Molecular probe with improved resolution, modified nucleic acid thereof, and application thereof in gene sequencing

By using cage-like hydrocarbons to link fluorescent dyes in two-color sequencing technology, the steric hindrance between fluorescent groups is increased, solving the problem of reduced fluorescence brightness and achieving a doubling of fluorescence brightness and improved sequencing quality.

WO2026020407A1PCT designated stage Publication Date: 2026-01-29MGI TECH CO LTD
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/107439
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-07-25
Publication Date
2026-01-29

AI Technical Summary

Technical Problem

In two-color sequencing technology, using two fluorescent dyes to label the same base leads to reduced brightness, affecting sequencing quality and making it difficult to achieve the resolution of four-color sequencing technology.

Method used

Using cage-like hydrocarbons as bridges to connect two or more fluorescent dyes increases the steric hindrance between fluorescent groups, reduces or eliminates collisions of intramolecular fluorescent groups, and improves fluorescence brightness.

Benefits of technology

By increasing the steric hindrance between fluorescent groups, fluorescence brightness can be doubled, thereby improving sequencing signal and resolution and enhancing sequencing quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2024107439-FTAPPB-I100001
    Figure PCTCN2024107439-FTAPPB-I100001
  • Figure PCTCN2024107439-FTAPPB-I100002
    Figure PCTCN2024107439-FTAPPB-I100002
  • Figure PCTCN2024107439-FTAPPB-I100003
    Figure PCTCN2024107439-FTAPPB-I100003
Patent Text Reader

Abstract

The present invention relates to the field of sequencing. In particular, the present invention relates to a molecular probe with an improved resolution, a modified nucleic acid thereof, and an application thereof in gene sequencing.
Need to check novelty before this filing date? Find Prior Art

Description

A resolution-enhanced molecular probe, modified nucleic acid thereof and application in gene sequencing TECHNICAL FIELD

[0001] The present application relates to the field of sequencing. In particular, the present application relates to a resolution-enhanced molecular probe, modified nucleic acid thereof and application in gene sequencing. BACKGROUND

[0002] A molecular probe is a molecule that interacts with a biomolecule, or labels a biomolecule through chemical reaction or physical action. Broadly, a molecular probe can include all labels, such as radioisotopes, fluorescent dyes, enzymes, etc.

[0003] Resolution enhancement is one of the main goals of molecular probe development, and the purpose is to obtain a higher level of signal. For fluorescent dyes, resolution can be enhanced by increasing brightness. There are many ways to increase the brightness of fluorescent dyes, such as researching, designing and synthesizing dyes with higher brightness. However, due to the limitations of the structure of the fluorescent dye molecule itself, it is extremely difficult to double the brightness of the dye itself. Researchers have also tried to double the brightness by accumulating dyes in the probe, but many studies have failed, because fluorescence quenching between fluorescent groups due to intramolecular collision will lead to a decrease in fluorescence brightness, rather than an increase in fluorescence brightness.

[0004] Two-color sequencing technology uses two fluorescent dyes to mix-label four bases, and then uses different light signal combinations to capture and convert into gene sequences by high-resolution cameras. This technology overcomes the fluorescence crosstalk and higher optical system requirements of the conventional four-color sequencing technology, and can directly use two fluorescent groups with a farther spectral distance to identify four bases in two images.

[0005] However, the sequencing quality of the current two-color sequencing technology is still inferior to that of the four-color sequencing technology, one of the reasons being that the two-color sequencing technology uses two different fluorescent dyes to label the same base (i.e., double labeling, such as 50% of base A labeled with dye AF532 and the other 50% of base A labeled with dye Cy5), and the brightness of the base is reduced by nearly half compared to the base labeled with a single fluorescent dye (i.e., single labeling). As shown in FIG. 1, the brightness of double-labeled A base (50% of base A labeled with dye AF532 and the other 50% of base A labeled with dye Cy5) in sequencing is only half of the brightness of other bases.

[0006] SUMMARY

[0007] In order to solve the above problems, the application provides a novel molecular probe, which uses cage hydrocarbon as a bridge connecting two or more fluorescent dyes, reduces or eliminates the collision of intramolecular fluorescent groups by increasing the steric hindrance between fluorescent groups, and doubles the brightness of fluorescence. The application of the molecular probe to gene sequencing can improve the signal and resolution, and achieve the purpose of improving sequencing quality.

[0008] Molecular probe

[0009] The application provides a molecular probe, which comprises a cage hydrocarbon group and at least two identical fluorescent dyes connected by the cage hydrocarbon group.

[0010] In the application, cage hydrocarbon refers to a multi-bridged ring hydrocarbon compound with a certain closed space and high symmetry composed of 4 or more rings, including polyhedral carbon alkane (CH) n (n is an even number greater than or equal to 4), and also includes adamantane, high cubane and basketane, etc.

[0011] The structures of adamantane, high cubane and basketane are as follows, respectively:

[0012] In the application, polyhedral carbon alkane (CH) n refers to a saturated carbon alkane with high symmetry composed of methine (≡C-H) as a structural unit, and each vertex of the polyhedron is a methine. In the application, polyhedral carbon alkane (CH) n can be used interchangeably with polyhedral carbon alkane (CH) n (n is an even number greater than or equal to 4). The examples of polyhedral carbon alkane (CH) n include but are not limited to the following structures:

[0013] The examples of polyhedral carbon alkane (CH) n also include the following structures:

[0014] The present application uses a cage-shaped hydrocarbon as a bridge to connect two or more fluorescent dyes, and by increasing the steric hindrance between the fluorescent groups, the collision of the fluorescent groups within the molecule is reduced or eliminated. The fluorescent dyes that can be used in the molecular probes of the present application can be fluorescent dyes with emission wavelengths ranging from the blue region to the red region, can be organic or inorganic fluorescent dyes, or can be biological fluorescent dyes, including but not limited to cyanine dyes, fluorescein dyes, rhodamine dyes, coumarin dyes, polycyclic aromatic hydrocarbon dyes, NBD-amine dyes, naphthalimide dyes, BODIPY dyes, thiazine dyes, and oxazine dyes. In some embodiments, the fluorescent dyes are AF series dyes or Cy series dyes. In some embodiments, the fluorescent dyes are AF532.

[0015] In some embodiments, a suitable linking group can be selected to connect the cage-shaped hydrocarbon and the fluorescent dye, depending on the structure of the cage-shaped hydrocarbon and the structure of the fluorescent dye. In some embodiments, an amino group or a carboxyl group can be modified on the cage-shaped hydrocarbon, and the cage-shaped hydrocarbon can be connected to the fluorescent dye through an amide bond. In some embodiments, the linking group between the cage-shaped hydrocarbon and the fluorescent dye can be selected from one or more of an amide bond, an ester bond, a polyethylene glycol segment, a terephthalic acid unit, and a terephthalic diamine unit.

[0016] As long as the space of the cage-shaped hydrocarbon is large enough to achieve sufficient steric hindrance between the fluorescent groups, the molecular probe of the present application can contain any number of fluorescent dyes. In some embodiments, the molecular probe of the present application can contain two or more (e.g., 3, 4, 5, or 6) fluorescent dyes.

[0017] In some embodiments, the molecular probe of the present application contains a cage-shaped hydrocarbon group that is an adamantane group or a cubane group, and contains 2-3 fluorescent dyes.

[0018] In some embodiments, the molecular probe further contains one or more active groups, such as an amino group or a carboxyl group, on the cage-shaped hydrocarbon group, so as to be subsequently connected to the substance to be labeled through a chemical reaction. Optionally, the amino group or the carboxyl group further contains a protecting group.

[0019] In some embodiments, the molecular probe has a structure selected from the following:

[0020] In some embodiments, the molecular probe is selected from the following compounds:

[0021] Modified nucleotides

[0022] The molecular probes of the present application can be attached to a substrate moiety as a dye. The substrate moiety can be virtually any molecule or substance to which the molecular probes described herein can be conjugated, and the molecular probes can be attached to substrates by way of non-limiting example, the substrate moiety can include nucleosides, nucleotides, polynucleotides, carbohydrates, proteins, antibodies, ligands, and chromosomes, nuclei, living cells, and the like. Accordingly, the present application provides the use of the molecular probes of the present application for labeling the aforementioned substances.

[0023] A particularly useful application of the molecular probes of the present application is for labeling biomolecules, such as nucleosides, nucleotides, or oligonucleotides. In certain instances, such modified nucleotides are also referred to as "labeled nucleotides."

[0024] Accordingly, in one aspect, the present application relates to nucleosides, nucleotides, or oligonucleotides that are modified or labeled with the molecular probes of the present application.

[0025] Attachment to a biomolecule can be via the caged hydrocarbon moiety of the molecular probes described herein. In certain embodiments, the active group (e.g., amino or carboxyl) carried on the caged hydrocarbon enables attachment of the molecular probe to a substrate (e.g., a nucleoside, nucleotide, or oligonucleotide) by formation of an amide bond. In some embodiments, the molecular probe is covalently attached to the nucleoside, nucleotide, or oligonucleotide via the caged hydrocarbon group.

[0026] In certain embodiments, the molecular probes can be covalently attached to a nucleoside, oligonucleotide, or nucleotide via a nucleotide base. For example, a modified or labeled nucleoside, nucleotide, or oligonucleotide can have a label attached to the C5 position of a pyrimidine base or the C7 position of a 7-deaza purine base via a linker moiety. A modified or labeled nucleotide or oligonucleotide can also have a 3' OH blocking group covalently attached to the ribose or deoxyribose of the nucleotide.

[0027] Nucleosides and nucleotides can be modified or labeled at a site on the sugar or the nucleobase. As understood by one of ordinary skill in the art, a "nucleotide" consists of a nitrogenous base, a sugar, and one or more phosphate groups. In RNA, the sugar is ribose and in DNA the sugar is deoxyribose, a sugar that lacks the hydroxyl group present in ribose. The nitrogenous base is a derivative of a purine or a pyrimidine. Purines are adenine (A) and guanine (G), and pyrimidines are cytosine (C) and thymine (T) or in the context of RNA, uracil (U). The C-1 atom of the deoxyribose is bonded to the N-1 of a pyrimidine or the N-9 of a purine. A nucleotide is also a phosphate ester of a nucleoside, where esterification occurs on the hydroxyl group attached to C-3 or C-5 of the sugar. Nucleotides are typically mono-, di-, or tri-phosphates.

[0028] A "nucleoside" is structurally similar to a nucleotide but lacks a phosphate moiety. An example of a nucleoside analog would be a nucleoside in which a label is attached to the base and there is no phosphate group attached to the sugar molecule.

