Constitutive promoter and use thereof

Abstract

The present invention relates to a constitutive promoter and use thereof. The nucleotide sequence of the constitutive promoter comprises SEQ ID NO: 2, and the constitutive promoter is derived from SEQ ID NO: 1. The constitutive promoter shows activity in almost the majority of tissues and many types of cells of plants, especially in roots, stems, leaves, flowers, pod walls, and fruits of plants, and has broad application prospects in plants.

Description

Constitutive promoter and use thereof TECHNICAL FIELD

[0001] The present invention relates to a constitutive promoter and use thereof, in particular to a constitutive promoter from soybean Tsf gene and use thereof. BACKGROUND

[0002] One of the goals of plant genetic engineering is to produce plants with desirable characteristics or traits for agriculture, and the traits commonly desired include improved nutritional quality, increased yield, conferred disease and pest resistance, increased drought and stress tolerance, improved horticultural quality, and conferred herbicide resistance, etc. Current technological advances have enabled researchers to obtain exogenous polynucleotide molecules (e.g. heterologous or naturally derived genes) and integrate the polynucleotide molecules into plant genomes, and the genes are expressed in plant cells to exhibit corresponding traits. It is important that appropriate regulatory signals must be present in a suitable structure to obtain expression of the coding sequence of the newly inserted gene in plant cells. These regulatory signals typically include a promoter region, a 5' untranslated leader sequence, and a 3' transcription terminator / polyadenylation sequence.

[0003] Certain promoters are capable of directing RNA synthesis in a certain degree of expression level in most or all tissues and / or growth and development stages of plants, and these promoters are referred to as "constitutive promoters". Constitutive promoters can be divided into strong, medium and weak promoters according to their effects on directing RNA synthesis. Since in many cases it is necessary to express the target gene in different tissues of plants at the same time to obtain the desired gene function, constitutive promoters are particularly advantageous in the above-mentioned cases.

[0004] Some constitutive promoters that function in plant cells have been described in the prior art, including the promoter Gm17gTsf1 of the soybean cell elongation factor gene, the nopaline synthase (nos) promoter carried on the tumor-inducing plasmid of Agrobacterium tumefaciens, the octopine synthase (ocs) promoter, and the Caulimovirus promoters, such as the Caulimovirus (CaMV) 19S or 35S promoter, the CaMV 35S promoter with repeated enhancers, and the Figwort mosaic virus (FMV) 35S promoter, which have been applied in plant constructs for transgenic expression. Although some constitutive promoters have been obtained at present, there is still great interest in isolating more novel constitutive promoters that can control the expression of recombinant DNA constructs (or genes) at different levels, and be applied in gene stacking for the expression of multiple genes in the same transgenic plants.

[0005] SUMMARY

[0006] The object of the present application is to provide a new constitutive promoter and use thereof, which can enable efficient expression of a heterologous nucleotide sequence in plant tissues.

[0007] To achieve the above object, the present application provides a constitutive promoter, the nucleotide sequence of which comprises SEQ ID NO: 2, and the constitutive promoter is derived from SEQ ID NO: 1.

[0008] Further, the present application provides a constitutive promoter, the nucleotide sequence of which comprises SEQ ID NO: 2 and is selected from at least a part of SEQ ID NO: 1.

[0009] Further, the present application provides a constitutive promoter, the nucleotide sequence of which is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0010] To achieve the above object, the present application further provides a recombinant DNA construct comprising the above constitutive promoter operably linked to a heterologous nucleotide sequence of interest.

[0011] Further, the heterologous nucleotide sequence of interest encodes a protein of interest.

[0012] To achieve the above object, the present application further provides an expression cassette comprising the above recombinant DNA construct.

[0013] To achieve the above object, the present application further provides a recombinant vector comprising the above expression cassette.

[0014] To achieve the above object, the present application further provides a method for expressing a heterologous nucleotide sequence of interest in a plant, comprising: stably integrating the heterologous nucleotide sequence of interest operably linked to the above constitutive promoter into a plant cell.

[0015] Further, the plant is Arabidopsis thaliana, Brassica napus, tobacco, soybean, cotton, pepper, sugar beet, pumpkin, eggplant, Chinese cabbage, carrot, tomato, pea, spinach, potato or peanut.

[0016] Preferably, the heterologous nucleotide sequence of interest is expressed constitutively in plant tissues.

[0017] Further, the heterologous nucleotide sequence of interest encodes a protein of interest.

[0018] Preferably, the heterologous nucleotide sequence of interest encodes a herbicide-tolerance protein.

[0019] Preferably, the heterologous nucleotide sequence of interest encodes an insect-resistance protein.

[0020] To achieve the above object, the present application further provides a plant or part comprising the above constitutive promoter.

[0021] To achieve the above object, the present application further provides a method for obtaining processed agricultural products, comprising processing the harvest of the above plant or part to obtain processed agricultural products.

[0022] To achieve the above object, the present application further provides a use of the above constitutive promoter for constitutively expressing a heterologous nucleotide sequence of interest in plant tissues.

[0023] Preferably, the plant is Arabidopsis thaliana, Brassica, tobacco, soybean, cotton, pepper, sugar beet, pumpkin, eggplant, Chinese cabbage, carrot, tomato, pea, spinach, potato or peanut.

[0024] Further, the heterologous nucleotide sequence of interest encodes a protein of interest.

[0025] In the present application, the term "comprising" or "including" means "including but not limited to".

[0026] In the present application, the term "promoter" means a DNA regulatory region, usually containing a TATA box capable of directing RNA polymerase II to initiate RNA synthesis at an appropriate transcription initiation site of a particular coding sequence. In the present application, the term "gene" means any DNA fragment containing a region of DNA ("transcribed DNA region") that is transcribed into an RNA molecule (e.g., mRNA) under the control of appropriate regulatory regions (e.g., plant expressible promoter regions) in a cell. Thus, a gene can contain several operably linked DNA fragments, such as a promoter, a 5' untranslated leader sequence, a coding region, and a 3' untranslated region containing a polyadenylation site. An endogenous plant gene is a gene naturally found in a plant species. A recombinant DNA construct is any gene that is not normally found in a plant species, or any gene whose promoter is not associated with some or all of the transcribed DNA region or with at least another regulatory region of the gene in the natural situation.

[0027] The term "constitutive promoter" as used herein refers to a specific class of gene regulatory sequences. Under the control of such promoters, a gene is expressed to some extent in most or all tissues and / or growth and development stages of an organism. A constitutive promoter is used to express an operably linked gene or heterologous nucleotide sequence of interest in most cells of an organism, with some degree of persistence in the initiated expression. It is understood that for the term "constitutive promoter" there can be some variation in the absolute level of expression or activity between different tissues and developmental stages of an organism. The tissues are structural units in a plant body, which are composed of one or more types of cells of the same origin and performing the same function, such as protective tissue, conducting tissue, nutritive tissue, mechanical tissue, meristem tissue, several different tissues organically cooperate and closely contact to form different organs, and different organs cooperate with each other to more effectively complete the entire life activity process of the organism. The growth and development stages can be divided into embryonic stage, seedling stage, mature stage and senescence stage according to the differences in plant morphology and function.

[0028] The term "constitutive expression" as used herein refers to the relatively stable and persistent expression of a gene or heterologous nucleotide sequence of interest in most or all tissues and / or growth and development stages of a plant, for example, the cauliflower mosaic virus (CaMV) 35S promoter, which is capable of initiating high-intensity expression of a foreign gene in most organs and different developmental stages of a plant.

[0029] Isolated sequences having promoter activity and hybridizing to a promoter sequence of the present application or a fragment thereof under stringent conditions are included in the present application. These sequences are at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to a sequence of the present application. That is, the range of sequence identity is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity.

[0030] The present application provides a constitutive promoter whose nucleotide sequence comprises SEQ ID NO: 2 and is selected from at least a portion of SEQ ID NO: 1. SEQ ID NO: 2 is a fragment of SEQ ID NO: 1, and with reference to SEQ ID NO: 1, the constitutive promoter of the present application can be extended to the 5' end or the 3' end of SEQ ID NO: 2 alone or to both the 5' end and the 3' end of SEQ ID NO: 2, but the length of the nucleotide sequence extended to both ends cannot exceed the 5' end or the 3' end of SEQ ID NO: 1 itself. In other words, the constitutive promoter whose nucleotide sequence is shown as SEQ ID NO: 2, or with reference to SEQ ID NO: 1, the constitutive promoter obtained by extending either end of SEQ ID NO: 2 arbitrarily and the length of the extension does not exceed the 5' end or the 3' end of SEQ ID NO: 1 itself are all within the scope of the present application. Moreover, for such a constitutive promoter (with reference to SEQ ID NO: 1, the constitutive promoter obtained by extending either end of SEQ ID NO: 2 arbitrarily and the length of the extension does not exceed the 5' end or the 3' end of SEQ ID NO: 1 itself), the other nucleotide sequence included in the constitutive promoter other than SEQ ID NO: 2 does not affect the activity of the sequence of SEQ ID NO: 2 itself. The second embodiment of the present application also demonstrates this conclusion: the prGm8gTsf1-02 promoter (SEQ ID NO: 2) has activity, and the prGm8gTsf1-01 promoter (SEQ ID NO: 1) containing SEQ ID NO: 2 also has activity. Those skilled in the art can reasonably predict, based on the content described in the present application, that the constitutive promoter whose nucleotide sequence comprises SEQ ID NO: 2 and is selected from at least a portion of SEQ ID NO: 1 all have the same or similar activity as SEQ ID NO: 2.

