1-methyladenosine, pseudouridine, and N6-methyladenosine, preferably wherein the RNA contains less than 100% N1-methylpseudouridine or wherein the RNA does not contain N1-methylpseudouridine.
49. The composition for use according to any one of claims 28 to 48, wherein the composition is to be administered to a patient in need thereof.
50. The composition for use according to any one of claims 28 to 49, wherein said site of administration comprises a tissue, an organ, and / or an anatomical region, preferably said solid tissue, organ, and / or anatomical region is a solid tissue, organ and / or anatomical region, more preferably said solid tissue, organ, and / or anatomical region is selected from the group consisting of the lungs, the nose, the heart, the brain, the spleen, the lymph nodes, the bones, the tendons, the skeletal muscles, joints, the stomach, the small intestine, the large intestine, the kidneys, the bladder, the breast, the testes, the ovaries, the uterus, the spleen, the thymus, the brainstem, the cerebellum, the spinal cord, the eye, the ear, the tongue, the skin and / or tumors present in said solid tissues, organs and / or anatomical regions.
51. The composition for use according to any one of claims 28 to 50, further comprising one or more stabilizing agent(s), adjuvant(s), and / or immunomodulator(s).
52. The composition for use according to any one of claims 28 to 51, wherein said therapeutic agent or carrier is encapsulated within a hydrogel or a biocompatible matrix.
53. A method for preventing, treating, and / or ameliorating a disease, wherein the method comprises administering an effective amount of the composition as defined in any one of claims 26 to 52 to a subject.
54. Use of a composition as defined in any one of claims 26 to 52 in the manufacture of medicament for the prevention, treatment, and / or amelioration of a disease.
55. The composition for use according to any one of claims 26 to 52, the method of treatment according to claim 63, or the use of the composition according to claim 53, wherein the prevention of said disease comprises prevention by immunization, even more preferably in the prevention by local or systemic immunization.
56. The composition for use according to any one of claims 26 to 52 or claim 55, the method of treatment according to claim 53 or claim 55, or the use of the composition according to claim 54 or 55, wherein said disease is selected from: genetic mutations, autoimmune diseases, metabolic imbalances, neurodegenerative disorders, degenerative disorders of the joints, arthrosis, arthritis, bone fractures, non-union fractures, solid tumor diseases (including soft tissue tumors, tumors of the heart, the lungs, the liver, the spleen, the kidneys, the brain, the oral cavity, the intestine, the skin, the pancreas, the prostate gland, the mammary glands, the ovaries, the urinarybladder, the bones (including osteosarcoma, chondrosarcoma, Ewing sarcoma)), tumors of the pleural and the peritoneal cavity, lung diseases including lung autoimmune diseases and ciliopathies, bone fractures or lesions thereof, tendon fractures or lesions thereof, joint infections, ligament ruptures, resistant Staphylococcus Aureus (MRSA) and / or Multidrug resistant Tuberculosis), viral infections, preferably a viral infection, more preferably a viral infection selected from Influenza (Flu), respiratory syncytial virus (RSV) Hepatitis A, Hepatitis B, Hepatitis C, Human Papillomavirus (HPV), Measles, Mumps, Rubella, Polio, Rabies, Varicella (Chickenpox), Shingles (Herpes Zoster), Rotavirus, Yellow Fever, Smallpox, Japanese Encephalitis, Tick-Borne Encephalitis (TBE), Dengue Fever, West Nile Virus, Chikungunya Virus, Ebola Virus, Marburg Virus, Human Immunodeficiency Virus (HIV), a coronavirus infection (including COVID-19), most preferably a coronavirus infection.
57. The composition for use according to any one of claims 26 to 52 or claim 55 or 56, the method of treatment according to any one of claim 53 or claim 55 or 56, or the use of the composition according to any one of claims 54 to 56, wherein said composition is to be administered to one or more solid tissue(s), solid organ(s) and / or solid anatomical region(s), preferably wherein said one or more solid tissue(s), solid organ(s) and / or solid anatomical region(s) are selected from the group consisting of the lungs, the nose, the heart, the brain, the spleen, the lymph nodes, the bones, the tendons, the skeletal muscles, the joints, the stomach, the small intestine, the large intestine, the kidneys, the bladder, the breast, the testes, the ovaries, the uterus, the spleen, the thymus, the brainstem, the cerebellum, the spinal cord, the eye, the ear, the tongue, the skin and / or tumors present in said one or more solid tissue(s), solid organ(s) and / or solid anatomical region(s).
58. The composition for use according to any one of claims 26 to 52 or any one of claims 55 to 57, the method of treatment according to any one of claim 63 or any one of claims 55 to 57, or the use of the composition according to any one of claims 54 to 57, wherein the subject to be treated is a mammal, preferably a human.
59. The composition for use according to any one of claims 26 to 52 or any one of claims 55 to 58, the method of treatment according to any one of claim 53 or any one of claims 55 to 58, or the use of the composition according to any one of claims 54 to 58, wherein said composition is to be administered via intravenous, intradermal, subcutaneous, intramuscular, intratumoral injection, topical application, nasal delivery such asintranasal delivery, inhalation, preferably aerosol delivery, more preferably aerosol delivery with nebulizers, metered-dose inhalers (MDIs), or dry powder inhalers (DPIs).
60. A method of inducing an immune response in a subject, which comprises administering to said subject an effective amount of the composition as defined in or according to any one of claims 26 to 52 or any one of claims 55 to 59.