[0029] While bases are often referred to as purines or pyrimidines, the skilled person will appreciate that derivatives and analogs are available which do not alter the ability of the nucleotide or nucleoside to undergo Watson-Crick base pairing. By "derivative" or "analog" is meant a compound or molecule which has the same or very similar core structure as the parent compound but which has a chemical modification or physical modification, such as a different or additional pendant group, which allows the derivatized nucleotide or nucleoside to be attached to another molecule. For example, the base can be a deazapurine. The derivative should be capable of undergoing Watson-Crick pairing. By "derivative" and "analog" is also meant a synthetic nucleotide derivative or nucleoside derivative having a modified base moiety and / or a modified sugar moiety. Such derivatives and analogs are discussed in, for example, Scheit, Nucleotide analogs (John Wiley & Son, 1980) and Uhlman et al. Chemical Reviews 90:543-584, 1990. Nucleotide analogs can also comprise modified phosphodiester linkages including phosphorothioate linkages, phosphorodithioate linkages, alkylphosphonate linkages, phosphoranilidate linkages, phosphoramidate linkages, and the like.

[0030] The molecular probe can be attached to any position on the nucleotide base via a linker, provided that Watson-Crick base pairing can still occur. Particular nucleobase labeling sites include the C5 position of a pyrimidine base or the C7 position of a 7-deazapurine base. As described above, a linking group can be used to covalently attach the molecular probe to the nucleoside or nucleotide.

[0031] In particular embodiments, the modified or labeled nucleoside or nucleotide can be enzymatically incorporable and enzymatically extendable. Thus, the linker moiety can be of sufficient length to link the nucleotide to the molecular probe such that the molecular probe does not significantly interfere with the overall binding and recognition of the nucleotide by nucleic acid replication enzymes. Thus, the linker can also comprise a spacer unit. For example, the spacer unit distances the nucleotide base from the cleavage site or label.

[0032] The nucleoside or nucleotide modified or labeled with the molecular probe of the present application can have the following structure:

[0033] where B is a nucleobase such as, for example, uracil, thymine, cytosine, adenine, guanine, and the like, and L is an optional (i.e., can or can not be present) linking group. R' can be H, mono-, di-, tri-phosphate, phosphorothioate, phosphate analog, -O- attached to a reactive phosphorus-containing group, or -O- protected by a blocking group. R" can be H, OH, phosphoramidite, or a 3'-OH blocking group, and R'" is H or OH. In some embodiments, the 3'-OH blocking group is an azidomethylene (-CH2-N3) or an allyl group. In some embodiments, the linking group comprises a cleavable linking group, including but not limited to a linking group having the structure shown below:

[0034] where the alkynyl group is attached to the nucleobase.

[0035] In some embodiments, the nucleotide modified or labeled with a molecular probe of the application is a deoxyribonucleotide triphosphate (dNTP), such as dATP (deoxyadenosine triphosphate), dGTP (deoxyguanosine triphosphate), dTTP (deoxythymidine triphosphate), or dCTP (deoxycytidine triphosphate).

[0036] In some embodiments, the nucleotide modified or labeled with a molecular probe of the application is a nucleoside triphosphate (NTP), such as ATP (adenosine triphosphate), GTP (guanosine triphosphate), CTP (cytidine triphosphate), and UTP (uridine triphosphate).

[0037] The application also relates to polynucleotides encompassing molecular probes of the application incorporated therein. Such polynucleotides can be DNA or RNA comprising deoxyribonucleotides or ribonucleotides, respectively, linked by phosphodiester bonds. The polynucleotides can comprise naturally occurring nucleotides, non-naturally occurring (or modified) nucleotides different from the modifications or labels described herein, or any combination thereof, provided that there is at least one modified or labeled nucleotide with a molecular probe according to the application. The polynucleotides can also include non-natural backbone linkages and / or non-nucleotide chemical modifications. Chimeric structures comprising a mixture of ribonucleotides and deoxyribonucleotides comprising at least one modified or labeled nucleotide are also contemplated.

[0038] The nucleotide modified or labeled with a molecular probe of the application can be selected from:

[0039] Modified or labeled dATP, for example:

[0040] Modified or labeled dGTP, for example:

[0041] Modified or labeled dCTP, for example:

[0042] modified or labeled dTTP, for example:

[0043] In some embodiments, the modified or labeled nucleotide has a structure selected from the group consisting of:

[0044] Further, the nucleotide modified or labeled with the molecular probe of the present application can be selected from the group consisting of:

[0045] Methods of making the molecular probe

[0046] The molecular probe of the present application can be made by a method comprising the steps of:

[0047] (1) providing a cage hydrocarbon modified with at least three active groups, the active groups including but not limited to amino or carboxyl groups;

[0048] (2) linking at least two identical dye molecules to at least two active groups of the cage hydrocarbon, respectively, in some embodiments, the linking can be achieved by forming an amide bond;

[0049] Optionally, the method further comprises step (3) of protecting, deprotecting or reacting the remaining active groups on the cage hydrocarbon; through the reaction, other active groups can be linked.

[0050] In some embodiments, in step (1), the cage hydrocarbon is adamantane. In some embodiments, the active groups are each located at position 1, 3, 5 or 7 of the adamantane.

[0051] In some embodiments, in step (1), the cage hydrocarbon is adamantane, which is modified with four active groups, the active groups are each located at position 1, 3, 5 and 7 of the adamantane.

[0052] In some embodiments, the active groups are all amino groups.

[0053] In some embodiments, in step (2), two identical dye molecules are linked to two active groups of the adamantane, respectively.

[0054] In some embodiments, in step (2), two identical dye molecules are linked to the active groups at position 1 and 5 of the adamantane, respectively.

[0055] In some embodiments, in step (2), three identical dye molecules are attached to the three active groups on the cage hydrocarbon, respectively.

[0056] In some embodiments, in step (2), three identical dye molecules are attached to the active groups at positions 1, 3 and 5 of adamantane, respectively.

[0057] In some embodiments, in step (3), the remaining active groups on the cage hydrocarbon are reacted to attach carboxyl groups.

[0058] The following shows an exemplary numbering of carbon atoms on adamantane.

[0059] Methods of modifying or labeling nucleotides

[0060] The present application also provides methods of modifying or labeling nucleotides using the molecular probes of the present application, the methods comprising the steps of:

[0061] (1) providing a nucleotide and a molecular probe of the present application, the molecular probe having at least one active group (e.g., carboxyl or amino) on the cage hydrocarbon group; optionally, the nucleotide has an excisable group;

[0062] (2) attaching the molecular probe to the base of the nucleotide or to the excisable group on the nucleotide via the active group; in some embodiments, the attachment can be via an amide bond.

[0063] In some embodiments, the cage hydrocarbon group is adamantane. In some embodiments, the active group is at position 3 or 7 of adamantane.

[0064] In some embodiments, the nucleotide is a dNTP, i.e., a deoxyribonucleoside triphosphate, which can be selected from dATP, dGTP, dTTP, dCTP.

[0065] In some embodiments, the nucleotide is a rNTP, i.e., a ribonucleoside triphosphate, which can be selected from ATP, GTP, CTP, UTP.

[0066] In some embodiments, the nucleotide is modified with a reversible blocking group, e.g., an azidomethylene (-CH2-N3) or an allyl group at the 3'-O of the deoxyribose.

[0067] Synthetic intermediates

[0068] The present application also provides synthetic intermediates that can be used in the synthesis of the molecular probes or modified nucleotides described herein, including but not limited to the following compounds, salts or esters thereof:

[0069] The application also protects the use of the above-mentioned compounds, salts or esters thereof for the synthesis of molecular probes or modified nucleosides, nucleotides or oligonucleotides described herein, etc.

[0070] In some embodiments, the synthesis process is carried out according to the methods of preparation of molecular probes or methods of modification or labelling of nucleotides described hereinabove.

[0071] Methods of sequencing

[0072] The modified nucleotides of the application can be used in any analytical method requiring the detection of a fluorescent label attached to a nucleotide or nucleoside, whether in its own right or incorporated into or associated with a larger molecular structure or conjugate. Certain embodiments of the application relate to methods of sequencing comprising: (a) incorporating at least one modified or labelled nucleotide as described herein into a polynucleotide; and (b) detecting the modified nucleotide incorporated into the polynucleotide by detecting a fluorescent signal from a fluorescent dye attached to the modified or labelled nucleotide.

[0073] In certain embodiments, the at least one modified or labelled nucleotide is incorporated into a polynucleotide by the action of a polymerase in a synthesis step. However, other methods of incorporating modified or labelled nucleotides into polynucleotides are not excluded, such as chemical oligonucleotide synthesis or ligation of labelled oligonucleotides to unlabelled oligonucleotides. Thus, the term "incorporating" a nucleotide into a polynucleotide encompasses polynucleotide synthesis by chemical as well as enzymatic methods.

[0074] In particular non-limiting embodiments, modified nucleotides according to the application labelled can be used in methods of nucleic acid sequencing, resequencing, whole genome sequencing, single nucleotide polymorphism scoring, any other application involving the detection of modified nucleotides or nucleosides when incorporated into a polynucleotide, or any other application requiring the use of polynucleotides labelled with modified nucleotides comprising the application.

[0075] In particular embodiments, the present application provides use of a modified nucleotide comprising a molecular probe of the present application in a polynucleotide "sequencing by synthesis" reaction. Sequencing by synthesis generally involves the sequential addition of one or more nucleotides or oligonucleotides to a growing polynucleotide chain in the 5' to 3' direction using a polymerase or ligase enzyme in order to form an extended polynucleotide chain complementary to a template nucleic acid to be sequenced. The identity of the bases present in the one or more of the added nucleotides is determined in a detection step or "imaging" step. The identity of the added bases can be determined after each nucleotide incorporation step. The sequence of the template can then be inferred using conventional Watson-Crick base pairing rules. The use of modified nucleotides labeled according to the present disclosure for determining the identity of single bases can be useful, for example, in the scoring of single nucleotide polymorphisms, and such single base extension reactions are within the scope of the present application.

[0076] In embodiments, the sequence of a template polynucleotide is determined by detecting the incorporation of one or more nucleotides into a nascent strand complementary to a template polynucleotide to be sequenced via detection of a fluorescent label attached to the incorporated nucleotide. The nucleic acid template to be sequenced can be DNA or RNA, or even a hybrid molecule comprising both deoxy- and ribonucleotides. The nucleic acid template can comprise naturally occurring nucleotides and / or non-naturally occurring nucleotides and natural or non-natural backbone linkages, provided that these do not prevent replication of the template in the sequencing reaction.

[0077] While one application of the modified nucleotides of the present application is in sequencing by synthesis reactions, the utility of such labeled nucleotides is not limited to such methods. In fact, the nucleotides can be advantageously used in any sequencing method that requires detection of a fluorescent label attached to a nucleotide incorporated into a polynucleotide.

