Plastid transit peptide and use thereof

By providing novel amino acid and nucleotide sequences for plasmid transport peptides, the problems of low versatility and targeting efficiency of existing plasmid transport peptides are solved, enabling efficient targeting of peptides or proteins and enhanced plant herbicide tolerance.

WO2026020415A1PCT designated stage Publication Date: 2026-01-29BEIJING DABEINONG BIOTECHNOLOGY CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/107561
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-07-25
Publication Date
2026-01-29

AI Technical Summary

Technical Problem

Existing plasmid transport peptides have poor versatility and adaptability, low targeting efficiency, and are difficult to effectively guide peptides or proteins to plant plasmids.

Method used

We provide novel plasmid transport peptide amino acid sequences and their encoding nucleotide sequences for constructing compositions and methods that operatively link peptides or proteins to plant plasmids, including the production of transgenic plant materials and enhancing plant tolerance to herbicides.

Benefits of technology

It improves the versatility and targeting efficiency of plasmid transport peptides, enhances plant tolerance to herbicides, and enables effective targeting of peptides or proteins and guidance of specific organelles.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024107561_29012026_PF_FP_ABST
    Figure CN2024107561_29012026_PF_FP_ABST
Patent Text Reader

Abstract

Provided are a novel plastid transit peptide and a use thereof. The provided plastid transit peptide can direct an operably linked polypeptide or protein to a plant plastid in a targeted manner. The present invention further relates to a composition and method for directing an operably linked polypeptide or protein to a plastid in a targeted manner, and in particular to a method for producing a transgenic plant material comprising the plastid transit peptide, a plant material produced by this method, and a plant commodity, product or processed agricultural product produced from the plant material. Compared with natural plastid transit peptides, the provided novel plastid transit peptide has the advantages of stronger universality, better adaptability, and higher targeted localization efficiency, and has broad application prospects in the field of plants.
Need to check novelty before this filing date? Find Prior Art

Description

Plastid transit peptides and uses thereof TECHNICAL FIELD

[0001] The present invention relates to the field of plant molecular biology, the field of plastid biology, and the field of protein transport. More specifically, the present invention relates to the field of protein targeting. The present invention provides plastid transit peptides that direct operably linked polypeptides or proteins to localize to plant plastids, including the amino acid sequences of the plastid transit peptides, and / or the nucleotide sequences encoding the amino acid sequences, and in particular to genetically encoded and expressed polypeptide compositions and methods for targeting to plant plastids, including but not limited to the production of transgenic plant material and plant commodities, products, or processed agricultural products produced from the plant material. BACKGROUND

[0002] Plastids are important organelles in cells of plants and algae that are involved in photosynthesis, respiration, and various metabolic processes, store products such as starches, and are responsible for the synthesis of many types of molecules such as fatty acids, terpenes, and other molecules required for cellular building blocks. Plastids have the ability to differentiate or re-differentiate into several forms depending on their role in the cell. Undifferentiated proplastids have the potential to develop into any of the following plastids, including chloroplasts, chromoplasts, leucoplasts, amyloplasts, otoliths, elaioplasts, and proteinoplasts.

[0003] It has been described in the prior art that many important biological processes occur within plastids, and thus it is important to localize foreign proteins to plastids for the study of these processes. Plastid transit peptides (PTP) are capable of efficiently mediating the targeting, localization, or transport of a linked polypeptide to a plastid. Such plastids can be primary, secondary, or tertiary plastids. The transit peptide is located at the N-terminus of the protein that is imported into the plastid. Plastid transit peptides or chloroplast transit peptides (CTP) direct polypeptides containing a chloroplast transit peptide to a plastid (e.g., chloroplast) in a “co- or post-translational manner”. Endogenous chloroplast proteins or exogenous proteins can be directed to the chloroplast by expressing such proteins as larger precursor polypeptides containing a chloroplast transit peptide. Most chloroplast proteins are encoded in the nucleus of the plant cell, synthesized as larger precursor proteins in the cytosol, and post-translationally transported to the chloroplast. The precursor proteins destined for chloroplast expression contain an N-terminal extension known as a chloroplast transit peptide. The transit peptide plays a role in the specific recognition at the chloroplast surface and is involved in mediating the post-translational transport of the precursor protein through the chloroplast envelope and from the chloroplast envelope to the various sub-compartments of the chloroplast (e.g., the stroma, thylakoids, and thylakoid membranes). These N-terminal transit peptide sequences contain all the information required for the transport of the chloroplast protein into the plastid.

[0004] Studies have shown that the structure of plastid transit peptides generally contains the following characteristics: plastid transit peptides generally contain 40 to 100 amino acids; they have few negatively charged amino acids such as aspartic acid, glutamic acid, asparagine or glutamine; the N-terminal region is free of charged amino acids and amino acids such as glycine or proline; their central region contains a very high proportion of basic or hydroxyl amino acids such as serine or threonine; the C-terminal region is rich in arginine and has the ability to form a facultative beta-sheet secondary structure. After the polypeptide is introduced into the plastid, the transit peptide can be effectively cleaved from the connecting polypeptide by specific proteases in the plastid (Christian, Ryan W et al., PeerJ 8.2 (2020): e9772). The structure of higher plant chloroplast transit peptides generally has the following characteristics: they have similar features to mitochondrial transit peptides on the surface, i.e. they are rich in hydroxylated residues and lack acidic residues; they have a length of 30-120 residues; the N-terminal 10-15 amino acids lack glycine, proline and charged residues; the variable central region is rich in serine, threonine, lysine and arginine; the C-terminal region contains a loosely conserved sequence for proteolytic processing; there is no conservation of extension sequences or conserved secondary structure motifs; and theoretically, mainly random coil conformation is adopted (Cline and Henry, Annual Review of Cell and Developmental Biology 12: 1-26 (1996)).

[0005] Although there are some natural plastid transit peptides at present, there is less data on the structure of higher plant transit peptides, and it is still urgent to isolate more novel plastid transit peptides. Compared with the prior art, the present application provides a novel plastid transit peptide and its use, and the technical scheme of the application mainly solves the following problems: (1) the natural plastid transit peptide has poor universality and adaptability, and can only be used for positioning specific polypeptides or proteins; (2) the number of target receptors on the plastid membrane is limited, and the natural plastid transit peptide has low efficiency in guiding the targeted positioning of polypeptides or proteins.

[0006] SUMMARY

[0007] The purpose of the present application is to provide a novel plastid transit peptide and its use, which can guide the positioning of an operably linked polypeptide or protein to the plant plastid, and has the advantages of stronger universality, adaptability and higher targeting efficiency compared with the natural plastid transit peptide.

[0008] To achieve the above-mentioned purpose, the present application provides a novel plastid transit peptide, and the amino acid sequence of the plastid transit peptide comprises SEQ ID NO: 1 to SEQ ID NO: 36.

[0009] To achieve the above object, the present application further provides a nucleotide sequence encoding a plastid transit peptide comprising SEQ ID NO: 37 to SEQ ID NO: 72.

[0010] To achieve the above object, the present application further provides a composition of a polypeptide or protein operably linked to target plant plastids.

[0011] Further, the plant plastid is chloroplast.

[0012] Further, the composition comprises a nucleic acid molecule, characterized in that the nucleic acid molecule comprises a nucleotide sequence capable of encoding a plastid transit peptide and a nucleotide sequence of interest operably linked,

[0013] Further, the nucleic acid molecule is capable of being used for expression and targeting a polypeptide encoded by the nucleotide sequence of interest to plant plastids.

[0014] Further, the composition is a same frame nucleotide sequence, a chimeric nucleotide sequence or a fusion nucleotide sequence comprising the nucleic acid molecule.

[0015] Further, the composition is an expression cassette comprising a nucleic acid molecule, characterized in that the expression cassette comprises a regulatory sequence linked to regulate the nucleic acid molecule.

[0016] Further, the composition is a recombinant vector comprising the expression cassette.

[0017] Preferably, the plant is a monocotyledon or a dicotyledon.

[0018] More preferably, the plant is corn, soybean, Arabidopsis, cotton, oilseed rape, rice, sorghum, wheat, barley, millet, tobacco, sunflower, sugarcane or oat.

[0019] To achieve the above object, the present application further provides a method of targeting a polypeptide or protein operably linked to plant plastids, comprising:

[0020] Obtaining cells of a transgenic host organism comprising a nucleic acid molecule comprising a plastid transit peptide and a nucleotide sequence of interest operably linked to an expression cassette;

[0021] Culturing the cells of the transgenic host organism;

[0022] Recovering the protein of the plastid transit peptide.

[0023] Further, the transgenic host organism comprises a plant, an animal, a bacterium, a yeast, a baculovirus, a nematode or an alga.

[0024] To achieve the above object, the present application further provides a method of producing a plant material comprising the plastid transit peptide, comprising:

[0025] planting at least one plant propagule comprising in its genome said plastid transit peptide or said expression cassette;

[0026] growing said plant propagule into a plant;

[0027] Further, said plant is a monocotyledonous plant or a dicotyledonous plant.

[0028] Further, a plant material produced by said method, obtaining a plant commodity, product or processed agricultural product produced from said plant material.

[0029] Preferably, said plant is corn, soybean, Arabidopsis, cotton, rape, rice, sorghum, wheat, barley, millet, tobacco, sunflower, sugarcane or oat.

[0030] To achieve the above object, the present application further provides a method for enhancing herbicide tolerance of a plant.

[0031] Further, said method for enhancing herbicide tolerance of a plant is introducing into a plant a nucleic acid molecule, an expression cassette or a recombinant vector operably linked to a herbicide tolerance gene sequence.

[0032] Further, said herbicide tolerance gene is cPTG (protoporphyrinogen oxidase gene) and / or cEPSPS gene (5-Enolpyruvylmangiferyl-3-phosphate synthase gene), characterized in that said gene is operably linked to a plastid transit peptide.

[0033] Further, said herbicide for increasing herbicide tolerance is a protoporphyrinogen oxidase (PPO) inhibitor herbicide, a 5-Enolpyruvylmangiferyl-3-phosphate synthase (EPSPS) herbicide.

[0034] Preferably, said herbicide for increasing herbicide tolerance is oxyfluorfen, saflufenacil, flumioxazin, glyphosate.

[0035] Preferably, said plant is a monocotyledonous plant or a dicotyledonous plant.

[0036] More preferably, said plant is corn, soybean, Arabidopsis, cotton, rape, rice, sorghum, wheat, barley, millet, tobacco, sunflower, sugarcane or oat.

[0037] As a specific embodiment of the application, the plastid transit peptide (also known as a secretion signal sequence or targeting sequence) is a polypeptide or protein that is synthesized cytosolically and targeted and directed to a specific plastid, organelle or cellular compartment by a post-translational mechanism, and can be exogenous, the plastid-targeted polypeptide or protein can be a polypeptide or protein that includes, but is not limited to, traits such as herbicide tolerance, resistance to insect pests and pathogens (viral resistance, bacterial pathogen resistance, insect resistance, nematode resistance, fungal resistance, synthesis of Bt toxin proteins), plant yield or environmental tolerance (tolerance to extreme temperatures, soil conditions, light levels, moisture levels, nitrogen levels, and chemical environments), plant physiological processes (photosynthesis, synthesis of hormones), nutritional enhancements, pharmaceutical or industrial products (fatty acids, amino acids, oils, carotenoids, terpenes, starch, zeaxanthin epoxidase, choline monooxygenase, ferrochelatase, omega-3 fatty acid desaturase, glutamine synthetase, starch-modifying enzymes, essential amino acids, synthesis of provitamin A), extended shelf life, restoration of cytoplasmic male sterility, and the like. For example, a chloroplast transit peptide sequence is used to target the chloroplast, or a 'KDEL' retention sequence is used to target the endoplasmic reticulum, or a C-terminal propeptide (CTPP) of the barley lectin gene is used to target the vacuole. Plastid transit peptides are composed of three major domains (Karlin-Neumann & Tobin, 1986; Quigley, Martin & Cerff, 1988; Bruce, 2000, 2001; Li & Teng, 2013), including an uncharged N-terminal proximal region, a central domain rich in hydroxylated residues and lacking acidic residues, and a C-terminal distal region rich in arginine (Bruce, 2001).

[0038] As a specific embodiment of the application, isolated sequences having plastid transit peptide activity and hybridizing to a plastid transit peptide sequence of the application or a fragment thereof under stringent conditions are included in the application, which sequences are at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to a sequence of the application. That is, the range of sequence identity is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity.

[0039] As a specific embodiment of the application, the terms "transports," "targets," and "translocates" refer to the property of a plastid transit peptide amino acid sequence of the application to facilitate movement of a polypeptide comprising the amino acid sequence from the nucleus of a host cell to the plastid of the host cell. In particular embodiments, such an amino acid sequence can be capable of transporting about 100%, at least about 95%, at least about 90%, at least about 85%, at least about 80%, at least about 70%, at least about 60%, or at least about 50% of a polypeptide comprising the amino acid sequence into the plastid of a host cell.

[0040] As a specific embodiment of the present application, the porphyrin biosynthesis pathway is used to synthesize chlorophyll and heme, which play important roles in plant metabolism, and the pathway occurs in chloroplasts. In the pathway, protoporphyrinogen oxidase (PPO for short) catalyzes the oxidation of protoporphyrinogen IX into protoporphyrin IX. After the generation of protoporphyrin IX, protoporphyrin IX is combined with magnesium by a magnesium chelatase to synthesize chlorophyll, or is combined with iron by an iron chelatase to synthesize heme. Herbicides that act by inhibiting PPO include diphenyl ether PPO inhibitor herbicides, oxadiazon PPO inhibitor herbicides, N-phenyl phthalimide PPO inhibitor herbicides, oxazoline ketone PPO inhibitor herbicides, phenylpyrazole PPO inhibitor herbicides, uracil PPO inhibitor herbicides, thiazole PPO inhibitor herbicides, triazolinone PPO inhibitor herbicides, triazinone PPO inhibitor herbicides, and other types of PPO inhibitor herbicides. In plants, PPO inhibitors inhibit the enzyme activity of PPO, resulting in the inhibition of the synthesis of chlorophyll and heme, and resulting in the accumulation of the substrate protoporphyrinogen IX, which is rapidly exported from the chloroplast to the cytoplasm, where the protoporphyrinogen IX is converted to protoporphyrin IX in a non-enzymatic reaction and further generates highly reactive singlet oxygen (1O2) in the presence of light and oxygen molecules, which will destroy the cell membrane and rapidly cause the death of plant cells.The "PPO inhibitor herbicide" also known as "PPO inhibitor herbicides" can be one or more selected from the group consisting of, but not limited to: diphenyl ether (chloroxuron, chlomethoxyfen, bifenox, oxyfluorfen, fluorodifen, its salts and esters, fomesafen, lactofen, fluoroglycofen-ethyl, fluoronitrilo, aclonifen, bifenox, ethoxyfen, chloronitrofen, halosafen); oxadiazolone (oxadiazon, oxadiargyl); N-phenylphthalimide (flumioxazin, flumiclorac-pentyl, cinidon-ethyl); oxazolone (pentoxazone); phenylpyrazole (fluazolate, pyraflufen-ethyl); ureidopyrimidine (bifenoxal, fluthiamide, saflufenacil); thidiazole (thidiazimin, fluthiacet-methyl); triazolinone (azafenidin, sulfentrazone, carfentrazone); triazinone (trifludimoxazin); others (flufenpyr-ethyl, pyraclonil).

