Constitutive promoter and use thereof

By linking the constitutive promoter of the cotton Histone gene with a heterologous nucleotide sequence, a recombinant DNA construct was constructed, which solved the problem of low expression efficiency of heterologous nucleotide sequences in plant tissues. This enabled stable expression and efficient driving of exogenous genes in multiple plant tissues, improving the efficiency and accuracy of gene editing.

WO2026020350A1PCT designated stage Publication Date: 2026-01-29BEIJING DABEINONG BIOTECHNOLOGY CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/107194
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-07-24
Publication Date
2026-01-29

AI Technical Summary

Technical Problem

Existing technologies lack constitutive promoters that can efficiently express heterologous nucleotide sequences in plant tissues, making it difficult to meet the expression needs of multiple genes in different tissues and growth and development stages.

Method used

A constitutive promoter from the cotton Histone gene is provided, the nucleotide sequence of which includes SEQ ID NO:4 and is selected from a portion of SEQ ID NO:1. By operatively linking it with a heteronucleotide sequence, a recombinant DNA construct and expression cassette are constructed to achieve constitutive expression of the heteronucleotide sequence in plant tissues.

Benefits of technology

Stable expression of heterologous nucleotide sequences in most plant tissues and various cell types has been achieved, particularly in roots, stems, leaves, flowers, pods, and fruits, which efficiently drives the expression of exogenous genes and improves the efficiency and accuracy of gene editing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024107194_29012026_PF_FP_ABST
    Figure CN2024107194_29012026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a constitutive promoter and use thereof. The nucleotide sequence of the constitutive promoter comprises SEQ ID NO: 4, and the constitutive promoter is derived from SEQ ID NO: 1. The provided constitutive promoter shows activity in almost most tissues of plants and many types of cells, especially in roots, stems, leaves, flowers, pods, and fruits of plants. The constitutive promoter holds great promise for applications in plants.
Need to check novelty before this filing date? Find Prior Art

Description

Constitutive promoter and use thereof TECHNICAL FIELD

[0001] The present invention relates to a constitutive promoter and use thereof, in particular, to a constitutive promoter from cotton Histone gene and use thereof. BACKGROUND

[0002] One of the goals of plant genetic engineering is to produce plants with desirable characteristics or traits for agriculture, and the traits commonly desired include improved nutritional quality, increased yield, conferred disease and pest resistance, increased drought and stress tolerance, improved horticultural quality, and conferred herbicide resistance, etc. Current technological advances have enabled researchers to obtain exogenous polynucleotide molecules (e.g. heterologous or naturally derived genes) and integrate the polynucleotide molecules into plant genomes, and the genes are expressed in plant cells to exhibit corresponding traits. It is important that appropriate regulatory signals must be present in a suitable structure to obtain expression of the coding sequence of the newly inserted gene in plant cells. These regulatory signals typically include a promoter region, a 5' untranslated leader sequence, and a 3' transcription terminator / polyadenylation sequence.

[0003] Certain promoters are capable of directing RNA synthesis in a certain degree of expression level in most or all tissues and / or growth and development stages of plants, and these promoters are referred to as "constitutive promoters". Constitutive promoters can be divided into strong, medium, and weak promoters according to their effects on directing RNA synthesis. Since in many cases it is necessary to express a gene of interest in different tissues of a plant at the same time to obtain the desired gene function, constitutive promoters are particularly advantageous in the above-mentioned cases.

[0004] Some constitutive promoters that function in plant cells have been described in the prior art, including the promoter of soybean cell elongation factor gene Gm17gTsf1, the nopaline synthase (nos) promoter carried on the tumor-inducing plasmid of Agrobacterium tumefaciens, the octopine synthase (ocs) promoter, and the Caulimovirus promoters, such as the Caulimovirus (CaMV) 19S or 35S promoter, the CaMV 35S promoter with repeated enhancers, and the Figwort mosaic virus (FMV) 35S promoter, which have been applied in plant constructs for transgenic expression. Although some constitutive promoters have been obtained at present, there is still great interest in isolating more novel constitutive promoters that can control the expression of recombinant DNA constructs (or genes) at different levels, and be applied in gene stacking for the expression of multiple genes in the same transgenic plant.

[0005] SUMMARY

[0006] The present application aims to provide a new constitutive promoter and use thereof, which can enable efficient expression of a heterologous nucleotide sequence in plant tissues.

[0007] To achieve the above-mentioned object, the present application provides a constitutive promoter, the nucleotide sequence of which comprises SEQ ID NO: 4, and the constitutive promoter is derived from SEQ ID NO: 1.

[0008] Further, the present application provides a constitutive promoter, the nucleotide sequence of which comprises SEQ ID NO: 4 and is selected from at least a part of SEQ ID NO: 1.

[0009] Further, the present application provides a constitutive promoter, the nucleotide sequence of which is shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4.

[0010] To achieve the above-mentioned object, the present application further provides a recombinant DNA construct comprising the above-mentioned constitutive promoter operably linked to a heterologous nucleotide sequence of interest.

[0011] Further, the heterologous nucleotide sequence of interest encodes a protein of interest.

[0012] To achieve the above-mentioned object, the present application further provides an expression cassette comprising the above-mentioned recombinant DNA construct.

[0013] To achieve the above-mentioned object, the present application further provides a recombinant vector comprising the above-mentioned expression cassette.

[0014] To achieve the above-mentioned object, the present application further provides a method for expressing a heterologous nucleotide sequence of interest in a plant, comprising: stably integrating the heterologous nucleotide sequence of interest operably linked to the above-mentioned constitutive promoter into a plant cell.

[0015] Further, the plant is Arabidopsis thaliana, Brassica napus, tobacco, soybean, cotton, pepper, sugar beet, pumpkin, eggplant, Chinese cabbage, carrot, tomato, pea, spinach, potato or peanut.

[0016] Preferably, the heterologous nucleotide sequence of interest is expressed constitutively in plant tissues.

[0017] Further, the heterologous nucleotide sequence of interest encodes a protein of interest.

[0018] Preferably, the heterologous nucleotide sequence of interest encodes a herbicide-tolerance protein.

[0019] Preferably, the heterologous nucleotide sequence of interest encodes an insect-resistance protein.

[0020] To achieve the above object, the present application further provides a plant or part comprising the above constitutive promoter.

[0021] To achieve the above object, the present application further provides a method for obtaining processed agricultural products, comprising processing the harvest of the above plant or part to obtain processed agricultural products.

[0022] To achieve the above object, the present application further provides a use of the above constitutive promoter for constitutively expressing a heterologous nucleotide sequence of interest in plant tissues.

[0023] Preferably, the plant is Arabidopsis thaliana, Brassica, tobacco, soybean, cotton, pepper, sugar beet, pumpkin, eggplant, Chinese cabbage, carrot, tomato, pea, spinach, potato or peanut.

[0024] Further, the heterologous nucleotide sequence of interest encodes a protein of interest.

[0025] In the present application, the term "comprising" or "including" means "including but not limited to".

[0026] In the present application, the term "promoter" means a DNA regulatory region, usually containing a TATA box capable of directing RNA polymerase II to initiate RNA synthesis at an appropriate transcription initiation site of a particular coding sequence. In the present application, the term "gene" means any DNA fragment containing a region of DNA ("transcribed DNA region") that is transcribed into an RNA molecule (e.g., mRNA) under the control of appropriate regulatory regions (e.g., a plant expressible promoter region) in a cell. Thus, a gene can contain several operably linked DNA fragments, such as a promoter, a 5' untranslated leader sequence, a coding region, and a 3' untranslated region containing a polyadenylation site. An endogenous plant gene is a gene naturally found in a plant species. A recombinant DNA construct is any gene that is not normally found in a plant species, or any gene whose promoter is not associated with some or all of the transcribed DNA region or with at least another regulatory region of the gene in the natural situation.

[0027] The term "constitutive promoter" in the present invention refers to a special class of gene regulatory sequences. Under the control of this class of promoters, a certain degree of gene expression is exhibited by most or all tissues and / or growth and development stages of an organism. Constitutive promoters are used to express operably linked genes, heterologous nucleotide sequences of interest or gene editing system guide RNAs (gRNAs) in most cells of an organism, with a certain degree of persistence in the initiated expression. It is understood that for the term "constitutive promoter", there can be some variation in the absolute level of expression or activity between different tissues and developmental stages of an organism. The tissues are structural units in a plant body, which are formed by the aggregation of one or more types of cells with the same origin and performing the same function, such as protective tissue, transport tissue, nutritive tissue, mechanical tissue, meristem, several different tissues organically cooperate and closely contact to form different organs, and different organs cooperate with each other to more effectively complete the entire life activity process of the organism. The growth and development stages can be divided into embryonic stage, seedling stage, mature stage and senescence stage according to the differences in plant morphology and function.