[0078] In certain embodiments, the present application provides a method of determining the sequence of a target single-stranded polynucleotide comprising the steps of:

[0079] (a) providing a duplex, a nucleotide, a polymerase, and an excision reagent; the duplex comprising a growing nucleic acid strand and a nucleic acid molecule to be sequenced;

[0080] (b) performing a reaction cycle comprising steps (i), (ii), and (iii):

[0081] Step (i): using the polymerase, incorporating the nucleotide into the growing nucleic acid strand to form a nucleic acid intermediate comprising a blocking group and a detectable label;

[0082] Step (ii): detecting the detectable label on the nucleic acid intermediate;

[0083] Step (iii): removal of the blocking group on the nucleic acid intermediate using a cleavage reagent.

[0084] In certain embodiments, the reaction cycle further comprises step (iv): removal of the detectable label on the nucleic acid intermediate using a cleavage reagent.

[0085] In the present invention, a nucleic acid can include a nucleotide or a nucleotide analog. A nucleotide typically contains a sugar, a nucleobase, and at least one phosphate group. Nucleotides include deoxyribonucleotides, modified deoxyribonucleotides, ribonucleotides, modified ribonucleotides, peptide nucleotides, modified peptide nucleotides, modified phosphate sugar backbone nucleotides, and mixtures thereof. Examples of nucleotides include, for example, adenosine monophosphate (AMP), adenosine diphosphate (ADP), adenosine triphosphate (ATP), thymidine monophosphate (TMP), thymidine diphosphate (TDP), thymidine triphosphate (TTP), cytidine monophosphate (CMP), cytidine diphosphate (CDP), cytidine triphosphate (CTP), guanosine monophosphate (GMP), guanosine diphosphate (GDP), guanosine triphosphate (GTP), uridine monophosphate (UMP), uridine diphosphate (UDP), uridine triphosphate (UTP), deoxyadenosine monophosphate (dAMP), deoxyadenosine diphosphate (dADP), deoxyadenosine triphosphate (dATP), deoxythymidine monophosphate (dTMP), deoxythymidine diphosphate (dTDP), deoxythymidine triphosphate (dTTP), deoxycytidine diphosphate (dCDP), deoxycytidine triphosphate (dCTP), deoxyguanosine monophosphate (dGMP), deoxyguanosine diphosphate (dGDP), deoxyguanosine triphosphate (dGTP), deoxyuridine monophosphate (dUMP), deoxyuridine diphosphate (dUDP), and deoxyuridine triphosphate (dUTP). Nucleotide analogs comprising modified nucleobases can also be used in the methods described herein. Exemplary modified nucleobases that can be included in a polynucleotide, whether having a natural backbone or analog structure, include, for example, inosine, xanthine, hypoxanthine, isocytosine, isoguanine, 2-aminopurine, 5-methylcytosine, 5-hydroxymethylcytosine, 2-aminoadenine, 6-methyladenine, 6-methylguanine, 2-propylguanine, 2-propyladenine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 15-halouracil, 15-halocytosine, 5-propynyluracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil, 4-thiouracil, 8-halo-adenine or guanine, 8-amino-adenine or guanine, 8-thioladenine or guanine, 8-thiolalkyladenine or guanine, 8-hydroxyladenine or guanine, 5-halogen substituted uracil or cytosine, 7-methylguanine, 7-methyladenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, and the like. Certain nucleotide analogs, such as adenosine 5'-phosphorothioate, cannot be incorporated into a polynucleotide, as known in the art.

[0086] In the methods of the application, the nucleic acid molecules to be sequenced are not limited by their length. In certain preferred embodiments, the nucleic acid molecules to be sequenced can be at least 10 bp, at least 20 bp, at least 30 bp, at least 40 bp, at least 50 bp, at least 100 bp, at least 200 bp, at least 300 bp, at least 400 bp, at least 500 bp, at least 1000 bp, or at least 2000 bp in length. In certain preferred embodiments, the nucleic acid molecules to be sequenced can be 10-20 bp, 20-30 bp, 30-40 bp, 40-50 bp, 50-100 bp, 100-200 bp, 200-300 bp, 300-400 bp, 400-500 bp, 500-1000 bp, 1000-2000 bp, or more than 2000 bp in length. In certain preferred embodiments, the nucleic acid molecules to be sequenced can be 10-1000 bp in length, to facilitate high-throughput sequencing.

[0087] In certain preferred embodiments, the nucleic acid molecules can be pre-processed prior to immobilization on the support. Such pre-processing includes, but is not limited to, fragmentation of the nucleic acid molecules, end-filling, addition of adaptors, addition of tags, amplification of the nucleic acid molecules, separation and purification of the nucleic acid molecules, and any combination thereof.

[0088] In certain embodiments, the surface of the solid support can bear reactive functional groups that react with complementary functional groups on the polynucleotide molecules to form covalent bonds, for example, in the same manner as used for attaching cDNA to microarrays, for example, see Smirnov et al. (2004), Genes, Chromosomes & Cancer, 40:72-77 and Beaucage (2001), Current Medicinal Chemistry, 8:1213_1244, both of which are incorporated herein by reference. DNBs can also be effectively attached to hydrophobic surfaces, for example, clean glass surfaces bearing low concentrations of various reactive functional groups, for example, -OH groups. Attachment via covalent bonds formed between the reactive functional groups on the surface and the polynucleotide molecules is also referred to herein as "chemical attachment."

[0089] In other embodiments, the polynucleotide molecules can be adsorbed to the surface. In this implementation, the polynucleotides are immobilized by non-specific interactions with the surface, or by non-covalent interactions such as hydrogen bonds, van der Waals forces, and the like.

[0090] In other embodiments, the nucleic acid library can be double-stranded nucleic acid fragments, which are immobilized on the surface of a solid support by ligation with oligonucleotides immobilized on the surface of the solid support, followed by rolling circle amplification to prepare sequencing library.

[0091] In some embodiments, the modified nucleotides of the present application are used in a two-color sequencing technology. See, e.g., US 9,222,132 B, which is incorporated by reference herein in its entirety.

[0092] Kit

[0093] In another aspect, the present application provides a kit comprising a molecular probe of the present application, or modified with a nucleotide of the present application. In certain embodiments, the kit comprises one or more nucleotides, at least one of which is a modified nucleotide of the present application. In certain embodiments, the kit can comprise two or more labeled nucleotides. The modified nucleotides or kits of the present application can be used for sequencing, expression analysis, hybridization analysis, genetic analysis, RNA analysis, or protein binding assays. The use can be performed on an automated sequencing instrument. The sequencing instrument can include two lasers operating at different wavelengths.

[0094] In the case where the kit comprises a plurality of nucleotides, in particular two nucleotides and four nucleotides, labeled with dye compounds, the different nucleotides can be labeled with the same or different dye compounds, or one nucleotide can be unlabeled with a dye compound. In the case where the different nucleotides are labeled with the same or different dye compounds, the kit is characterized in that the dye compound-labeled nucleotides can be distinguished by fluorescence spectra and algorithms. When two nucleotides labeled with fluorescent dye compounds are supplied in a kit, in certain embodiments, the spectrally distinguishable fluorescent dyes can be excited at the same wavelength (such as, for example, by the same laser). When four nucleotides labeled with fluorescent dye compounds are supplied in a kit, in certain embodiments, two of the spectrally distinguishable fluorescent dyes can both be excited at one wavelength, and the other two spectrally distinguishable dyes can both be excited at another wavelength.

[0095] In certain embodiments, the kits of the present application can further comprise: reagents for immobilizing (e.g., by covalent or non-covalent ligation) a nucleic acid molecule to be sequenced to a support; primers for initiating nucleotide polymerization reactions; polymerases for performing nucleotide polymerization reactions; one or more buffer solutions; one or more wash solutions; or any combination thereof.

[0096] In certain embodiments, the kit of the present application can further comprise reagents and / or devices for extracting nucleic acid molecules from a sample. Methods for extracting nucleic acid molecules from a sample are well known in the art. Thus, various reagents and / or devices for extracting nucleic acid molecules can be provided in the kit of the present application as necessary, such as reagents for disrupting cells, reagents for precipitating DNA, reagents for washing DNA, reagents for dissolving DNA, reagents for precipitating RNA, reagents for washing RNA, reagents for dissolving RNA, reagents for removing proteins, reagents for removing DNA (e.g., when the nucleic acid molecule of interest is RNA), reagents for removing RNA (e.g., when the nucleic acid molecule of interest is DNA), and any combination thereof.

[0097] In certain embodiments, the kit of the present application further comprises reagents for pretreating nucleic acid molecules. The reagents for pretreating nucleic acid molecules in the kit of the present application are not additionally limited, and can be selected as necessary. The reagents for pretreating nucleic acid molecules include, for example, reagents for fragmenting nucleic acid molecules (e.g., DNase I), reagents for filling in the ends of nucleic acid molecules (e.g., DNA polymerases such as T4 DNA polymerase, Pfu DNA polymerase, Klenow DNA polymerase), linker molecules, tag molecules, reagents for ligating linker molecules to nucleic acid molecules of interest (e.g., ligases such as T4 DNA ligase), reagents for repairing the ends of nucleic acids (e.g., DNA polymerases that lack 3'-5' exonuclease activity but exhibit 5'-3' exonuclease activity), reagents for amplifying nucleic acid molecules (e.g., DNA polymerases, primers, dNTPs), reagents for isolating and purifying nucleic acid molecules (e.g., chromatography columns), and any combination thereof.

[0098] In certain embodiments, the kit of the present application further comprises a support for immobilizing nucleic acid molecules to be sequenced. In general, the support for immobilizing nucleic acid molecules to be sequenced is in a solid phase, so as to facilitate handling. Thus, in the present disclosure, the "support" is sometimes also referred to as a "solid support" or a "solid-phase support". However, it should be understood that the "support" referred to herein is not limited to a solid, but can also be a semi-solid (e.g., a gel).

[0099] As used herein, the terms "loading", "immobilizing" and "attaching" when used in reference to nucleic acids means attachment, either directly or indirectly, to a solid support, either via covalent or non-covalent bonds. In certain embodiments of the present disclosure, the methods of the present invention comprise immobilizing nucleic acids on a solid support via covalent attachment. However, generally, all that is required is that the nucleic acid remains immobilized or attached to the solid support under conditions in which it is desired to use the solid support (e.g. in applications in which nucleic acid amplification and / or sequencing is required). In certain embodiments, immobilizing a nucleic acid on a solid support can comprise immobilizing an oligonucleotide to be used as a capture primer or amplification primer on a solid support such that the 3' end is available for enzymatic extension and at least a portion of the primer sequence is capable of hybridizing to a complementary nucleic acid sequence; then hybridizing the nucleic acid to be immobilized to the oligonucleotide, in which case the immobilized oligonucleotide or polynucleotide can be in the 3'-5' orientation. In certain embodiments, immobilizing a nucleic acid on a solid support can comprise binding a nucleic acid binding protein to a solid support by way of an aminated modification, and capturing nucleic acid molecules by the nucleic acid binding protein. Alternatively, loading can occur by other means than base-pairing hybridization, such as the covalent attachment described above. Non-limiting examples of ways in which nucleic acids can be attached to a solid support include nucleic acid hybridization, biotin streptavidin binding, thiol binding, photoactivated binding, covalent binding, antibody-antigen, physical confinement via hydrogels or other porous polymers, and the like. Various exemplary methods for immobilizing nucleic acids on a solid support can be found, for example, in G. Steinberg-Tatman et al., Bioconjugate Chemistry 2006, 17, 841-848; Xu X. et al. Journal of the American Chemical Society 128 (2006) 9286-9287; US Patent Applications US 5639603, US 5641658, US2010248991; International Patent Applications WO 2001062982, WO 2001012862, WO 2007111937, WO0006770, all of which are incorporated herein by reference in their entirety, particularly for all teachings related to the preparation of solid supports on which nucleic acids are immobilized.