[0041] Oxyfluorfen, as described herein, refers to 2-chloro-l-(3-ethoxy-4-nitrophenoxy)-4- trifluoromethylbenzene, which is a colorless crystalline solid. It is a diphenyl ether class of ultra-low use rate selective, pre- and post-emergence contact PPO inhibitor herbicide, which can be formulated as an emulsifiable concentrate. Weeds are killed mainly by uptake of the chemical through the coleoptile and hypocotyl. Oxyfluorfen can effectively control weeds in rice, soybean, corn, cotton, vegetable, grape, fruit tree, and other crop fields, including but not limited to barnyardgrass, riceflatsedge, sandbur, green foxtail, horseweed, Palmer amaranth, ragweed, prickly sida, Palmer amaranth, riceflatsedge, and broadleaf weeds. The effective dose of oxyfluorfen, as described herein, is 180-720 g ai / ha, including 190-700 g ai / ha, 250-650 g ai / ha, 300-600 g ai / ha, or 400-500 g ai / ha.

[0042] Saflufenacil, as described herein, refers to N'-[2-chloro-4-fluoro-5-(3-methyl-2,6-dioxo-4- (trifluoromethyl)-3,6-dihydro-l(2H)-pyrimidinyl)benzoyl]-N-isopropyl-N-methylsulfamide, which is a tan extruded granular solid. It is a uracil class of total herbicide PPO inhibitor, which can be formulated as a 70% water dispersible granule. Saflufenacil can effectively control a variety of broadleaf weeds, including weeds resistant to glyphosate, ALS, and triazines, and has a very fast total herbicidal effect and soil residues degrade rapidly. The effective dose of saflufenacil, as described herein, is 25-100 g ai / ha, including 30-95 g ai / ha, 40-90 g ai / ha, 50-85 g ai / ha, or 60-80 g ai / ha.

[0043] Flumioxazin, as described herein, refers to 2-[7-fluoro-3,4-dihydro-3-oxo-4-(2-propynyl)-2H-l,4- benzoxazin-6-yl]-4,5,6,7-tetrahydro-lH-isoindole-l,3(2H)-dione. It is a N-phenyl phthalimide class of seedling and leaf absorption type PPO inhibitor herbicide, and the commonly used dosage form is 50% wettable powder and 48% suspension concentrate. Flumioxazin can effectively control 1-year-old broadleaf weeds and some gramineous weeds. It is easily degradable in the environment and safe to subsequent crops. The effective dose of flumioxazin, as described herein, is 60-240 g ai / ha, including 70-220 g ai / ha, 85-200 g ai / ha, 90-185 g ai / ha, or 100-150 g ai / ha.

[0044] As a specific embodiment of the present application, N-phosphonomethylglycine, also known as glyphosate, is a systemic, non-selective, post-emergence herbicide. Glyphosate is a competitive inhibitor of phosphoenolpyruvate (PEP), the substrate for the synthesis of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), and inhibits the conversion of both PEP and 3-phosphoshikimate to 5-enolpyruvylshikimate-3-phosphate catalyzed by EPSPS, thereby blocking the shikimic acid pathway for aromatic amino acid synthesis and interfering with protein synthesis, resulting in the death of plants and bacteria. Glyphosate tolerance can be achieved by expressing a modified EPSPS. The modified EPSPS has a lower affinity for glyphosate, and thus retains their catalytic activity in the presence of glyphosate, i.e., glyphosate tolerance is achieved.

[0045] As used herein, "glyphosate" refers to N-phosphonomethylglycine and its salts, and treatment with "glyphosate herbicide" refers to treatment with any of the herbicide formulations containing glyphosate. Commercial formulations of glyphosate include, but are not limited to, Roundup® (glyphosate as isopropylamine salt), WEATHERMAX (glyphosate as potassium salt), DRY and Roundup PowerMax® (glyphosate as amine salt), GEOFORCE (glyphosate as sodium salt), and Roundup PowerMax® (glyphosate as trimethylsulfonium salt). As used herein, an effective amount of glyphosate refers to the use of 200-1600 g ae / ha, including 250-1600 g ae / ha, 300-1600 g ae / ha, 500-1600 g ae / ha, 800-1500 g ae / ha, 1000-1500 g ae / ha, or 1200-1500 g ae / ha.

[0046] As is well known in the art, DNA typically exists in a double-stranded form. In this arrangement, one strand is complementary to the other, and vice versa. Because DNA replicates in plants to produce other complementary strands of DNA. Thus, the present application includes the use of the polynucleotides exemplified in the Sequence Listing and their complementary strands. As is common in the art, the "coding strand" refers to the strand that is bound by the antisense strand. For the in vivo expression of a protein, typically one strand of the DNA is transcribed into a complementary strand of mRNA, which serves as a template for translation of the protein. The mRNA is actually transcribed from the "antisense" strand of the DNA. The "sense" or "coding" strand has a series of codons (a codon is three nucleotides, read in triplets, that produce a particular amino acid), which can be read as an open reading frame (ORF) to form the protein or peptide of interest. The present application also includes RNA that has the equivalent function as the exemplified DNA.

[0047] The plastid transit peptides described herein include not only the specific exemplary sequences, but also portions and fragments (including truncations at either or both ends) of the specific exemplary sequences that retain the amino acid sequence characteristics of the specific exemplary sequences, variants, mutants, substitutions (proteins with alternative amino acids), chimeras, and fusion proteins. By "variant" or "variation" is meant a nucleotide sequence that encodes the same protein or an equivalent protein having plastid transit peptide activity. By "equivalent protein" is meant a protein having the same or substantially the same biological activity of a plastid transit peptide as the protein of the claims.

[0048] By "fragment" or "truncation" of a DNA molecule or protein sequence described herein is meant a portion of the original DNA or protein sequence (nucleotides or amino acids) involved or an artificially engineered version thereof (e.g., a sequence suitable for plant expression) that varies in length but is sufficient to ensure that the (encoded) protein is a plastid transit peptide.

[0049] Due to the redundancy of the genetic code, a variety of different DNA sequences can encode the same amino acid sequence. It is within the skill in the art to generate alternative DNA sequences that encode the same or substantially the same protein. These different DNA sequences are included within the scope of the present application. By "substantially the same" sequence is meant a sequence that has amino acid substitutions, deletions, additions, or insertions that do not substantially affect the plastid transit peptide activity, as well as fragments that retain plastid transit peptide activity.

[0050] Substitutions, deletions, or additions to the amino acid sequences of the present application are within the skill in the art, and are preferably of a minor nature, that is conservative amino acid substitutions, small deletions, typically of one to about five amino acids, or small amino- or carboxyl-terminal extensions, such as an initiation methionine residue.

[0051] Regulatory sequences as used herein include, but are not limited to, promoters, terminators, enhancers, leader sequences, introns, and other expression control sequences operably linked to a plastid transit peptide of the present application.

[0052] The promoter is a plant-expressible promoter, by which is meant a promoter that ensures expression of a coding sequence operably linked thereto in a plant cell. The plant-expressible promoter can be a constitutive promoter. Examples of promoters that direct constitutive expression in plants include, but are not limited to, the 35S promoter from cauliflower mosaic virus, the maize Ubi promoter, the promoter of the rice GOS2 gene, and the like. Alternatively, the plant-expressible promoter can be a tissue-specific promoter, i.e., a promoter that directs a higher level of expression of a coding sequence in some tissues of a plant, such as in green tissues, than in other tissues of the plant (as can be determined by routine RNA assays), such as the PEP carboxylase promoter. Alternatively, the plant-expressible promoter can be a wound-inducible promoter. A wound-inducible promoter or a promoter that directs a wound-induced expression pattern is one in which the expression of a coding sequence under the control of the promoter is significantly increased when the plant is subjected to mechanical or insect feeding-induced wounding as compared to normal growth conditions. Examples of wound-inducible promoters include, but are not limited to, the promoters of the protease inhibitor genes (pin I and pin II) of potato and tomato and the maize protease inhibitor (MPI) gene.

[0053] The leader sequence includes, but is not limited to, a picornavirus leader; a potyvirus leader; the untranslated leader of asparagus mosaic virus coat protein mRNA (AMV RNA 4); a tobacco mosaic virus (TMV) leader.

[0054] The enhancer includes, but is not limited to, a cauliflower mosaic virus (CaMV) enhancer, a figwort mosaic virus (FMV) enhancer, a carnation etch ring virus (CERV) enhancer, a cassava vein mosaic virus (CsVMV) enhancer, a Mirabilis mosaic virus (MMV) enhancer, a Cestrum yellow leaf curl virus (CmYLCV) enhancer, a Cotton leaf curl Multan virus (CLCuMV), a Commelina yellow mottle virus (CoYMV), and a Peanut chlorotic streak virus (PCLSV) enhancer.

[0055] For monocot applications, the intron includes, but is not limited to, a maize hsp70 intron, a maize ubiquitin intron, an Adh intron 1, a sucrose synthase intron, or a rice Actl intron. For dicot applications, the intron includes, but is not limited to, a CAT-1 intron, a pKANNIBAL intron, a PIV2 intron, and a "super ubiquitin" intron.

[0056] The terminator can be a suitable polyadenylation signal sequence that functions in plants, including but not limited to, the polyadenylation signal sequence from the Agrobacterium tumefaciens nopaline synthase (NOS) gene, the polyadenylation signal sequence from the protease inhibitor II (pin II) gene, the polyadenylation signal sequence from the pea ssRUBISCO E9 gene, and the polyadenylation signal sequence from the a-tubulin gene.

[0057] The transformation protocols and plant cell regeneration procedures vary depending on the host plant cell used. Appropriate methods of introducing nucleotide sequences into plant cells include, but are not limited to, Agrobacterium-mediated transformation, microprojectile bombardment, direct DNA uptake into protoplasts, electroporation, or whisker silicon-mediated DNA introduction. The transformed cells can be grown into plants and the resulting plants can be bred to obtain identified phenotypic characteristics. The seeds of these plants can be harvested and the process repeated to obtain plants that express the desired phenotypic characteristic.

[0058] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0059] The terms "comprising," "including," and "containing" used herein are used in the sense of "including but not limited to."

[0060] The term "genetic material" as used herein includes all genes and nucleic acid molecules, such as DNA and RNA.

[0061] The term "endogenous" as used herein refers to material (e.g., nucleic acid molecules and polypeptides) that originates from a particular organism, tissue, or cell. For example, an "endogenous" polypeptide expressed in a plant cell can refer to a polypeptide that is normally expressed in the same type of cell from a non-genetically engineered plant of the same species.

[0062] The term "exogenous" as used herein refers to material from another source. In the context of DNA, "exogenous" refers to any foreign "non-self" DNA, including DNA from another plant of the same species.

[0063] The term "nucleic acid molecule" as used herein refers to a polymeric form of nucleotides, which includes both sense and antisense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers thereof. Nucleotides can refer to ribonucleotides, deoxyribonucleotides, or modified forms of either type of nucleotide. "Nucleic acid molecule" as used herein is synonymous with "nucleic acid" and "polynucleotide." Unless otherwise indicated, nucleic acid molecules are typically at least 10 bases in length. The term includes single- and double- stranded forms of DNA. Nucleic acid molecules include dimeric (so-called tandem) forms and transcription products of nucleic acid molecules. Nucleic acid molecules can include naturally occurring nucleotides and modified nucleotides, which are linked together by naturally occurring nucleotide linkages and / or non-naturally occurring nucleotide linkages. As is readily understood by those skilled in the art, nucleic acid molecules can be chemically or biochemically modified, or can contain non-natural or derivatized nucleotide bases. Such modifications include, for example, markers, methylation, replacement of one or more of the naturally occurring nucleotides with an analogue, internucleotide modifications (e.g. uncharged linkages: e.g. methyl phosphonates, phosphotriesters, amino phosphonates, amino -methy l phosphonates, phosphoramidates, etc.; charged linkages: e.g. phosphorothioates, phosphorodithioates, etc.; pendent portions: e.g. peptides; intercalators; chelators; alkylators; and modified linkages: e.g. alpha anomeric nucleic acids, etc.). The term "nucleic acid molecule" also encompasses any topological conformation, including single-stranded, double-stranded, partial duplexes, triplexes, hairpins, circles, and padlock configurations.

[0064] The term "encodes" or "encoding" as used herein in the context of a particular nucleic acid means that the nucleic acid comprises the necessary information to direct the translation of a polynucleotide sequence or gene into a particular protein. The information to encode a protein is specified by the use of codons. A nucleic acid that encodes a protein can include untranslated sequences (e.g., introns) within the translated region of the nucleic acid, or can lack such intervening untranslated sequences (e.g., in cDNA).

[0065] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acid residues. These terms apply to polymers of amino acid residues, some or all of which can be artificial chemical analogs of natural amino acids, as well as to natural amino acid polymers.

[0066] The term "functionally active" or "active" as used herein in the context of the use of the present invention refers to the ability of the plastid transit peptide of the present invention (alone or in combination with other proteins) to direct the localization of an operably linked polypeptide or protein to the plastids of a plant.

[0067] The term "expression" as used herein refers to the process by which the coded information of a nucleic acid transcriptional unit, including for example genomic DNA or cDNA, is converted into a functional part, non-functional part, or structural part of a cell, typically including the synthesis of a protein. Gene expression can be influenced by external signals, for example the cell, tissue, or organism being exposed to an agent that increases or decreases the expression of a gene. Gene expression can also be regulated at any point in the pathway from DNA to RNA to protein. Regulation of gene expression occurs, for example, by controlling the action of transcription, translation, RNA transport and processing, degradation of intermediate molecules such as mRNA, or by activation, inactivation, compartmentalization, or degradation of the specific protein molecule after it has been made, or a combination of these. Gene expression can be measured at the RNA level or protein level by any method known in the art, including but not limited to Northern blotting, RT-PCR, Western blotting, or in vitro, in situ, or in vivo protein activity assays.