[0031] The promoter sequences and fragments thereof of the present application, when assembled into a DNA construct to operably link the promoter sequence to a heterologous nucleotide sequence of interest, are used to genetically manipulate any plant. By "operably linked" is meant that the promoter sequence of the present application is functionally connected to a second sequence in which the promoter sequence initiates and modulates transcription of the DNA sequence corresponding to the second sequence. Generally, operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, are in the same reading frame. In this manner, the promoter nucleotide sequence and the heterologous nucleotide sequence of interest are provided together in an expression cassette to be expressed in a plant of interest. The expression cassette provides a number of restriction sites for insertion of the heterologous nucleotide sequence of interest which will be subject to transcriptional regulation by the regulatory regions comprising the promoter sequence of the present application. The expression cassette can additionally contain at least one additional gene to be co-transformed into the organism. Alternatively, the additional gene can be provided on a plurality of expression cassettes.

[0032] The expression cassette can additionally contain a selectable marker gene. Generally, the expression cassette will contain a selectable marker gene for selection of transformed cells. The selectable marker gene is used to select transformed cells or tissues. The selectable marker genes include, but are not limited to, genes encoding antibiotic resistance such as genes encoding neomycin phosphotransferase II (NPT) and hygromycin phosphotransferase (HPT), and genes conferring herbicide resistance such as phosphinothricin, bromoxynil, imidazolinone, and 2,4-dichlorophenoxyacetate (2,4-D) resistance genes.

[0033] The expression cassette includes the promoter sequence of the present application, a translation initiation region, a heterologous nucleotide sequence of interest, and a transcriptional and translational termination region functional in plants, transcribed in the 5'-3' direction. The heterologous nucleotide sequence of interest can be native or foreign or heterologous to the plant host. Alternatively, the heterologous nucleotide sequence of interest can be a native sequence or a selectively synthetic sequence. By "foreign" is meant that the introduced transcriptional initiation region does not exist naturally in the plant into which the transcriptional initiation region is introduced. For example, a recombinant DNA construct comprises a promoter sequence of the present application operably linked to a coding sequence that is different from the promoter sequence of the present application.

[0034] The termination region can be derived from the promoter sequence of the present application, from the operably linked heterologous nucleotide sequence of interest, or from another source. Conventional termination regions can be obtained from the Ti plasmid of Agrobacterium tumefaciens, such as the octopine synthase and nopaline synthase (NOS) termination regions.

[0035] In making the expression cassette, the various DNA fragments can be manipulated to provide the DNA sequences in the proper orientation and, in appropriate combinations, to provide the desired reading frame. In doing so, it can be necessary to employ linkers, adapters, restriction-site engineered sites, or other art-accepted methods, to provide for the proper orientation, reading frame, and accommodation of the desired DNA sequences. For these purposes, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, such as transitions and transversions, can be involved.

[0036] In appropriate cases, the heterologous nucleotide sequence of interest can be optimized to increase the amount of expression in the transformed plant. That is, the gene can be synthesized using plant-preferred codons to improve expression.

[0037] It is known in the art that additional sequence modifications can be made to increase the level of gene expression in a cellular host. These include but are not limited to removal of sequences encoding pseudoprolation signals, exon-intron splice site signals, transposon repeats, and other sequences that can be characterized as potentially deleterious to gene expression. The G-C content of the sequences can be adjusted to be at or near the average level known to be acceptable in the host cell of choice, calculated from the known gene expression levels in the host cell. The sequences can be modified to avoid predicted hairpin mRNA secondary structures.

[0038] In the expression cassette or recombinant vector, the expression cassette can additionally contain a 5' leader sequence. The leader sequence can serve to improve the efficiency of transcription. Leader sequences are known in the art and include, but are not limited to, picornavirus leader sequences, such as the EMCV leader (the 5' noncoding region of the encephalomyocarditis virus); potyvirus leaders, such as the TEV leader, the MDMV leader, and the human immunoglobulin heavy chain binding protein (BiP); the untranslated leader sequence from the mRNA of the coat protein of alfalfa mosaic virus (AMV RNA 4); the tobacco mosaic virus (TMV) leader; and the maize chlorotic mottle virus (MCMV) leader. Other art-recognized elements that improve transcription efficiency, such as introns, can also be used.

[0039] The promoter sequence of the present application can be used to initiate transcription of an antisense construct that is at least partially complementary to the messenger RNA (mRNA) of the heterologous nucleotide sequence of interest. Antisense nucleotide sequences are constructed to hybridize with the corresponding mRNA. The antisense sequence can be modified as long as it is long enough to hybridize with the corresponding mRNA and interfere with its expression. In this manner, an antisense construct having 80%, preferably 90%, more preferably 95% sequence identity with the corresponding antisense sequence can be used. In addition, a portion of the antisense nucleotide sequence can be used to disrupt the expression of the target gene. Generally, a sequence of at least 50 nucleotides, 100 nucleotides, 200 nucleotides, or more can be used.

[0040] The promoter sequences of the present application are used for constitutive expression of a heterologous nucleotide sequence of interest. A "heterologous nucleotide sequence" refers to a sequence that does not naturally occur with the promoter sequence. Although the nucleotide sequence is heterologous to the promoter sequence, it can be homologous or native or heterologous or foreign to the plant host. The heterologous nucleotide sequence operably linked to the promoter of the present application can encode a protein of interest. Examples of such heterologous nucleotide sequences include, but are not limited to, nucleotide sequences encoding polypeptides that confer resistance to abiotic stresses such as drought, temperature, salinity, ozone, and herbicides, or biotic stresses such as pathogen attack, including insects, viruses, bacteria, fungi, and nematodes, and prevent the development of disease that accompanies these organisms.

[0041] The herbicide tolerance proteins of the present application can express resistance and / or tolerance to herbicides. These genes include, but are not limited to, hydroxyphenylpyruvate dioxygenase (HPPD) genes, protoporphyrinogen oxidase (PPO) genes, acetolactate synthase (ALS) genes, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) genes, phosphinothricin acetyltransferase (PAT) genes, glyphosate oxidoreductase (GOX) genes, GAT genes, and the like.

[0042] In the present application, "insect resistance" refers to the avoidance by a plant of the symptoms and damage caused by the plant-insect interaction. That is, to prevent or alternatively to minimize or reduce plant damage, crop damage, plant deformation, and plant disease caused by insects. The insects can belong to the order Lepidoptera (e.g., corn earworm), Hemiptera (e.g., stink bugs), Coleoptera (e.g., beetles), Orthoptera (e.g., grasshoppers), Homoptera (e.g., aphids), Diptera (e.g., flies), and the like. Insect resistance proteins of interest are known in the art and include, but are not limited to, Bacillus thuringiensis toxic proteins; lectins, wherein lectins include snowdrop lectin, pea lectin, jack bean lectin, wheat germ agglutinin, potato lectin, peanut lectin, and the like; lipoxygenases, wherein lipoxygenases include pea lipoxygenase 1 or soybean lipoxygenase; insect chitinases, and the like.

[0043] Different pests transmit viruses from infected plants to healthy plants in different ways. The viruses include, but are not limited to, rice tungro bacilliform virus, tobacco mosaic virus, sweet potato feathery mottle virus, and sweet potato chlorotic dwarf virus, and the like. Thus, it can be desirable to constitutively express in plant tissues a heterologous nucleotide sequence that has anti-pathogen activity or minimizes the effects of a viral pathogen.

[0044] The promoter sequences and methods of the present application can be used to modulate the expression of any heterologous nucleotide sequence of interest in a plant host to alter the phenotype of the plant. Various phenotypic alterations of interest include, but are not limited to, altering the fatty acid composition of the plant, altering the amino acid content of the plant, altering the pathogen defense mechanisms of the plant, and the like. Such alterations can be obtained by providing for the expression of a heterologous product or increasing the expression of an endogenous product of the plant. Alternatively, such alterations can be obtained by decreasing the expression of one or more endogenous products of the plant, particularly enzymes or cofactors. Such alterations will result in a transformed plant having an altered phenotype.