[0100] In the present application, the support can be made of various suitable materials. Such materials include, for example: inorganics, natural polymers, synthetic polymers, and any combination thereof. Specific examples include, but are not limited to: cellulose, cellulose derivatives (e.g., nitrocellulose), acrylic resins, glass, silica gel, silica, polystyrene, gelatin, polyvinylpyrrolidone, copolymers of vinyl and acrylamide, polyphenylacetylene cross-linked with divinylbenzene (see, e.g., Merrifield Biochemistry 1964, 3, 1385-1390), polyacrylamide, latex, dextran, rubber, silicon, plastic, natural sponge, metal plastic, cross-linked dextran (e.g., Sephadex TM ), agarose gel (Sepharose TM ), and other supports known to those skilled in the art.

[0101] In certain preferred embodiments, the support for immobilization of nucleic acid molecules to be sequenced can be a solid support comprising an inert substrate or matrix (e.g., a glass slide, a polymeric bead, etc.) that has been functionalized, e.g., by applying an intermediate material containing reactive groups that allow covalent attachment of biological molecules such as polynucleotides. Examples of such supports include, but are not limited to, polyacrylamide hydrogels loaded on an inert substrate such as glass, in particular the polyacrylamide hydrogels described in WO 2005 / 065814 and US 2008 / 0280773, the contents of which are incorporated herein by reference in their entirety. In such embodiments, the biological molecules (e.g., polynucleotides) can be covalently attached directly to the intermediate material (e.g., hydrogel), while the intermediate material itself can be non-covalently attached to the substrate or matrix (e.g., a glass substrate). In certain preferred embodiments, the support is a glass or silicon slide that is surface-modified with a layer of avidin, amino, acrylamide silane, or aldehyde groups.

[0102] In the present application, the support or solid support is not limited in size, shape, and configuration. In some embodiments, the support or solid support is a planar structure, e.g., a slide, a chip, a microchip, and / or an array. The surface of such a support can be in the form of a planar layer.

[0103] In certain preferred embodiments, the support for immobilization of nucleic acid molecules to be sequenced is an array of beads or wells (which is also referred to as a chip). The array can be prepared using any of the materials outlined herein for preparing a solid support, and preferably, the surface of the beads or wells on the array is functionalized to facilitate immobilization of nucleic acid molecules. The number of beads or wells on the array is not limited. For example, each array can comprise 10-10 2 , 10 2 -103 , 10 3 -10 4 , 10 4 -10 5 , 10 5 -10 6 , 10 6 -10 7 , 10 7 -10 8 , 10 8 -10 9 , 10 10 -10 11 , 10 11 -10 12 or more beads or wells. In certain exemplary embodiments, the surface of each bead or well can immobilize one or more nucleic acid molecules. Accordingly, each array can immobilize 10-10 2 , 10 2 -10 3 , 10 3 -10 4 , 10 4 -10 5 , 10 5 -10 6 , 10 6 -10 7 , 10 7 -10 8 , 10 8 -10 9 , 10 10 -10 11 , 10 11 -10 12 or more nucleic acid molecules. Such arrays can thus be particularly advantageous for high-throughput sequencing of nucleic acid molecules.

[0104] In certain preferred embodiments, the kits of the application further comprise reagents for immobilizing (e.g., by covalent or non-covalent linkage) the nucleic acid molecule to be sequenced to a support. Such reagents include, for example, reagents that activate or modify the nucleic acid molecule (e.g., at its 5' end), such as a phosphate, a thiol, an amine, a carboxylic acid, or an aldehyde; reagents that activate or modify the surface of the support, such as an amino-alkoxysilane (e.g., aminopropyltrimethoxysilane, aminopropyltriethoxysilane, 4-aminobutyltriethoxysilane, etc.); a crosslinking agent, such as succinic anhydride, phenyl diisothiocyanate (Guo et al., 1994), maleic anhydride (Yang et al., 1998), l-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC), m-maleimidobenzoic acid-N-hydroxysuccinimide ester (MBS), N-succinimidyl [4-iodoacetyl]aminobenzoate (SIAB), 4-(N-maleimidomethyl) cyclohexane-l-carboxylate succinimidyl ester (SMCC), N-γ-maleimidobutyryloxy-succinimide ester (GMBS), 4-(p-maleimidophenyl) butyric acid succinimidyl ester (SMPB); and any combination thereof.

[0105] In certain preferred embodiments, the kits of the application further comprise a primer for initiating nucleotide polymerization. In the present application, the primer is not additionally limited as long as it is capable of annealing specifically to a region of the target nucleic acid molecule. In some exemplary embodiments, the primer can be 5-50 bp in length, such as 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50 bp. In some exemplary embodiments, the primer can comprise naturally-occurring or non-naturally-occurring nucleotides. In some exemplary embodiments, the primer comprises or consists of naturally-occurring nucleotides. In some exemplary embodiments, the primer comprises modified nucleotides, such as locked nucleic acids (LNAs). In certain preferred embodiments, the primer comprises a universal primer sequence.

[0106] In certain preferred embodiments, the kits of the present application further comprise a polymerase for performing a nucleotide polymerization reaction. In the present application, various suitable polymerases can be used to perform a polymerization reaction. In some exemplary embodiments, the polymerase is capable of synthesizing a new DNA strand using DNA as a template (e.g., a DNA polymerase). In some exemplary embodiments, the polymerase is capable of synthesizing a new DNA strand using RNA as a template (e.g., a reverse transcriptase). In some exemplary embodiments, the polymerase is capable of synthesizing a new RNA strand using DNA or RNA as a template (e.g., an RNA polymerase). Thus, in certain preferred embodiments, the polymerase is selected from the group consisting of a DNA polymerase, an RNA polymerase, and a reverse transcriptase.

[0107] In certain preferred embodiments, the kits of the present application further comprise one or more excision reagents. In certain embodiments, the excision reagents are selected from one or more of the following reagents: Endo IV, alkaline phosphatase, an organophosphine (e.g., tris(3-hydroxypropyl)phosphine (THPP), tris(2-carboxyethyl)phosphine hydrochloride (TCEP)), or a PdCl2sulfonated triphenylphosphine complex. In certain preferred embodiments, the kits of the present application further comprise one or more buffer solutions. Such buffer solutions include, but are not limited to, a buffer solution for DNAse I, a buffer solution for DNA polymerase, a buffer solution for ligase, a buffer solution for eluting nucleic acid molecules, a buffer solution for dissolving nucleic acid molecules, a buffer solution for performing a nucleotide polymerization reaction (e.g., PCR), and a buffer solution for performing a ligation reaction. The kits of the present application can comprise any one or more of the above-mentioned buffer solutions.

[0108] In certain preferred embodiments, the kits of the present application further comprise one or more wash solutions. Examples of such wash solutions include, but are not limited to, phosphate buffered saline, citrate buffered saline, Tris-HCl buffered saline, acetate buffered saline, carbonate buffered saline, and the like. The kits of the present application can comprise any one or more of the above-mentioned wash solutions.

[0109] In certain preferred embodiments, the kits of the present application comprise sequencing reagents. In certain preferred embodiments, the sequencing reagents comprise at least one of: a dNTPs mix, a nucleic acid polymerase mix, an elution solution.

[0110] In certain preferred embodiments, the dNTPs mix contains at least one modified or labeled nucleotide of the present application.

[0111] In certain preferred embodiments, the elution solution contains a cleavage reagent; optionally, the cleavage reagent is selected from one or more of the following reagents: Endonuclease IV, Alkaline Phosphatase, an organic phosphine (e.g. tris(3-hydroxypropyl)phosphine (THPP), tris(2-carboxyethyl)phosphine hydrochloride (TCEP)), or a PdCl2sulfonated triphenylphosphine complex.

[0112] In another aspect, the present application provides the use of the molecular probe, the modified nucleotide or the kit of the present application for determining the sequence of a target polynucleotide.

[0113] The present application provides the use of the molecular probe of the present application in sequencing, expression analysis, hybridization analysis, genetic analysis, RNA analysis, protein binding assay, in vitro diagnosis, immunoassay, molecular labeling; preferably, the molecular labeling is used for cell imaging, tissue imaging or bio-imaging.

[0114] The present application provides the use of the molecular probe of the present application in fluorescent labeling, quantification or detection of proteins, enzymes or nucleic acids.

[0115] The present application provides the use of the modified or labeled nucleoside or nucleotide of the present application or the kit of the present application in sequencing. Advantages

[0116] The molecular probe of the present application can double the brightness of fluorescence, and when applied to gene sequencing, can improve the signal and resolution, and effectively improve the sequencing quality of dual-color sequencing technology.

[0117] Embodiments of the present application will be described in detail below with reference to the accompanying drawings and examples, but those skilled in the art will understand that the following drawings and examples are only used to illustrate the present application, and are not limiting the scope of the present application. According to the following detailed description of the preferred embodiments and the accompanying drawings, various objects and advantages of the present application will become apparent to those skilled in the art. BRIEF DESCRIPTION OF DRAWINGS

[0118] Figure 1 exemplarily shows that in the current dual-color sequencing technology, the brightness of the dual-labeled A base (50% of base A labeled dye AF532, and the other 50% of base A labeled dye Cy5) in sequencing is only half of that of other bases.

[0119] Figure 2 is a synthetic route of V5 linker-2 AF532, V5 linker-2 AF532-dATP-1.

[0120] Figure 3 is the1H NMR spectrum of V5 linker-2 AF532-dATP-1. 31 P NMR spectrum.

[0121] Figure 4 is a synthetic route for V5 linker-2 AF532-dATP-2.

[0122] Figure 5 is a UV-Vis absorption spectrum of V5 linker-2 AF532-dATP-2. 1 H NMR spectrum.

[0123] Figure 6 is a UV-Vis absorption spectrum of V5 linker-2 AF532-dATP-2. 31 P NMR spectrum.

[0124] Figure 7 is a synthetic route for V5 linker-3 AF532, V5 linker-3 AF532-dATP.

[0125] Figure 8 is a UV-Vis absorption spectrum of V5 linker-3 AF532-dATP. 31 P NMR spectrum.

[0126] Figure 9 is a synthetic route for V6 linker-2 AF532.

[0127] Figure 10 is a synthetic route for V7 linker-2 AF532-dATP.