[0068] The term "sequence identity" or "identity" as used herein in the context of two nucleic acid or polypeptide sequences, can refer to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. To achieve optimal alignment, the sequence portions in the comparison window can include additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions). The number of matching positions is determined by identifying positions of identical nucleotide or amino acid residues in the sequences, and the percent sequence identity is calculated by dividing the number of matching positions by the total number of positions in the comparison window and multiplying the result by 100. The percent sequence identity is calculated by determining the number of positions at which the same nucleotide or amino acid residue occurs in both sequences, dividing the number of positions by the total number of positions in the comparison window, and multiplying the result by 100.

[0069] The term "operably linked" as used herein refers to a first nucleotide sequence being "operably linked" with a second nucleotide sequence when the first nucleotide sequence is in a functional relationship with the second nucleotide sequence. For instance, a promoter is operably linked with a coding sequence if the promoter affects the transcription or expression of the coding sequence. When created in a recombinant manner, operably linked nucleotide sequences are typically contiguous, and the two protein coding regions are linked in the same reading frame, if necessary. However, operably linked nucleotide sequences need not be contiguous. The term "operably linked," when used in reference to a regulatory sequence and a coding sequence, means that the regulatory sequence affects the expression of the coding sequence to which it is operably linked. A "regulatory sequence" or "control element" refers to a nucleotide sequence that affects the timing and level / amount of transcription, RNA processing or stability, or translation of a relevant coding sequence. Regulatory sequences can include promoters, translation leader sequences, introns, enhancers, stem-loop structures, repressor binding sequences, termination sequences, polyadenylation recognition sequences, and the like. Particular regulatory sequences can be located upstream and / or downstream of a coding sequence with which they are operably linked. Also, particular regulatory sequences operably linked with a coding sequence can be located on the relevant complementary strand of a double-stranded nucleic acid molecule.

[0070] The term "linked" as used herein refers to the joining of nucleic acid sequences, such that the sequences are operably connected in such a way as to permit the sequences to function in unison. In the present application, the term "linked" can refer to the joining of a plastid transit peptide to a sequence of interest, such that the transit of a polypeptide encoded by the sequence of interest is controlled and regulated by the plastid transit peptide. The term "linked" as used herein includes, but is not limited to, in-frame linking, which refers to the joining of two or more different DNA fragments or biological elements in a specific order by recombinant DNA technology into the same expression cassette or recombinant vector. In-frame linking allows multiple genes to be expressed simultaneously in the same cell to construct a biological system capable of expressing multiple genes or having a complex function; and fusion linking, which refers to the joining of two or more different biological elements or protein sequences by molecular biology techniques (e.g., a linker sequence) to form a new fusion protein or fusion gene. The nucleic acid sequences that can be "linked" include, but are not limited to, sequences that provide gene expression functions (i.e., gene expression elements, such as promoters, 5' untranslated regions, introns, protein coding regions, 3' untranslated regions, polyadenylation sites, and / or transcription terminators), sequences that provide DNA transfer and / or integration functions (i.e., T-DNA border sequences, site-specific recombinase recognition sites, integrase recognition sites), sequences that provide selection functions (i.e., antibiotic resistance markers, biosynthetic genes), sequences that provide scorable marker functions, sequences that assist in the manipulation of sequences in vitro or in vivo (i.e., polylinker sequences, site-specific recombination sequences), and sequences that provide replication functions (i.e., bacterial replication origins, autonomous replication sequences, centromere sequences).

[0071] The term "expression cassette" as used herein refers to a DNA sequence comprising all the necessary components that work together to ensure that one or more genes of interest are expressed in a host cell, and is a genetic construct with specific functions. The components of an expression cassette include, but are not limited to, a promoter, a gene of interest, a terminator, an enhancer, a marker gene, the promoter controls the starting point of gene expression, can bind to RNA polymerase, and initiates the transcription process; the gene of interest refers to a gene that needs to be expressed in a cell; the terminator is a signal sequence that indicates the end of the transcription process. Methods for constructing an expression cassette include PCR amplification, gene cloning, enzyme digestion, and ligation, which are conventional molecular biology techniques well known to those skilled in the art.

[0072] The term "vector" as used herein refers to a nucleic acid molecule that is introduced into a cell, e.g., to produce a transformed cell. A vector can include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication. Examples of vectors include, but are not limited to: plasmids, cosmids, bacteriophages, or viruses that carry foreign DNA into a cell. A vector can also include one or more genes, antisense molecules, and / or selectable marker genes, as well as other genetic elements known in the art. A vector can transduce, transform, or infect a cell, thereby causing the cell to express the nucleic acid molecule and / or protein encoded by the vector. A vector optionally includes a substance that aids the nucleic acid molecule in entering the cell (e.g., a liposome, a protein coat, etc.).

[0073] The term "transformed" or "transduced" as used herein refers to the transfer of one or more nucleic acid molecules into a cell. A cell is "transformed" by a nucleic acid molecule that is stably replicated by the cell, either by incorporation of the nucleic acid molecule into the cell's genome, or by episomal replication. The term "transformation" encompasses all techniques available for the introduction of a nucleic acid molecule into such a cell. Examples include, but are not limited to: transfection with viral vectors; transformation with plasmid vectors; electroporation (Fromm et al., (1986), Nature 319:791-3); lipofection (Feigner et al., (1987), Proc. Natl. Acad. Sci. USA 84:7413-7); microinjection (Mueller et al., (1978), Cell 15:579-85); Agrobacterium-mediated transfer (Fraley et al., (1983), Proc. Natl. Acad. Sci. USA 80:4803-7); direct DNA uptake; and microprojectile bombardment (Klein et al., (1987), Nature 327:70).

[0074] The term "plant" as used herein refers to whole plants, including all plant and plant populations, such as desired and undesired wild plants or crop plants (including naturally occurring crop plants). Crop plants can be plants that have been so modified by genetic modification or by mutagenesis methods or a combination of these and which are to be harvested as crops or vegetables. The term "plant" also refers to plants at a certain stage of development or at a certain location, such as plants in a field, or plants in a greenhouse.

[0075] The term "plant part" as used herein includes plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or in plant parts such as leaves, embryos, pollen, ovules, seeds, roots, shoots, tubers, flowers, and the like. It is understood that plant parts as described herein include, but are not limited to, plant cells, protoplasts, tissues, calli, embryos, and flowers, stems, fruits, leaves and roots, the latter of which are derived from the transgenic plants or their progeny that have been transformed with the DNA molecules of the present application and thus are at least partially composed of transgenic cells. In one aspect, the plant part is a plant cell. In yet another aspect, the plant part is a non-regenerable cell or a regenerable cell. In another aspect, the plant cell is a somatic cell. By non-regenerable cell is meant a cell that cannot be regenerated into a whole plant through in vitro culture. The non-regenerable cell can be in a plant or plant part (e.g., a leaf) of the present application. The non-regenerable cell can be a cell in a seed or seed coat of the present application. A mature plant organ (including a mature leaf, a mature stem, or a mature root) contains at least one non-regenerable cell. In another aspect, the plant cell is a reproductive cell, such as an ovule or a cell that is part of pollen. In one aspect, the pollen cell is a vegetative (non-reproductive) cell, or a sperm cell.

[0076] The term "herbicide tolerance" or "herbicide-tolerant plant, seed, plant tissue or cell" as used herein refers to the ability of a plant, seed, plant tissue or cell to withstand the effects of a herbicide when applied. For example, a herbicide-tolerant plant can survive or continue to grow in the presence of a herbicide. Herbicide tolerance of a plant, seed, plant tissue or cell can be measured by comparing the plant, seed, plant tissue or cell to a suitable control. For example, herbicide tolerance can be measured or assessed by applying a herbicide to a plant comprising a DNA molecule encoding a protein capable of conferring herbicide tolerance (test plant) and a plant not comprising a DNA molecule encoding a protein capable of conferring herbicide tolerance (control plant), and then comparing the plant damage of the two plants, wherein herbicide tolerance of the test plant is indicated by a decrease in the rate of damage as compared to the rate of damage of the control plant. A herbicide-tolerant plant, seed, plant tissue or cell exhibits a decreased response to the toxic effects of a herbicide as compared to a control plant, seed, plant tissue or cell. The term "herbicide tolerance trait" refers to a transgenic trait that confers improved herbicide tolerance to a plant as compared to a wild-type plant.

[0077] The present application can be applied in a variety of plants, said dicotyledonous plants including, but not limited to, alfalfa, bean, broccoli, cabbage, carrot, celery, cotton, cucumber, eggplant, lettuce, melon, pea, pepper, pumpkin, radish, rapeseed, spinach, soybean, squash, tomato, Arabidopsis thaliana, or watermelon; preferably, the dicotyledonous plant refers to soybean, Arabidopsis thaliana, tobacco, cotton, or rapeseed. The monocotyledonous plants include, but are not limited to, corn, rice, sorghum, wheat, barley, rye, millet, sugarcane, oat, or turf grass; preferably, the monocotyledonous plant refers to corn, rice, sorghum, wheat, barley, millet, sugarcane, or oat.

[0078] The term weed as used in the present application refers to a plant that competes with the cultivated plant of interest in the environment in which the plant is growing.

[0079] The present application provides a commodity, product, or processed agricultural product obtained from the processing of a harvest comprising a plant or part of a plant comprising a plastid transit peptide of the present application. The term "commodity", "product", or "processed agricultural product" refers to any composition or product that is comprised of material derived from a plant, seed, plant cell, or plant part comprising a plastid transit peptide of the present application. In particular, the term "commodity", "product", or "processed agricultural product" includes, but is not limited to, a food or feed product, meal, starch, flour, oil, milled or whole grain or seed, protein concentrate, protein isolate, or biomass.

[0080] Unless specifically explained otherwise, all technical and scientific terms as used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Definitions of common terms in molecular biology can be found in publications such as Lewin B., Genes V, Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Meyers R.A. (ed.), Molecular Biology and Biotechnology: A Comprehensive Desk Reference, VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8). Unless otherwise indicated, all percentages are by weight, all solvent mixture proportions are by volume, and all temperatures are in degrees Celsius.

[0081] All references cited herein are incorporated by reference to the extent that they provide exemplary procedural or other details supplementary to those set forth herein. References provided herein are for the purpose of providing a clear and complete disclosure of the prior art pertaining to the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate the referenced material by virtue of prior application.

[0082] The present application provides a novel plastid transit peptide and its use, which can guide the polypeptide or protein operably connected to be located in plant plastid, and has the following advantages compared with natural plastid transit peptide:

[0083] 1. The present application first discloses a novel plastid transit peptide, and the amino acid sequence of the plastid transit peptide comprises SEQ ID NO: 1 to SEQ ID NO: 36.

[0084] 2. The plastid transit peptide disclosed by the present application has strong universality and adaptability in guiding the polypeptide or protein operably connected.

[0085] 3. The plastid transit peptide disclosed by the present application has high recognition positioning efficiency in guiding the polypeptide or protein operably connected to target plastid.

[0086] 4. The plastid transit peptide disclosed by the present application has wide application prospect in the field of plants.

[0087] The technical solutions of the present application are further described in detail below through the drawings and examples. BRIEF DESCRIPTION OF DRAWINGS

[0088] Fig. 1 is a structural schematic diagram of the plant expression vector DBNBC-01 of the present application;

[0089] Fig. 2 is a structural schematic diagram of the dicotyledonous skeleton vector DBNBC-PTG-D of the present application;

[0090] Fig. 3 is a structural schematic diagram of the recombinant expression vector DBN101-P containing the plastid transit peptide spAtCLP4 and the cPTG gene of the present application;

[0091] Fig. 4 is a structural schematic diagram of the positive control recombinant expression vector DBN170-P containing the positive control plastid transit peptide spAtCLP2 and the cPTG gene of the present application;

[0092] Fig. 5 is a structural schematic diagram of the negative control vector DBN172-P without plastid transit peptide of the present application;

[0093] Fig. 6 is a structural schematic diagram of the negative control vector DBN173-P without cPTG gene of the present application;

[0094] Figure 7 is a schematic diagram of the dicot backbone vector DBNBC-EPSPS and DBN164-P containing the cEPSPS gene of the present application;

[0095] Figure 8 is a schematic diagram of the recombinant expression vector DBN165-P containing the plastid transit peptide spAtLTP3 and the cEPSPS gene of the present application;

[0096] Figure 9 is a schematic diagram of the positive control vector DBN169-P containing the Arabidopsis chloroplast transit peptide spAtCTP2 and the cEPSPS gene of the present application;

[0097] Figure 10 is a result of resistance of the T0 generation of Arabidopsis containing the plastid transit peptide and the cEPSPS gene of the present application after 7 days of treatment with glyphosate herbicide spray;

[0098] Figure 11 is a result of resistance of the T1 generation of Arabidopsis containing the plastid transit peptide and the cEPSPS gene of the present application after 7 days of treatment with glyphosate herbicide spray;

[0099] Figure 12 is a schematic diagram of the negative control vector DBN174-P not containing the cPTG gene of the present application;

[0100] Figure 13 is a schematic diagram of the monocot backbone vector DBNBC-PTG-M containing the cPTG-S-Z gene of the present application;

[0101] Figure 14 is a schematic diagram of the recombinant expression vector DBN137-P containing the plastid transit peptide spAtCLP4 and the cPTG-S-Z gene of the present application;

[0102] Figure 15 is a schematic diagram of the positive control vector DBN171-P containing the positive control plastid transit peptide spAtCLP2 and the cPTG-S-Z gene of the present application. DETAILED DESCRIPTION

[0103] The technical solutions of the plastid transit peptide and its use of the present application are further illustrated below by specific examples.

[0104] First embodiment, design and production of the plastid transit peptide sequence

[0105] The inventors, based on the scientific understanding of the structure and function of plastid transit peptides, and by analyzing the biological characteristics of the structure of plastid transit peptides, implemented artificial rational design and domain splicing assembly for the three domains of plastid transit peptides, i.e. chaperone recognition domain, channel protein recognition domain and signal peptide recognition domain, thereby generating novel plastid transit peptides. The inventors, through a large number of experimental tests and screening, obtained a novel plastid transit peptide spAtCLP4, spAtCLP5, spAtCLP6, spAtCLP7, spAtCLP8, spAtCLP9, spAtCLP10, spAtCLP11, spAtCLP12, spAtCLP13, spAtCLP14, spAtCLP15, spAtCLP16, spPhCTP2, spAtCTP4, spAtLTP1, spAtLTP2, spAtLTP3, spAtLTP4, spAtLTP5, spAtLTP6, spAtLTP7, spAtLTP8, spAtLTP9, spAtLTP10, spAtLTP11, spAtLTP12, spAtLTP13, spAtLTP15, spAtLTP17, spAtLTP18, spAtLTP19, spAtLTP20, spAtLTP21, spAtLTP22 and spAtLTP23 with good physiological activity of plastid transit function. The amino acid sequences of the novel plastid transit peptides are shown in SEQ ID NO: 1 to SEQ ID NO: 36 in the sequence listing, and the nucleotide sequences encoding the corresponding amino acid sequences are obtained according to plant-preferred codons, as shown in SEQ ID NO: 37 to SEQ ID NO: 72 in the sequence listing.