[0045] The transformation protocol and the protocol for introducing the nucleotide sequence into the plant will vary depending on the type of plant or plant cell being transformed, i.e., monocot or dicot. Suitable methods for introducing the nucleotide sequence into the plant cell and subsequently into the plant genome include, but are not limited to, Agrobacterium-mediated transformation, microprojectile bombardment, direct DNA uptake into protoplasts, electroporation, or whisker silicon-mediated DNA introduction.

[0046] The transformed cells can be grown into plants in accordance with conventional ways. These plants are crossed with the same transformed strain or different transformed strains, and the progeny are evaluated for expression of the desired phenotypic characteristic. The progeny can be grown and evaluated for a second or more generations to ensure that the expression of the desired phenotypic characteristic is stable and inherited in the desired manner.

[0047] The term "plant" refers to the whole plant, including all plant and plant populations, such as those that occur naturally or by cultivation of plants or plant varieties, including plants that contain one or more imported DNA sequences. The plant can be a plant that has been modified using methods of genetic engineering or by optimized breeding or by a combination of these methods.

[0048] The term "plant part" includes plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or in plant parts such as leaves, pollen, embryos, flowers, seeds, roots, root tips, anthers, and the like. It is understood that plant parts of transgenic plants within the scope of the application include, but are not limited to, plant cells, protoplasts, tissues, callus, embryos, and flowers, stems, fruits, leaves and roots, the latter three derived from the transformed plant or its progeny and which have at least one cell that contains a transgene.

[0049] In one aspect, the plant part is a plant cell. In yet another aspect, the plant part is a non-regenerable cell or a regenerable cell. In another aspect, the plant cell is a somatic cell.

[0050] Non-regenerable cells are cells that cannot be regenerated into a whole plant through in vitro culture. Non-regenerable cells can be in a plant or plant part (e.g. a leaf) of the application. Non-regenerable cells can be in a seed or the seed coat of the seed. A mature plant organ (including a mature leaf, a mature stem or a mature root) comprises at least one non-regenerable cell.

[0051] In another aspect, the plant cell is a reproductive cell, such as an ovule or a cell that is part of pollen. In one aspect, the pollen cell is a vegetative (non-reproductive) cell, or a sperm cell.

[0052] The present application provides a harvest of a plant or part comprising the constitutive promoter of the application for processing to obtain a processed agricultural product. The term "processed agricultural product" refers to any composition or product that is composed of material derived from a plant, seed, plant cell or plant part comprising the constitutive promoter of the application. In particular, the term "processed agricultural product" includes, but is not limited to, protein concentrate, protein isolate, starch, flour, biomass and seed oil.

[0053] The present application provides a constitutive promoter and uses thereof, with the following advantages:

[0054] 1. The present application discloses a constitutive promoter from soybean Tsf gene for the first time, the nucleotide sequence of the constitutive promoter comprises SEQ ID NO: 2, and is derived from SEQ ID NO: 1.

[0055] 2. The constitutive promoter of the present application shows activity in almost all tissues and many types of cells of plants, especially in the roots, stems, leaves, flowers, pod skins and fruits of plants.

[0056] 3. The constitutive promoter of the present application can drive constitutive expression of an exogenous gene in plant tissues.

[0057] The technical solutions of the present application are described in further detail below with the aid of the accompanying drawings and examples. BRIEF DESCRIPTION OF DRAWINGS

[0058] Figure 1 is a schematic diagram of the structure of the vector DBNBC-Dual_LUC containing LUC and REN reporter genes of the present application;

[0059] Figure 2 is a schematic diagram of the structure of the recombinant expression vector DBN11-N containing the prGm8gTsf1-01 promoter sequence of the present application;

[0060] Figure 3 is a schematic diagram of the structure of the vector DBNBC-HTG containing the herbicide-tolerant gene HTG of the present application;

[0061] Figure 4 is a schematic diagram of the structure of the recombinant expression vector DBN18-N of the present application. DETAILED DESCRIPTION

[0062] The technical solutions of the constitutive promoter and the use thereof of the present application are further illustrated below through specific examples.

[0063] The first embodiment, obtaining the constitutive promoter of the present application

[0064] 1. Obtaining the prGm8gTsf1-01 promoter sequence

[0065] By querying the soybean expression profile database (ePlant (utoronto.ca)), genes with high abundance expression in root, stem, leaf, flower, pod, fruit and other tissues can be retrieved. The 2562bp sequence upstream of the gene Glyma.08g170000 is selected and named as the promoter prGm8gTsf1-01. The soybean variety JACK genomic DNA sequence is used as the PCR amplification template, and primer 1 and primer 2 are designed to perform PCR amplification:

[0066] Primer 1: 5'-ttgattacagtataaaaaacttt-3', as shown in SEQ ID NO: 5 in the sequence listing;

[0067] Primer 2: 5'-tttgattaggccttagtttccaa-3', as shown in SEQ ID NO: 6 in the sequence listing.

[0068] The PCR reaction system is as follows:

[0069] The primers comprise 2.5μL of each primer at a concentration of 10uM, and the reaction buffer is the reaction buffer in the New England Biolabs High-Fidelity DNA Polymerase kit. In the above PCR reaction system, supplement with nuclease-free water to 50μL. The specific operation steps are carried out according to the New England Biolabs PCR Using High-Fidelity DNA Polymerase (M0491) kit instructions.

[0070] The PCR reaction conditions are as follows:

[0071] ​​​The PCR amplification product is connected with the blunt end Blunt vector (Clontech cloning vector, Beijing), and the operation steps are performed according to the Blunt vector instruction of Clontech product, and then the connection product is sequenced (Sanger sequencing), and the prGm8gTsf1-01 promoter sequence is confirmed, as shown in SEQ ID NO: 1 in the sequence listing.

[0072] 2, obtain prGm8gTsf1-02, prGm8gTsf1-03 and prGm8gTsf1-04 promoter sequences

[0073] The prGm8gTsf1-01 gene sequence is used as a PCR amplification template, and the following primer pairs are designed respectively: primer 2 (SEQ ID NO: 6) and primer 3 (SEQ ID NO: 7), primer 2 (SEQ ID NO: 6) and primer 4 (SEQ ID NO: 8), primer 2 (SEQ ID NO: 6) and primer 5 (SEQ ID NO: 9), and the above-mentioned primer pairs are used for PCR amplification reaction according to the method of obtaining the prGm8gTsf1-01 promoter sequence, and the prGm8gTsf1-02 promoter sequence (SEQ ID NO: 2), the prGm8gTsf1-03 promoter sequence (SEQ ID NO: 3) and the prGm8gTsf1-04 promoter sequence (SEQ ID NO: 4) are obtained in turn.

[0074] 3, synthesis of the above-mentioned prGm8gTsf1-01 to prGm8gTsf1-04 promoter sequences

[0075] The 5' and 3' ends of the above-mentioned prGm8gTsf1-01 promoter sequence, prGm8gTsf1-02 promoter sequence, prGm8gTsf1-03 promoter sequence, prGm8gTsf1-04 promoter sequence and prGm17gTsf1 control promoter sequence (SEQ ID NO: 10), pr35S control promoter sequence (SEQ ID NO: 11) and prAtH4A748: lTEV chimeric control promoter sequence (SEQ ID NO: 12) are connected with universal adapter primer 1 respectively:

[0076] 5' end universal adapter primer 1: 5'-ctaaaaccaaaatccagtggactagt-3', as shown in SEQ ID NO: 13 in the sequence listing;

[0077] 3' end universal adapter primer 1: 5'-atgtttttggcgtcttccat-3', as shown in SEQ ID NO: 14 in the sequence listing.

[0078] Second embodiment, verification of the effect of the promoter element driving the expression of the LUC reporter gene in transgenic tobacco

[0079] 1. Introducing the Dual-Luciferase Reporter system, respectively constructing recombinant expression vectors containing prGm8gTsf1-01 promoter sequence, recombinant expression vectors containing prGm8gTsf1-02 promoter sequence, recombinant expression vectors containing prGm8gTsf1-03 promoter sequence, recombinant expression vectors containing prGm8gTsf1-04 promoter sequence.