[0128] Figure 11 is a UV-Vis absorption spectrum of V7 linker-2 AF532-dATP. 1 H NMR spectrum.

[0129] Figure 12 is a UV-Vis absorption spectrum of V7 linker-2 AF532-dATP. 31 P NMR spectrum.

[0130] Figure 13 is a UV-Vis absorption spectrum of AF532, hot dATP V1-AF532, V5 linker-2 AF532-dATP-1, and V5 linker-2 AF532-dATP-2 (PBS buffer).

[0131] Figure 14 is a UV-Vis absorption spectrum of AF532, hot dATP V1-AF532, V5 linker-2 AF532-dATP-1, and V5 linker-2 AF532-dATP-2 (DMSO solution).

[0132] Figure 15 is a UV-Vis absorption spectrum of hot dATP V1-AF532, V5 linker-3 AF532-dATP (PBS buffer).

[0133] Figure 16 is the UV-Visible absorption spectrum of hot dATP VI-AF532, V5 linker-3 AF532-dATP (DMSO solution).

[0134] Figure 17 is the UV-Visible absorption spectrum of hot dATP VI-AF532, V5 linker-3 AF532-dATP (LTE buffer).

[0135] Figure 18 is the UV-Visible absorption spectrum of AF532, V6 linker-2 AF532 (PBS buffer and DMSO solution).

[0136] Figure 19 is the emission spectrum of AF532, hot dATP VI-AF532, V5 linker-2 AF532-dATP-1 and V5 linker-2 AF532-dATP-2 (PBS buffer).

[0137] Figure 20 is the emission spectrum of AF532, hot dATP VI-AF532, V5 linker-2 AF532-dATP-1 and V5 linker-2 AF532-dATP-2 (DMSO solution).

[0138] Figure 21 is the emission spectrum of AF532, hot dATP VI-AF532, V5 linker-2 AF532-dATP-1 and V5 linker-2 AF532-dATP-2 (LTE buffer).

[0139] Figure 22 is the emission spectrum of hot dATP VI-AF532, V5 linker-3 AF532-dATP (DMSO solution).

[0140] Figure 23 is the emission spectrum of hot dATP VI-AF532, V5 linker-3 AF532-dATP (LTE buffer solution).

[0141] Figure 24 shows the intensity of DNA sequencing dual label AF532 compared to the intensity of a blank control experiment.

[0142] Figure 25 shows the raw plot of the intensity of DNA sequencing dual label AF532 compared to the intensity of a blank control experiment. DETAILED DESCRIPTION

[0143] Embodiments of the present application will be described in detail below with reference to Examples, but those skilled in the art will appreciate that the following Examples are intended to be illustrative only and should not be viewed as limiting the scope of the present application. Where specific conditions are not specified in the Examples, they are carried out under conventional conditions or under conditions recommended by the manufacturer. Where the manufacturer of the reagent or instrument is not specified, it is a conventional product that can be obtained commercially.

[0144] Reagents and instruments

[0145] (1) Instruments:

[0146] DIONEX UltiMate 3000 liquid chromatograph-mass spectrometer (degasser: SRD-3400, binary pump: HPG-3400RS, automatic sampler: WPS-3000TRS, column oven: TCC-3000SD, detector: DAD-3000, mass spectrometer: ISQ EM-Mass spectrometer, Thermo Fisher Scientific), DIONEX UltiMate 3000 preparative liquid chromatograph (binary pump: HPG-3200BX, automatic sampler: WPS-3000TSL, detector: DAD-3000, fraction collector: Fraction Collector F, Thermo Fisher Scientific), KQ-300E ultrasonic cleaner (Kunshan Ultrasonic Instrument Co., Ltd.), electronic balance (model: BCA324I-10CN, Sartorius Scientific Instruments (Beijing) Co., Ltd.), biotage automatic column chromatography machine (Biotage Trading (Shanghai) Co., Ltd.), vacuum freeze dryer (Bio-Medical Kong (Beijing) Instrument Co., Ltd.), pipette (eppendorf, 20 μL; 200 μL; 1000 μL; 5000 μL).

[0147] (2) Reagents:

[0148] Acetonitrile (Lot: JA113030, Chromatographically pure, Sigma-Aldrich Reagent), ultrapure water, N’N-Diisopropylethylamine (DIPEA) (Lot: C12677270, 99%, Shanghai Macklin Biochemical Technology Co., Ltd.), anhydrous dimethyl sulfoxide (DMSO) (Lot: C14955203, 99.7%, Shanghai Macklin Biochemical Technology Co., Ltd.), N,N'-disuccinimidyl carbonate (DSC) (Lot: BCCB6748, 95%, Sigma-Aldrich Reagent), 4-dimethylaminopyridine (DMAP) (Lot: C12509524, 99%, Shanghai Macklin Biochemical Technology Co., Ltd.), triethylamine (Et3N) (Lot: STBK3222, 99.5%, Sigma-Aldrich Reagent), ethyl bromoacetate (Lot: C12187494, 98%, Shanghai Macklin Biochemical Technology Co., Ltd.), lithium hydroxide (Lot: 20210125, 98%, National Pharmaceutical Group Chemical Reagent Co., Ltd.), AF532 active ester (Lot: KS23D323-202304, Beijing Oukaisi Technology Co., Ltd.), HotdATP-V1 (Lot: WHR039-052-A1, Wuhan Huadaizhi Zao Technology Co., Ltd.). Aminomodified adamantane or cubane was obtained by commercial purchase. dATP-V1 Linker (Lot: WHR039-052-A1, Wuhan Huadaizhi Zao Technology Co., Ltd.), O-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (HATU) (Lot: DNA844, 99.06%, Shanghai Bide Pharmaceutical Technology Co., Ltd.), trifluoroacetic acid (TFA) (Lot: C15139616, AR, Shanghai Macklin Biochemical Technology Co., Ltd.), dichloromethane (DCM) (Lot: C15110397, 99.9%, Shanghai Macklin Biochemical Technology Co., Ltd.), 4-(Boc-aminomethyl)benzoic acid (Lot: DNZ036, 99.95%, Shanghai Bide Pharmaceutical Technology Co., Ltd.), p-Phthalic acid monomethyl ester (Lot: C13313655, 97%, Shanghai Macklin Biochemical Technology Co., Ltd.), 4-hydrazinylbenzoic acid (Lot: CMY716, 99.9%, Bide Pharmaceutical), 3-methyl-2-butanone (Lot: 9TREORXN, 99%, Anjieji Chemical), 1,3-propanesultone (Lot: CML344, 99.4%, Bide Pharmaceutical), N,N-dimethylacetamide (Lot: C13470597, 99.8%, Shanghai Macklin Biochemical Technology Co., Ltd.), propenylidene aniline hydrochloride (Lot: FKLKK-XR, 98%, TCI), glacial acetic acid (Lot: 20221118, 98%, Shanghai Reagent), acetic anhydride (Lot: 20220128, AR, Shanghai Reagent).

[0149] Example 1 Synthesis of V5 linker-2 AF532, V5 linker-2 AF532-dATP-1

[0150] The synthetic route is shown in Figure 2.

[0151] Synthesis of compound 2

[0152] Take 20 mL brown reaction bottle, weigh compound 1 (30 mg, 0.15 mmol), AF532 active ester (199 mg, 0.27 mmol), add anhydrous DMSO (6 mL) to dissolve, add DIPEA (253 μL, 1.5 mmol), and stir magnetically at room temperature for 15 h. The reaction solution is filtered, and the filtrate is purified by reverse-phase biotage automatic column machine (welflash C18-I, regular C18 20-40 μm, 330 g, 0.1 M TEAB / acetonitrile, acetonitrile content 5-95%) to obtain compound 2 (V5 linker-2 AF532). LCMS: calcd for C 70 H 76 N8O 16 S4[(M-2) / 2] - : 705.21. Found, m / z, [(M-2) / 2] - : 705.75.

[0153] Synthesis of compound 3

[0154] Take 20 mL brown reaction bottle, weigh compound 2 (200 mg, 0.14 mmol), add anhydrous DMSO (6 mL) to dissolve, add ethyl bromoacetate (118 mg, 0.7 mmol), add TEA (197 μL, 1.4 mmol), and stir magnetically at room temperature for 1.5 h. The reaction solution is filtered, and the filtrate is purified by reverse-phase biotage automatic column machine (welflash C18-I, regular C18 20-40 μm, 330 g, 0.1 M TEAB / acetonitrile, acetonitrile content 5-95%) to obtain compound 3. LCMS: calcd for C 78 H 82 N8O 18 S4[(M-2) / 2] - : 748.23. Found, m / z, [(M-2) / 2] - : 748.47.

[0155] Synthesis of compound 4

[0156] Take 50 mL round-bottom flask, weigh compound 3 (190 mg, 0.13 mmol), dissolve in ethanol / water (v:v = 1:1, 8 mL), add LiOH (18 mg, 0.78 mmol), and stir magnetically at room temperature for 2 h. Filter the reaction solution, and purify the filtrate by reverse-phase biotage autopurifier (welflash C18-I, regular C18 20-40 μm, 330 g, 0.1 M TEAB / acetonitrile, acetonitrile content 5-95%) to give compound 4. LCMS: calcd for C 72 H 78 N8O 18 S4[M-H] - : 1469.43. Found, m / z, [M-H] - : 1469.79.

[0157] Synthesis of compound 5

[0158] Take 20 mL brown reaction bottle, weigh compound 4 (50 mg, 0.03 mmol), dissolve in anhydrous DMSO (2 mL), add DSC (22 mg, 0.08 mmol), DMAP (0.8 mg, 0.007 mmol), and stir magnetically at room temperature for 5 h, then add hot dATP V1-Linker (32 mg, 0.03 mmol) and TEA (28 μL, 0.2 mmol), and stir magnetically at room temperature for 15 h. Filter the reaction solution, and purify the filtrate by reverse-phase biotage autopurifier (welflash C18-I, regular C18 20-40 μm, 120 g, 0.1 M TEAB / acetonitrile, acetonitrile content 5-95%) and then by preparative HPLC (COSMOSIL, 5 C18-MS-II, 10 ID x 250 mm, Code: 38023-11, 0.1 M TEAB / acetonitrile, acetonitrile content 5-95%) to give compound 5 (V5 linker-2 AF532-dATP-1). 31 P NMR (162 MHz, D2O) δ = -5.55, -10.84, -19.28. LCMS: calcd for C 102 H 116 N 21 O 34 P3S4[(M-2) / 2] - : 1199.31. Found, m / z, [(M-2) / 2] - : 1199.04. FIG. 3 is a MALDI-TOF mass spectrum of V5 linker-2 AF532-dATP-1.31 P NMR spectrum.

[0159] Synthesis of Example 2 V5 linker-2 AF532-dATP-2

[0160] The synthetic route is shown in Figure 4.