[0028] The term "constitutive expression" in the present invention refers to the relatively stable and persistent expression of a gene or heterologous nucleotide sequence of interest in most or all tissues and / or growth and development stages of a plant, for example, the cauliflower mosaic virus CaMV 35S promoter, which can initiate high-intensity expression of foreign genes in most organs and different development periods in plants; constitutive promoters can also ensure the widespread expression of gRNAs in host cells, improving the efficiency and accuracy of gene editing. Isolated sequences having promoter activity and hybridizing to the promoter sequences of the present invention or fragments thereof under stringent conditions are included in the present invention. These sequences are at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to the sequences of the present invention. That is, the range of sequence identity is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity.

[0029] The present application provides a constitutive promoter whose nucleotide sequence comprises SEQ ID NO: 4 and is selected from at least a portion of SEQ ID NO: 1. SEQ ID NO: 4 is a fragment of SEQ ID NO: 1. With reference to SEQ ID NO: 1, the constitutive promoter of the present application can be extended to the 5' end or the 3' end of SEQ ID NO: 4 alone or to both the 5' end and the 3' end of SEQ ID NO: 4, but the length of the nucleotide sequence extended to both ends cannot exceed the 5' end or the 3' end of SEQ ID NO: 1 itself. In other words, the constitutive promoter whose nucleotide sequence is shown as SEQ ID NO: 4, or with reference to SEQ ID NO: 1, the constitutive promoter obtained by extending either end of SEQ ID NO: 4 arbitrarily and the length of the extension does not exceed the 5' end or the 3' end of SEQ ID NO: 1 itself are within the scope of the present application. Moreover, for such a constitutive promoter (with reference to SEQ ID NO: 1, the constitutive promoter obtained by extending either end of SEQ ID NO: 4 arbitrarily and the length of the extension does not exceed the 5' end or the 3' end of SEQ ID NO: 1 itself), the other nucleotide sequence included in the constitutive promoter other than SEQ ID NO: 4 does not affect the activity of the sequence of SEQ ID NO: 4 itself. The second embodiment of the present application also demonstrates that the prGhH3-3-04 promoter (SEQ ID NO: 4) has activity, and the prGhH3-3-01 promoter (SEQ ID NO: 1), the prGhH3-3-02 promoter (SEQ ID NO: 2), and the prGhH3-3-03 promoter (SEQ ID NO: 3) all have activity. Those skilled in the art can reasonably predict, based on the content described in the present application, that the constitutive promoters whose nucleotide sequence comprises SEQ ID NO: 4 and is selected from at least a portion of SEQ ID NO: 1 all have the same or similar activity as SEQ ID NO: 4.

[0030] The promoter sequences and fragments thereof of the present application, when assembled into a DNA construct to operably link the promoter sequence to a heterologous nucleotide sequence of interest, are used to genetically manipulate any plant. By "operably linked" is meant that the promoter sequence of the present application is functionally connected to a second sequence in which the promoter sequence initiates and modulates transcription of the DNA sequence corresponding to the second sequence. Generally, operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, are in the same reading frame. In this manner, the promoter nucleotide sequence and the heterologous nucleotide sequence of interest are provided together in an expression cassette to be expressed in a plant of interest. The expression cassette provides a number of restriction sites for insertion of the heterologous nucleotide sequence of interest which will be subject to transcriptional regulation by the regulatory regions comprising the promoter sequence of the present application. The expression cassette can additionally contain at least one additional gene to be co-transformed into the organism. Alternatively, the additional gene can be provided on a plurality of expression cassettes.

[0031] The expression cassette can additionally contain a selectable marker gene. Generally, the expression cassette will contain a selectable marker gene for selection of transformed cells. The selectable marker gene is used to select transformed cells or tissues. The selectable marker genes include, but are not limited to, genes encoding antibiotic resistance such as genes encoding neomycin phosphotransferase II (NPT) and hygromycin phosphotransferase (HPT), and genes conferring herbicide resistance such as phosphinothricin, bromoxynil, imidazolinone, and 2,4-dichlorophenoxyacetate (2,4-D) resistance genes.

[0032] The expression cassette includes the promoter sequence of the present application, a translation initiation region, a heterologous nucleotide sequence of interest, and a transcriptional and translational termination region functional in plants, transcribed in the 5'-3' direction. The heterologous nucleotide sequence of interest can be native or foreign or heterologous to the plant host. Alternatively, the heterologous nucleotide sequence of interest can be a native sequence or a selectively synthetic sequence. By "foreign" is meant that the introduced transcriptional initiation region does not exist naturally in the plant into which the transcriptional initiation region is introduced. For example, a recombinant DNA construct comprises a promoter sequence of the present application operably linked to a coding sequence that is different from the promoter sequence of the present application.

[0033] The termination region can be derived from the promoter sequence of the present application, from the operably linked heterologous nucleotide sequence of interest, or from another source. Conventional termination regions can be obtained from the Ti plasmid of Agrobacterium tumefaciens, such as the octopine synthase and nopaline synthase (NOS) termination regions.

[0034] In making the expression cassette, the various DNA fragments can be manipulated to provide the DNA sequences in the proper orientation and, in appropriate combinations, to provide the desired reading frame. In doing so, it can be necessary to employ linkers, adapters, restriction-site engineered sites, or other art-accepted methods. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, such as transitions and transversions, can be involved.

[0035] In appropriate cases, the heterologous nucleotide sequence of interest can be optimized to increase the amount of expression in the transformed plant. That is, the gene can be synthesized using plant-preferred codons to improve expression.

[0036] It is known in the art that additional sequence modifications can be made to increase the level of gene expression in a cellular host. These include but are not limited to removal of sequences encoding potential post-translational proteolytic cleavage sites, exon-intron splice site sequences, transposon-like repeats, and other sequences that can be deleterious to gene expression in a given host cell. The G-C content of the sequences can be adjusted to obtain a desired level of gene expression in a given host cell. The sequence can be modified to avoid predicted hairpin secondary structures.

[0037] In the expression cassette or recombinant vector, the expression cassette can additionally contain a 5' leader sequence. The leader sequence can function to improve the efficiency of transcription. The leader sequences are known in the art and include, but are not limited to, picornavirus leader sequences, such as the EMCV leader (the 5' noncoding region of the encephalomyocarditis virus); potyvirus leaders, such as the TEV leader, the MDMV leader, and the human immunoglobulin heavy chain binding protein (BiP); the untranslated leader sequence from the mRNA of the coat protein of alfalfa mosaic virus (AMV RNA 4); the tobacco mosaic virus (TMV) leader; and the maize chlorotic mottle virus (MCMV) leader. Other art-recognized elements that improve transcription efficiency, such as introns, can also be used.

[0038] The promoter sequence of the present application can be used to initiate transcription of an antisense construct that is at least partially complementary to the messenger RNA (mRNA) of the heterologous nucleotide sequence of interest. The antisense nucleotide sequence is constructed to hybridize to the corresponding mRNA. The antisense sequence can be modified as long as it is long enough to hybridize to the corresponding mRNA and interfere with its expression. In this manner, an antisense construct having 80%, preferably 90%, more preferably 95% sequence identity to the corresponding antisense sequence can be used. In addition, a portion of the antisense nucleotide sequence can be used to disrupt the expression of the target gene. Generally, a sequence of at least 50 nucleotides, 100 nucleotides, 200 nucleotides, or more can be used.

[0039] The promoter sequences of the present application are used for constitutive expression of a heterologous nucleotide sequence of interest. A "heterologous nucleotide sequence" refers to a sequence that does not naturally occur with the promoter sequence. Although the nucleotide sequence is heterologous to the promoter sequence, it can be homologous or native or heterologous or foreign to the plant host. The heterologous nucleotide sequence operably linked to the promoter of the present application can encode a protein of interest. Examples of such heterologous nucleotide sequences include, but are not limited to, nucleotide sequences encoding polypeptides that confer resistance to abiotic stresses such as drought, temperature, salinity, ozone, and herbicides, or biotic stresses such as pathogen attack, including insects, viruses, bacteria, fungi, and nematodes, and prevent the development of disease that accompanies these organisms.

[0040] The herbicide tolerance proteins of the present application can express resistance and / or tolerance to herbicides. These genes include, but are not limited to, hydroxyphenylpyruvate dioxygenase (HPPD) genes, protoporphyrinogen oxidase (PPO) genes, acetolactate synthase (ALS) genes, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) genes, phosphinothricin acetyltransferase (PAT) genes, glyphosate oxidoreductase (GOX) genes, GAT genes, and the like.

[0041] In the present application, "insect resistance" refers to the avoidance by a plant of the symptoms and damage caused by the plant-insect interaction. That is, to prevent or alternatively to minimize or reduce plant damage, crop damage, plant deformation, and plant disease caused by insects. The insects can belong to the order Lepidoptera (e.g., corn earworm), Hemiptera (e.g., stink bugs), Coleoptera (e.g., beetles), Orthoptera (e.g., grasshoppers), Homoptera (e.g., aphids), Diptera (e.g., flies), and the like. Insect resistance proteins of interest are known in the art and include, but are not limited to, Bacillus thuringiensis toxic proteins; lectins, wherein lectins include snowdrop lectin, pea lectin, jack bean lectin, wheat germ agglutinin, potato lectin, peanut lectin, and the like; lipoxygenases, wherein lipoxygenases include pea lipoxygenase 1 or soybean lipoxygenase; insect chitinases, and the like.