[0106] Second embodiment, expression of plastid transit peptide linked protoporphyrinogen oxidase cPTG gene in transgenic Arabidopsis thaliana

[0107] 1. Construction of Arabidopsis thaliana recombinant expression vector containing plastid transit peptide linked cPTG gene

[0108] 1.1 Construction of dicotyledonous skeleton vector DBNBC-PTG-D containing cPTG gene

[0109] The plant expression vector DBNBC-01 was linearized by double enzyme digestion with restriction enzymes HindIII and SbfI, and the linearized DBNBC-01 expression vector backbone was obtained by purifying the enzyme digestion product. The vector backbone was a resistance tag modified pCAMBIA2301 vector (available from CAMBIA) and the structure of the DBNBC-01 expression vector is shown in FIG. 1 (cSpec: spectinomycin gene; RB: right border; LB: left border). The first fragment pr35S was amplified using primers of SEQ ID NO: 80 and SEQ ID NO: 81 with the pCAMBIA2301 vector as the template. The second fragment cPTG was amplified using primers of SEQ ID NO: 82 and SEQ ID NO: 83 with the synthetic gene as the template. The third fragment t35S was amplified using primers of SEQ ID NO: 84 and SEQ ID NO: 85 with the synthetic gene as the template. The fourth fragment prAtUbi10 was amplified using primers of SEQ ID NO: 86 and SEQ ID NO: 87 with the Arabidopsis thaliana genome as the template. The fifth fragment cPAT was amplified using primers of SEQ ID NO: 88 and SEQ ID NO: 89 with the synthetic gene as the template. The sixth fragment tNos was amplified using primers of SEQ ID NO: 90 and SEQ ID NO: 91 with the pCAMBIA2301 vector as the template. The synthetic genes were all synthesized by Jinshui Biotechnology Co., Ltd.

[0110] The six PCR amplified fragments were mixed with the linearized DBNBC-01 expression vector backbone for recombination reaction, and the operation steps were performed according to the instructions of the Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949) to construct the backbone vector DBNBC-PTG-D containing the cPTG gene, and the structure is shown in FIG. 2 (cSpec: spectinomycin gene; RB: right border; pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); t35s: cauliflower virus 35s terminator (SEQ ID NO: 75); prAtUbi10: promoter of Arabidopsis thaliana ubiquitin 10 gene (SEQ ID NO: 76); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); LB: left border).

[0111] The recombinant backbone vector DBNBC-PTG-D was transformed into E. coli DH5a competent cells by heat shock method. The heat shock conditions were as follows: 100 μL of E. coli DH5a competent cells, 20 μL of recombinant plasmid DNA (backbone vector DBNBC-PTG-D), gently mix, 42°C water bath heat shock for 30 seconds, immediately placed on ice for 2 min; add 250 μL of antibiotic-free LB liquid medium (10 g / L of tryptone, 5 g / L of yeast extract, 10 g / L of NaCl, adjust pH to 7.5 with NaOH, 37°C shaking (200 rpm / min) culture for 1 hour). Then invert culture at a temperature of 37°C for 12 hours on the LB solid plate containing 50 mg / L of spectinomycin, pick positive clone colonies, and shake culture at a temperature of 37°C (200 rpm / min) overnight in LB liquid medium containing 50 mg / L of spectinomycin. The plasmid was extracted by alkaline lysis method: centrifuge the bacterial solution at a speed of 12000 rpm for 1 min, remove the supernatant, and suspend the precipitated bacterial cells with 100 μL of ice-precooled solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH=8.0); add 200 μL of freshly prepared solution II (0.2 M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times, mix, and place on ice for 3-5 min; add 150 μL of ice-cold solution III (3 M potassium acetate, 5 M acetic acid), mix thoroughly immediately, and place on ice for 5-10 min; centrifuge at a temperature of 4°C and a speed of 12000 rpm for 5 min, transfer the supernatant to a new 2 mL centrifuge tube, add 2 volumes of absolute ethanol, mix, and place at room temperature for 5 min; centrifuge at a temperature of 4°C and a speed of 12000 rpm for 5 min, discard the supernatant, and wash the precipitate with 70% (V / V) ethanol and air dry; add 30 μL of TE (10 mM Tris-HCl, 1 mM EDTA, pH=8.0) containing RNase (20 μg / mL) to dissolve the precipitate; digest RNA in a water bath at a temperature of 37°C for 30 min; and store at -20°C for later use. The extracted plasmid was sequenced and identified, and the results showed that the backbone vector DBNBC-PTG-D containing the cPTG gene was successfully constructed.

[0112] 1.2 Synthesis of plastid transit peptide nucleotide sequences

[0113] The nucleotide sequences of the plastid transit peptides are shown in the sequence listing SEQ ID NO: 37 to SEQ ID NO: 72, which were all synthesized by Kingsriver Biotech Co., Ltd. The 5' and 3' ends of the plastid transit peptide nucleotide sequences were respectively connected to the universal adapter primer 1:

[0114] 5' end universal adaptor primer 1: 5'-ttcatttggagaggacaggcgcc-3', as shown in SEQ ID NO: 92 in the Sequence Listing;

[0115] 3' end universal adaptor primer 1: 5'-cttcccattaggagaagacat-3', as shown in SEQ ID NO: 93 in the Sequence Listing.

[0116] 1.3 Construction of dicot expression vector containing plastid transit peptide linked cPTG gene

[0117] The backbone vector DBNBC-PTG-D was linearized by restriction enzyme KasI. The spAtCLP4 element (SEQ ID NO: 37) with universal adaptor primer 1 was mixed with the linearized backbone vector DBNBC-PTG-D fragment for recombination reaction, and the operation steps were performed according to the instruction of Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949). The vector DBN101-P containing plastid transit peptide spAtCLP4 linked cPTG gene was constructed, and the structure of the vector DBN101-P is shown in Figure 3 (cSpec: spectinomycin gene; RB: right border; pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); spAtCLP4: artificial plastid transit peptide nucleotide sequence (SEQ ID NO: 37); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); prAtUbi10: promoter of Arabidopsis thaliana ubiquitin 10 gene (SEQ ID NO: 76); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); LB: left border).

[0118] According to the same method of constructing the recombinant expression vector DBN101-P described above, the plastid transit peptide spAtCLP5 (SEQ ID NO: 38) to spAtLTP23 (SEQ ID NO: 72) is replaced with spAtCLP4 (SEQ ID NO: 37),Additional 35 recombinant expression vectors were constructed, DBN101-P (comprising plastid transit peptide spAtCLP4), DBN102-P (comprising plastid transit peptide spAtCLP5), DBN103-P (comprising plastid transit peptide spAtCLP6), DBN104-P (comprising plastid transit peptide spAtCLP7), DBN105-P (comprising plastid transit peptide spAtCLP8), DBN106-P (comprising plastid transit peptide spAtCLP9), DBN107-P (comprising plastid transit peptide spAtCLP10), DBN108-P (comprising plastid transit peptide spAtCLP11), DBN109-P (comprising plastid transit peptide spAtCLP12), DBN110-P (comprising plastid transit peptide spAtCLP13), DBN111-P (comprising plastid transit peptide spAtCLP14), DBN112-P (comprising plastid transit peptide spAtCLP15), DBN113-P (comprising plastid transit peptide spAtCLP16), DBN114-P (comprising plastid transit peptide spPhCTP2), DBN115-P (comprising plastid transit peptide spAtCTP4), DBN116-P (comprising plastid transit peptide spAtLTP1), DBN117-P (comprising plastid transit peptide spAtLTP2), DBN118-P (comprising plastid transit peptide spAtLTP3), DBN119-P (comprising plastid transit peptide spAtLTP4), DBN120-P (comprising plastid transit peptide spAtLTP5), DBN121-P (comprising plastid transit peptide spAtLTP6), DBN122-P (comprising plastid transit peptide spAtLTP7), DBN123-P (comprising plastid transit peptide spAtLTP8), DBN124-P (comprising plastid transit peptide spAtLTP9), DBN125-P (comprising plastid transit peptide spAtLTP10), DBN126-P (comprising plastid transit peptide spAtLTP11), DBN127-P (comprising plastid transit peptide spAtLTP12), DBN128-P (comprising plastid transit peptide spAtLTP13), DBN129-P (comprising plastid transit peptide spAtLTP15), DBN130-P (comprising plastid transit peptide spAtLTP17), DBN131-P (comprising plastid transit peptide spAtLTP18), DBN132-P (comprising plastid transit peptide spAtLTP19), DBN133-P (comprising plastid transit peptide spAtLTP20), DBN134-P (comprising plastid transit peptide spAtLTP21), DBN135-P (comprising plastid transit peptide spAtLTP22), and DBN136-P (comprising plastid transit peptide spAtLTP23).

[0119] 1.4 Construction of Arabidopsis thaliana control vector containing known control transit peptide linked cPTG gene

[0120] (1) Construction of positive control vector DBN170-P containing known positive control plastid transit peptide linked cPTG gene

[0121] The backbone vector DBNBC-PTG-D was linearized by restriction enzyme KasI. The nucleotide sequence (SEQ ID NO: 79) of the known positive control plastid transit peptide spAtCLP2 (from the prior patent application CN202110514749.8 of the present applicant) with universal linker primer 1 was mixed with the linearized backbone vector DBNBC-PTG-D fragment for recombination reaction, and the operation steps were performed according to the instructions of Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949). The positive control vector DBN170-P containing the positive control plastid transit peptide linked cPTG gene was constructed, and the structure of the vector DBN170-P is shown in Figure 4 (cSpec: spectinomycin gene; RB: right border; pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); spAtCLP2: positive control plastid transit peptide (SEQ ID NO: 79); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); prAtUbi10: promoter of Arabidopsis thaliana ubiquitin 10 gene (SEQ ID NO: 76); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); LB: left border).

[0122] (2) Construction of negative control vector DBN172-P without plastid transit peptide

[0123] The same recombinant construction method as disclosed in paragraph 1.1 of the above second embodiment was used, and the operation steps were performed according to the instructions of the In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949) of Takara Co. to construct a dicot negative control vector DBN172-P without a plastid transit peptide and containing only a cPTG gene, the structural diagram of which is shown in FIG. 5 (Spec: spectinomycin gene; RB: right border; prAtUbi10: promoter of Arabidopsis thaliana ubiquitin 10 gene (SEQ ID NO: 76); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); LB: left border).

[0124] (3) Construction of a negative control vector DBN173-P without a cPTG gene

[0125] The same recombinant construction method as disclosed in paragraph 1.1 of the above-mentioned second embodiment was adopted, and the operation steps were performed according to the instructions of Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949), to obtain a dicot cPTG gene-free negative control vector DBN173-P, the structural diagram of which is shown in Figure 6 (Spec: spectinomycin gene; RB: right border; eFMV: 34S enhancer of figwort mosaic virus (SEQ ID NO: 122); prBrCBP1: promoter of Brassica napus eukaryotic elongation factor gene 1a (Tsf1) (SEQ ID NO: 123); spAtCTP2: Arabidopsis thaliana chloroplast transit peptide (SEQ ID NO: 127); cEPSPS: 5-enolpyruvate shikimate-3-phosphate synthase gene (SEQ ID NO: 124); tPsE9: pea RbcS gene terminator (SEQ ID NO: 125); prAtUbi10: promoter of Arabidopsis thaliana ubiquitin 10 gene (SEQ ID NO: 76); cEGFP: green fluorescent protein gene (SEQ ID NO: 126); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); LB: left border).

[0126] 2. Transformation of Agrobacterium with recombinant expression vector of Arabidopsis thaliana

[0127] The correct recombinant expression vectors DBN101-P to DBN136-P and control vectors DBN170-P, DBN172-P, DBN173-P which have been constructed are transformed into Agrobacterium GV3101 by liquid nitrogen method, and the transformation conditions are as follows: 100 μL Agrobacterium GV3101, 3 μL plasmid DNA (recombinant expression vectors DBN101-P to DBN136-P and control vectors DBN170-P, DBN172-P, DBN173-P); placed in liquid nitrogen for 10 min, 37°C water bath for 10 min; the transformed Agrobacterium GV3101 is inoculated into LB test tube and cultured at a temperature of 28°C and a rotation speed of 200 rpm for 2 h, and then coated on the LB solid plate containing 50 mg / L of Rifampicin and 50 mg / L of Spectinomycin until positive monoclonal is grown, and the monoclonal is picked and cultured, and the plasmid is extracted, and the extracted plasmid is sequenced and identified, and the results show that the structure of the recombinant expression vectors DBN101-P to DBN136-P and control vectors DBN170-P, DBN172-P, DBN173-P is completely correct.

[0128] 3. Obtaining of transgenic Arabidopsis plants

[0129] Wild-type Arabidopsis seeds are suspended in 0.1% (w / v) agarose solution. The suspended seeds are stored at 4°C for 2 days to complete the need for dormancy to ensure synchronized germination of the seeds. Vermiculite mixed with horse manure soil is irrigated with water from below to be moist, and the soil mixture is drained for 24 h. The pretreated seeds are planted on the soil mixture and covered with a humidity cover for 7 days. The seeds are allowed to germinate and the plants are cultivated in a greenhouse under constant temperature (22°C), constant humidity (40-50%), light intensity of 120-150 μmol / m2s-1, and long-day conditions (16 h light / 8 h dark). The plants are initially irrigated with Hoagland solution, and then with deionized water, keeping the soil moist but not wet.

[0130] Arabidopsis transformation was performed using the flower dip method. One or more 15-30 mL pre-cultures of LB media containing spectinomycin (50 mg / L) and rifampicin (10 mg / L) were inoculated with selected Agrobacterium colonies. The pre-cultures were incubated overnight at 28°C with constant shaking at 220 rpm. Each pre-culture was used to inoculate two 500 mL cultures of the YEP media containing spectinomycin (50 mg / L) and rifampicin (10 mg / L) and the cultures were incubated overnight at 28°C with constant shaking. The cells were pelleted by centrifugation at room temperature for 20 min at approximately 4000 rpm and the resulting supernatant was discarded. The cell pellet was gently resuspended in 500 mL of a osmotic medium containing 1 / 2 x MS salts / B5 vitamins, 10% (w / v) sucrose, 0.044 μM benzylaminopurine (10 μL / L (1 mg / mL stock in DMSO)), and 300 μL / L Silwet L-77. Approximately 1 month old Arabidopsis plants were dipped in the osmotic medium containing the resuspended cells for 5 min, ensuring that the newest inflorescences were submerged. The Arabidopsis plants were then laid on their sides and covered, and after 24 h of moisture in the dark, the plants were returned to normal growth conditions at 22°C with a 16 h light / 8 h dark photoperiod. Seeds were harvested approximately 4 weeks later.