[0161] Synthesis of compound 6

[0162] Take 20 mL brown reaction bottle, weigh compound 2 (100 mg, 0.07 mmol), dissolve in anhydrous DMSO (3 mL), add ethyl bromoacetate (118 mg, 0.7 mmol), add TEA (86 μL, 0.7 mmol), and stir electromagnetically at room temperature for 15 h. Filter the reaction solution, and purify the filtrate by reverse-phase biotage automatic column machine (welflash C18-I, regular C18 20-40 μm, 120 g, 0.1 M TEAB / acetonitrile, acetonitrile content 5-95%) to obtain compound 6. LCMS: calcd for C 78 H 88 N8O 20 S4[(M-2) / 2] - : 791.25. Found, m / z, [(M-2) / 2] - : 791.89.

[0163] Synthesis of compound 7

[0164] Take 50 mL round-bottom flask, weigh compound 6 (130 mg, 0.08 mmol), dissolve in ethanol / water (v:v = 1:1, 6 mL), add LiOH (12 mg, 0.48 mmol), and stir electromagnetically at room temperature for 7 h. Filter the reaction solution, and purify the filtrate by reverse-phase biotage automatic column machine (welflash C18-I, regular C18 20-40 μm, 330 g, 0.1 M TEAB / acetonitrile, acetonitrile content 5-95%) to obtain compound 7. LCMS: calcd for C 74 H 80 N8O 20 S4[M-H] - : 1527.44. Found, m / z, [(M-2) / 2] - : 1527.58.

[0165] Synthesis of compound 8

[0166] Take 20 mL brown reaction bottle, weighed compound 7 (50 mg, 0.03 mmol), dissolved in anhydrous DMSO (2 mL), added DSC (21 mg, 0.08 mmol), DMAP (0.8 mg, 0.006 mmol), room temperature, electromagnetic stirring for 4 h, then added hot dATP V1-Linker (31 mg, 0.03 mmol) and TEA (27 μL, 0.2 mmol), room temperature, electromagnetic stirring for 15 h. The reaction solution was filtered, and the filtrate was first purified by reverse phase biotage automatic column machine (welflash C18-I, regular C18 20-40 μm, 120 g, 0.1 M TEAB / acetonitrile, acetonitrile content 5-95%), then purified by preparative HPLC (COSMOSIL, 5C18-MS-II, 10 ID x 250 mm, Code: 38023-11, 0.1 M TEAB / acetonitrile, acetonitrile content 5-95%), and the prepared solution was concentrated under reduced pressure, freeze-dried to obtain compound 8 (V5 linker-2 AF532-dATP-2). 1 H NMR (400 MHz, D2O) δ = 8.04-7.79 (m, 5H), 7.46 (d, J = 9.4 Hz, 1H), 7.31-6.90 (m, 7H), 6.70 (s, 4H), 6.30 (s, 1H), 5.03-4.83 (m, 3H), 4.56 (s, 1H), 4.28 (s, 1H), 4.22-4.03 (m, 7H), 3.96-3.76 (m, 8H), 3.55 (s, 7H), 2.84 (s, 1H), 2.65-2.33 (m, 4H), 2.09-1.90 (m, 3H), 1.83 (s, 3H), 1.15 (s, 12H), 1.04 (s, 12H), 0.90 (s, 12H).31P NMR (162 MHz, D2O) δ = -6.18, -11.22 (d, J = 16.6 Hz), -21.52. LCMS: calcd for C 104 H 118 N 21 O 36 P3S4[(M-2) / 2] - : 1228.31. Found, m / z, [(M-2) / 2] - : 1228.12. Figure 5 is the1H NMR spectrum of V5 linker-2 AF532-dATP-2, and Figure 6 is the31P NMR spectrum of V5 linker-2 AF532-dATP-2. 1 H NMR spectrum of V5 linker-2 AF532-dATP-2, and Figure 6 is the31P NMR spectrum of V5 linker-2 AF532-dATP-2. 31 P NMR spectrum.

[0167] Synthesis of V5 linker-3 AF532, V5 linker-3 AF532-dATP

[0168] The synthetic route is shown in Figure 7.

[0169] Synthesis of compound 9

[0170] Take 20 mL brown reaction bottle, weigh compound 1 (30 mg, 0.15 mmol), AF532 active ester (310 mg, 0.43 mmol), add anhydrous DMSO (6 mL) to dissolve, add DIPEA (303 μL, 1.83 mmol), electromagnetic stirring at room temperature for 8 h. The reaction solution was filtered, and the filtrate was purified by reverse phase biotage automatic column machine (welflash C18-I, regular C18 20-40 μm, 330 g, 0.1 M TEAB / acetonitrile, acetonitrile content 5-95%), and the preparation solution was concentrated under reduced pressure, freeze-dried to obtain compound 9 (V5 linker-3 AF532). LCMS: calcd for C 100 H 10 4N 10 O 24 S6[(M-2) / 2] - : 1010.23. - : 1010.23.

[0171] Synthesis of compound 10

[0172] Take 20 mL brown reaction bottle, weigh compound 9 (100 mg, 0.05 mmol), add anhydrous DMSO (4 mL) to dissolve, add ethyl bromoacetate (25 mg, 0.15 mmol), add TEA (82 μL, 0.6 mmol), electromagnetic stirring at room temperature for 15 h. The reaction solution was filtered, and the filtrate was purified by reverse phase biotage automatic column machine (welflash C18-I, regular C18 20-40 μm, 330 g, 0.1 M TEAB / acetonitrile, acetonitrile content 5-95%), and the preparation solution was concentrated under reduced pressure, freeze-dried to obtain compound 10. LCMS: calcd for C 104 H 110 N 10 O 26 S6[(M-2) / 2] - : 1052.67. - : 1052.67.

[0173] Synthesis of compound 11

[0174] Take 50 mL round-bottom flask, weigh compound 10 (110 mg, 0.05 mmol), dissolve in ethanol / water (v:v = 1:1, 5 mL), add LiOH (10 mg, 0.4 mmol), and stir magnetically at room temperature for 3 h. Filter the reaction solution, and purify the filtrate by reverse-phase biotage autopurifier (welflash C18-I, regular C18 20-40 μm, 330 g, 0.1 M TEAB / acetonitrile, acetonitrile content 5-95%) to obtain compound 11. LCMS: calcd for C 102 H 106 N 10 O 26 S6[M-H] - : 1038.78. Found, m / z, [(M-2) / 2] - : 1038.36.

[0175] Synthesis of compound 12

[0176] Take 20 mL brown reaction bottle, weigh compound 11 (25 mg, 0.012 mmol), dissolve in anhydrous DMSO (3 mL), add DSC (12.5 mg, 0.048 mmol), DMAP (0.3 mg, 0.002 mmol), and stir magnetically at room temperature for 7 h, then add hot dATP V1-Linker (12 mg, 0.012 mmol) and TEA (19 μL, 0.096 mmol), and stir magnetically at room temperature for 15 h. Filter the reaction solution, and purify the filtrate by reverse-phase biotage autopurifier (welflash C18-I, regular C18 20-40 μm, 120 g, 0.1 M TEAB / acetonitrile, acetonitrile content 5-95%) and then by preparative HPLC (COSMOSIL, 5 C18-MS-II, 10 ID x 250 mm, Code: 38023-11, 0.1 M TEAB / acetonitrile, acetonitrile content 5-95%) to obtain compound 12 (V5 linker-3 AF532-dATP). LCMS: calcd for C 31 P NMR (162 MHz, D2O) δ = -5.51 (d, J = 16.0 Hz), -10.83, -19.00. LCMS: calcd for C 132 H 144 N 23 O 42 P3S6[(M-2) / 2] -: 1503.37. Found, m / z, [(M-2) / 2]-: 1503.45. Figure 8 is a HPLC chromatogram of V5 linker-3 AF532-dATP 31 P NMR spectrum.

[0177] Synthesis of V6 linker-2 AF532

[0178] The synthesis route of V6 linker-2 AF532 is shown in Figure 9.

[0179] Synthesis of compound 14 and compound 15

[0180] Take 20 mL brown reaction bottle, weigh compound 1 (100 mg, 0.509 mmol), compound 13 (282 mg, 1.12 mmol), HATU (484 mg, 1.27 mmol), add anhydrous DMSO (8 mL) to dissolve, add DIPEA (395 mg, 532 μL, 3.06 mmol), under the condition of room temperature, electromagnetic stirring for 12 h. The reaction solution was filtered, and the filtrate was purified by reverse phase biotage automatic column machine (welflash C18-I, regular C18 20-40 μm, 120 g, 0.1 M TEAB / acetonitrile, acetonitrile content 5-95%) to prepare a solution, which was concentrated under reduced pressure, and freeze-dried to obtain compound 14 and 15. Compound 14: LCMS: calcd for C 36 H 50 N6O6[M+H] + : 663.38. Found, m / z, [M+H] + : 663.10. Compound 15: LCMS: calcd for C 49 H 65 N7O9[M+H] + : 896.48. Found, m / z, [M+H] + : 896.20.

[0181] Synthesis of compound 17

[0182] Take 20 mL brown reaction bottle, weighed compound 14 (100 mg, 0.15 mmol), compound 16 (136 mg, 0.75 mmol), HATU (287 mg, 0.75 mmol), dissolved in anhydrous DMSO (6 mL), added DIPEA (292 mg, 394 μL, 2.26 mmol), room temperature, electromagnetic stirring 12 h. The reaction liquid was filtered, and the filtrate was purified by reverse phase biotage automatic column machine (welflash C18-I, regular C18 20-40 μm, 120 g, 0.1 M TEAB / acetonitrile, acetonitrile content 5-95%) to prepare a solution, which was concentrated under reduced pressure, freeze-dried to obtain compound 17. LCMS: calcd for C 54 H 62 N6O 12 [M+H] + : 987.44. Found, m / z, [M+H] + : 987.20.

[0183] Synthesis of compound 18

[0184] Take 50 mL round-bottom flask, weighed compound 17 (120 mg, 0.12 mmol), dissolved in anhydrous DCM (9 mL), added TFA (3 mL), room temperature, electromagnetic stirring 3 h. The reaction liquid was rotary evaporated, dissolved in methanol, purified by reverse phase biotage automatic column machine (welflash C18-I, regular C18 20-40 μm, 120 g, 0.1% TFA / acetonitrile, acetonitrile content 5-95%) to prepare a solution, which was concentrated under reduced pressure, freeze-dried to obtain compound 18. LCMS: calcd for C 44 H 46 N6O8[M+H] + : 787.34. Found, m / z, [M+H] + : 787.20.