[0042] Different pests transmit viruses from infected plants to healthy plants in different ways. The viruses include, but are not limited to, rice tungro bacilliform virus, tobacco mosaic virus, sweet potato feathery mottle virus, and sweet potato chlorotic dwarf virus, and the like. Thus, it can be desirable to constitutively express in plant tissues a heterologous nucleotide sequence that has anti-pathogen activity or minimizes the effects of a viral pathogen.

[0043] The promoter sequences and methods of the present application can be used to modulate the expression of any heterologous nucleotide sequence of interest in a plant host to alter the phenotype of the plant. Various phenotypic alterations of interest include, but are not limited to, altering the fatty acid composition of the plant, altering the amino acid content of the plant, altering the pathogen defense mechanisms of the plant, and the like. Such alterations can be achieved by providing for the expression of a heterologous product or increasing the expression of an endogenous product of the plant. Alternatively, such alterations can be achieved by decreasing the expression of one or more endogenous products of the plant, particularly enzymes or cofactors. Such alterations will result in a transformed plant having an altered phenotype.

[0044] The transformation protocol and the protocol for introducing the nucleotide sequence into the plant will vary depending on the type of plant or plant cell being transformed, i.e., monocot or dicot. Suitable methods for introducing the nucleotide sequence into the plant cell and subsequently into the plant genome include, but are not limited to, Agrobacterium-mediated transformation, microprojectile bombardment, direct DNA uptake into protoplasts, electroporation, or whisker silicon-mediated DNA introduction.

[0045] The transformed cells can be grown into plants in accordance with conventional ways. These plants are crossed with the same transformed strain or different transformed strains, and the progeny are evaluated for expression of the desired phenotypic characteristic. The progeny can be grown and evaluated for a second or more generations to ensure that the expression of the desired phenotypic characteristic is stable and inherited in the desired manner.

[0046] The term "plant" refers to the whole plant, including all plant and plant populations, such as those that occur naturally or by cultivation of plants or plant varieties, including plants that contain one or more imported DNA sequences. The plant can be a plant that has been modified using methods of genetic engineering or by optimized breeding or by a combination of these methods.

[0047] The term "plant part" includes plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or in plant parts such as leaves, pollen, embryos, flowers, seeds, roots, root tips, anthers, and the like. It is understood that plant parts of transgenic plants within the scope of the application include, but are not limited to, plant cells, protoplasts, tissues, callus, embryos, and flowers, stems, fruits, leaves and roots, the latter three derived from the transformed plant or its progeny and which have at least one cell that contains a transgene.

[0048] In one aspect, the plant part is a plant cell. In yet another aspect, the plant part is a non-regenerable cell or a regenerable cell. In another aspect, the plant cell is a somatic cell.

[0049] Non-regenerable cells are cells that cannot be regenerated into a whole plant by in vitro culture. Non-regenerable cells can be in a plant or plant part (e.g. a leaf) of the application. Non-regenerable cells can be in a seed or the seed coat of the seed. A mature plant organ (including a mature leaf, a mature stem or a mature root) comprises at least one non-regenerable cell.

[0050] In another aspect, the plant cell is a reproductive cell, such as an ovule or a cell that is part of pollen. In one aspect, the pollen cell is a vegetative (non-reproductive) cell, or a sperm cell.

[0051] The present application provides a harvest of a plant or part comprising the constitutive promoter of the application for processing to obtain a processed agricultural product. The term "processed agricultural product" refers to any composition or product that is composed of material derived from a plant, seed, plant cell or plant part comprising the constitutive promoter of the application. In particular, the term "processed agricultural product" includes, but is not limited to, protein concentrate, protein isolate, starch, flour, biomass and seed oil.

[0052] The present application provides a constitutive promoter and uses thereof, with the following advantages:

[0053] 1. The present application discloses for the first time a constitutive promoter from a cotton Histone gene, the nucleotide sequence of the constitutive promoter comprising SEQ ID NO: 4 and derived from SEQ ID NO: 1.

[0054] 2. The constitutive promoter of the present application shows activity in almost all tissues and many types of cells of a plant, particularly in the roots, stems, leaves, flowers, pod skins, fruits of a plant.

[0055] 3. The constitutive promoter of the present application can drive constitutive expression of a foreign gene in plant tissues.

[0056] The technical solutions of the present application are described in further detail below with reference to the accompanying drawings and examples. BRIEF DESCRIPTION OF DRAWINGS

[0057] Figure 1 is a schematic diagram of the structure of the vector DBNBC-Dual_LUC containing LUC and REN reporter genes of the present application;

[0058] Figure 2 is a schematic diagram of the structure of the recombinant expression vector DBN11-L containing the prGhH3-3-01 promoter sequence of the present application;

[0059] Figure 3 is a schematic diagram of the structure of the vector DBNBC-HTG containing the herbicide-tolerant gene HTG of the present application;

[0060] Figure 4 is a schematic diagram of the structure of the recombinant expression vector DBN18-L of the present application. DETAILED DESCRIPTION

[0061] The technical solutions of the constitutive promoter and the use thereof of the present application are further illustrated below through specific examples.

[0062] The first embodiment, obtaining the constitutive promoter of the present application

[0063] 1. Obtaining the prGhH3-3-01 promoter sequence

[0064] By querying the cotton expression profile database (Cotton Functional Genomic Database, https: / / cottonfgd.org), genes with high abundance expression in root, stem, leaf, flower and other tissues can be retrieved. The 2632bp sequence upstream of the gene Gh_D03G042200 is selected and named as the promoter prGhH3-3-01. The cotton variety JM14 genomic DNA sequence is used as the PCR amplification template, and primer 1 and primer 2 are designed to perform PCR amplification:

[0065] Primer 1: 5'-tcattttcttttgattcaaaggc-3', as shown in SEQ ID NO: 5 in the sequence listing;

[0066] Primer 2: 5'-ctctgcaaagatacgaataattt-3', as shown in SEQ ID NO: 6 in the sequence listing.

[0067] The PCR reaction system is as follows:

[0068] The primer contains 2.5μL of each primer at a concentration of 10uM, and the reaction buffer is the reaction buffer in the New England Company High-Fidelity DNA Polymerase kit, supplemented with nuclease-free water to 50μL in the above PCR reaction system. The specific operation steps are carried out according to the New England Company PCR Using High-Fidelity DNA Polymerase(M0491) kit instructions.

[0069] The PCR reaction conditions are as follows:

[0070] The PCR amplification product is connected with a blunt end Blunt vector (a cloning vector of Fullgold Company, Beijing), and the operation steps are performed according to the Blunt vector instruction of Fullgold Company product, and then the connection product is sequenced (Sanger sequencing), and the prGhH3-3-01 promoter sequence is confirmed, as shown in SEQ ID NO: 1 in the sequence listing.

[0071] 2, obtaining prGhH3-3-02, prGhH3-3-03 and prGhH3-3-04 promoter sequences

[0072] The prGhH3-3-01 gene sequence is used as a PCR amplification template, and the following primer pairs are designed respectively: primer 2 (SEQ ID NO: 6) and primer 3 (SEQ ID NO: 7), primer 2 (SEQ ID NO: 6) and primer 4 (SEQ ID NO: 8), primer 2 (SEQ ID NO: 6) and primer 5 (SEQ ID NO: 9), and the above-mentioned primer pairs are used for PCR amplification reaction according to the method of obtaining the prGhH3-3-01 promoter sequence, and the prGhH3-3-02 promoter sequence (SEQ ID NO: 2), the prGhH3-3-03 promoter sequence (SEQ ID NO: 3) and the prGhH3-3-04 promoter sequence (SEQ ID NO: 4) are obtained in turn.

[0073] 3, synthesizing the above-mentioned prGhH3-3-01 to prGhH3-3-04 promoter sequences

[0074] The 5' and 3' ends of the above-mentioned prGhH3-3-01 promoter sequence, prGhH3-3-02 promoter sequence, prGhH3-3-03 promoter sequence, prGhH3-3-04 promoter sequence and prGm17gTsf1 control promoter sequence (SEQ ID NO: 10), pr35S control promoter sequence (SEQ ID NO: 11) and prAtH4A748:1TEV chimeric control promoter sequence (SEQ ID NO: 12) are connected with a universal adapter primer 1 respectively.

[0075] 5' end universal adapter primer 1: 5'-ctaaaaccaaaatccagtggactagt-3', as shown in SEQ ID NO: 13 in the sequence listing;

[0076] 3' end universal adapter primer 1: 5'-atgtttttggcgtcttccat-3', as shown in SEQ ID NO: 14 in the sequence listing.