[0131] Newly harvested Tl seeds were dried at room temperature for 7 days. The seeds were sown in 26.5 cm x 51 cm germination trays, with each tray receiving 200 mg of Tl seeds (approximately 10,000 seeds), which had been previously suspended in distilled water and stored at 4°C for 2 days to complete the need for dormancy to ensure synchronized germination of the seeds.

[0132] The vermiculite was mixed with horse manure soil and bottom irrigated with water to a moist consistency, using gravity drainage. The pre-treated seeds were evenly sown on the soil mixture using a pipette and covered with a humidity dome for 4-5 days. The dome was removed 1 day prior to the initial transformant selection using post-emergence spraying of glufosinate (selecting for the co-transformed cPAT gene). The Tl plants were sprayed with a 0.2% solution of Liberty herbicide (200 g ai / L glufosinate) at a spray volume of 10 mL / tray (703 L / ha) using a DeVilbiss compressed air nozzle at 7 days after planting and 11 days after planting (cotyledon stage and 2-4 leaf stage, respectively) to provide an effective amount of 280 g ai / ha glufosinate per application. Surviving plants (vigorously growing plants) were identified 4-7 days after the last spray and transplanted into 7 cm x 7 cm square pots prepared with horse manure soil and vermiculite (3-5 plants per pot). The transplanted plants were covered with a humidity dome for 3-4 days and placed in a 22°C growth chamber as before or directly moved to a greenhouse.

[0133] Then the plants were transplanted to the greenhouse (temperature 22±5℃, 50±30% RH, 14h light: 10h dark, minimum 500 μE / m2s-1 natural + supplemental light) at least 1 day before further testing spAtCLP4 to spAtLTP23 linked with cPTG genes for their ability to provide PPO inhibitor herbicide tolerance.

[0134] 4. Herbicide tolerance effect detection of transgenic Arabidopsis plants

[0135] Firstly, the transformed Arabidopsis T1 generation plants were selected using glufosinate herbicide. Further, 24 plants of each of the Arabidopsis T1 plants transformed with the nucleotide sequence of spAtCLP4 to spAtLTP23 linked with cPTG genes, the Arabidopsis T1 generation plants transformed with the positive control vector, the Arabidopsis T1 generation plants transformed with the negative control vector and wild type Arabidopsis plants (CK) were selected, and on the 18th day after sowing, three kinds of PPO inhibitor herbicides were sprayed to detect the herbicide tolerance of Arabidopsis, and the three kinds of PPO inhibitor herbicides and their corresponding spraying concentrations were as follows: two concentrations of oxyfluorfen 180 g ai / ha (1x field concentration), 720 g ai / ha (4x field concentration); two concentrations of metazachlor 25 g ai / ha (1x field concentration), 100 g ai / ha (4x field concentration); two concentrations of butafenacil 60 g ai / ha (1x field concentration), 240 g ai / ha (4x field concentration).

[0136] The person skilled in the art should know that after 7 days of spraying (7DAT, DAT is the abbreviation of the first letter of the English word Day after treatment, which means the number of days after treatment, excluding the day of treatment, the same below), the degree of herbicide damage to each plant can be evaluated according to the average damage percentage of the plants (average damage percentage of the plants = leaf damage area / total leaf area x 100%), i.e. the phytotoxicity grade: 0 grade for the growth condition and spraying of blank solvent (water) is basically the same, 1 grade for the average damage percentage of the plants less than 10%, 2 grade for the average damage percentage of the plants more than 10%, and 3 grade for the average damage percentage of the plants 100%. The resistance performance of each transformation event of the recombinant expression vector was scored according to the formula X = [∑(N x S) / (T x M)] x 100. (X-phytotoxicity score, N-number of plants with the same grade of damage, S-number of phytotoxicity grades, T-total number of plants, M-highest phytotoxicity grade), and the resistance was evaluated according to the score: highly resistant plants (0-15 points), moderately resistant plants (16-33 points), low resistant plants (34-67 points), and non-resistant plants (68-100 points). The experimental results are shown in Tables 1 to 3.

[0137] Table 2, the results of the tolerance experiment of T1 generation plants of transgenic Arabidopsis to oxyfluorfen

[0138] The results of Table 1 show that the T1 generation plants of Arabidopsis of the negative control DBN172-P and DBN173-P vectors are not resistant to oxyfluorfen, and the T1 generation plants of Arabidopsis of the positive control DBN170-P vector are highly resistant to 1 to 4 times the field concentration of oxyfluorfen. The T1 generation plants of Arabidopsis of the DBN101-P to DBN136-P vectors into which the plastid transit peptide spAtCLP4 to spAtLTP23 respectively linked to the cPTG gene are respectively transferred exhibit excellent tolerance to oxyfluorfen, of which 32 vectors exhibit high or medium resistance to 1 to 4 times the field concentration of oxyfluorfen, and the technical effect of the plastid transit peptide is superior to or equivalent to the herbicide tolerance of the T1 generation plants of transgenic Arabidopsis into which the positive control plastid transit peptide spAtCLP2 is transferred.

[0139] Table 2, the results of the tolerance experiment of T1 generation plants of transgenic Arabidopsis to oxyfluorfen

[0140] The results of Table 1 show that the T1 generation plants of Arabidopsis of the negative control DBN172-P and DBN173-P vectors are not resistant to oxyfluorfen, and the T1 generation plants of Arabidopsis of the positive control DBN170-P vector are highly resistant to 1 to 4 times the field concentration of oxyfluorfen. The T1 generation plants of Arabidopsis of the DBN101-P to DBN136-P vectors into which the plastid transit peptide spAtCLP4 to spAtLTP23 respectively linked to the cPTG gene are respectively transferred exhibit excellent tolerance to oxyfluorfen, of which 32 vectors exhibit high or medium resistance to 1 to 4 times the field concentration of oxyfluorfen, and the technical effect of the plastid transit peptide is superior to or equivalent to the herbicide tolerance of the T1 generation plants of transgenic Arabidopsis into which the positive control plastid transit peptide spAtCLP2 is transferred.

[0141] Table 3, the results of the tolerance experiment of T1 generation plants of transgenic Arabidopsis to prynol

[0142] The results of Table 3 show that the T1 generation plants of Arabidopsis thaliana of the negative control DBN172-P vector and the DBN173-P vector are not resistant to flumioxazin, the T1 plants of the positive control DBN170-P vector are highly resistant to 1 to 4 times field concentration of flumioxazin. The T1 generation plants of DBN101-P to DBN136-P of Arabidopsis thaliana into which the plastid transit peptide spAtCLP4 to spAtLTP23 is respectively linked to the cPTG gene, 29 of which show excellent tolerance to flumioxazin, are highly resistant / intermediate resistant to 1 to 4 times field concentration of flumioxazin, and the technical effect of the plastid transit peptide is superior to or equivalent to the herbicide tolerance of the T1 generation plants of the transgenic Arabidopsis thaliana into which the positive control plastid transit peptide spAtCTP2 is introduced.

[0143] Third embodiment, expression of plastid transit peptide linked cEPSPS gene in transgenic Arabidopsis thaliana

[0144] 1. Construction of recombinant expression vector of Arabidopsis thaliana containing plastid transit peptide and cEPSPS gene

[0145] 1.1 Construction of dicot skeleton vector DBNBC-EPSPS containing cEPSPS gene and negative control vector DBN164-P without plastid transit peptide

[0146] The same vector recombination construction method as disclosed in paragraph 1.1 of the above second embodiment was adopted, and the operation steps were performed according to the instructions of the In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949) of Takara Bio Inc. to obtain dicot skeleton vector DBNBC-EPSPS containing the cEPSPS gene and negative control vector DBN164-P without a plastid transit peptide. The structural diagram of the skeleton vector DBNBC-EPSPS is shown in FIG. 7-A, and the structural diagram of the negative vector DBN164-P is shown in FIG. 7-B (Spec: spectinomycin gene; RB: right border; pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); eFMV: 34S enhancer of figwort mosaic virus (SEQ ID NO: 122); prBrCBP1: promoter of Brassica napus eukaryotic elongation factor gene 1a (Tsf1) (SEQ ID NO: 123); cEPSPS: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 124); tPsE9: terminator of pea RbcS gene (SEQ ID NO: 125); LB: left border). The dicot skeleton vector DBNBC-EPSPS and the negative control vector DBN164-P without a plastid transit peptide differ in that an AscI restriction site is added between the prBrCBP1 promoter element and the cEPSPS gene of the skeleton vector DBNBC-EPSPS, and the plastid transit peptide of the present application is inserted into the skeleton vector DBNBC-EPSPS at the AscI restriction site.

[0147] 1.2 Synthesis of plastid transit peptide nucleotide sequence

[0148] The plastid transit peptide nucleotide sequences spAtLTP3 (SEQ ID NO: 54), spAtCLP11 (SEQ ID NO: 44), spAtCLP13 (SEQ ID NO: 46), and spPhCTP2 (SEQ ID NO: 50) were all synthesized by GenScript Biotech Corporation. The 5' and 3' ends of the plastid transit peptide nucleotide sequences (SEQ ID NO: 54, SEQ ID NO: 44, SEQ ID NO: 46, and SEQ ID NO: 50) were respectively connected to the universal adapter primer 3:

[0149] 5' end universal linker primer 3: 5'-ttgcattgacaagtagcc-3', as shown in SEQ ID NO: 120 of the Sequence Listing;

[0150] 3' end universal linker primer 3: 5'-atgcttcacggtgcaagc-3', as shown in SEQ ID NO: 121 of the Sequence Listing.

[0151] 1.3 Construction of expression vector containing cEPSPS gene with plastid transit peptide

[0152] The backbone vector DBNBC-EPSPS was linearized using restriction enzyme AscI. spAtLTP3 (SEQ ID NO: 54) with universal linker 3 was mixed with the linearized backbone vector DBNBC-EPSPS fragment for recombination reaction, and the operation steps were performed according to the instructions of Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949). The vector DBN165-P containing cEPSPS gene was constructed, and the structure of the vector DBN165-P is shown in FIG. 8 (Spec: spectinomycin gene; RB: right border; pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); eFMV: 34S enhancer of figwort mosaic virus (SEQ ID NO: 122); prBrCBP1: promoter of Brassica napus eukaryotic elongation factor gene 1a (Tsf1) (SEQ ID NO: 123); plastid transit peptide spAtLTP3 (SEQ ID NO: 54); cEPSPS: 5-enolpyruvate shikimate-3-phosphate synthase gene (SEQ ID NO: 124); tPsE9: terminator of pea RbcS gene (SEQ ID NO: 125); LB: left border).

[0153] According to the same method of constructing the recombinant expression vector DBN165-P described above, the plastid transit peptide spAtCLP11 (SEQ ID NO: 44), spAtCLP13 (SEQ ID NO: 46), spPhCTP2 (SEQ ID NO: 50) was replaced by spAtLTP3 (SEQ ID NO: 54) to construct other three recombinant expression vectors DBN166-P (containing plastid transit peptide spAtCLP11), DBN167-P (containing plastid transit peptide spAtCLP13), DBN168-P (containing plastid transit peptide spPhCTP2).

[0154] 1.4 Construction of Arabidopsis thaliana positive control vector containing known plastid transit peptide linked to cEPSPS gene

[0155] (1) Construction of positive control vector DBN169-P containing known plastid transit peptide spAtCTP2 linked to cEPSPS gene

[0156] The backbone vector DBNBC-EPSPS was linearized by restriction enzyme AscI. The nucleotide sequence of the known positive control Arabidopsis thaliana chloroplast transit peptide spAtCTP2 (SEQ ID NO: 127) with universal adapter primer 3 was mixed with the linearized backbone vector DBNBC-EPSPS fragment for recombination reaction, and the operation steps were carried out according to the instructions of Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949). The positive control vector DBN169-P containing the positive control plastid transit peptide and cEPSPS gene was constructed as the first positive control vector of this example, and the structure of the vector DBN169-P is shown in Figure 9 (Spec: spectinomycin gene; RB: right border; pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); eFMV: 34S enhancer of figwort mosaic virus (SEQ ID NO: 122); prBrCBP1: promoter of Brassica napus eukaryotic elongation factor gene 1 alpha (Tsf1) (SEQ ID NO: 123); spAtCTP2: Arabidopsis thaliana chloroplast transit peptide (SEQ ID NO: 127); cEPSPS: 5-enolpyruvate shikimate-3-phosphate synthase gene (SEQ ID NO: 124); tPsE9: terminator of pea RbcS gene (SEQ ID NO: 125); LB: left border).

[0157] (2) Positive control vector DBN173-P containing the known plastid transit peptide spAtCTP2 linked to the cEPSPS gene

[0158] Using the vector DBN173-P disclosed in paragraph 1.4(3) of the second embodiment above, which contains the known plastid transit peptide spAtCTP2 linked to the cEPSPS gene, as the second positive control vector of this embodiment.

[0159] 2. Obtaining of transgenic Arabidopsis plants

[0160] Using the methods of transforming Agrobacterium and obtaining transgenic Arabidopsis plants disclosed in paragraphs 2 and 3 of the second embodiment above, the recombinant vectors DBN164-P (negative control), DBN165-P, DBN166-P, DBN167-P, DBN168-P, DBN169-P (positive control) were subjected to Agrobacterium transformation and the corresponding transgenic Arabidopsis plants were obtained.

[0161] 3. Detection of glyphosate herbicide tolerance effect of transgenic Arabidopsis plants

[0162] The herbicide tolerance effect of the obtained transgenic Arabidopsis T0 plants was detected by spraying with glyphosate herbicide. 24 plants each of Arabidopsis T0 plants into which the plastid transit peptide spAtLTP3 (vector DBN165-P), spAtCLP11 (vector DBN166-P), spAtCLP13 (vector DBN167-P), spPhCTP2 (vector DBN168-P) were linked to the cEPSPS gene, respectively; Arabidopsis T0 plants containing the positive control vector DBN169-P and the positive control vector DBN173-P of the known control transit peptide spAtCTP2; negative control vector DBN164-P without plastid transit peptide and wild-type Arabidopsis plants (CK) were sprayed with 2 different concentrations of glyphosate herbicide on the 18th day after sowing, i.e. 1680 g ae / ha (2 times field concentration, 2x), 3360 g ae / ha (4 times field concentration, 4x), for detecting the herbicide tolerance of transgenic Arabidopsis T0 plants, and the experimental results are shown in Table 4 and Figure 10.