[0185] Synthesis of compound 19

[0186] Take 20 mL brown reaction bottle, weigh compound 18 (50 mg, 0.064 mmol), AF532 active ester (101 mg, 0.14 mmol), add anhydrous DMSO (5 mL) to dissolve, add DIPEA (82 μL, 0.64 mmol), electromagnetic stirring at room temperature for 12 h. The reaction solution was filtered, and the filtrate was purified by reverse phase biotage automatic column machine (welflash C18-I, regular C18 20-40 μm, 220 g, 0.1 M TEAB / acetonitrile, acetonitrile content 5-95%), and the preparation solution was concentrated under reduced pressure, and freeze-dried to obtain compound 19 (V6 linker-2 AF532). LCMS: calcd for C 104 H 102 N 10 O 24 S4[(M-2) / 2] - : 1000.80. Found, m / z, [(M-2) / 2] - : 1000.50.

[0187] Synthesis of V7 linker-2 AF532-dATP

[0188] The synthesis route is shown in Figure 10.

[0189] Synthesis of compound 14

[0190] Take 50 mL round-bottom flask, weigh compound 13 (120 mg, 0.26 mmol), add anhydrous DMSO (5 mL) to dissolve, add DSC (78 mg, 0.31 mmol), DMAP (4.2 mg, 0.04 mmol), electromagnetic stirring at room temperature for 4 h, then add hot dATP V1-Linker (162 mg, 0.17 mmol) and DIPEA (148 μL, 0.85 mmol), electromagnetic stirring at room temperature for 15 h. The reaction solution was filtered, and the filtrate was first purified by reverse phase biotage automatic column machine (welflash C18-I, regular C18 20-40 μm, 330 g, 0.1 M TEAB / acetonitrile, acetonitrile content 5-95%), and the preparation solution was concentrated under reduced pressure, and freeze-dried to obtain compound 14. LCMS: calcd for C 50 H 76 N 13 O 28 P3[M-H] - : 1398.41 Found, m / z, [[M-H] - : 1398.58.

[0191] Synthesis of compound 15

[0192] Take 20 mL brown reaction bottle, weigh compound 14 (38.5 mg, 0.028 mmol), dissolve in anhydrous DMSO (3 mL), add DSC (14 mg, 0.059 mmol), DMAP (0.7 mg, 0.01 mmol), electromagnetic stirring at room temperature for 4 h, then add compound 2 (31.1 mg, 0.02 mmol) and DIPEA (23 μL, 0.14 mmol), electromagnetic stirring at room temperature for 15 h. The reaction solution was filtered, the filtrate was first purified by reverse phase biotage automatic column machine (welflash C18-I, regular C18 20-40 μm, 220 g, 0.1 M TEAB / acetonitrile, acetonitrile content 5-95%), the preparation solution was concentrated under reduced pressure, freeze-dried to obtain compound 15 (V7 linker-2 AF532).

[0193] 1 H NMR (400 MHz, DMSO-d6) δ 8.76 (s, 2H), 8.58 (s, 1H), 8.45 (s, 1H), 8.39-8.32 (m, 1H), 8.19-7.99 (m, 4H), 7.91 (d, J = 6.5 Hz, 1H), 7.60 (s, 1H), 7.42 (d, J = 8.2 Hz, 3H), 7.33-7.25 (m, 1H), 7.02 (t, J = 6.7 Hz, 1H), 6.65 (s, 3H), 6.40 (t, J = 7.4 Hz, 1H), 5.28 (t, J = 4.8 Hz, 1H), 5.11 (q, J = 4.4 Hz, 1H), 4.89 (d, J = 8.9 Hz, 1H), 4.81 (d, J = 8.8 Hz, 1H), 4.55 (d, J = 5.2 Hz, 1H), 4.27-4.04 (m, 4H), 3.99-3.87 (m, 3H), 3.84-3.70 (m, 4H), 3.65 (d, J = 4.5 Hz, 3H), 3.58-3.02 (m, 46H), 3.02-2.77 (m, 13H), 2.46 (p, J = 1.9 Hz, 4H), 2.39-2.09 (m, 8H), 2.07-1.84 (m, 3H), 1.45-1.36 (m, 1H), 1.20 (d, J = 3.2 Hz, 4H), 1.16-1.02 (m, 24H), 0.96 (s, 6H), 0.87-0.75 (m, 2H). 31 P NMR (162 MHz, DMSO-d6) δ -11.76 (d, J = 23.5 Hz), -12.47 (d, J = 24.9 Hz), -24.32 (d, J = 24.5 Hz). LCMS: calcd for C120 H 150 N 21 O 43 P3S4[(M-2H) / 2] - : 1396.40 Found, m / z, [(M-2H) / 2] - : 1396.74. Figure 11 is a H NMR spectrum of V7 linker-2 AF532-dATP. 1 H NMR spectrum, Figure 12 is a P NMR spectrum of V7 linker-2 AF532-dATP. 31 P NMR spectrum.

[0194] The hot dATP-V1-AF532 used in the spectral test is a dNTP in a commercial kit from Huada Intelligent Manufacturing, and its chemical structure is as follows:

[0195] Example 6 Spectral test

[0196] (1) Solution preparation method for spectral test

[0197] 1.2 μmol / L AF532:

[0198] Accurately weigh 12.5 mg of AF532 (0.017 mmol), and use a pipette to remove 8.635 mL of DMSO, ultrasonic dissolution, to prepare a 2 mmol / L solution. Use a pipette to remove 6 μL of the above solution, and dilute it with 10 mL of 20 mM PBS buffer / DMSO solution / LTE buffer solution (Low TE buffer) to prepare a 1.2 μmol / L solution.

[0199] 1.2 μmol / L hot dATP-V1-AF532:

[0200] Accurately weigh 4.6 mg of hot dATP-V1-AF532 (2.346 μmol), and use a pipette to remove 2.346 mL of DMSO, ultrasonic dissolution, to prepare a 1 mmol / L solution. Use a pipette to remove 12 μL of the above solution, and dilute it with 10 mL of 20 mM PBS buffer / DMSO solution / LTE buffer solution to prepare a 1.2 μmol / L solution.

[0201] 1.2 μmol / L V5 linker-2 AF532-dATP-1:

[0202] Accurately weigh 1.5 mg of V5 linker-2 AF532-dATP-1 (0.481 μmol), pipette 0.481 mL of DMSO, ultrasonic dissolution, and prepare a 1 mmol / L solution. Pipette 12 μL of the above solution, and dilute with 10 mL of 20 mM PBS buffer / DMSO solution / LTE buffer solution to prepare a 1.2 μmol / L solution.

[0203] 1.2 μmol / L V5 linker-2 AF532-dATP-2:

[0204] Accurately weigh 1.9 mg of V5 linker-2 AF532-dATP-2 (0.598 μmol), pipette 0.598 mL of DMSO, ultrasonic dissolution, and prepare a 1 mmol / L solution. Pipette 12 μL of the above solution, and dilute with 10 mL of 20 mM PBS buffer / DMSO solution / LTE buffer solution to prepare a 1.2 μmol / L solution.

[0205] 1.2 μmol / L V5 linker-3 AF532-dATP:

[0206] Accurately weigh 1.7 mg of V5 linker-3 AF532-dATP (0.439 μmol), pipette 0.439 mL of DMSO, ultrasonic dissolution, and prepare a 1 mmol / L solution. Pipette 12 μL of the above solution, and dilute with 10 mL of 20 mM PBS buffer / DMSO solution / LTE buffer solution to prepare a 1.2 μmol / L solution.

[0207] 1.2 μmol / L V6 linker-2 AF532:

[0208] Accurately weigh 0.5 mg of V6 linker-2 AF532 (0.227 μmol), pipette 0.227 mL of DMSO, ultrasonic dissolution, and prepare a 1 mmol / L solution. Pipette 12 μL of the above solution, and dilute with 10 mL of 20 mM PBS buffer / DMSO solution to prepare a 1.2 μmol / L solution.

[0209] (2) UV-visible absorption spectrum test results

[0210] Take 1.2 μmol / L of the sample solution to be tested into a 1 cm quartz cuvette, and PBS buffer / DMSO solution / LTE buffer / blank reference is scanned in the wavelength range of 350-800 nm to determine the maximum absorption wavelength of the sample. The results are shown in Figures 13-18.

[0211] (3) Fluorescence spectrum test results

[0212] Take 1.2 μmol / L of the sample solution to be tested into a 1 cm quartz cuvette, and set the excitation light wavelength to 532 nm or 650 nm. Scan the emission spectrum in the wavelength range of 300-800 nm. The results are shown in Figures 19-23.

[0213] As shown in the figures, under the condition that the solvent is constant, the ultraviolet absorption intensity of V5 linker-2 AF532-dATP-1, V5 linker-2 AF532-dATP-2, V5 linker-3 AF532-dATP, and V6 linker-2 AF532 is greater than that of AF532 and / or hot dATP-V1-AF532.

[0214] As shown in the figures, under the condition that the solvent is constant, the fluorescence emission intensity of V5 linker-2 AF532-dATP-1, V5 linker-2 AF532-dATP-2, V5 linker-3 AF532-dATP, and V6 linker-2 AF532 is greater than that of AF532 and / or hot dATP-V1-AF532.

[0215] Example 7 Sequencer biochemical test

[0216] 1) Experimental equipment: DNBSEQ-G99 sequencer, MGIDL-G99 & MGIDL-G99RS

[0217] Portable sample injector, DNBSEQ-G99 sequencing slide, DNBSEQ-G99RS high-throughput sequencing reagent kit (G99SM+FCL PE150)

[0218] 2) Reagents and raw materials used in the experiment

[0219] Ultra-pure water, E. coli single-stranded loop DNA as a template, standard library reagent V3.0, primer sequence: CAACTCCTTGGCTCACAGAACATGGCTACGATCCGACTT (SEQ ID NO. 1). DNA polymerase from BGI, DNA nanoballs from BGI. The following experiments are all prepared with E. coli single-stranded loop DNA as a template, and DNA nanoballs are prepared and loaded into the chip using the DNBSEQ-G99 sequencing kit for subsequent sequencing.

[0220] Experimental group 1: using DNBSEQ-G99 high-throughput sequencing kit, according to the experimental procedure, SE3 short cycle sequencing was carried out on DNBSEQ-G99 sequencing platform. In DNBSEQ-G99 sequencing platform, fluorescent double label modified and ordinary fluorescent modified nucleotides and reversible blocked nucleotide mixture were sequentially polymerized, then free nucleotides were eluted using elution reagent, signal acquisition was carried out under the photographing solution, the protection group was removed using the excision reagent, and the washing step was carried out using the elution reagent. Then the signal intensity of each cycle was counted.

[0221] Control group 1: using DNBSEQ-G99 high-throughput sequencing kit, according to the experimental procedure, SE3 short cycle sequencing was carried out on DNBSEQ-G99 sequencing platform. In DNBSEQ-G99 sequencing platform, fluorescent double label modified and ordinary fluorescent modified nucleotides and reversible blocked nucleotide mixture were sequentially polymerized, then free nucleotides were eluted using elution reagent, signal acquisition was carried out under the photographing solution, the protection group was removed using the excision reagent, and the washing step was carried out using the elution reagent. Then the signal intensity of each cycle was counted.