[0080] The construction of vectors using conventional enzyme digestion methods is well known to those skilled in the art. The structure of the vector DBNBC-Dual_LUC (vector backbone: pCAMBIA2301 (CAMBIA company can provide) with resistance label modified) containing LUC and REN reporter genes is shown in Figure 1 (Spec: spectinomycin gene; RB: right border; prAtAct2: Arabidopsis thaliana Act2 gene promoter (SEQ ID NO: 15); REN: Renilla luciferase gene (SEQ ID NO: 16); t35s: cauliflower virus 35s terminator (SEQ ID NO: 17); Spel: restriction endonuclease Spel recognition site; LUC: firefly luciferase gene (SEQ ID NO: 18); tPsE9: terminator of pea RbcS gene (SEQ ID NO: 19); prAtUbi10: promoter of Arabidopsis thaliana ubiquitin 10 gene (SEQ ID NO: 20); spAtCTP2: Arabidopsis thaliana chloroplast transit peptide (SEQ ID NO: 21); cEPSPS: 5-enolpyruvate shikimate-3-phosphate synthase gene (SEQ ID NO: 22); tNos: terminator of nopaline synthase gene (SEQ ID NO: 23); LB: left border).

[0081] The above-mentioned vector DBNBC-Dual_LUC was subjected to a restriction enzyme cleavage reaction with a restriction enzyme Spe I, thereby linearizing the vector DBNBC-Dual_LUC, and the linearized DBNBC-Dual_LUC expression vector was obtained by purifying the cleavage product. The prGm8gTsf1-01 promoter sequence of the universal linker primer 1 was subjected to a recombination reaction with the linearized DBNBC-Dual_LUC expression vector, and the operation steps were performed according to the instructions of the Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949), thereby constructing a recombinant expression vector DBN11-N, and the structural diagram thereof is shown in FIG. 2.

[0082] The recombinant expression vector DBN11-N is transformed into E. coli DH5a competent cells by heat shock method. The heat shock conditions are as follows: 100 μL of E. coli DH5a competent cells, 20 μL of recombinant plasmid DNA (recombinant expression vector DBN11-N), mix gently, heat shock at 42°C for 30 s, immediately place on ice for 2 min; add 250 μL of antibiotic-free LB liquid medium (10 g / L of tryptone, 5 g / L of yeast extract, 10 g / L of NaCl, adjust pH to 7.5 with NaOH), incubate at 37°C with shaking (200 rpm / min) for 1 h. Then invert culture at a temperature of 37°C for 12 h on the LB solid plate containing 50 mg / L of spectinomycin, pick positive clone colonies, and incubate at a temperature of 37°C with shaking (200 rpm / min) overnight in LB liquid medium containing 50 mg / L of spectinomycin. Extract the plasmid by alkaline lysis method: centrifuge the bacterial solution at a speed of 12000 rpm for 1 min, remove the supernatant, and suspend the precipitated bacterial cells with 100 μL of ice-precooled solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH = 8.0); add 200 μL of freshly prepared solution II (0.2 M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times, mix, and place on ice for 3-5 min; add 150 μL of ice-cold solution III (3 M potassium acetate, 5 M acetic acid), mix thoroughly immediately, and place on ice for 5-10 min; centrifuge at a temperature of 4°C and a speed of 12000 rpm for 5 min, transfer the supernatant to a new 2 mL centrifuge tube, add 2 volumes of absolute ethanol, mix, and place at room temperature for 5 min; centrifuge at a temperature of 4°C and a speed of 12000 rpm for 5 min, discard the supernatant, and dry the precipitate after washing with 70% (V / V) ethanol; add 30 μL of TE (10 mM Tris-HCl, 1 mM EDTA, pH = 8.0) containing RNase (20 μg / mL) to dissolve the precipitate; digest RNA in a water bath at a temperature of 37°C for 30 min; and store at -20°C for later use. The extracted plasmid is sequenced and identified. The results show that the recombinant expression vector DBN11-N contains the nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing, i.e., the prGm8gTsf1-01 promoter sequence.

[0083] According to the above method of constructing the recombinant expression vector DBN11-N containing the prGm8gTsf1-01 promoter sequence, the prGm8gTsf1-02 promoter sequence connected with the universal adapter primer 1, the prGm8gTsf1-03 promoter sequence connected with the universal adapter primer 1, the prGm8gTsf1-04 promoter sequence connected with the universal adapter primer 1, the prGm17gTsf1 control promoter sequence connected with the universal adapter primer 1, the pr35S control promoter sequence connected with the universal adapter primer 1, and the prAtH4A748:ITEV chimeric control promoter sequence connected with the universal adapter primer 1 are respectively recombined with the linearized DBNBC-Dual_LUC expression vector to sequentially obtain recombinant expression vectors DBN12-N to DBN17-N, and the correct insertion of the above nucleotide sequences in the recombinant expression vectors DBN12-N to DBN17-N is verified by sequencing.

[0084] 2. Transformation of Agrobacterium with recombinant expression vector

[0085] The correctly constructed recombinant expression vectors DBN11-N to DBN17-N are respectively transformed into Agrobacterium LBA4404 (Invitrogen, Chicago, USA; Cat. No: 18313-015) by liquid nitrogen method, and the transformation conditions are as follows: 100 μL of Agrobacterium LBA4404, 3 μL of plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 min, and then placed in a 37°C water bath for 10 min; the transformed Agrobacterium LBA4404 is inoculated into an LB test tube and cultured at a temperature of 28°C and a rotation speed of 200 rpm for 2 h, and then spread on an LB solid plate containing 50 mg / L of rifampicin and 50 mg / L of spectinomycin until positive monoclonal colonies are grown, and the monoclonal colonies are cultured and the plasmid is extracted, and the extracted plasmid is identified by sequencing, and the results show that the structures of the recombinant expression vectors DBN11-N to DBN17-N are completely correct.

[0086] 3. Tobacco leaf transient transformation

[0087] Tobacco leaves are high-efficiency protein expression bioreactors, and foreign genes are introduced into tobacco leaves by Agrobacterium injection infiltration method for expression, and high-throughput protein expression is used to verify the effect of the constitutive promoter of the application.

[0088] The tobacco leaf transformation method is as follows:

[0089] Step 1, planting tobacco, culturing tobacco under the conditions of 14 h light / 10 h darkness, a temperature of 25°C, and a relative humidity of 70% for 4-5 weeks, and collecting tobacco leaves;

[0090] Step 2, the Agrobacterium strains transformed with the recombinant expression vectors DBN11-N, DBN12-N, DBN13-N, DBN14-N, DBN15-N, DBN16-N and DBN17-N in part 2 of this example were picked successively and inoculated into 1 mL of LB liquid medium (Tryptone 10 g / L, Yeast extract 10 g / L, NaCl 5 g / L, Rifampicin 50 mg / mL, Spectinomycin 50 mg / mL, Tetracycline 10 mg / mL) containing antibiotics, and cultured at 28°C with shaking (200 rpm) until the Agrobacterium entered the logarithmic growth phase (OD 600 = 0.5-0.6), 1 mL of the logarithmic growth phase Agrobacterium was taken and transferred into 20 mL of LB liquid medium (Tryptone 10 g / L, Yeast extract 10 g / L, NaCl 5 g / L, Rifampicin 50 mg / mL, Spectinomycin 50 mg / mL, Tetracycline 10 mg / mL) containing antibiotics, and cultured at 28°C with shaking (200 rpm) until the Agrobacterium entered the logarithmic growth phase (OD 600 = 0.5-0.6), centrifuged at room temperature at 5000 rpm for 10 min, the bacterial cells were collected, and the Agrobacterium was suspended in infiltration solution (containing 10 mM MgCl2, 10 mM MES, 150 uM acetosyringone, pH = 5.6) to OD 600 = 0.8, and allowed to stand at room temperature for 2-3 h, to obtain Agrobacterium strains transformed with the recombinant expression vectors DBN11-N to DBN17-N for injection, respectively;

[0091] Step 3: Using a 1mL needle, gently make a small incision on the back of the tobacco leaf obtained in Step 1 of this embodiment (be careful not to puncture). Then, using a syringe without the needle, draw up the Agrobacterium tumefaciens bacterial solution transformed with recombinant expression vectors DBN11-N to DBN17-N in Step 2 of this embodiment and inject it into the tobacco leaf through the small incision. This will allow the T-DNA (including the prAtAct2 promoter sequence, REN gene sequence, t35s terminator sequence, and sequences selected from the prGm8gTsf1-01 promoter sequence and prGm8gTsf1-01 promoter sequence, respectively) from the recombinant expression vectors DBN11-N to DBN17-N to be injected into the tobacco leaf. The following promoter sequences were transferred into tobacco leaves: Tsf1-02 promoter sequence, prGm8gTsf1-03 promoter sequence, prGm8gTsf1-04 promoter sequence, prGm17gTsf1 control promoter sequence, pr35S control promoter sequence, one of the prAtH4A748:lTEV chimeric control promoter sequences, LUC gene sequence, tPsE9 terminator sequence, prAtUbi10 promoter sequence, spAtCTP2 nucleotide sequence, cEPSPS gene sequence, and tNos terminator sequence; wild-type tobacco leaves (CK1) were used as a control. Water-stained areas on the tobacco leaves were marked with a marker.