[0163] The herbicide tolerance effect of the obtained transgenic Arabidopsis T1 generation plants was detected by spraying glyphosate herbicide. The Arabidopsis T1 generation plants into which the plastid transit peptide spAtLTP3 (vector DBN165-P), spAtCLP11 (vector DBN166-P), spAtCLP13 (vector DBN167-P), and spPhCTP2 (vector DBN168-P) were respectively connected with the cEPSPS gene; the Arabidopsis T1 generation plants of the positive control vector DBN169-P and the positive control vector DBN173-P containing the known positive control transit peptide spAtCTP2; the negative control vector DBN164-P without the plastid transit peptide and the wild-type Arabidopsis plant (CK), each taking 12 plants, were sprayed with glyphosate herbicide with a concentration of 3360 g ae / ha (4 times the field concentration, 4x) at the 18th day after sowing, for detecting the herbicide tolerance of the transgenic Arabidopsis T1 generation plants, and the experimental results are shown in Table 5 and FIG. 11.

[0164] The person skilled in the art should know that the judgment points of glyphosate phytotoxicity level are the yellowing degree of old leaves and new leaves, and the recovery progress, and the grading standards are as follows: 0 level: new leaves have almost no any green fading; 1 level: new leaves have slight green fading, and can recover to normal leaf color within 7 days; 2 level: new leaves have obvious green fading, and can recover to normal leaf color within 7-10 days, and have certain influence on plant growth and fruiting; 3 level: new leaves have obvious green fading and are accompanied by deformity, and have obvious inhibition on plant growth and fruiting, and the leaves of severely damaged plants wither and are close to death. After spraying for 7 days (7DAT), the resistance performance of each transformation event of the recombinant expression vector was scored according to the formula X = [∑(N×S) / (T×M)]×100. (X-phytotoxicity score, N-number of plants with the same damage, S-number of phytotoxicity levels, T-total number of plants, M-highest phytotoxicity level), and the resistance was evaluated according to the score: highly resistant plants (0-15 points), moderately resistant plants (16-33 points), low-resistant plants (34-67 points), and non-resistant plants (68-100 points).

[0165] Table 4 Herbicide tolerance experimental results of transgenic Arabidopsis T0 generation plants with plastid transit peptide connected with cEPSPS gene

[0166] The results of Table 4 show that the T0 generation plants of the negative control vector DBN164-P without plastid transit peptide and the wild type (CK) Arabidopsis plants are not tolerant to glyphosate, the T0 generation plants of the positive control DBN169-P and DBN173-P vectors containing the plastid transit peptide spAtCTP2 are highly resistant to 2 to 4 times the field concentration of glyphosate, the T0 generation plants of the DBN165-P, DBN166-P, DBN167-P and DBN168-P vectors into which the cEPSPS gene is linked with the plastid transit peptides spAtLTP3, spAtCLP11, spAtCLP13 and spPhCTP2 respectively show excellent tolerance to the glyphosate herbicide, and are highly resistant / intermediate resistant to 2 to 4 times the field concentration of glyphosate, and the technical effects of the plastid transit peptides are superior to or equivalent to the herbicide tolerance of the T0 generation transgenic Arabidopsis plants into which the positive control plastid transit peptide spAtCTP2 is transferred.

[0167] Table 5: Experimental results of the tolerance of the T1 generation transgenic Arabidopsis plants with the plastid transit peptide linked cEPSPS gene to glyphosate

[0168] The results of Table 5 show that the T1 generation plants of the negative control vector DBN164-P without plastid transit peptide and the wild type (CK) Arabidopsis plants are not tolerant to glyphosate, the T1 generation plants of the positive control DBN169-P and DBN173-P vectors containing the plastid transit peptide spAtCTP2 are highly resistant to 4 times the field concentration of glyphosate, the T1 generation plants of the DBN165-P, DBN166-P, DBN167-P and DBN168-P vectors into which the cEPSPS gene is linked with the plastid transit peptides spAtLTP3, spAtCLP11, spAtCLP13 and spPhCTP2 respectively show excellent tolerance to the glyphosate herbicide, and are highly resistant to 4 times the field concentration of glyphosate, and the technical effects of the plastid transit peptides are superior to or equivalent to the herbicide tolerance of the T1 generation transgenic Arabidopsis plants into which the positive control plastid transit peptide spAtCTP2 is transferred.

[0169] In combination with the experimental results of the second and third embodiments, the plastid transit peptide disclosed in the present application can be connected to the cPTG gene and transport protoporphyrinogen oxidase protein, and realize high resistance to 1 to 4 times the field concentration of PPO inhibitor herbicide. Further, the plastid transit peptide can also be connected to the cEPSPS gene and transport EPSPS protein, and realize high resistance to 2 to 4 times the field concentration of glyphosate herbicide. The experimental results show that the novel plastid transit peptide disclosed in the present application can enhance the tolerance of plants to herbicides, and has the following advantages compared with the natural plastid transit peptide: (1) strong universality and adaptability of guiding the operably connected polypeptide or protein; (2) high recognition and positioning efficiency of guiding the operably connected polypeptide or protein to target plastid; (3) wide application prospect in the field of plants.

[0170] Fourth embodiment, expression of plastid transit peptide connected protoporphyrinogen oxidase cPTG gene in transgenic soybean

[0171] 1. Construction of soybean recombinant expression vector containing plastid transit peptide connected cPTG gene

[0172] 1.1 Construction of soybean negative control vector DBN174-P

[0173] The same vector recombination construction method as 1.1 in the above embodiment 2 is used, and the operation steps are performed according to the instructions of Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949). A double negative control vector DBN174-P without plastid transit peptide and cPTG gene is obtained, and the structure diagram is shown in Figure 12 (Spec: spectinomycin gene; RB: right border; prGm17gTsf1: soybean tsf1 gene promoter (SEQ ID NO: 136); spAtCTP2: Arabidopsis chloroplast transit peptide (SEQ ID NO: 127); cEPSPS: 5-enolpyruvate shikimate-3-phosphate synthase gene (SEQ ID NO: 124); tPsE9: terminator of pea RbcS gene (SEQ ID NO: 125); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); t35S: cauliflower mosaic 35S terminator (SEQ ID NO: 75); LB: left border).

[0174] 1.2 Construction of soybean recombinant expression vector

[0175] The seven recombinant expression vectors DBN101-P (containing plastid transit peptide spAtCLP4), DBN104-P (containing plastid transit peptide spAtCLP7), DBN105-P (containing plastid transit peptide spAtCLP8), DBN108-P (containing plastid transit peptide spAtCLP11), DBN109-P (containing plastid transit peptide spAtCLP12), DBN110-P (containing plastid transit peptide spAtCLP13), and DBN118-P (containing plastid transit peptide spAtLTP3) constructed as described in paragraph 1.1 of the second example above, and the positive control vector DBN170-P and the negative control vector DBN174-P were used for genetic transformation of soybean.

[0176] 2. Obtaining transgenic soybean plants

[0177] 1.1 Transformation of Agrobacterium with recombinant expression vectors

[0178] The recombinant expression vectors DBN101-P, DBN104-P, DBN105-P, DBN108-P, DBN109-P, DBN110-P, DBN118-P, the positive control vector DBN170-P and the negative control vector DBN174-P constructed as described in paragraph 1.1 of the second example above were used to co-culture sterile cultured cotyledon node tissue of the soybean variety Jack with the Agrobacterium described above according to the conventional Agrobacterium infection method.

[0179] The constructed soybean recombinant expression vectors: T-DNA of DBN101-P (comprising pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtCLP4 (SEQ ID NO: 37); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); t35S: Cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); prAtUbi10: promoter of Arabidopsis thaliana Ubiquitin 10 gene (SEQ ID NO: 76); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)), T-DNA of DBN104-P (comprising pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtCLP7 (SEQ ID NO: 40); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); t35S: Cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); prAtUbi10: promoter of Arabidopsis thaliana Ubiquitin 10 gene (SEQ ID NO: 76); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)), T-DNA of DBN105-P (comprising pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtCLP8 (SEQ ID NO: 41); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); t35S: Cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); prAtUbi10: promoter of Arabidopsis thaliana Ubiquitin 10 gene (SEQ ID NO: 76); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)), T-DNA of DBN108-P (comprising pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtCLP11 (SEQ ID NO: 44); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); t35S: Cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); prAtUbi10: promoter of Arabidopsis thaliana Ubiquitin 10 gene (SEQ ID NO: 76);T-DNA of DBN109-P (comprising pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtCLP12 (SEQ ID NO: 45); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); t35S: Cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); prAtUbi10: promoter of Arabidopsis thaliana Ubiquitin 10 gene (SEQ ID NO: 76); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)), T-DNA of DBN110-P (comprising pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtCLP13 (SEQ ID NO: 46); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); t35S: Cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); prAtUbi10: promoter of Arabidopsis thaliana Ubiquitin 10 gene (SEQ ID NO: 76); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)), T-DNA of DBN118-P (comprising pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtLTP3 (SEQ ID NO: 54); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); t35S: Cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); prAtUbi10: promoter of Arabidopsis thaliana Ubiquitin 10 gene (SEQ ID NO: 76); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)), T-DNA of positive control vector DBN170-P and negative control vector DBN174-P were transformed into soybean genome, and soybean plants with the cPTG gene and the cPAT gene linked to the plastid transit peptide, respectively, and soybean plants with the positive control vector DBN170-P and the negative control vector DBN174-P were obtained.

[0180] 1.2 Soybean genetic transformation

[0181] Agrobacterium-mediated genetic transformation of soybean, briefly, mature soybean seeds are germinated in soybean germination medium (B5 salts 3.1 g / L, B5 vitamins, sucrose 20 g / L, agar 8 g / L, pH 5.6) and the seeds are plated on the germination medium and incubated at 25 ± 1 °C under a photoperiod (light / dark) of 16:8 hours. After 4-6 days of germination, the greenest cotyledonary node swollen soybean aseptic seedlings are taken and the hypocotyls are cut 3-4 mm below the cotyledonary node, the cotyledons are cut longitudinally and the apical and lateral buds and seed roots are removed. The cotyledonary node is wounded with the back of a scalpel and the wounded cotyledonary node tissue is contacted with an Agrobacterium suspension, wherein the Agrobacterium is capable of delivering the T-DNA sequences of the vector to the wounded cotyledonary node tissue (step 1 : infection step). In this step, the cotyledonary node tissue is preferably immersed in an Agrobacterium suspension (OD660= 0.5-0.8) in infection medium (MS salts 2.15 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, acetosyringone (AS) 40 mg / L, 2-morpholinoethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, pH 5.3) to initiate inoculation. The cotyledonary node tissue is co-cultivated with the Agrobacterium for a period of time (3 days) (step 2: co-cultivation step). Preferably, the cotyledonary node tissue is incubated on solid medium (MS salts 4.3 g / L, B5 vitamins, sucrose 20 g / L, glucose 10 g / L, MES 4 g / L, ZT 2 mg / L, agar 8 g / L, pH 5.6) after the infection step. After this co-cultivation phase, there can be an optional "recovery" step. In the "recovery" step, a recovery medium (B5 salts 3.1 g / L, B5 vitamins, MES 1 g / L, sucrose 30 g / L, ZT 2 mg / L, agar 8 g / L, cefotaxime 150 mg / L, glutamic acid 100 mg / L, aspartic acid 100 mg / L, pH 5.6) is provided with at least one antibiotic known to inhibit the growth of Agrobacterium (cefotaxime 150-250 mg / L) without the addition of a selection agent for plant transformants (step 3: recovery step). Preferably, the cotyledonary node regenerated tissue pieces are incubated on solid medium with the antibiotic but without the selection agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the cotyledonary node regenerated tissue pieces are incubated on medium containing the selection agent (phosphinothricin) and growing transformed callus tissue is selected (step 4: selection step). Preferably, the cotyledonary node regenerated tissue pieces are incubated on selection solid medium (B5 salts 3.1 g / L, B5 vitamins, MES 1 g / L, sucrose 30 g / L, 6-benzylaminopurine (6-BAP) 1 mg / L, agar 8 g / L, cefotaxime 150 mg / L, glutamic acid 100 mg / L, aspartic acid 100 mg / L, phosphinothricin 6 mg / L, pH 5.6) with the selection agent, resulting in the selective growth of transformed cells.The transformed cells are then regenerated into plants (step 5: regeneration step), preferably, the tissue pieces of the cotyledon node grown on the medium containing the selection agent are cultured on solid medium (B5 differentiation medium and B5 rooting medium) to regenerate plants.

[0182] The resistant tissue pieces obtained by screening are transferred to the B5 differentiation medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, ZT 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 50 mg / L, aspartic acid 50 mg / L, gibberellin 1 mg / L, auxin 1 mg / L, glufosinate 6 mg / L, pH 5.6) for differentiation at 25°C. The small plants differentiated are transferred to the B5 rooting medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, agar 8 g / L, cephalosporin 150 mg / L, indole-3-butyric acid (IBA) 1 mg / L) for rooting culture at 25°C to about 10 cm high, and then moved to the greenhouse for culture to seed setting. In the greenhouse, the plants are cultured at 26°C for 16 hours and at 20°C for 8 hours per day.

[0183] 3. Taqman probe fluorescent quantitative PCR method for verifying transgenic plants

[0184] About 100 mg of leaf of each of the soybean plants into which the cPTG gene and the cPAT gene is introduced is taken as a sample, and the genomic DNA of the sample is extracted by using Qiagen's DNeasy Plant Maxi Kit. The copy number of the cPAT gene is detected by using the Taqman probe fluorescent quantitative PCR method to determine the copy number of the target gene. Meanwhile, the wild-type soybean plant is taken as a control, and the detection and analysis are performed according to the above method. The experiment is set in triplicate, and the average value is taken.

[0185] The specific method for detecting the copy number of the cPAT gene is as follows:

[0186] Step 6. About 100 mg of leaf of each of the soybean plants into which the cPTG gene and the cPAT gene is introduced and the wild-type soybean plant is taken, and the leaf is ground into a homogenate in a mortar by using liquid nitrogen. Three replicates are taken for each sample.

[0187] Step 7. The genomic DNA of the above sample is extracted by using Qiagen's DNeasy Plant Mini Kit, and the specific method is referred to the product manual of the kit.

[0188] Step 8. The concentration of the genomic DNA of the above sample is determined by using NanoDrop 2000 (Thermo Scientific).