[0077] Second embodiment, verification of the effect of promoter elements driving expression of a LUC reporter gene in transgenic tobacco

[0078] 1. Introducing a dual-luciferase reporter system, respectively constructing a recombinant expression vector containing the prGhH3-3-01 promoter sequence, a recombinant expression vector containing the prGhH3-3-02 promoter sequence, a recombinant expression vector containing the prGhH3-3-03 promoter sequence, and a recombinant expression vector containing the prGhH3-3-04 promoter sequence.

[0079] It is well known to those skilled in the art to construct vectors using conventional enzyme digestion methods. The structure of the vector DBNBC-Dual_LUC (vector backbone: pCAMBIA2301 (CAMBIA company) with resistance marker modified) containing LUC and REN reporter genes is shown in Figure 1 (Spec: spectinomycin gene; RB: right border; prAtAct2: Arabidopsis thaliana Act2 gene promoter (SEQ ID NO: 15); REN: Renilla luciferase gene (SEQ ID NO: 16); t35s: Cauliflower virus 35s terminator (SEQ ID NO: 17); Spel: restriction endonuclease Spel recognition site; LUC: firefly luciferase gene (SEQ ID NO: 18); tPsE9: terminator of pea RbcS gene (SEQ ID NO: 19); prAtUbi10: promoter of Arabidopsis thaliana ubiquitin 10 gene (SEQ ID NO: 20); spAtCTP2: Arabidopsis thaliana chloroplast transit peptide (SEQ ID NO: 21); cEPSPS: 5-enolpyruvate shikimate-3-phosphate synthase gene (SEQ ID NO: 22); tNos: terminator of nopaline synthase gene (SEQ ID NO: 23); LB: left border).

[0080] The above vector DBNBC-Dual_LUC was subjected to enzyme digestion reaction with restriction endonuclease Spel, thereby linearizing the vector DBNBC-Dual_LUC, and the linearized DBNBC-Dual_LUC expression vector was obtained by purifying the enzyme digestion product. The prGhH3-3-01 promoter sequence with the universal adapter primer 1 was subjected to recombination reaction with the linearized DBNBC-Dual_LUC expression vector, and the operation steps were performed according to the instructions of the Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949), thereby constructing a recombinant expression vector DBN11-L, and the structure thereof is shown in Figure 2.

[0081] The recombinant expression vector DBN11-L is transformed into E. coli DH5a competent cells by heat shock method. The heat shock conditions are as follows: 100 μL of E. coli DH5a competent cells, 20 μL of recombinant plasmid DNA (recombinant expression vector DBN11-L), mix gently, heat shock at 42°C for 30 s, immediately place on ice for 2 min; add 250 μL of antibiotic-free LB liquid medium (10 g / L of tryptone, 5 g / L of yeast extract, 10 g / L of NaCl, adjust pH to 7.5 with NaOH), incubate at 37°C with shaking (200 rpm / min) for 1 h. Then invert culture at a temperature of 37°C for 12 h on the LB solid plate containing 50 mg / L of spectinomycin, pick positive clone colonies, and incubate at a temperature of 37°C with shaking (200 rpm / min) overnight in LB liquid medium containing 50 mg / L of spectinomycin. Extract the plasmid by alkaline lysis method: centrifuge the bacterial solution at a speed of 12000 rpm for 1 min, remove the supernatant, and suspend the precipitated bacterial cells with 100 μL of ice-precooled solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH = 8.0); add 200 μL of freshly prepared solution II (0.2 M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times, mix, and place on ice for 3-5 min; add 150 μL of ice-cold solution III (3 M potassium acetate, 5 M acetic acid), mix thoroughly immediately, and place on ice for 5-10 min; centrifuge at a temperature of 4°C and a speed of 12000 rpm for 5 min, transfer the supernatant to a new 2 mL centrifuge tube, add 2 volumes of absolute ethanol, mix, and place at room temperature for 5 min; centrifuge at a temperature of 4°C and a speed of 12000 rpm for 5 min, discard the supernatant, and wash the precipitate with 70% (V / V) ethanol and air dry; add 30 μL of TE (10 mM Tris-HCl, 1 mM EDTA, pH = 8.0) containing RNase (20 μg / mL) to dissolve the precipitate; digest RNA in a water bath at a temperature of 37°C for 30 min; and store at -20°C for later use. The extracted plasmid is sequenced and identified. The results show that the recombinant expression vector DBN11-L contains the nucleotide sequence shown in SEQ ID NO: 1 in the sequence table, i.e., the prGhH3-3-01 promoter sequence.

[0082] According to the above method of constructing the recombinant expression vector DBN11-L containing the prGhH3-3-01 promoter sequence, the prGhH3-3-02 promoter sequence connected with the universal adapter primer 1, the prGhH3-3-03 promoter sequence connected with the universal adapter primer 1, the prGhH3-3-04 promoter sequence connected with the universal adapter primer 1, the prGm17gTsf1 control promoter sequence connected with the universal adapter primer 1, the pr35S control promoter sequence connected with the universal adapter primer 1, and the prAtH4A748:1TEV chimeric control promoter sequence connected with the universal adapter primer 1 are respectively recombined with the linearized DBNBC-Dual_LUC expression vector to sequentially obtain recombinant expression vectors DBN12-L to DBN17-L, and the correct insertion of the above nucleotide sequences in the recombinant expression vectors DBN12-L to DBN17-L is verified by sequencing.

[0083] 2. Transformation of Agrobacterium with recombinant expression vectors

[0084] The correctly constructed recombinant expression vectors DBN11-L to DBN17-L are respectively transformed into Agrobacterium LBA4404 (Invitrogen, Chicago, USA; Cat. No: 18313-015) by liquid nitrogen method, and the transformation conditions are as follows: 100 μL of Agrobacterium LBA4404, 3 μL of plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 min, and then placed in a 37°C water bath for 10 min; the transformed Agrobacterium LBA4404 is inoculated into an LB test tube and cultured at a temperature of 28°C and a rotation speed of 200 rpm for 2 h, and then spread on an LB solid plate containing 50 mg / L of rifampicin and 50 mg / L of spectinomycin until positive monoclonal colonies are grown, and the monoclonal colonies are cultured and the plasmid is extracted, and the extracted plasmid is identified by sequencing, and the results show that the structures of the recombinant expression vectors DBN11-L to DBN17-L are completely correct.

[0085] 3. Transient transformation of tobacco leaves

[0086] Tobacco leaves are high-efficiency protein expression bioreactors, and foreign genes are introduced into tobacco leaves by Agrobacterium injection infiltration method for expression, and high-throughput protein expression is used to verify the effect of the constitutive promoter of the application.

[0087] The tobacco leaf transformation method is as follows:

[0088] Step 1, planting tobacco, culturing tobacco under the conditions of 14 h light / 10 h darkness, a temperature of 25°C, and a relative humidity of 70% for 4-5 weeks, and collecting tobacco leaves;

[0089] Step 2, the Agrobacterium strains transformed with the recombinant expression vectors DBN11-L, DBN12-L, DBN13-L, DBN14-L, DBN15-L, DBN16-L and DBN17-L respectively in part 2 of this example were picked successively and inoculated into 1 mL of LB liquid medium (Tryptone 10 g / L, Yeast extract 10 g / L, NaCl 5 g / L, Rifampicin 50 mg / mL, Spectinomycin 50 mg / mL, Tetracycline 10 mg / mL) containing antibiotics, and cultured at 28°C with shaking (200 rpm) until the Agrobacterium entered the logarithmic growth phase (OD 600 = 0.5-0.6), 1 mL of the logarithmic growth phase Agrobacterium was taken and transferred into 20 mL of LB liquid medium (Tryptone 10 g / L, Yeast extract 10 g / L, NaCl 5 g / L, Rifampicin 50 mg / mL, Spectinomycin 50 mg / mL, Tetracycline 10 mg / mL) containing antibiotics, and cultured at 28°C with shaking (200 rpm) until the Agrobacterium entered the logarithmic growth phase (OD 600 = 0.5-0.6), centrifuged at room temperature at 5000 rpm for 10 min, the bacterial cells were collected, and the Agrobacterium was suspended in infiltration solution (containing 10 mM MgCl2, 10 mM MES, 150 uM acetosyringone, pH = 5.6) to OD 600 = 0.8, and allowed to stand at room temperature for 2-3 h, to obtain Agrobacterium strains transformed with the recombinant expression vectors DBN11-L to DBN17-L for injection respectively;

[0090] Step 3: Using a 1mL needle, gently make a small incision on the back of the tobacco leaf obtained in Step 1 of this embodiment (be careful not to puncture it). Then, using a syringe without the needle, draw up the Agrobacterium bacterial suspension transformed with recombinant expression vectors DBN11-L to DBN17-L in Step 2 of this embodiment. T-DNA from recombinant expression vectors DBN11-L to DBN17-L (including the prAtAct2 promoter sequence, REN gene sequence, t35S terminator sequence, one of the following promoter sequences selected from prGhH3-3-01, prGhH3-3-02, prGhH3-3-03, prGhH3-3-04, prGm17gTsf1 control promoter sequence, pr35S control promoter sequence, and prAtH4A748:lTEV chimeric control promoter sequence, LUC gene sequence, tPsE9 terminator sequence, prAtUbi10 promoter sequence, spAtCTP2 nucleotide sequence, cEPSPS gene sequence, and tNos terminator sequence) was injected into tobacco leaves through a small incision in the leaf to transfer into tobacco leaves; wild-type tobacco leaves (CK1) were used as a control. Water-stained areas on the tobacco leaves were marked with a marker.