[0092] Step 4: Place the tobacco leaves injected in Step 3 of this embodiment and the wild-type tobacco leaves in the dark for 12 hours, and then incubate them in a constant temperature incubator at 21°C for 2 days. Cut off the labeled areas of the tobacco leaves, and take three equal mass portions of leaves with labeled areas of recombinant expression vectors DBN11-N to DBN17-N and wild-type tobacco leaves as biological replicates. Freeze-mill them in liquid nitrogen, and then add 1×Passive lysis buffer (PLB) buffer to each. Centrifuge at 12000 rpm for 10 min at 4°C, and collect the supernatant for later use.

[0093] 4. Detection of the effect of the constitutive promoter of the present invention on driving LUC reporter gene expression in tobacco leaves.

[0094] Step 5: Take 100 μL of the supernatant from Step 4 above, add it to an ELISA plate, and set up 3 replicates. Add 100 μL of 1× firefly luciferase reaction solution LAR II (dissolve the lyophilized luciferase assay substrate in luciferase assay buffer II (Promega)). The luciferase activity of fireflies was obtained from the Reporter Assay System (E1960) kit and stored at -80°C protected from light. After shaking the plate to mix, the activity was measured using a BioTek-H1MF microplate reader. The measurement was completed within 30 minutes. The unit of the measured luciferase activity value is RLU (relative light unit).

[0095] Step 6, add 100 μL 1x Renilla luciferase reaction liquid Stop & Glo (dissolve 200 μL of Stop & Glo Substrate (50x) in 10 mL of Stop & Glo buffer to obtain, avoid light storage at -80°C), shake plate mixing, using a microplate reader BioTek-H1MF to detect Renilla luciferase (REN) activity value, detection is completed within 30 min, the detection of Renilla luciferase activity value unit is RLU (relative light unit).

[0096] In order to eliminate the different transformation efficiencies of plant tissues due to the infection of Agrobacterium and other factors, the REN gene was used as an internal reference, and the LUC / REN ratio reflected the relative activity strength of the promoter (LUC / REN ratio = (LUC value of tobacco leaves transformed with different recombinant expression vectors - LUC value of wild type tobacco leaves) / (REN value of tobacco leaves transformed with different recombinant expression vectors - REN value of wild type tobacco leaves)). The test results of LUC and REN enzyme activity detection of transiently transformed tobacco leaves are shown in Table 1.

[0097] Table 1, LUC and REN enzyme activity values and LUC / REN ratio in transiently transformed tobacco leaves

[0098] The results of Table 1 show that: (1) the promoters prGm8gTsf1-01 and prGm8gTsf1-02 have universal activity, which can drive LUC gene expression in tobacco leaves; the LUC / REN values of prGm8gTsf1-03 and prGm8gTsf1-04 are 0, indicating that prGm8gTsf1-03 and prGm8gTsf1-04 have no promoter activity. (2) Compared with the prAtH4A748:lTEV control promoter, prGm8gTsf1-01 and prGm8gTsf1-02 have higher activity in driving LUC gene expression in tobacco leaves.

[0099] Third embodiment, verification of the effect of the promoter element driving LUC reporter gene expression in transgenic Arabidopsis

[0100] 1. Transformation of Agrobacterium with recombinant expression vector

[0101] The recombination expression vectors DBN11-N, DBN15-N to DBN17-N which have been constructed correctly in part 1 of the above second embodiment were respectively transformed into Agrobacterium GV3101 by liquid nitrogen method, and the transformation conditions were as follows: 100 μL Agrobacterium GV3101, 3 μL plasmid DNA (recombination expression vector); placed in liquid nitrogen for 10 min, 37°C warm water bath for 10 min; the transformed Agrobacterium GV3101 was inoculated into LB test tube and cultured at a temperature of 28°C and a rotation speed of 200 rpm for 2 h, and then coated on the LB solid plate containing 50 mg / L of rifampicin and 50 mg / L of spectinomycin until positive monoclonal was grown, the monoclonal was picked and cultured, and the plasmid was extracted, and the extracted plasmid was sequenced and identified, and the results showed that the recombination expression vectors DBN11-N, DBN15-N to DBN17-N were completely correct in structure.

[0102] 2. Obtaining of transgenic Arabidopsis plant

[0103] Wild-type Arabidopsis seeds were suspended in 0.1% (w / v) agarose solution. The suspended seeds were stored at 4°C for 2 days to complete the need for dormancy to ensure synchronized germination of the seeds. Vermiculite mixed with horse manure soil and bottom irrigated with water to wet, the soil mixture was drained for 24 h. The pretreated seeds were planted on the soil mixture and covered with a humidity cover for 7 days. The seeds were germinated and the plants were cultured in a greenhouse under long-day conditions (16 h light / 8 h dark) with constant temperature (22°C) and constant humidity (40-50%) and light intensity of 120-150 μmol / m 2 s -1 The plants were initially irrigated with Hoagland's nutrient solution, and then with deionized water, keeping the soil moist but not waterlogged.

[0104] Flowers were transformed using the flower dip method. One or more 15-30 mL pre-cultures of LB broth (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, pH 7.5 adjusted with NaOH) containing spectinomycin (50 mg / L) and rifampicin (10 mg / L) were inoculated with selected Agrobacterium colonies. The pre-cultures were incubated overnight at 28°C with constant shaking at 220 rpm. Each pre-culture was used to inoculate two 500 mL cultures of the LB broth containing spectinomycin (50 mg / L) and rifampicin (10 mg / L) and the cultures were incubated overnight at 28°C with constant shaking. The cells were pelleted by centrifugation at room temperature for 20 min at approximately 4000 rpm and the resulting supernatant was discarded. The cell pellet was gently resuspended in 500 mL of a osmotic medium containing ½ x MS salts / B5 vitamins, 10% (w / v) sucrose, 0.044 μΜ benzylaminopurine (10 μL / L (1 mg / mL stock in DMSO)) and 300 μL / L Silwet L-77. Approximately 1 month old Arabidopsis plants were dipped in the osmotic medium with resuspended cells for 5 min, ensuring that the newest inflorescences were submerged. The Arabidopsis plants were then laid on their side and covered, and were kept moist in the dark for 24 h, and were grown normally under a 16 h light / 8 h dark photoperiod at 22°C. Seeds were harvested approximately 4 weeks later.

[0105] Newly harvested (containing prGm8gTsf1-01 promoter sequence, prGm17gTsf1 control promoter sequence, pr35S control promoter sequence, prAtH4A748:1TEV chimeric control promoter sequence) T1 seeds were dried at room temperature for 7 days. Seeds were sown in 26.5 cm x 51 cm germination trays, with each tray receiving 200 mg of T1 seeds (approximately 10,000 seeds), which had been previously suspended in distilled water and stored at 4°C for 2 days to complete the need for dormancy to ensure synchronized germination of the seeds.

[0106] The vermiculite was mixed with horse manure and bottom watered to moist with gravity drainage. The pretreated seeds were evenly sown on the soil mixture using a pipette and covered with a humidity dome for 4-5 days. The dome was removed 1 day before initial transformant selection using post-emergence spraying of glyphosate (selecting for the co-transformed EPSPS gene).

[0107] T1 plants (cotyledon stage and 2-4 leaf stage, respectively) were sprayed with a 0.5% solution of Roundup herbicide (glyphosate at 356 g ae / L) using a DeVilbiss compressed air nozzle at a spray volume of 10 mL / plate (703 L / ha) at 7 days after planting (DAP) and again at 11 DAP to provide an effective amount of glyphosate of 420 g ae / ha per application. Surviving plants (actively growing plants) were identified 4-7 days after the last spray and transplanted into 7 cm x 7 cm square pots prepared with horse manure and vermiculite (2-4 plants per pot). Transplanted plants were covered with a humidity dome for 3-4 days and placed in a temperature 22°C growth chamber or directly into the greenhouse as before. The dome was then removed and plants were transplanted into the greenhouse (temperature 22 ± 5°C, 50 ± 30% RH, 14 h light: 10 h dark, minimum 500 μE / m2s natural + supplemental light) at least 1 day before testing the effect of the promoter element driving the LUC reporter gene. 2 -1 Natural + supplemental light).

[0108] 3. Testing the effect of the constitutive promoter of the present application to drive LUC reporter gene expression in different tissues of Arabidopsis

[0109] T1 transformants were selected from the untransformed seed background using the glyphosate selection scheme. Arabidopsis T1 plants transformed with the prGm8gTsf1-01 promoter sequence, Arabidopsis T1 plants transformed with the prGm17gTsf1 control promoter sequence, Arabidopsis T1 plants transformed with the pr35S control promoter sequence and Arabidopsis T1 plants transformed with the prAtH4A748:1TEV chimeric control promoter sequence of Part 2 of this example were sampled at different times in different parts of the above-mentioned Arabidopsis T1 plants as test samples:

[0110] At rosette stage, 3 parts were sampled as test samples: root, stem and leaf;

[0111] At bolting stage, 4 parts were sampled as test samples: root, stem, leaf and flower;

[0112] At mature stage, 4 parts were sampled as test samples: root, stem, leaf and pod.