[0189] Step 9. Adjust the genomic DNA concentration of the above samples to the same concentration value, which ranges from 80 to 100 ng / μL;

[0190] Step 10. Identify the copy number of the samples by using Taqman probe fluorescence quantitative PCR method, use the samples with identified known copy number as standard, use wild type soybean plant samples as control, 3 repeats for each sample, and take the average value; the fluorescence quantitative PCR primer and probe sequences are as follows:

[0191] The following primers and probes are used to detect the cPAT gene sequence:

[0192] Primer 1: gagggtgttgtggctggtattg, as shown in SEQ ID NO: 137 in the sequence listing;

[0193] Primer 2: tctcaactgtccaatcgtaagcg, as shown in SEQ ID NO: 138 in the sequence listing;

[0194] Probe 1: cttacgctgggccctggaaggctag, as shown in SEQ ID NO: 139 in the sequence listing

[0195] The PCR reaction system is as follows:

[0196] The 50x primer / probe mixture contains 45 μL of each primer at 1 mM concentration, 50 μL of probe at 100 μM concentration, and 860 μL of 1x TE buffer, and is stored in amber test tubes at 4°C.

[0197] The PCR reaction conditions are as follows:

[0198] The data is analyzed by using the rapid real-time fluorescence quantitative PCR system software (Applied Biosystems 7900HT Fast Real-Time PCR System SDS v2.3, Applied Biosystems). The experimental results show that the cPTG gene and cPAT gene sequences have been integrated into the chromosome set of the detected soybean plants. The obtained single copy transgenic soybean plants with cPTG gene and cPAT gene sequences are used for herbicide tolerance effect detection.

[0199] 4. Herbicide tolerance effect detection of transgenic soybean plants

[0200] The recombinant expression vectors DBN101-P, DBN104-P, DBN105-P, DBN108-P, DBN109-P, DBN110-P, DBN118-P, in which the plastid transit peptides spAtCLP4, spAtCLP7, spAtCLP8, spAtCLP11, spAtCLP12, spAtLTP3 are respectively connected to the cPTG gene, are respectively introduced into transgenic soybean T1 generation plants of soybean chromosome groups, transgenic soybean plants of the positive control vector DBN170-P and the negative control vector DBN174-P, and three kinds of PPO inhibitor herbicides are sprayed, the three kinds of PPO inhibitor herbicides and their corresponding spraying concentrations are 4 times the field concentration of oxyfluorfen (720 g ai / ha), 4 times the field concentration of saflufenacil (100 g ai / ha) and 4 times the field concentration of flumioxazin (240 g ai / ha). After 3 days and 7 days of spraying, the phenotype is observed, and the herbicide tolerance of the transgenic soybean is detected.

[0201] The person skilled in the art should know that the PPO inhibitor herbicide phytotoxicity feature is yellowing of the leaves, relatively dispersed mottling, and brown appearance of the growth point. PPO inhibitor herbicide phytotoxicity generally occurs at the growth point, the first, second and third compound leaves, and the true leaf phytotoxicity is generally not obvious, and 0 level is defined as no phytotoxicity at all; 1 level is defined as <50% of the leaf area appearing slight phytotoxicity, the growth point appearing slight brown, and one of the two is evaluated as 1 level; 2 level is defined as >50% of the leaf area appearing serious phytotoxicity, and the growth point appearing serious inhibition; and 3 level is defined as the whole plant appearing serious phytotoxicity, and the growth is affected by phytotoxicity and cannot be recovered.

[0202] The resistance of each transformation event of the recombinant expression vector is scored according to the formula X = [Σ(N×S) / (T×M)]×100 (X-phytotoxicity score, N-number of plants with the same level of damage, S-number of phytotoxicity levels, T-total number of plants, M-highest phytotoxicity level), and the resistance is evaluated according to the score: high resistance plants (0-15 points), medium resistance plants (16-33 points), low resistance plants (34-67 points), and non-resistant plants (68-100 points). The experimental results are shown in Table 6.

[0203] Table 6 Experimental results of the tolerance of transgenic soybean T1 generation plants to PPO inhibitor herbicides

[0204] Table 6 shows that the transgenic soybean plants of the negative control vector DBN174-P were intolerant to ethoxyflufenican, pyrimisulfuron, or propyzoxyl herbicides. The transgenic soybean plants of the positive control vector DBN170-P, containing the positive control plasmid transport peptide spAtCLP2, were highly resistant to 4 times the field concentration of ethoxyflufenican, pyrimisulfuron, and propyzoxyl. The transgenic soybean plants incorporating plasmid transport peptides spAtCLP4, spAtCLP7, spAtCLP8, spAtCLP11, spAtCLP12, and spAtLTP3 were respectively linked to… Transgenic soybean T1 generation plants inoculated with the recombinant expression vectors DBN101-P, DBN104-P, DBN105-P, DBN108-P, DBN109-P, and DBN118-P of the cPTG gene exhibited excellent tolerance to PPO inhibitor herbicides. They showed high or moderate resistance to 4 times the field concentration of ethoxyflufenican, pyrimisulfuron, or propyzoxystrobin. The technical effect of the plasmid transport peptide was superior to or equivalent to the herbicide tolerance of transgenic soybean T1 generation plants inoculated with the positive control plasmid transport peptide spAtCLP2.

[0205] Fifth Example: Expression of the plasmid transport peptide-linked protoporphyrinogen oxidase cPTG-SZ gene in transgenic maize.

[0206] 1. Construct a maize recombinant expression vector containing a plasmid transport peptide linked to the cPTG-SZ gene.

[0207] 1.1 Construction of the monocotyledonous scaffold vector DBNBC-PTG-M containing the cPTG-SZ gene

[0208] The plant expression vector DBNBC-01 (structure diagram as shown in Figure 1) was subjected to double enzyme digestion reaction with restriction enzymes Kpnl and Sbfl, thereby linearizing the plant expression vector. The enzyme digestion product was purified to obtain the linearized DBNBC-01 expression vector backbone, which was a resistance tag modified pCAMBIA2301 vector (available from CAMBIA). The first fragment prHvLTP2 was amplified using primers of SEQ ID NO: 94 and SEQ ID NO: 95, with synthetic gene as template. The second fragment cDsRed was amplified using primers of SEQ ID NO: 96 and SEQ ID NO: 97, with synthetic gene as template. The third fragment tPinII was amplified using primers of SEQ ID NO: 98 and SEQ ID NO: 99, with synthetic gene as template. The fourth fragment prOsActl was amplified using primers of SEQ ID NO: 100 and SEQ ID NO: 101, with synthetic gene as template. The fifth fragment cPAT was amplified using primers of SEQ ID NO: 102 and SEQ ID NO: 103, with synthetic gene as template. The sixth fragment tNos was amplified using primers of SEQ ID NO: 104 and SEQ ID NO: 105, with pCAMBIA2301 vector as template. The seventh fragment pr35S was amplified using primers of SEQ ID NO: 106 and SEQ ID NO: 107, with pCAMBIA2301 vector as template. The eighth fragment cPTG-S-Z was amplified using primers of SEQ ID NO: 108 and SEQ ID NO: 109, with synthetic gene as template, which was a nucleotide sequence of protoporphyrinogen oxidase designed according to maize preference codons. The ninth fragment t35S was amplified using primers of SEQ ID NO: 110 and SEQ ID NO: 111, with synthetic gene as template. The tenth fragment prZmUbil was amplified using primers of SEQ ID NO: 112 and SEQ ID NO: 113, with synthetic gene as template. The eleventh fragment cPMI was amplified using primers of SEQ ID NO: 114 and SEQ ID NO: 115, with synthetic gene as template. The twelfth fragment tNos was amplified using primers of SEQ ID NO: 116 and SEQ ID NO: 117, with pCAMBIA2301 vector as template.

[0209] The twelve PCR amplified fragments were mixed with the linearized DBNBC-01 expression vector backbone for recombination reaction, the operation steps were performed according to the instructions of Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949), and a backbone vector DBNBC-PTG-M containing the cPTG-S-Z gene was constructed, and the structural diagram is shown in Figure 13 (cSpec: spectinomycin gene; RB: right border; prHvLTP2: barley lipid transfer protein promoter (SEQ ID NO: 128); cDsRed: coral red fluorescent protein gene (SEQ ID NO: 129); tPinII: protease inhibitor II gene terminator (SEQ ID NO: 130); prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: nopaline synthase gene terminator (SEQ ID NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); cPTG-S-Z: protoporphyrinogen oxidase gene designed according to maize preferred codon (SEQ ID NO: 132); t35s: cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbi1: maize ubiquitin 1 gene promoter (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: nopaline synthase gene terminator (SEQ ID NO: 78); LB: left border).

[0210] The recombinant backbone vector DBNBC-PTG-M was transformed into E. coli DH5a competent cells by heat shock method. The heat shock conditions were as follows: 100 μL of E. coli DH5a competent cells, 20 μL of recombinant plasmid DNA (backbone vector DBNBC-PTG-M), gently mix, heat shock at 42°C for 30 seconds, immediately place on ice for 2 min; add 250 μL of antibiotic-free LB liquid medium (10 g / L of tryptone, 5 g / L of yeast extract, 10 g / L of NaCl, adjust pH to 7.5 with NaOH, 37°C shaking (200 rpm / min) culture for 1 hour). Then invert culture at a temperature of 37°C for 12 hours on the LB solid plate containing 50 mg / L of spectinomycin, pick positive clone colonies, and shake (200 rpm / min) culture at a temperature of 37°C overnight in LB liquid medium containing 50 mg / L of spectinomycin. Extract the plasmid by alkaline lysis method: centrifuge the bacterial solution at a speed of 12000 rpm for 1 min, remove the supernatant, and suspend the precipitated bacterial cells with 100 μL of ice-precooled solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH = 8.0); add 200 μL of freshly prepared solution II (0.2 M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times, mix, and place on ice for 3-5 min; add 150 μL of ice-cold solution III (3 M potassium acetate, 5 M acetic acid), mix thoroughly immediately, and place on ice for 5-10 min; centrifuge at a temperature of 4°C and a speed of 12000 rpm for 5 min, transfer the supernatant to a new 2 mL centrifuge tube, add 2 volumes of absolute ethanol, mix, and place at room temperature for 5 min; centrifuge at a temperature of 4°C and a speed of 12000 rpm for 5 min, discard the supernatant, and wash the precipitate with 70% ethanol; add 30 μL of TE (10 mM Tris-HCl, 1 mM EDTA, pH = 8.0) containing RNase (20 μg / mL) to dissolve the precipitate; digest the RNA in a water bath at a temperature of 37°C for 30 min; and store at -20°C for later use. The extracted plasmid was sequenced and identified, and the results showed that the backbone vector DBNBC-PTG-M containing the cPTG-S-Z gene was successfully constructed.

[0211] 1.2 Synthesis of plastid transit peptide nucleotide sequence

[0212] Nucleotide sequences of plastid transit peptides spAtCLP4 (SEQ ID NO: 37), spAtCLP5 (SEQ ID NO: 38), spAtCLP6 (SEQ ID NO: 39), spAtCLP7 (SEQ ID NO: 40), spAtCLP8 (SEQ ID NO: 41), spAtCLP9 (SEQ ID NO: 42), spAtCLP10 (SEQ ID NO: 43), spAtCLP11 (SEQ ID NO: 44), spAtCLP12 (SEQ ID NO: 45), spAtCLP13 (SEQ ID NO: 46), spAtCLP14 (SEQ ID NO: 47), spAtCLP15 (SEQ ID NO: 48), spAtCLP16 (SEQ ID NO: 49), spPhCTP2 (SEQ ID NO: 50), spAtCTP4 (SEQ ID NO: 51), spAtLTP1 (SEQ ID NO: 52), spAtLTP2 (SEQ ID NO: 53), spAtLTP3 (SEQ ID NO: 54), spAtLTP4 (SEQ ID NO: 55), spAtLTP5 (SEQ ID NO: 56), spAtLTP6 (SEQ ID NO: 57), spAtLTP7 (SEQ ID NO: 58), spAtLTP12 (SEQ ID NO: 63), spAtLTP13 (SEQ ID NO: 64), spAtLTP15 (SEQ ID NO: 65), spAtLTP17 (SEQ ID NO: 66), spAtLTP18 (SEQ ID NO: 67), and positive control plastid transit peptide spAtCLP2 (SEQ ID NO: 79) were all synthesized by GenScript. The 5’ and 3’ ends of the nucleotide sequences of the plastid transit peptides SEQ ID NO: 37 to SEQ ID NO: 58, SEQ ID NO: 63 to SEQ ID NO: 67, and SEQ ID NO: 79 were ligated to the universal linker primer 2:

[0213] 5’ end universal linker primer 2: 5’-ttcatttggagaggacaaagctt-3’, as set forth in SEQ ID NO: 118 of the Sequence Listing;

[0214] 3’ end universal linker primer 2: 5’-ccgttgggacttgacat-3’, as set forth in SEQ ID NO: 119 of the Sequence Listing.

[0215] 1.3. Construction of monocot expression vector containing cPTG-S-Z gene with plastid transit peptide

[0216] The backbone vector DBNBC-PTG-M was linearized by using restriction enzyme HindIII. The plastid transit peptide spAtCLP4 (SEQ ID NO: 37) with universal linker 2, the positive control plastid transit peptide spAtCLP2 (SEQ ID NO: 79) were mixed with the linearized backbone vector DBNBC-PTG-M fragment respectively for recombination reaction, the operation steps were performed according to the instructions of Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949), to construct the vector DBN137-P containing the plastid transit peptide spAtCLP4 connecting the cPTG-S-Z gene, the structure of the vector DBN137-P is shown in Figure 14 (cSpec: spectinomycin gene; RB: right border; prHvLTP2: barley lipid transfer protein promoter (SEQ ID NO: 128); cDsRed: coral red fluorescent protein gene (SEQ ID NO: 129); tPinII: protease inhibitor II gene terminator (SEQ ID NO: 130); prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); spAtCLP4 (SEQ ID NO: 37); cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbi1: promoter of maize ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); LB: left border); the positive control vector DBN171-P containing the positive control plastid transit peptide spAtCLP2 connecting the cPTG-S-Z gene was constructed, the structure of the positive control vector DBN171-P is shown in Figure 15 (cSpec: spectinomycin gene; RB: right border; prHvLTP2: barley lipid transfer protein promoter (SEQ ID NO: 128); cDsRed: coral red fluorescent protein gene (SEQ ID NO: 129); tPinII: protease inhibitor II gene terminator (SEQ ID NO: 130);prOsActl : Rice Actl gene promoter (SEQ ID NO: 131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); positive control transit peptide spAtCLP2 (SEQ ID NO: 79); cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: Cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil : promoter of Zea mays Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); LB: left border).