[0091] Step 4: Place the tobacco leaves injected in Step 3 of this embodiment and wild-type tobacco leaves in the dark for 12 hours, and then incubate them in a constant temperature incubator at 21°C for 2 days. Cut off the labeled areas of the tobacco leaves, and take three equal mass portions of leaves with labeled areas transferred to recombinant expression vectors DBN11-L to DBN17-L and wild-type tobacco leaves as biological replicates. Freeze-mill them in liquid nitrogen, and then add 1×Passive lysis buffer (PLB) buffer to each. Centrifuge at 12000 rpm for 10 min at 4°C, and collect the supernatant for later use.

[0092] 4. Detection of the effect of the constitutive promoter of the present invention on driving LUC reporter gene expression in tobacco leaves.

[0093] Step 5: Take 100 μL of the supernatant from Step 4 above, add it to an ELISA plate, and set up 3 replicates. Add 100 μL of 1× firefly luciferase reaction solution LAR II (dissolve the lyophilized luciferase assay substrate in luciferase assay buffer II (Promega)). The luciferase activity of fireflies was obtained from the Reporter Assay System (E1960) kit and stored at -80°C protected from light. After shaking the plate to mix, the activity was measured using a BioTek-H1MF microplate reader. The measurement was completed within 30 minutes. The unit of the measured luciferase activity value is RLU (relative light unit).

[0094] Step 6, add 100 μL 1x Renilla luciferase reaction liquid Stop & Glo (obtained by dissolving 200 μL of Stop & Glo Substrate (50x) in 10 mL of Stop & Glo buffer, and storing in -80°C in the dark), shake plate and mix, use an enzyme marker BioTek-H1MF to detect Renilla luciferase activity value, detection is completed within 30 min, and the Renilla luciferase (REN) activity value unit is RLU (relative light unit).

[0095] In order to eliminate the group error caused by different transformation efficiencies of plant tissues due to Agrobacterium infection, the REN gene is used as an internal reference, and the LUC / REN ratio reflects the relative activity strength of the promoter (LUC / REN ratio = (LUC value of tobacco leaves into which different recombinant expression vectors are transformed - LUC value of wild type tobacco leaves) / (REN value of tobacco leaves into which different recombinant expression vectors are transformed - REN value of wild type tobacco leaves)), and the test results of LUC and REN enzyme activity detection of transiently transformed tobacco leaves are shown in Table 1.

[0096] Table 1, LUC and REN enzyme activity values and LUC / REN ratio in transiently transformed tobacco leaves

[0097] The results of Table 1 show that: (1) the promoters prGhH3-3-01, prGhH3-3-02, prGhH3-3-03 and prGhH3-3-04 in the application generally have activity, and can drive LUC gene expression in tobacco leaves; 2) compared with the pr35S and prAtH4A748:lTEV control promoters, the prGhH3-3-02 drives LUC gene expression with higher activity in tobacco leaves.

[0098] Third embodiment, verification of the effect of the promoter element driving LUC reporter gene expression in transgenic Arabidopsis

[0099] 1. Transformation of Agrobacterium with recombinant expression vectors

[0100] The recombination expression vectors DBN11-L, DBN15-L to DBN17-L which have been constructed correctly in part 1 of the above second embodiment were respectively transformed into Agrobacterium GV3101 by liquid nitrogen method, and the transformation conditions were as follows: 100 μL Agrobacterium GV3101, 3 μL plasmid DNA (recombination expression vector); placed in liquid nitrogen for 10 min, 37°C warm water bath for 10 min; the transformed Agrobacterium GV3101 was inoculated into LB test tube and cultured at a temperature of 28°C and a rotation speed of 200 rpm for 2 h, and then coated on the LB solid plate containing 50 mg / L of Rifampicin and 50 mg / L of Spectinomycin until positive monoclonal was grown, the monoclonal was picked and cultured, and the plasmid was extracted, and the extracted plasmid was sequenced and identified, and the results showed that the recombination expression vectors DBN11-L, DBN15-L to DBN17-L were completely correct in structure.

[0101] 2. Obtaining of transgenic Arabidopsis plant

[0102] Wild-type Arabidopsis seeds were suspended in 0.1% (w / v) agarose solution. The suspended seeds were stored at 4°C for 2 days to complete the need for dormancy to ensure synchronized germination of the seeds. Vermiculite mixed with horse manure soil and bottom irrigated with water to wet, the soil mixture was drained for 24 h. The pretreated seeds were planted on the soil mixture and covered with a humidity cover for 7 days. The seeds were germinated and the plants were cultured in a greenhouse under long-day conditions (16 h light / 8 h dark) with constant temperature (22°C) and constant humidity (40-50%) and light intensity of 120-150 μmol / m 2 s -1 The plants were initially irrigated with Hoagland's nutrient solution, and then with deionized water, keeping the soil moist but not waterlogged.

[0103] Flower dip method was used to transform Arabidopsis. One or more 15-30 mL pre-cultures of LB broth (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, pH 7.5 adjusted with NaOH) containing spectinomycin (50 mg / L) and rifampicin (10 mg / L) were inoculated with selected Agrobacterium colonies. The pre-cultures were incubated overnight at 28°C with constant shaking at 220 rpm. Each pre-culture was used to inoculate two 500 mL cultures of the LB broth containing spectinomycin (50 mg / L) and rifampicin (10 mg / L) and the cultures were incubated overnight at 28°C with constant shaking. The cells were pelleted by centrifugation at room temperature for 20 min at approximately 4000 rpm and the resulting supernatant was discarded. The cell pellet was gently resuspended in 500 mL of osmotic medium containing ½ x MS salts / B5 vitamins, 10% (w / v) sucrose, 0.044 μΜ benzylaminopurine (10 μL / L (1 mg / mL stock in DMSO)), and 300 μL / L Silwet L-77. Approximately 1 month old Arabidopsis plants were dipped in the osmotic medium with resuspended cells for 5 min, ensuring that the newest inflorescences were submerged. The Arabidopsis plants were then laid on their sides and covered, and were kept moist in the dark for 24 h. The Arabidopsis plants were then grown normally under a 16 h light / 8 h dark photoperiod at 22°C. Seeds were harvested approximately 4 weeks later.

[0104] T1 seeds (prGhH3-3-01 promoter sequence, prGm17gTsf1 control promoter sequence, pr35S control promoter sequence, prAtH4A748:1TEV chimeric control promoter sequence) were dried at room temperature for 7 days. Seeds were sown in 26.5 cm x 51 cm germination trays, with each tray receiving 200 mg of T1 seeds (approximately 10,000 seeds), which had been previously suspended in distilled water and stored at 4°C for 2 days to complete the need for dormancy to ensure synchronized germination of the seeds.

[0105] Vermiculite was mixed with horse manure and bottom watered to moisten with gravity drainage. The pretreated seeds were evenly sown on the soil mixture using a pipette and covered with a humidity dome for 4-5 days. The dome was removed 1 day before initial transformant selection using post-emergence spraying of glyphosate (selecting for the co-transformed EPSPS gene).

[0106] T1 plants (cotyledon stage and 2-4 leaf stage, respectively) were sprayed with a 0.5% solution of Roundup herbicide (glyphosate at 356 g ae / L) using a DeVilbiss compressed air nozzle at a spray volume of 10 mL / plate (703 L / ha) at 7 days after planting (DAP) and again at 11 DAP to provide an effective amount of 420 g ae / ha of glyphosate per application. Surviving plants (actively growing plants) were identified 4-7 days after the last spray and transplanted into 7 cm x 7 cm square pots prepared with horse manure and vermiculite (2-4 plants per pot). Transplanted plants were covered with a humidity dome for 3-4 days and placed in a temperature 22°C growth chamber or directly into the greenhouse as before. The dome was then removed and plants were transplanted into the greenhouse (temperature 22 ± 5°C, 50 ± 30% RH, 14 h light: 10 h dark, minimum 500 μE / m2s natural + supplemental light) at least 1 day before testing the effect of the promoter element driving the LUC reporter gene. 2 -1 Natural + supplemental light).