61. A method of immunizing a subject against a pathogen, which comprises administering to said subject an effective amount of an mRNA vaccine in a pharmaceutical composition, wherein said pharmaceutical composition comprises the composition as defined in or according to any one of claims 26 to 52 or any one of claims 55 to 59.
62. The method according to claim 61, wherein said mRNA vaccine is administered via intravenous, intradermal, subcutaneous, intramuscular, or intratumoral injection.
63. The composition for use according to any one of claims 26 to 52 or any one of claims 55 to 59, or the method according to any one of claims 60 to 62, wherein said pharmaceutically acceptable excipient or diluent further comprises a biodegradable or bioresorbable material, facilitating gradual release and local persistence of said therapeutic agent at the site of interest.
64. The composition for use according to any one of claims 26 to 52, any one of claims 55 to 59 or claim 63, or the method according to any one of claims 60 to 63, wherein said therapeutic agent is encapsulated within a biocompatible microneedle patch or implantable device, facilitating controlled and / or sustained release of said therapeutic agent at the site of interest.
65. The composition for use according to any one of claims 26 to 52, any one of claims 55 to 59 or claim 63 or 64, or the method according to any one of claims 60 to 64, wherein said mRNA further comprises a self-amplifying mRNA (saRNA) molecule, enabling enhanced protein or antigen production at the site of interest.
66. The composition for use according to any one of claims 26 to 52, any one of claims 55 to 59 or any one of claims 63 to 65, or the method according to any one of claims 60 to 65, wherein said one or more mRNA molecules comprise an ORF encoding CFTR, Erythropoietin (EPO), Factor VIII, Factor IX, Chimeric Antigen Receptor (CAR) T-cell, Survivin (BIRC5) or a dominant-negative form thereof, P53, Vascular Endothelial Growth Factor (VEGF), Insulin, SARS-CoV-2 Spike protein, Alpha-synuclein, Dystrophin, Glucocerebrosidase (GCase), a cytokine such as Interleukin-2 (IL-2),Interleukin-10 (IL-10), Interleukin-12 (IL-12), an interferon, Interferon-alpha (IFN-α), Interferon-beta (IFN-β), Interferon-gamma (IFN-γ), interferon lambda (IFNλ), such as interferon lambda 1 (IFN-λ1, also known as IL-29), IFN-λ2 (also known as IL-28A), IFN- λ3 (also known as IL-28B), and / or IFN-λ4, human interferon lambda 1 (hIFNλ1), Tumor Necrosis Factor-alpha (TNF-α), Granulocyte-macrophage colony-stimulating factor (GM-CSF), a primary ciliary dyskinesia protein or factor such as DNAH5, DNAH11, CCDC39, DNAI1, CCDC40, CCDC103, SPAG1, ZMYND10, ARMC4, CCDC151, DNAI2, RSPH1, CCDC114, RSPH4A, DNAAF1 (LRRC50), DNAAF2 (KTU), LRRC6, C21orf59, CCDC65 (DRC2), CCNO, DNAAF3, DNAH1, DNAH8, DNAL1, DRC1 (CCDC164), DYX1C1, DNAAF5 (HEATR2), HYDIN, MCIDAS, NME8 (TXNDC3), RSPH3, RSPH9, or FOXJ1, preferably wherein said one or more mRNA molecules comprise an ORF encoding interferon lambda 1 (IFNλ1), more preferably human interferon lambda 1 (hIFNλ1).
67. An RNA molecule comprising modified nucleosides, wherein the modified nucleosides are selected from: a) 5-methylcytidine (m5C) and 2-thiouridine (s2U); or (b) 5-methylcytidine (m5C) and / or pseudouridine (ΨU); or b) N1-methyl-pseudouridine (N1mΨU), wherein the RNA comprises 1 to 99% N1mΨU.
68. The RNA molecule of claim 67, wherein the RNA molecule comprises a combination of unmodified and modified nucleosides and wherein at least 5% of its cytidine nucleosides are m5C, and / or at least 0.05% of its uridine nucleosides are s2U.
69. The RNA molecule according to 67 or 68, wherein: between 0.1 % and 20% of the uridines are s2U, between 0.5% and 20%, preferably between 0.1% and 10%, more preferably between 0.5% and 5%, between 0.7% and 4%, between 1% and 3%, most preferably about 1% or 3%; and between 5% and 99% of the cytidines are m5C, preferably wherein between 5% and 95%, between 5% and 90%, between 5% and 85%, between 5% and 80%, between 5% and 75%, between 5% and 70%, between 5% and 65%, between 5% and 60%, between 5% and 55%, between 5% and 50%, more preferably between 10 % and 50%, between 15 % and 40%, more preferably between 20% and 50%, between 20 % and 40%,more preferably 30% to 37% , most preferably about 33% of the cytidines are m5C.
70. The RNA molecule according to any one of claims 67 to 69, wherein: between 1% and 3% are s2U; and 30% to 37%, most preferably about 33% of the cytidines are m5C.
Citation Information
Patent Citations
Compositions for introducing RNA into cells
EP3013964B1
Betacoronavirus mRNA vaccine
US10702600B1
Plasmid containing a sequence encoding an mRNA with a segmented poly(a) tail
WO2020074642A1
RNA with a combination of unmodified and modified nucleotides for protein expression
US20150290288A1
Compositions for introducing RNA into cells
US20170021036A1