[0113] Wild type Arabidopsis (CK2) at the same growth stage and in the same part were sampled as negative control samples.

[0114] ​Three identical samples were taken from different parts of the plant at different stages of the recombinant expression vectors DBN11-N, DBN15-N to DBN17-N, and negative control samples from the same part of the wild-type Arabidopsis thaliana plant at the same stage as biological replicates. The samples were cryogenically ground in liquid nitrogen, and then 1×PLB buffer was added to each sample. The samples were centrifuged at 12,000 rpm for 10 min at 4 °C, and the supernatant was collected for later use.

[0115] The activity of dual-luciferase inhibitors (LCIs) in the test samples and negative control samples was detected according to steps 5 and 6 in Example 4 of the second embodiment. The REN gene was used as an internal control. The LUC / REN ratio reflected the relative activity intensity of the promoter (LCI / REN ratio = (LCI value of test samples transformed into different recombinant expression vectors at different times and locations - LUC value of wild-type plants at the same time and location) / (REN value of test samples transformed into different recombinant expression vectors at different times and locations - REN value of wild-type plants at the same time and location)). The LUC / REN ratios of stably transformed Arabidopsis thaliana at different times and locations are shown in Table 2.

[0116] Table 2. Ratio of LUC / REN in different parts of Arabidopsis thaliana at different stages of stable transformation.

[0117] The results in Table 2 show that: (1) The promoter prGm8gTsf1-01 of this invention is active and is expressed in the roots, stems, leaves, flowers, and pods of Arabidopsis thaliana plants, indicating that the promoter prGm8gTsf1-01 can drive the constitutive expression of the target heterologous gene in the plant. (2) In the leaves, stems, and roots of Arabidopsis thaliana plants at the rosette, bolting, and maturity stages, prGm8gTsf1-01 has a higher activity in driving LUC gene expression compared with the prAtH4A748:lTEV control promoter. (3) In the pods of mature Arabidopsis thaliana plants, prGm8gTsf1-01 has a higher activity in driving LUC gene expression compared with the prGm17gTsf1, pr35S, and prAtH4A748:lTEV control promoters. (4) In the flowers of Arabidopsis thaliana during the bolting stage, the prGm8gTsf1-01 promoter showed higher activity in driving LUC gene expression compared with the prAtH4A748:lTEV control promoter.

[0118] Fourth Example: Validation of the effect of promoter elements driving LUC reporter gene expression in transgenic soybeans

[0119] 1. Transformation of Agrobacterium with recombinant expression vector

[0120] The correctly constructed recombinant expression vectors DBN11-N, DBN15-N to DBN17-N were transformed into Agrobacterium EHA101 using the liquid nitrogen method. The transformation conditions were as follows: 100 μL Agrobacterium EHA101, 3 μL plasmid DNA (recombinant expression vector); incubation in liquid nitrogen for 10 min, followed by a 37°C water bath for 10 min; the transformed Agrobacterium EHA101 was inoculated into LB tubes and cultured at 28°C and 200 rpm for 2 h; then plated onto LB agar plates containing 50 mg / L rifampicin and 50 mg / L spectinomycin until positive single colonies grew. Single colonies were picked, cultured, and their plasmids were extracted. The extracted plasmids were sequenced and identified, and the results showed that the recombinant expression vectors DBN11-N, DBN15-N to DBN17-N had completely correct structures.

[0121] 2. Obtaining transgenic soybean plants

[0122] Following the conventional Agrobacterium infection method, cotyledonary node tissues of aseptically cultured soybean variety SY2043C were co-cultured with the Agrobacterium described in Example 1 to transmit the T-DNA (including the prAtAct2 promoter sequence, REN gene sequence, t35S terminator sequence, and sequences selected from the prGm8gTsf1-01 promoter sequence, prGm17gTsf1 control promoter sequence, pr35S control promoter sequence, and prAtH4A748:lTEV) from the recombinant expression vectors DBN11-N, DBN15-N to DBN17-N to the target gene. The following sequences (one of the control promoter sequences, LUC gene sequence, tPsE9 terminator sequence, prAtUbi10 promoter sequence, spAtCTP2 nucleotide sequence, cEPSPS gene sequence, and tNos terminator sequence) were transferred into the soybean chromosome, resulting in soybean plants with the prGm8gTsf1-01 promoter sequence, soybean plants with the prGm17gTsf1 control promoter sequence, soybean plants with the pr35S control promoter sequence, and soybean plants with the prAtH4A748:lTEV chimeric control promoter sequence.

[0123] For Agrobacterium-mediated soybean transformation, mature soybean seeds were germinated in soybean germination medium (3.1 g / L B5 salt, B5 vitamin, 20 g / L sucrose, 8 g / L agar, pH 5.6). Seeds were inoculated onto the germination medium and cultured under the following conditions: temperature 25 ± 1℃; photoperiod (light / dark) 16 / 8 h. One day after germination, a cotyledon and the first true leaf were removed and inoculated onto a pretreated medium containing cytokinins (MS salt 4.3 g / L, vitamin B5, sucrose 20 g / L, agar 8 g / L, 2-morpholinoethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, 6-benzyladenine (6-BAP) 1 mg / L, acetylsyringone (AS) 40 mg / L, pH = 5.3). Three days after inoculation on the pretreated medium, the cotyledonary node was wounded with the back of a scalpel, and Agrobacterium suspension was applied to the wounded cotyledonary node tissue. Agrobacterium can deliver the prGm8gTsf1-01 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence, and the prAtH4A748:lTEV chimeric control promoter sequence to the wounded cotyledonary node tissue (Step 1: Infection Step). In this step, the cotyledonary node tissue is preferably immersed in Agrobacterium suspension (OD). 660=0.5-0.8, inoculated in infection medium (MS salt 2.15 g / L, vitamin B5, sucrose 20 g / L, glucose 10 g / L, acetylsuccinone (AS) 40 mg / L, 2-morpholinoethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, pH 5.3). Cotyledonary tissue is co-cultured with Agrobacterium for a period (3 days) (Step 2: Co-culture step). Preferably, after the infection step, the cotyledonary tissue is cultured on solid medium (MS salt 4.3 g / L, vitamin B5, sucrose 20 g / L, glucose 10 g / L, MES 4 g / L, ZT 2 mg / L, agar 8 g / L, pH 5.6). After this co-culture phase, a selective "recovery" step can be performed. In the "recovery" step, the recovery medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, ZT 2 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamate 100 mg / L, aspartic acid 100 mg / L, pH 5.6) contains at least one known antibiotic that inhibits the growth of Agrobacterium (cephalosporin 150-250 mg / L), without adding a selector for plant transformants (Step 3: Recovery Step). Preferably, the cotyledonary node regenerated tissue blocks are cultured on a solid medium containing antibiotics but without a selector to eliminate Agrobacterium and provide a recovery period for infected cells. Next, the cotyledonary node regenerated tissue blocks are cultured on a medium containing a selector (glyphosate) and the growing transformed callus is selected (Step 4: Selection Step). Preferably, the cotyledonary regenerated tissue blocks are cultured on a selective solid medium containing a selector (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, 6-benzyladenine (6-BAP) 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamate 100 mg / L, aspartic acid 100 mg / L, N-(phosphonocarboxymethyl)glycine 0.25 mol / L, pH 5.6), leading to selective growth of the transformed cells. The transformed cells then regenerate into plants (step 5: regeneration step). Preferably, the cotyledonary regenerated tissue blocks grown on the selective medium are cultured on solid media (B5 differentiation medium and B5 rooting medium) to regenerate plants.

[0124] The selected resistant tissue blocks were transferred to the B5 differentiation medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, ZT 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamate 50 mg / L, aspartic acid 50 mg / L, gibberellin 1 mg / L, auxin 1 mg / L, N-(phosphocarboxymethyl)glycine 0.25 mol / L, pH 5.6) and cultured at 25°C for differentiation. The differentiated seedlings were transferred to the B5 rooting medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, agar 8 g / L, cephalosporin 150 mg / L, indole-3-butyric acid (IBA) 1 mg / L) and cultured at 25°C until approximately 10 cm tall, then transferred to a greenhouse for further cultivation until fruit set. In the greenhouse, the plants were cultured at 26°C for 16 hours each day, followed by 8 hours at 20°C.