[0107] 3. Testing the effect of the constitutive promoter of the present application to drive LUC reporter gene expression in different tissues of Arabidopsis

[0108] T1 transformants were selected from the untransformed seed background using the glyphosate selection scheme. Arabidopsis T1 plants transformed with the prGhH3-3-01 promoter sequence of Part 2 of this example, Arabidopsis T1 plants transformed with the prGm17gTsf1 control promoter sequence, Arabidopsis T1 plants transformed with the pr35S control promoter sequence and Arabidopsis T1 plants transformed with the prAtH4A748:1TEV chimeric control promoter sequence were sampled at different times in different parts of the above-mentioned Arabidopsis T1 plants as test samples, respectively:

[0109] At rosette stage, 3 parts were sampled as test samples: root, stem and leaf;

[0110] At bolting stage, 4 parts were sampled as test samples: root, stem, leaf and flower;

[0111] At mature stage, 4 parts were sampled as test samples: root, stem, leaf and pod.

[0112] Wild type Arabidopsis (CK2) at the same growth stage and in the same part were sampled as negative control samples.

[0113] ​Take three same quality of the different period different parts of the test sample and the same period same part of the negative control sample of wild type Arabidopsis thaliana plant into the recombinant expression vector DBN11-L, DBN15-L to DBN17-L as biological repeats, liquid nitrogen frozen grinding, then add 1xPLB buffer, centrifuge at 4℃, 12000rpm for 10min, respectively, take the supernatant for standby.

[0114] According to the method of step 5 and step 6 in the second embodiment 4, the test sample and the negative control sample are detected by double luciferase, taking REN gene as internal reference, and the high and low ratio of LUC / REN reflects the relative activity strength of the promoter (the ratio of LUC / REN=(the LUC value of the test sample of different period different parts of the different recombinant expression vectors-the LUC value of the same period same part of the wild type plant) / (the REN value of the test sample of different period different parts of the different recombinant expression vectors-the REN value of the same period same part of the wild type plant)). The ratio of LUC / REN of the stably transformed Arabidopsis thaliana in different periods and different parts is shown in table 2.

[0115] Table 2, the ratio of LUC / REN of the stably transformed Arabidopsis thaliana in different periods and different parts

[0116] The results of table 2 show that: (1) the promoter prGhH3-3-01 in the application exists activity, which can express in the root, stem, leaf, flower and pod of Arabidopsis thaliana plant, indicating that the promoter prGhH3-3-01 can drive the constitutive expression of the heterologous gene in the plant.(2) In the leaf of Arabidopsis thaliana plant in rosette stage, bolting stage and mature stage, compared with the prAtH4A748:lTEV control promoter, the activity of prGhH3-3-01 driving LUC gene expression is higher.(3) In the stem of Arabidopsis thaliana plant in mature stage, the root in rosette stage and the flower in bolting stage, compared with pr35S and prAtH4A748:lTEV control promoter, the activity of prGhH3-3-01 driving LUC gene expression is higher.(4) In the pod of Arabidopsis thaliana plant in mature stage, compared with prGm17gTsf1, pr35S and prAtH4A748:lTEV control promoter, the activity of prGhH3-3-01 driving LUC gene expression is higher.

[0117] Fourth embodiment, verification of the effect of the promoter element driving LUC reporter gene expression in transgenic soybean

[0118] 1、Recombinant expression vector transformed agrobacterium

[0119] The correctly constructed recombinant expression vectors DBN11-L, DBN15-L to DBN17-L were transformed into Agrobacterium EHA101 by liquid nitrogen method, and the transformation conditions were as follows: 100 μL of Agrobacterium EHA101, 3 μL of plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 min, and then placed in a 37°C water bath for 10 min; the transformed Agrobacterium EHA101 was inoculated into an LB test tube, and incubated at a temperature of 28°C and a rotation speed of 200 rpm for 2 h, and then coated on an LB solid plate containing 50 mg / L of rifampicin and 50 mg / L of spectinomycin until positive monoclonal colonies were grown, and the monoclonal colonies were cultured and the plasmid was extracted, and the extracted plasmid was sequenced and identified, and the results showed that the structures of the recombinant expression vectors DBN11-L, DBN15-L to DBN17-L were completely correct.

[0120] 2. Obtaining of transgenic soybean plants

[0121] According to the conventional Agrobacterium infection method, the cotyledon node tissue of the aseptic culture soybean variety SY2043C was co-cultured with the Agrobacterium described in Part 1 of the present example, so as to introduce the T-DNA (including the prAtAct2 promoter sequence, the REN gene sequence, the t35s terminator sequence, one selected from the prGhH3-3-01 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence and the prAtH4A748: lTEV chimeric control promoter sequence, the LUC gene sequence, the tPsE9 terminator sequence, the prAtUbi10 promoter sequence, the spAtCTP2 nucleotide sequence, the cEPSPS gene sequence and the tNos terminator sequence) in the recombinant expression vectors DBN11-L, DBN15-L to DBN17-L into the soybean chromosome, and the soybean plants into which the prGhH3-3-01 promoter sequence was introduced, the soybean plants into which the prGm17gTsf1 control promoter sequence was introduced, the soybean plants into which the pr35S control promoter sequence was introduced and the soybean plants into which the prAtH4A748: lTEV chimeric control promoter sequence were obtained.

[0122] For Agrobacterium-mediated soybean transformation, mature soybean seeds were germinated in soybean germination medium (3.1 g / L B5 salt, B5 vitamin, 20 g / L sucrose, 8 g / L agar, pH 5.6). Seeds were inoculated onto the germination medium and cultured under the following conditions: temperature 25 ± 1℃; photoperiod (light / dark) 16 / 8 h. One day after germination, a cotyledon and the first true leaf were removed and inoculated onto a pretreated medium containing cytokinins (MS salt 4.3 g / L, vitamin B5, sucrose 20 g / L, agar 8 g / L, 2-morpholinoethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, 6-benzyladenine (6-BAP) 1 mg / L, acetylsyringone (AS) 40 mg / L, pH = 5.3). Three days after inoculation on the pretreated medium, the cotyledonary node was wounded with the back of a scalpel, and Agrobacterium suspension was applied to the wounded cotyledonary node tissue. Agrobacterium can deliver the prGhH3-3-01 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence, and the prAtH4A748:lTEV chimeric control promoter sequence to the wounded cotyledonary node tissue (Step 1: Infection Step). In this step, the cotyledonary node tissue is preferably immersed in Agrobacterium suspension (OD). 660= 0.5-0.8, in infection medium (MS salts 2.15 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, acetosyringone (AS) 40 mg / L, 2-morpholinoethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, pH 5.3) to initiate inoculation. The cotyledonary node tissue is co-cultivated with Agrobacterium for a period of time (3 days) (step 2: co-cultivation step). Preferably, the cotyledonary node tissue is cultured on solid medium (MS salts 4.3 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, MES 4 g / L, ZT 2 mg / L, agar 8 g / L, pH 5.6) after the infection step. Following this co-cultivation phase, there can be an optional "recovery" step. In the "recovery" step, a recovery medium (B5 salts 3.1 g / L, B5 vitamins, MES 1 g / L, sucrose 30 g / L, ZT 2 mg / L, agar 8 g / L, cefotaxime 150 mg / L, glutamic acid 100 mg / L, aspartic acid 100 mg / L, pH 5.6) is provided with at least one antibiotic (cefotaxime 150-250 mg / L) known to inhibit the growth of Agrobacterium, without the addition of a selection agent for plant transformants (step 3: recovery step). Preferably, the cotyledonary node regenerated tissue pieces are cultured on solid medium with the antibiotic but without the selection agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the cotyledonary node regenerated tissue pieces are cultured on medium containing the selection agent (glyphosate) and growing transformed callus is selected (step 4: selection step). Preferably, the cotyledonary node regenerated tissue pieces are cultured on selection solid medium (B5 salts 3.1 g / L, B5 vitamins, MES 1 g / L, sucrose 30 g / L, 6-benzylaminopurine (6-BAP) 1 mg / L, agar 8 g / L, cefotaxime 150 mg / L, glutamic acid 100 mg / L, aspartic acid 100 mg / L, N-(phosphonomethyl)glycine 0.25 mol / L, pH 5.6) with the selection agent, resulting in the selective growth of transformed cells. The transformed cells are then regenerated into plants (step 5: regeneration step), preferably, the cotyledonary node regenerated tissue pieces grown on medium with the selection agent are cultured on solid medium (B5 differentiation medium and B5 rooting medium) to regenerate plants.

[0123] The resistant tissue pieces obtained by screening are transferred to the B5 differentiation medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, ZT 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 50 mg / L, aspartic acid 50 mg / L, gibberellin 1 mg / L, auxin 1 mg / L, N-(phosphonomethyl)glycine 0.25 mol / L, pH 5.6) and cultured to differentiate at 25°C. The small seedlings differentiated are transferred to the B5 rooting medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, agar 8 g / L, cephalosporin 150 mg / L, indole-3-butyric acid (IBA) 1 mg / L) and cultured to about 10 cm high at 25°C and then moved to a greenhouse for cultivation to seed.