[0222] 3). Experimental method and step

[0223] First step: loading DNA nanoballs into the prepared chip

[0224] Second step: pumping the prepared dNTP molecular mixture into the chip using DNA polymerase to add dNTP molecules to the parent strand of DNA

[0225] Third step: determine the type of base and obtain the corresponding signal intensity by scanning the reagent photograph

[0226] Fourth step: using excision reagent to expose the 3' end hydroxyl group

[0227] Fifth step: the second cycle sequencing is carried out according to the first four steps

[0228] Figure 24 shows the intensity of DNA sequencing dual label AF532 compared to the intensity of a blank control experiment. Figure 25 shows the raw plot of the intensity of DNA sequencing dual label AF532 compared to the intensity of a blank control experiment. As can be seen from Figure 24 and Figure 25, labelling two AF532 dyes on the A base by a special liner modification increases the intensity of the A base by 39.6%.

[0229] The above examples are only used to illustrate the technical solutions of the present application but not limit the present application. Modifications or equivalent replacements to the technical solutions of the present application without departing from the purpose and scope of the present application should be covered within the protection scope of the present application.

Claims

1. A molecular probe comprising a cage hydrocarbon group and at least two identical fluorescent dyes linked via the cage hydrocarbon group; Preferably, the cage hydrocarbon is selected from polyhedral carbon alkanes (CH) n (n is an even number ≥ 4), such as cubane; Preferably, the cage hydrocarbon is adamantane.

2. The molecular probe of claim 1, the fluorescent dye is selected from the group consisting of fluorescent dyes emitting wavelengths from the blue region all the way to the red region, such as cyanine dyes, fluorescein dyes, rhodamine dyes, coumarin dyes, polycyclic aromatic hydrocarbon dyes, NBD-amine dyes, naphthalimide dyes, BODIPY dyes, thiazine dyes and oxazine dyes; Preferably, the fluorescent dye is an AF series dye or a Cy series dye; Preferably, the fluorescent dye is AF532.

3. The molecular probe of claim 1 or 2, the cage hydrocarbon and fluorescent dye are linked via one or more linker groups selected from the group consisting of amide bonds, ester bonds, polyethylene glycol segments, terephthalic acid units, terephthalic diamine units.

4. The molecular probe of any one of claims 1-3, the molecular probe comprises two or more (e.g. 3, 4, 5 or 6) fluorescent dyes.

5. The molecular probe of any one of claims 1-4, the molecular probe further carries one or more reactive groups, such as amino or carboxyl groups, on the cage hydrocarbon group.

6. The molecular probe of any one of claims 1-5, having a structure selected from the group consisting of: Preferably, the molecular probe is selected from the following compounds:

7. Use of the molecular probe of any one of claims 1-6 for labeling a biomolecule (e.g. a nucleoside, a nucleotide, a polynucleotide, a carbohydrate, a protein), an antibody, a ligand, a chromosome, a nucleus or a living cell.

8. A nucleoside, a nucleotide or an oligonucleotide modified or labeled with the molecular probe of any one of claims 1-6; Preferably, the molecular probe is covalently attached to the nucleoside, nucleotide or oligonucleotide via the cage hydrocarbon group; Preferably, the molecular probe can be covalently attached to an oligonucleotide or a nucleotide via a nucleotide base; Preferably, the nucleoside, nucleotide or oligonucleotide modified or labeled with the molecular probe of any one of claims 1-6 has the following structure: wherein B is a nucleobase, such as uracil, thymine, cytosine, adenine, guanine and the like; L is an optional (i.e. can be present or can be absent) linker group; R’ is selected from the group consisting of -CH2O(P=O)(OH)2, -CH2(O(P=O)OH)2OH, -CH2(O(P=O)OH)3OH, a phosphorothioate, a phosphate analogue, -O- attached to a reactive phosphorus-containing group or -O- protected by a blocking group; R” is H, OH, a phosphoramidite or a 3’-OH blocking group; R”’ is H or OH; Preferably, the 3’-OH blocking group is an azidomethylene group; Preferably, the linking group comprises a cleavable linking group, for example a linking group having the structure shown below: wherein the alkynyl group is linked to the nucleobase; Preferably, the nucleotide or oligonucleotide modified or labeled with the molecular probe of any one of claims 1-6 is a deoxyribonucleoside triphosphate (dNTP), such as dATP (deoxyadenosine triphosphate), dGTP (deoxyguanosine triphosphate), dTTP (deoxythymidine triphosphate) or dCTP (deoxycytidine triphosphate), or is a nucleoside triphosphate (NTP), such as ATP (adenosine triphosphate), GTP (guanosine triphosphate), CTP (cytosine triphosphate) and UTP (uridine triphosphate).

9. A nucleotide modified or labeled with the molecular probe of any one of claims 1-6, selected from the group consisting of: Modified or labeled dATP, for example: modified or labeled dGTP, for example: Modified or labeled dCTP, for example: modified or labeled dTTP, for example: wherein The molecular probe is according to any one of claims 1 to 6.

10. A nucleotide modified or labeled with the molecular probe of any one of claims 1-6, having a structure selected from the group consisting of: wherein L is an optional linker group, and dNTP is a deoxyribonucleoside triphosphate; Preferably, the nucleotide is selected from the group consisting of:

11. A method of preparing a molecular probe according to any one of claims 1 to 6, comprising the steps of: (1) providing a cage hydrocarbon modified with at least three reactive groups; (2) attaching at least two identical dye molecules to at least two of the reactive groups on the cage hydrocarbon, respectively; Optionally, the method further comprises step (3) of protecting, deprotecting or modifying the remaining reactive groups on the cage hydrocarbon.

12. The method of claim 11, wherein in step (1), the cage hydrocarbon is adamantane; preferably, each of the reactive groups is located at position 1, 3, 5 or 7 of the adamantane. Preferably, in step (1), the cage hydrocarbon is adamantane modified with four reactive groups, each of which is located at position 1, 3, 5 and 7 of the adamantane.

13. The method of claim 11 or 12, wherein in step (1), each of the reactive groups is an amino group.

14. The method of any one of claims 11 to 13, wherein in step (2), the attachment is achieved by forming an amide bond.

15. The method of any one of claims 11 to 14, wherein in step (2), two identical dye molecules are attached to two of the reactive groups on the adamantane, respectively; Preferably, in step (2), two identical dye molecules are attached to the reactive groups at positions 1 and 5 of the adamantane, respectively.

16. The method of any one of claims 11 to 15, wherein in step (2), three identical dye molecules are attached to three of the reactive groups on the cage hydrocarbon, respectively; Preferably, in step (2), three identical dye molecules are attached to the reactive groups at positions 1, 3 and 5 of the adamantane, respectively.

17. The method of any one of claims 11 to 16, wherein in step (3), the remaining reactive groups on the cage hydrocarbon are reacted to attach carboxyl groups.

18. A method of modifying or labeling a nucleotide using a molecular probe according to any one of claims 1 to 6, the method comprising the steps of: (1) providing a nucleotide and a molecular probe according to any one of claims 1 to 6, the molecular probe having at least one reactive group (e.g. a carboxyl group or an amino group) on the cage hydrocarbon group; optionally, the nucleotide has a cleavable group; (2) attaching the molecular probe to the base of the nucleotide or to the cleavable group on the nucleotide via the reactive group.

19. The method of claim 18, wherein the cage hydrocarbon group is adamantane; preferably, the reactive group is located at position 3 or 7 of the adamantane.

20. The method of claim 18 or 19, wherein the nucleotide is a dNTP, i.e. a deoxyribonucleoside triphosphate, e.g. selected from dATP, dGTP, dTTP, dCTP; or the nucleotide is a rNTP, i.e. a ribonucleoside triphosphate, e.g. selected from ATP, GTP, CTP, UTP.

21. The method of any one of claims 18 to 20, wherein the nucleotide is modified with a reversible blocking group, e.g. an azidomethylene (-CH2-N3) or an allyl group at the 3'-O of the deoxyribose.

22. Compounds, their salts, or esters having a structure selected from the following:

23. Use of a compound, salt or ester thereof according to claim 22 as an intermediate in the synthesis of a molecular probe according to any one of claims 1 to 6, a modified or labelled nucleoside, nucleotide or oligonucleotide according to claim 8, or a modified or labelled nucleotide according to claim 9 or 10.

24. A method of sequencing comprising incorporating a modified or labelled nucleotide according to claim 9 or 10 into a sequencing assay; preferably, the method further comprises detecting the modified or labelled nucleotide; preferably, the sequencing assay is performed on an automated sequencing instrument, and wherein the automated sequencing instrument comprises two light sources operating at different wavelengths.

25. A method of sequencing according to claim 24, the method of sequencing comprising: (a) incorporating at least one modified or labelled nucleotide according to claim 9 or 10 into a polynucleotide; and (b) detecting the modified or labelled nucleotide incorporated into the polynucleotide by detecting a fluorescent signal from a new fluorescent dye attached to the or labelled nucleotide.

26. A kit comprising one or more nucleotides, wherein at least one nucleotide is a modified or labelled nucleotide according to claim 9 or 10; preferably, the kit comprises two or more labelled nucleotides.

27. A kit according to claim 26, the kit comprising sequencing reagents; preferably, the sequencing reagents comprise at least one of: a dNTPs mix, a nucleic acid polymerase mix, an elution solution.

28. A kit according to claim 27, the dNTPs mix containing at least one modified or labelled nucleotide according to claim 9 or 10; preferably, the elution solution contains a cleavage reagent; optionally, the cleavage reagent is selected from one or more of the following: Endo IV, alkaline phosphatase, an organic phosphine (such as tris(3-hydroxypropyl)phosphine (THPP), tris(2-carboxyethyl)phosphine hydrochloride (TCEP)) or a PdCl2 complex with sulfonated triphenylphosphine.

29. Use of a molecular probe according to any one of claims 1 to 6 in sequencing, expression analysis, hybridisation analysis, genetic analysis, RNA analysis, protein binding assays, in vitro diagnostics, immunoassays, molecular labelling; preferably, the molecular labelling is for cell imaging, tissue imaging or imaging of a living organism.

30. Use of a molecular probe according to any one of claims 1 to 6 in fluorescent labelling, quantification or detection of proteins, enzymes or nucleic acids.

31. Use of a modified or labelled nucleoside, nucleotide or oligonucleotide according to claim 8, or a modified or labelled nucleotide according to claim 9 or 10, or a kit according to any one of claims 26 to 28 in sequencing.

Citation Information

Patent Citations

  • New fluorescent dyes and their uses as biomarkers

    CN109476654A

  • Coumarin compounds and their uses as fluorescent labels

    CN109476674A

  • Reagents for optical microscopy comprising an antibody or fab fragment and a fluorophore

    CN111194224A

  • Improved chemiluminescent 1,2-dioxetanes

    WO1994026726A1

  • Amplified fluorescent materials and uses thereof

    WO1999049831A2