[0125] 3. Verify transgenic soybean plants using TaqMan

[0126] Approximately 100 mg of leaves were collected from soybean plants transformed with the prGm8gTsf1-01 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence, and the prAtH4A748:lTEV chimeric control promoter sequence, respectively. Genomic DNA was extracted using Qiagen's DNeasy Plant Maxi Kit. The copy number of the EPSPS gene was determined by TaqMan probe-based quantitative PCR to identify the copy numbers of the prGm8gTsf1-01, prGm17gTsf1, pr35S, and prAtH4A748:lTEV genes. Wild-type soybean plants were used as controls, and the analysis was performed according to the following method. The experiment was repeated in triplicate, and the average value was used.

[0127] The specific method for detecting the EPSPS gene copy number is as follows:

[0128] Step 6: Take 100 mg of leaves from soybean plants transformed with the prGm8gTsf1-01 promoter sequence, soybean plants transformed with the prGm17gTsf1 control promoter sequence, soybean plants transformed with the pr35S control promoter sequence, soybean plants transformed with the prAtH4A748:lTEV chimeric control promoter sequence, and wild-type soybean plants, respectively. Grind each sample into a homogenate in a mortar using liquid nitrogen. Take 3 replicates for each sample.

[0129] Step 7: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. Refer to the product manual for specific methods.

[0130] Step 8: Determine the genomic DNA concentration of the above samples using NanoDrop 2000 (Thermo Scientific);

[0131] Step 9: Adjust the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80-100 ng / μL;

[0132] Step 10: The copy number of the samples was identified using TaqMan probe-based quantitative real-time PCR. Samples with known copy numbers were used as standards, and wild-type soybean plant samples were used as controls. Each sample was tested in triplicate, and the average value was taken. The primer and probe sequences for quantitative real-time PCR were as follows:

[0133] The following primers and probes are used to detect the EPSPS gene sequence:

[0134] Primer 1: ggtgtgcaggtgaagtctgaag is shown in SEQ ID NO:24 in the sequence listing;

[0135] Primer 2: gtctttggtccacgcaaggt is shown in SEQ ID NO:25 in the sequence listing;

[0136] Probe 1: cggtgatcgtcttccagt is shown as SEQ ID NO:26 in the sequence listing;

[0137] The PCR reaction system is as follows:

[0138] The 50× primer / probe mixture contains 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1×TE buffer, and is stored in amber tubes at 4°C.

[0139] The PCR reaction conditions are as follows:

[0140] The data was analyzed using SDS2.3 software (Applied Biosystems).

[0141] By analyzing the experimental results of EPSPS gene copy number, it was confirmed that the prGm8gTsf1-01 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence, and the prAtH4A748:lTEV chimeric control promoter sequence had all been integrated into the chromosome set of the tested soybean plants. Moreover, soybean plants transformed with the prGm8gTsf1-01 promoter sequence, soybean plants transformed with the prGm17gTsf1 control promoter sequence, soybean plants transformed with the pr35S control promoter sequence, and soybean plants transformed with the prAtH4A748:lTEV chimeric control promoter sequence all obtained single-copy transgenic soybean plants.

[0142] 4. Detection of the effect of the constitutive promoter of the present invention on driving LUC reporter gene expression in various soybean tissues.

[0143] In this embodiment, soybean plants transformed with the prGm8gTsf1-01 promoter sequence, soybean plants transformed with the prGm17gTsf1 control promoter sequence, soybean plants transformed with the pr35S control promoter sequence, and soybean plants transformed with the prAtH4A748:lTEV chimeric control promoter sequence were obtained. Samples were taken from different parts of the above transgenic soybean plants at different stages as test samples.

[0144] Samples were taken from three parts during the vegetative growth stage (V3 stage) as test samples: roots, stems, and leaves;

[0145] Samples were taken from six parts during the reproductive growth period as test samples: roots, stems, leaves, flowers, pods, and fruits;

[0146] Wild-type soybean plants (CK3) at the same growth stage and in the same part were sampled as negative control samples.

[0147] Test samples from different periods and parts of the plant and negative control samples from wild-type soybean plants (CK3) from the same period and part of the plant (three lines were sampled at each period, and three replicates of the same mass were sampled from each part of each line) were cryogenically ground in liquid nitrogen, and then 1×PLB buffer was added to each sample. The samples were centrifuged at 12,000 rpm for 10 min at 4°C, and the supernatant was collected for later use.

[0148] The test samples and negative control samples were subjected to dual-luciferase detection according to steps 5 and 6 in the second embodiment 4, with the REN gene as an internal reference. The LUC / REN ratio reflects the relative activity intensity of the promoter (the definition of the LUC / REN ratio is the same as that in Table 2 of the third embodiment above). The LUC / REN ratios of different parts of soybeans at different stages of stable transformation are shown in Table 3.

[0149] Table 3. LUC / REN ratios at different stages of stable transformation in different parts of soybean.

[0150] The results in Table 3 show that: (1) the promoter prGm8gTsf1-01 of this invention is expressed in the roots, stems, leaves, flowers, pods and fruits of soybean plants, indicating that the promoter prGm8gTsf1-01 can drive the constitutive expression of the target heterologous gene in the plant; (2) during the vegetative growth stage of soybean, compared with the prAtH4A748:lTEV control promoter, prGm8gTsf1-01 has a higher activity in driving the expression of the LUC gene; (3) during the reproductive growth stage of soybean, compared with the pr35S and prAtH4A748:lTEV control promoters, prGm8gTsf1-01 has a higher activity in driving the expression of the LUC gene.

[0151] Fifth Example: Detection of Herbicide Resistance in Transgenic Arabidopsis Plants

[0152] 1. Construct a recombinant expression vector that drives the herbicide-resistant gene HTG using prGm8gTsf1-01.

[0153] The 5' and 3' ends of the prGm8gTsf1-01 promoter sequence, the prGm17gTsf1 control promoter sequence, the pr35S control promoter sequence, and the prAtH4A748:lTEV chimeric control promoter sequence were ligated to universal adapter primer 2, respectively.

[0154] 5' universal adapter primer 2: 5'-cacgtgaccctagtcacttaaagcttggcgcgcc-3', as shown in SEQ ID NO:27 in the sequence listing;

[0155] 3' universal adapter primer 2: 5'-cagtagctggtgttggaggcat-3', as shown in SEQ ID NO:28 in the sequence listing.

[0156] Constructing vectors using conventional enzyme digestion methods is well known to those skilled in the art. Figure 3 shows a schematic diagram of the structure of the vector DBNBC-HTG containing the herbicide resistance gene HTG (vector backbone: pCAMBIA2301 modified with resistance tag (available from CAMBIA)). (Spec: spectinomycin gene; RB: right border; AscI: restriction endonuclease AscI recognition site; HTG: hydroxyphenylpyruvate dioxygenase gene (SEQ ID NO:29); t35s: cauliflower virus 35s terminator (SEQ ID NO:17); prAtUbi10: promoter of Arabidopsis ubiquitin 10 gene (SEQ ID NO:20); spAtCTP2: Arabidopsis chloroplast transport peptide (SEQ ID NO:21); cEPSPS: 5-enolpyruvate shikimate-3-phosphate synthase gene (SEQ ID NO:22); tNos: terminator of carmine synthase gene (SEQ ID NO:23); LB: left border).

[0157] The above-mentioned vector DBNBC-HTG was linearized by digestion with the restriction endonuclease AscI. The digestion product was purified to obtain the linearized DBNBC-HTG expression vector. The prGm8gTsf1-01 promoter sequence ligated with the universal adapter primer 2 was used to carry out a recombination reaction with the linearized DBNBC-HTG expression vector. The operation procedure was performed according to the instructions of the Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949) to construct the recombinant expression vector DBN18-N, the structural schematic diagram of which is shown in Figure 4.