[0124] 3. Verification of transgenic soybean plants by TaqMan

[0125] About 100 mg of leaves of the soybean plants into which the prGhH3-3-01 promoter sequence is introduced, the soybean plants into which the prGm17gTsf1 control promoter sequence is introduced, the soybean plants into which the pr35S control promoter sequence is introduced and the soybean plants into which the prAtH4A748:lTEV chimeric control promoter sequence is introduced are taken as samples, and the genomic DNA thereof is extracted by using the DNeasy Plant Maxi Kit of Qiagen. The copy number of the EPSPS gene is detected by Taqman probe fluorescence quantitative PCR method to determine the copy number of the prGhH3-3-01, prGm17gTsf1, pr35S and prAtH4A748:lTEV genes. Meanwhile, wild-type soybean plants are used as controls, and the detection and analysis are performed according to the following method. The experiment is set in triplicate, and the average value is taken.

[0126] The specific method for detecting the copy number of the EPSPS gene is as follows:

[0127] Step 6: About 100 mg of leaves of the soybean plants into which the prGhH3-3-01 promoter sequence is introduced, the soybean plants into which the prGm17gTsf1 control promoter sequence is introduced, the soybean plants into which the pr35S control promoter sequence is introduced, the soybean plants into which the prAtH4A748:lTEV chimeric control promoter sequence is introduced and wild-type soybean plants are taken, respectively, and are ground into homogenate in a mortar by using liquid nitrogen. Three replicates are taken for each sample.

[0128] Step 7: The genomic DNA of the above samples is extracted by using the DNeasy Plant Mini Kit of Qiagen, and the specific method is referred to the product manual thereof.

[0129] Step 8, the genomic DNA concentration of the above sample was determined by NanoDrop 2000 (Thermo Scientific);

[0130] Step 9, the genomic DNA concentration of the above sample was adjusted to the same concentration value, which was in the range of 80-100 ng / μL;

[0131] Step 10, the copy number of the sample was identified by Taqman probe fluorescence quantitative PCR method, the sample with identified known copy number was used as standard, the sample of wild type soybean plant was used as control, each sample was repeated for 3 times, and the average value was taken; the fluorescence quantitative PCR primer and probe sequences were as follows:

[0132] The following primer and probe were used to detect the EPSPS gene sequence:

[0133] Primer 1: ggtgtgcaggtgaagtctgaag as shown in SEQ ID NO: 24 in the sequence listing;

[0134] Primer 2: gtctttggtccacgcaaggt as shown in SEQ ID NO: 25 in the sequence listing;

[0135] Probe 1: cggtgatcgtcttccagt as shown in SEQ ID NO: 26 in the sequence listing;

[0136] The PCR reaction system was as follows:

[0137] The 50× primer / probe mixture contained 45 μL of each primer at 1 mM concentration, 50 μL of probe at 100 μM concentration and 860 μL of 1× TE buffer, and was stored in amber test tube at 4℃.

[0138] The PCR reaction condition was as follows:

[0139] The data was analyzed by SDS2.3 software (Applied Biosystems).

[0140] The results of the analysis of the copy number of the EPSPS gene further confirm that the prGhH3-3-01 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence, and the prAtH4A748:lTEV chimeric control promoter sequence have been integrated into the genome of the soybean plants tested, and that the soybean plants into which the prGhH3-3-01 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence, and the prAtH4A748:lTEV chimeric control promoter sequence have been introduced have all obtained single copy transgenic soybean plants.

[0141] 4. Detection of the effect of the constitutive promoter of the present application on the expression of the LUC reporter gene in each tissue of soybean

[0142] The soybean plants into which the prGhH3-3-01 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence, and the prAtH4A748:lTEV chimeric control promoter sequence were introduced in part 3 of this example were sampled at different times and different parts of the above transgenic soybean plants to obtain test samples:

[0143] At the vegetative growth stage (V3 stage), 3 parts were sampled as test samples: roots, stems, and leaves;

[0144] At the reproductive growth stage, 6 parts were sampled as test samples: roots, stems, leaves, flowers, pod skins, and fruits;

[0145] Wild-type soybean plants (CK3) at the same growth stage and the same part were sampled as negative control samples.

[0146] The test samples at different times and different parts and the negative control samples (3 replicates of the same mass were sampled from each part of each strain at each time) of wild-type soybean plants (CK3) at the same time and the same part were frozen in liquid nitrogen and ground, then 1xPLB buffer was added, centrifuged at 4°C and 12000 rpm for 10 min, and the supernatant was collected for use.

[0147] The test samples and the negative control samples were detected for dual luciferase according to the method of steps 5 and 6 in the second example 4, using the REN gene as an internal reference, and the LUC / REN ratio reflects the relative activity strength of the promoter (the definition of the LUC / REN ratio is the same as that in Table 2 of the third example above). The LUC / REN ratio of the different parts of the stable transformed soybean at different times is shown in Table 3.

[0148] Table 3: LUC / REN ratio of different parts of stable transformed soybean at different periods

[0149] The results of Table 3 show that: (1) the promoter prGhH3-3-01 of the application can express in the roots, stems, leaves, flowers, pod skins and fruits of soybean plants, indicating that the promoter prGhH3-3-01 can drive the constitutive expression of the heterologous gene of interest in the plant; (2) in the leaves and roots of soybean during the vegetative growth period, the activity of prGhH3-3-01 driving LUC gene expression is higher than that of the prAtH4A748:lTEV control promoter; (3) during the reproductive growth period of soybean, the activity of prGhH3-3-01 driving LUC gene expression is higher than that of the prAtH4A748:lTEV control promoter.

[0150] Fifth embodiment, detection of herbicide resistance effect of transgenic Arabidopsis thaliana plants

[0151] 1. Constructing a recombinant expression vector of prGhH3-3-01 driving herbicide-tolerant gene HTG.

[0152] The 5' and 3' ends of the prGhH3-3-01 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence and the prAtH4A748:lTEV chimeric control promoter sequence are respectively connected with the universal adapter primer 2:

[0153] 5' end universal adapter primer 2: 5'-cacgtgaccctagtcacttaaagcttggcgcgcc-3', as shown in SEQ ID NO: 27 in the sequence listing;

[0154] 3' end universal adapter primer 2: 5'-cagtagctggtgttggaggcat-3', as shown in SEQ ID NO: 28 in the sequence listing.

[0155] The construction of vectors using conventional enzyme digestion methods is well known to those skilled in the art. The structure of the vector DBNBC-HTG (vector backbone: pCAMBIA2301 (CAMBIA) with a modified resistance tag) containing the herbicide-tolerant gene HTG is shown in FIG. 3 (Spec: spectinomycin gene; RB: right border; AscI: restriction enzyme AscI recognition site; HTG: hydroxyphenylpyruvate dioxygenase gene (SEQ ID NO: 29); t35s: cauliflower mosaic virus 35s terminator (SEQ ID NO: 17); prAtUbi10: promoter of Arabidopsis thaliana ubiquitin 10 gene (SEQ ID NO: 20); spAtCTP2: Arabidopsis thaliana chloroplast transit peptide (SEQ ID NO: 21); cEPSPS: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 22); tNos: terminator of nopaline synthase gene (SEQ ID NO: 23); LB: left border).

[0156] The above vector DBNBC-HTG was subjected to an enzyme digestion reaction using the restriction enzyme AscI, thereby linearizing the vector DBNBC-HTG, and the linearized DBNBC-HTG expression vector was purified from the enzyme digestion product. The prGhH3-3-01 promoter sequence of the universal linker primer 2 was subjected to a recombination reaction with the linearized DBNBC-HTG expression vector, and the operation steps were performed according to the instructions of the Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949), thereby constructing the recombinant expression vector DBN18-L, the structure of which is shown in FIG. 4.

[0157] The recombinant expression vector DBN18-L is transformed into E. coli DH5a competent cells by heat shock method. The heat shock conditions are as follows: 100 μL of E. coli DH5a competent cells, 20 μL of recombinant plasmid DNA (recombinant expression vector DBN18-L), mix gently, heat shock at 42°C for 30 s, immediately place on ice for 2 min; add 250 μL of antibiotic-free LB liquid medium (10 g / L of tryptone, 5 g / L of yeast extract, 10 g / L of NaCl, adjust pH to 7.5 with NaOH), incubate at 37°C with shaking (200 rpm / min) for 1 h. Then invert culture at a temperature of 37°C for 12 h on the LB solid plate containing 50 mg / L of spectinomycin, pick positive clone colonies, and incubate at a temperature of 37°C with shaking (200 rpm / min) overnight in LB liquid medium containing 50 mg / L of spectinomycin. Extract the plasmid by alkaline lysis method: centrifuge the bacterial solution at a speed of 12000 rpm for 1 min, remove the supernatant, and suspend the precipitated bacterial cells with 100 μL of ice-precooled solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH = 8.0); add 200 μL of freshly prepared solution II (0.2 M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times, mix, and place on ice for 3-5 min; add 150 μL of ice-cold solution III (3 M potassium acetate, 5 M acetic acid), mix thoroughly immediately, and place on ice for 5-10 min; centrifuge at a temperature of 4°C and a speed of 12000 rpm for 5 min, transfer the supernatant to a new 2 mL centrifuge tube, add 2 volumes of absolute ethanol, mix, and place at room temperature for 5 min; centrifuge at a temperature of 4°C and a speed of 12000 rpm for 5 min, discard the supernatant, and wash the precipitate with 70% (V / V) ethanol, then air dry; add 30 μL of TE (10 mM Tris-HCl, 1 mM EDTA, pH = 8.0) containing RNase (20 μg / mL) to dissolve the precipitate; digest RNA in a water bath at a temperature of 37°C for 30 min; and store at -20°C for later use. The extracted plasmid is sequenced and identified. The results show that the recombinant expression vector DBN18-L contains the nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing, i.e., the prGhH3-3-01 promoter sequence.

[0158] According to the method for constructing the recombinant expression vector DBN18-L containing the prGhH3-3-01 promoter sequence described above, the prGm17gTsf1 control promoter sequence connected with the universal adapter primer 2, the pr35S control promoter sequence connected with the universal adapter primer 2 and the prAtH4A748:lTEV chimeric control promoter sequence connected with the universal adapter primer 2 are respectively subjected to recombination reactions with the linearized DBNBC-HTG expression vector to sequentially obtain recombinant expression vectors DBN19-L to DBN21-L, and the correct insertion of the above nucleotide sequences in the recombinant expression vectors DBN19-L to DBN21-L is verified by sequencing.

[0159] 2. Transformation of Agrobacterium with the recombinant expression vector

[0160] According to the method for transforming Agrobacterium with the recombinant expression vector in part 1 of the third embodiment, the correctly constructed recombinant expression vectors DBN18-L to DBN21-L are respectively transformed into Agrobacterium GV3101 by the liquid nitrogen method, and the results of sequencing verification show that the structures of the recombinant expression vectors DBN18-L to DBN21-L are completely correct.

[0161] 3. Detection of the herbicide resistance effect of the herbicide-resistant gene HTG driven by the promoter in the transgenic Arabidopsis thaliana plants

[0162] According to the method in part 2 of the third embodiment, the Arabidopsis thaliana inflorescences are soaked in the Agrobacterium bacterial solution in part 2 of the embodiment to transfer the T-DNA in the recombinant expression vectors DBN18-L to DBN21-L constructed in part 2 of the embodiment into the Arabidopsis thaliana chromosomes to obtain corresponding transgenic Arabidopsis thaliana plants, i.e., Arabidopsis thaliana T1 plants into which the prGhH3-3-01 promoter sequence is transferred, Arabidopsis thaliana T1 plants into which the prGm17gTsf1 control promoter sequence is transferred, Arabidopsis thaliana T1 plants into which the pr35S control promoter sequence is transferred and Arabidopsis thaliana T1 plants into which the prAtH4A748:lTEV chimeric control promoter sequence is transferred.

[0163] The T1 transformants were selected from the non-transformed seed background using the glyphosate selection scheme. The T1 Arabidopsis plants transformed with the prGhH3-3-01 promoter sequence, the T1 Arabidopsis plants transformed with the prGm17gTsf1 control promoter sequence, the T1 Arabidopsis plants transformed with the pr35S control promoter sequence, the T1 Arabidopsis plants transformed with the prAtH4A748:lTEV chimeric control promoter sequence, and the wild-type Arabidopsis plants (CK4) (18 days after sowing) were sprayed with topramezone at 4 times the field concentration (100 g ai / ha) to detect the herbicide tolerance of Arabidopsis. Seven days after spraying, the damage degree of each plant to the herbicide was calculated according to the proportion of leaf whitening area (proportion of leaf whitening area = leaf whitening area / total leaf area x 100%): 0 level for a basic non-whitening phenotype, 1 level for a leaf whitening area proportion less than 50%, 2 level for a leaf whitening area proportion greater than 50%, and 3 level for a leaf whitening area proportion of 100%.

[0164] The resistance of each transformation event of the recombinant expression vector was scored according to the formula X = [∑(N x S) / (T x M)] x 100 (X - phytotoxicity score, N - number of plants with the same damage, S - number of phytotoxicity grades, T - total number of plants, and M - highest phytotoxicity grade), and the resistance was evaluated according to the score: highly resistant plants (0-15 points), moderately resistant plants (16-33 points), lowly resistant plants (34-67 points), and non-resistant plants (68-100 points). The experimental results are shown in Table 4.

[0165] Table 4, experimental results of the tolerance of transgenic Arabidopsis T1 plants to topramezone

[0166] For Arabidopsis, topramezone at 4 times the field concentration is an effective dose of high-pressure treatment. The results in Table 4 show that: (1) compared with CK4, the Arabidopsis plants transformed with the prGhH3-3-01 promoter sequence are all tolerant to topramezone at 4 times the field concentration. Therefore, the constitutive promoter prGhH3-3-01 of the present application can drive the expression of a heterologous gene of interest in plants. (2) Compared with the pr35S and prAtH4A748:lTEV control promoters, the prGhH3-3-01 drives the herbicide resistance effect of the herbicide-tolerant gene HTG in transgenic Arabidopsis plants to be better.

[0167] In summary, the constitutive promoter from the cotton Histone gene is disclosed for the first time in the present application. The constitutive promoter of the present application shows activity in most tissues and many types of cells of plants, especially in the roots, stems, leaves, flowers, pod skins, and fruits of plants, and has a wide application prospect in plants.

[0168] Finally, it should be noted that the above examples are merely used to illustrate the technical solutions of the present application but not to limit the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or equivalent replaced without departing from the spirit and scope of the technical solutions of the present application.

Claims

1. A constitutive promoter comprising, the nucleotide sequence of which comprises SEQ ID NO: 4, the constitutive promoter being derived from SEQ ID NO:

1.

2. The constitutive promoter of claim 1, wherein, the nucleotide sequence of which comprises SEQ ID NO: 4 and is selected from at least a portion of SEQ ID NO:

1.

3. The constitutive promoter of claim 1 or 2, wherein, the nucleotide sequence of which is as set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO:

4.

4. A recombinant DNA construct comprising the constitutive promoter of any one of claims 1-3 operably linked to a heterologous nucleotide sequence of interest.

5. The recombinant DNA construct of claim 4, wherein, the heterologous nucleotide sequence of interest encodes a protein of interest.

6. An expression cassette comprising the recombinant DNA construct of claim 4 or 5.

7. A recombinant vector comprising the expression cassette of claim 6.

8. A method of expressing a heterologous nucleotide sequence of interest in a plant, comprising, comprises: stably integrating into a plant cell a heterologous nucleotide sequence of interest operably linked to the constitutive promoter of any one of claims 1-3.

9. The method for expressing a heterologous nucleotide sequence of interest in a plant according to claim 8, wherein, the plant is Arabidopsis thaliana, Brassica napus, tobacco, soybean, cotton, pepper, sugar beet, pumpkin, eggplant, Chinese cabbage, carrot, tomato, pea, spinach, potato or peanut.

10. The method for expressing a heterologous nucleotide sequence of interest in a plant according to claim 8, wherein, constitutive expression in plant tissue of the heterologous nucleotide sequence of interest.

11. The method for expressing a heterologous nucleotide sequence of interest in a plant according to claim 8, wherein, the heterologous nucleotide sequence of interest encodes a protein of interest.

12. The method of expressing a heterologous nucleotide sequence of interest in a plant of claim 11, wherein, the heterologous nucleotide sequence of interest encodes a herbicide tolerance protein.

13. The method for expressing a heterologous nucleotide sequence of interest in a plant according to claim 11, wherein, the heterologous nucleotide sequence of interest encodes an insect resistance protein.

14. A plant or part, characterized in that, the constitutive promoter of any one of claims 1-3.

15. A method of obtaining processed agricultural products, characterized by, comprises processing a harvest of the plant or part of claim 14 to obtain a processed agricultural product.

16. Use of the constitutive promoter of any one of claims 1-3 for constitutive expression in plant tissue of a heterologous nucleotide sequence of interest.

17. Use of the constitutive promoter according to claim 16 for constitutive expression of a heterologous nucleotide sequence of interest in plant tissue, characterized in that, the plant is Arabidopsis thaliana, Brassica napus, tobacco, soybean, cotton, pepper, sugar beet, pumpkin, eggplant, Chinese cabbage, carrot, tomato, pea, spinach, potato or peanut.

18. Use of the constitutive promoter according to claim 16 for constitutive expression of a heterologous nucleotide sequence of interest in plant tissue, characterized in that, the heterologous nucleotide sequence of interest encodes a protein of interest.

Citation Information

Patent Citations

  • Tissue-specific promoter and application thereof

    CN102559677A

  • Constitutive promoter and application thereof

    CN103725679A

  • Compositions and methods for controlling gene expression

    US20190352664A1

  • Tissue-preferred promoters and methods of use

    US20200270622A1