[0158] The recombinant expression vector DBN18-N was transformed into *E. coli* DH5α competent cells using a heat shock method. The heat shock conditions were as follows: 100 μL of *E. coli* DH5α competent cells and 20 μL of recombinant plasmid DNA (recombinant expression vector DBN18-N) were gently mixed and then heat-shocked in a 42°C water bath for 30 s, followed immediately by placing on ice for 2 min. Then, 250 μL of antibiotic-free LB broth (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, pH adjusted to 7.5 with NaOH) was added, and the cells were cultured at 37°C with shaking (200 rpm / min) for 1 h. The cells were then incubated upside down on LB agar plates containing 50 mg / L spectinomycin at 37°C for 12 h. Positive colonies were picked and cultured overnight in LB broth containing 50 mg / L spectinomycin at 37°C with shaking (200 rpm / min). Plasmids were extracted using the alkaline lysis method: The bacterial culture was centrifuged at 12000 rpm for 1 min, the supernatant was discarded, and the precipitated bacterial cells were resuspended in 100 μL of ice-cold solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH = 8.0); 200 μL of freshly prepared solution II (0.2 M... Add NaOH and 1% SDS (sodium dodecyl sulfate), invert the tube four times to mix, and place on ice for 3-5 min; add 150 μL of ice-cold Solution III (3M potassium acetate, 5M acetic acid), mix thoroughly immediately, and place on ice for 5-10 min; centrifuge at 4℃ and 12000 rpm for 5 min, transfer the supernatant to a new 2 mL centrifuge tube, add 2 volumes of anhydrous ethanol, mix well, and place at room temperature for 5 min; centrifuge at 4℃ and 12000 rpm for 5 min, discard the supernatant, wash the precipitate with 70% ethanol (V / V) and air dry; add 30 μL of TE (10 mM Tris-HCl, 1 mM EDTA, pH = 8.0) containing RNase (20 μg / mL) to dissolve the precipitate; digest RNA in a water bath at 37℃ for 30 min; store at -20℃ for later use. The extracted plasmid was sequenced and identified, and the results showed that the recombinant expression vector DBN18-N contained the nucleotide sequence shown in SEQ ID NO:1 in the sequence listing, which is the prGm8gTsf1-01 promoter sequence.

[0159] Following the method described above for constructing the recombinant expression vector DBN18-N containing the prGm8gTsf1-01 promoter sequence, the prGm17gTsf1 control promoter sequence connected to the universal adapter primer 2, the pr35S control promoter sequence connected to the universal adapter primer 2, and the prAtH4A748:lTEV chimeric control promoter sequence connected to the universal adapter primer 2 were respectively subjected to recombination reactions with the linearized DBNBC-HTG expression vector to obtain recombinant expression vectors DBN19-N to DBN21-N. Sequencing verified that the above nucleotide sequences were correctly inserted into the recombinant expression vectors DBN19-N to DBN21-N.

[0160] 2. Transformation of Agrobacterium with recombinant expression vector

[0161] Following the method for transforming Agrobacterium with recombinant expression vectors in Part 1 of the third embodiment described above, the correctly constructed recombinant expression vectors DBN18-N to DBN21-N were transformed into Agrobacterium GV3101 using liquid nitrogen. Sequencing verification results showed that the structures of the recombinant expression vectors DBN18-N to DBN21-N were completely correct.

[0162] 3. Detection of the herbicide resistance effect of the promoter-driven herbicide-tolerant gene HTG in transgenic Arabidopsis plants.

[0163] Following the method described in Part 2 of the third embodiment above, Arabidopsis inflorescences were immersed in the Agrobacterium tumefaciens bacterial solution described in Part 2 of this embodiment to transfer the T-DNA from the recombinant expression vectors DBN18-N to DBN21-N constructed in Part 2 of this embodiment into the Arabidopsis chromosome, thereby obtaining the corresponding transgenic Arabidopsis plants, namely, Arabidopsis T1 plants transformed with the prGm8gTsf1-01 promoter sequence, Arabidopsis T1 plants transformed with the prGm17gTsf1 control promoter sequence, Arabidopsis T1 plants transformed with the pr35S control promoter sequence, and Arabidopsis T1 plants transformed with the prAtH4A748:lTEV chimeric control promoter sequence.

[0164] T1 transformants were selected from untransformed seed backgrounds using a glyphosate selection scheme. Arabidopsis T1 plants transformed with the prGm8gTsf1-01 promoter sequence, Arabidopsis T1 plants transformed with the prGm17gTsf1 control promoter sequence, Arabidopsis T1 plants transformed with the pr35S control promoter sequence, Arabidopsis T1 plants transformed with the prAtH4A748:lTEV chimeric control promoter sequence, and wild-type Arabidopsis plants (CK4) (18 days after sowing) were sprayed with 4 times the field concentration (100 g ai / ha) of bensulfuron-methyl to test herbicide tolerance in Arabidopsis. Seven days after spraying, the degree of damage to each plant from the herbicide was determined based on the proportion of leaf whitening area (leaf whitening area ratio = leaf whitening area / total leaf area × 100%): level 0 was basically no whitening phenotype, level 1 was leaf whitening area ratio less than 50%, level 2 was leaf whitening area ratio greater than 50%, and level 3 was leaf whitening area ratio of 100%.

[0165] The resistance performance of each recombinant expression vector in the transformation event was scored according to the formula X=[Σ(N×S) / (T×M)]×100 (X-phytotoxicity score, N-number of plants with the same level of damage, S-number of phytotoxicity levels, T-total number of plants, M-highest phytotoxicity level). Resistance was evaluated based on the scores: highly resistant plants (0-15 points), moderately resistant plants (16-33 points), low-resistant plants (34-67 points), and non-resistant plants (68-100 points). The experimental results are shown in Table 4.

[0166] Table 4. Results of tolerance experiment of transgenic Arabidopsis thaliana T1 plants to benzyladenine.

[0167] For Arabidopsis, 4 times the field concentration of benzimidone is the effective dose for high-stress treatment. The results in Table 4 show that: (1) Compared with CK4, Arabidopsis plants transformed with the prGm8gTsf1-01 promoter sequence were tolerant to benzimidone at 4 times the field concentration. It can be seen that the constitutive promoter prGm8gTsf1-01 of this invention can drive the expression of the target heterologous gene in plants. (2) Compared with the pr35S and prAtH4A748:lTEV control promoters, prGm8gTsf1-01 has a better effect on driving the herbicide resistance gene HTG in transgenic Arabidopsis plants.

[0168] In summary, this invention discloses for the first time a constitutive promoter from the soybean Tsf gene. The constitutive promoter of this invention has shown activity in almost all tissues and many types of cells in plants, especially in the roots, stems, leaves, flowers, pods, and fruits of plants, and has broad application prospects in plants.

[0169] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

Claims

1. A constitutive promoter, characterized in that, Its nucleotide sequence includes SEQ ID NO:2, and the constitutive promoter is derived from SEQ ID NO:

1.

2. The constitutive promoter according to claim 1, characterized in that, Its nucleotide sequence includes SEQ ID NO:2 and is selected from at least a portion of SEQ ID NO:

1.

3. The constitutive promoter according to claim 1 or 2, characterized in that, Its nucleotide sequence is shown in SEQ ID NO:1 or SEQ ID NO:

2.

4. A recombinant DNA construct comprising a constitutive promoter according to any one of claims 1-3 operably linked to a target heteronucleotide sequence.

5. The recombinant DNA construct according to claim 4, characterized in that, The target heteronucleotide sequence encodes the target protein.

6. An expression cassette comprising the recombinant DNA construct of claim 4 or 5.

7. A recombinant vector comprising the expression cassette of claim 6.

8. A method for expressing a target heteronucleotide sequence in a plant, characterized in that, include: The target heteronucleotide sequence, operatively linked to the constitutive promoter of any one of claims 1-3, is stably integrated into plant cells.

9. The method for expressing a target heteronucleotide sequence in a plant according to claim 8, characterized in that, The plants mentioned are Arabidopsis thaliana, rapeseed, tobacco, soybean, cotton, chili pepper, beet, pumpkin, eggplant, Chinese cabbage, carrot, tomato, pea, spinach, potato, or peanut.

10. The method for expressing a target heteronucleotide sequence in a plant according to claim 8, characterized in that, Constitutive expression of the target heteronucleotide sequence in plant tissues.

11. The method for expressing a target heteronucleotide sequence in a plant according to claim 8, characterized in that, The target heteronucleotide sequence encodes the target protein.

12. The method for expressing a target heteronucleotide sequence in a plant according to claim 11, characterized in that, The target heteronucleotide sequence encodes a herbicide-resistant protein.

13. The method for expressing a target heteronucleotide sequence in a plant according to claim 11, characterized in that, The target heteronucleotide sequence encodes an insect resistance protein.

14. A plant or part thereof, characterized in that, It includes the compositional promoter according to any one of claims 1-3.

15. A method for obtaining processed agricultural products, characterized in that, This includes processing the harvest of the plant or part thereof as described in claim 14 to obtain processed agricultural products.

16. Use of a constitutive promoter according to any one of claims 1-3 for constitutively expressing a target heteronucleotide sequence in plant tissues.

17. The use of the constitutive promoter according to claim 16 for constitutive expression of a target heteronucleotide sequence in plant tissues, characterized in that, The plants mentioned are Arabidopsis thaliana, rapeseed, tobacco, soybean, cotton, chili pepper, beet, pumpkin, eggplant, Chinese cabbage, carrot, tomato, pea, spinach, potato, or peanut.

18. The use of the constitutive promoter according to claim 16 for constitutively expressing a target heteronucleotide sequence in plant tissues, characterized in that, The target heteronucleotide sequence encodes the target protein.

Images