[0217] According to the same method of constructing the recombinant expression vector DBN137-P above, the nucleotide sequence of the plastid transit peptide spAtCLP5 (SEQ ID NO: 38), spAtCLP6 (SEQ ID NO: 39), spAtCLP7 (SEQ ID NO: 40), spAtCLP8 (SEQ ID NO: 41), spAtCLP9 (SEQ ID NO: 42), spAtCLP10 (SEQ ID NO: 43), spAtCLP11 (SEQ ID NO: 44), spAtCLP12 (SEQ ID NO: 45), spAtCLP13 (SEQ ID NO: 46), spAtCLP14 (SEQ ID NO: 47), spAtCLP15 (SEQ ID NO: 48), spAtCLP16 (SEQ ID NO: 49), spPhCTP2 (SEQ ID NO: 50), spAtCTP4 (SEQ ID NO: 51), spAtLTP1 (SEQ ID NO: 52), spAtLTP2 (SEQ ID NO: 53), spAtLTP3 (SEQ ID NO: 54), spAtLTP4 (SEQ ID NO: 55), spAtLTP5 (SEQ ID NO: 56), spAtLTP6 (SEQ ID NO: 57), spAtLTP7 (SEQ ID NO: 58), spAtLTP12 (SEQ ID NO: 63), spAtLTP13 (SEQ ID NO: 64), spAtLTP15 (SEQ ID NO: 65), spAtLTP17 (SEQ ID NO: 66), or spAtLTP18 (SEQ ID NO: 67) is substituted for the plastid transit peptide spAtCLP4 (SEQ ID NO: 2) in the recombinant expression vector DBN137-P.The nucleotide sequence of NO: 37 was used to construct other 26 recombinant expression vectors, DBN138-P (containing plastid transit peptide spAtCLP5), DBN139-P (containing plastid transit peptide spAtCLP6), DBN140-P (containing plastid transit peptide spAtCLP7), DBN141-P (containing plastid transit peptide spAtCLP8), DBN142-P (containing plastid transit peptide spAtCLP9), DBN143-P (containing plastid transit peptide spAtCLP10), DBN144-P (containing plastid transit peptide spAtCLP11), DBN145-P (containing plastid transit peptide spAtCLP12), DBN146-P (containing plastid transit peptide spAtCLP13), DBN147-P (containing plastid transit peptide spAtCLP14), DBN148-P (containing plastid transit peptide spAtCLP15), DBN149-P (containing plastid transit peptide spAtCLP16), DBN150-P (containing plastid transit peptide spPhCTP2), DBN151-P (containing plastid transit peptide spAtCTP4), DBN152-P (containing plastid transit peptide spAtLTP1), DBN153-P (containing plastid transit peptide spAtLTP2), DBN154-P (containing plastid transit peptide spAtLTP3), DBN155-P (containing plastid transit peptide spAtLTP4), DBN156-P (containing plastid transit peptide spAtLTP5), DBN157-P (containing plastid transit peptide spAtLTP6), DBN158-P (containing plastid transit peptide spAtLTP7), DBN159-P (containing plastid transit peptide spAtLTP12), DBN160-P (containing plastid transit peptide spAtLTP13), DBN161-P (containing plastid transit peptide spAtLTP15), DBN162-P (containing plastid transit peptide spAtLTP17), and DBN163-P (containing plastid transit peptide spAtLTP18). The nucleotide sequences of the plastid transit peptides contained in the above recombinant expression vectors were confirmed to be correctly inserted by sequencing.

[0218] 2. Transformation of Agrobacterium with recombinant expression vectors of maize

[0219] The correctly constructed recombinant expression vectors DBN137-P, DBN138-P, DBN139-P, DBN140-P, DBN141-P, DBN142-P, DBN143-P, DBN144-P, DBN145-P, DBN146-P, DBN147-P, DBN148-P, DBN149-P, DBN150-P, DBN151-P, DBN152-P, DBN153-P, DBN154-P, DBN155-P, DBN156-P, DBN157-P, DBN158-P, DBN159-P, DBN160-P, DBN161-P, DBN162-P, DBN163-P and the positive control vector DBN171-P were transformed into Agrobacterium LBA4404 (Invitrogen, Chicago, USA, CAT: 18313-015) using liquid nitrogen method, the transformation conditions were: 100 μL Agrobacterium LBA4404, 3 μL plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 min, 37°C water bath for 10 min; the transformed Agrobacterium LBA4404 was inoculated into LB test tube and incubated at a temperature of 28°C and a rotation speed of 200 rpm for 2 hours, then coated on the LB solid plate containing 50 mg / L of Rifampicin and 50 mg / L of Spectinomycin until positive monoclonal colonies were grown, the monoclonal colonies were picked and cultured, and the extracted plasmid was sequenced and identified, the results showed that the structures of the recombinant expression vectors DBN137-P, DBN138-P, DBN139-P, DBN140-P, DBN141-P, DBN142-P, DBN143-P, DBN144-P, DBN145-P, DBN146-P, DBN147-P, DBN148-P, DBN149-P, DBN150-P, DBN151-P, DBN152-P, DBN153-P, DBN154-P, DBN155-P, DBN156-P, DBN157-P, DBN158-P, DBN159-P, DBN160-P, DBN161-P, DBN162-P, DBN163-P and the positive control vector DBN171-P were completely correct.

[0220] 3. Obtaining of transgenic maize plants

[0221] According to a conventional Agrobacterium infection method, the aseptically cultured immature embryos of the corn variety DBN567 were co-cultured with the above Agrobacterium, and the recombinant expression vector DBN137-P having the T-DNA (comprising prOsActl: rice Actl gene promoter (SEQ ID NO: 131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtCLP4 (SEQ ID NO: 37); cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil: promoter of corn Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)) described in Example 1.3, the T-DNA of DBN138-P (comprising prOsActl: rice Actl gene promoter (SEQ ID NO: 131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtCLP5 (SEQ ID NO: 38); cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil: promoter of corn Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)), and the T-DNA of DBN139-P (comprising prOsActl: rice Actl gene promoter (SEQ ID NO: 131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtCLP6 (SEQ ID NO: 39); cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil: promoter of corn Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)) were co-cultured with the above Agrobacterium.cPTG-SZ: Maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 75); prZmUbi1: Maize ubiquitin 1 gene promoter (SEQ ID NO: 133); cPMI: Phosphomannose isomerase gene (SEQ ID NO: 134); tNos: Autocarbamate synthase gene terminator (SEQ ID NO: 78)); DBN140-P T-DNA (containing prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131); cPAT: Phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); tNos: Autocarbamate synthase gene terminator (SEQ ID NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 132); t35s: cauliflower mosaic virus 35S promoter (SEQ ID NO: 75 ... NO: 73); plasmid transport peptide spAtCLP7 (SEQ ID NO: 40); cPTG-SZ: maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 75); prZmUbi1: maize ubiquitin 1 gene promoter (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: carmine synthase gene terminator (SEQ ID NO: 78)); DBN141-P T-DNA (containing prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131); cPAT: phosphinic acid N-acetyltransferase gene (SEQ ID NO: 77); tNos: carmine synthase gene terminator (SEQ ID NO: 78)); NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plasmid transport peptide spAtCLP8 (SEQ ID NO: 41); cPTG-SZ: maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 75); prZmUbi1: maize ubiquitin 1 gene promoter (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: carmine synthase gene terminator (SEQ ID NO: 78)); T-DNA of DBN142-P (containing prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131));cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO:77); tNos: terminator of the nopaline synthase gene (SEQ ID NO:78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO:73); plastid transit peptide spAtCLP9 (SEQ ID NO:42); cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO:132); t35s: Cauliflower virus 35s terminator (SEQ ID NO:75); prZmUbi1: promoter of the Zea mays Ubiquitin 1 gene (SEQ ID NO:133); cPMI: phosphomannose isomerase gene (SEQ ID NO:134); tNos: terminator of the nopaline synthase gene (SEQ ID NO:78)), T-DNA of DBN143-P (comprising prOsActl: promoter of the rice Actl gene (SEQ ID NO:131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO:77); tNos: terminator of the nopaline synthase gene (SEQ ID NO:78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO:73); plastid transit peptide spAtCLPlO (SEQ ID NO:43); cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO:132); t35s: Cauliflower virus 35s terminator (SEQ ID NO:75); prZmUbi1: promoter of the Zea mays Ubiquitin 1 gene (SEQ ID NO:133); cPMI: phosphomannose isomerase gene (SEQ ID NO:134); tNos: terminator of the nopaline synthase gene (SEQ ID NO:78)), T-DNA of DBN144-P (comprising prOsActl: promoter of the rice Actl gene (SEQ ID NO:131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO:77); tNos: terminator of the nopaline synthase gene (SEQ ID NO:78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO:73); plastid transit peptide spAtCLPl l (SEQ ID NO:44); cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO:132); t35s: Cauliflower virus 35s terminator (SEQ ID NO:75); prZmUbi1: promoter of the Zea mays Ubiquitin 1 gene (SEQ ID NO:133);cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)) of DBN145-P, the T-DNA of DBN146-P comprising prOsActl : rice Actl gene promoter (SEQ ID NO: 131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtCLPl 3 (SEQ ID NO: 46); cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: Cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil : promoter of Zea mays Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)) of DBN147-P, the T-DNA of DBN148-P comprising prOsActl : rice Actl gene promoter (SEQ ID NO: 131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtCLPl 4 (SEQ ID NO: 47); cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: Cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil : promoter of Zea mays Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)) of DBN149-P, the T-DNA of DBN150-P comprising prOsActl : rice Actl gene promoter (SEQ ID NO: 131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtCLPl 5 (SEQ ID NO: 48); cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: Cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil : promoter of Zea mays Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)) of DBN151-P.cPTG-S-Z: Zea mays codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: Cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil: promoter of Zea mays Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); T-DNA of DBN148-P (comprising prOsActl: promoter of rice Actl gene (SEQ ID NO: 131); cPAT: phosphinotricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtCLP15 (SEQ ID NO: 48); cPTG-S-Z: Zea mays codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: Cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil: promoter of Zea mays Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); T-DNA of DBN149-P (comprising prOsActl: promoter of rice Actl gene (SEQ ID NO: 131); cPAT: phosphinotricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtCLP16 (SEQ ID NO: 49); cPTG-S-Z: Zea mays codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: Cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil: promoter of Zea mays Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); T-DNA of DBN150-P (comprising prOsActl: promoter of rice Actl gene (SEQ ID NO: 131);cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO:77); tNos: terminator of the nopaline synthase gene (SEQ ID NO:78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO:73); plastid transit peptide spPhCTP2 (SEQ ID NO:50); cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO:132); t35s: Cauliflower virus 35s terminator (SEQ ID NO:75); prZmUbi1: promoter of the Zea mays Ubiquitin 1 gene (SEQ ID NO:133); cPMI: phosphomannose isomerase gene (SEQ ID NO:134); tNos: terminator of the nopaline synthase gene (SEQ ID NO:78)), T-DNA of DBN151-P (comprising prOsActl: promoter of the rice Actl gene (SEQ ID NO:131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO:77); tNos: terminator of the nopaline synthase gene (SEQ ID NO:78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO:73); plastid transit peptide spAtCTP4 (SEQ ID NO:51); cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO:132); t35s: Cauliflower virus 35s terminator (SEQ ID NO:75); prZmUbi1: promoter of the Zea mays Ubiquitin 1 gene (SEQ ID NO:133); cPMI: phosphomannose isomerase gene (SEQ ID NO:134); tNos: terminator of the nopaline synthase gene (SEQ ID NO:78)), T-DNA of DBN152-P (comprising prOsActl: promoter of the rice Actl gene (SEQ ID NO:131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO:77); tNos: terminator of the nopaline synthase gene (SEQ ID NO:78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO:73); plastid transit peptide spAtLTP1 (SEQ ID NO:52); cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO:132); t35s: Cauliflower virus 35s terminator (SEQ ID NO:75); prZmUbi1: promoter of the Zea mays Ubiquitin 1 gene (SEQ ID NO:133);cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)) of DBN153-P, the T-DNA of DBN154-P comprising prOsActl : rice Actl gene promoter (SEQ ID NO: 131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtLTP3 (SEQ ID NO: 54); cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: Cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil : promoter of Zea mays Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)) of DBN155-P, the T-DNA of DBN156-P comprising prOsActl : rice Actl gene promoter (SEQ ID NO: 131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtLTP4 (SEQ ID NO: 55); cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: Cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil : promoter of Zea mays Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)) of DBN157-P, the T-DNA of DBN158-P comprising prOsActl : rice Actl gene promoter (SEQ ID NO: 131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtLTP5 (SEQ ID NO: 56); cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: Cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil : promoter of Zea mays Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)) of DBN159-P.cPTG-S-Z: Zea mays codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: Cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil: promoter of Zea mays Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); T-DNA of DBN156-P (comprising prOsActl: promoter of rice Actl gene (SEQ ID NO: 131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtLTP5 (SEQ ID NO: 56); cPTG-S-Z: Zea mays codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: Cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil: promoter of Zea mays Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); T-DNA of DBN157-P (comprising prOsActl: promoter of rice Actl gene (SEQ ID NO: 131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtLTP6 (SEQ ID NO: 57); cPTG-S-Z: Zea mays codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: Cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil: promoter of Zea mays Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); T-DNA of DBN158-P (comprising prOsActl: promoter of rice Actl gene (SEQ ID NO: 131);cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO:77); tNos: terminator of the nopaline synthase gene (SEQ ID NO:78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO:73); plastid transit peptide spAtLTP7 (SEQ ID NO:58); cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO:132); t35s: Cauliflower virus 35s terminator (SEQ ID NO:75); prZmUbi1: promoter of the Zea mays Ubiquitin 1 gene (SEQ ID NO:133); cPMI: phosphomannose isomerase gene (SEQ ID NO:134); tNos: terminator of the nopaline synthase gene (SEQ ID NO:78)), T-DNA of DBN159-P (comprising prOsActl: promoter of the rice Actl gene (SEQ ID NO:131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO:77); tNos: terminator of the nopaline synthase gene (SEQ ID NO:78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO:73); plastid transit peptide spAtLTP12 (SEQ ID NO:63); cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO:132); t35s: Cauliflower virus 35s terminator (SEQ ID NO:75); prZmUbi1: promoter of the Zea mays Ubiquitin 1 gene (SEQ ID NO:133); cPMI: phosphomannose isomerase gene (SEQ ID NO:134); tNos: terminator of the nopaline synthase gene (SEQ ID NO:78)), T-DNA of DBN160-P (comprising prOsActl: promoter of the rice Actl gene (SEQ ID NO:131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO:77); tNos: terminator of the nopaline synthase gene (SEQ ID NO:78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO:73); plastid transit peptide spAtLTP13 (SEQ ID NO:64); cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO:132); t35s: Cauliflower virus 35s terminator (SEQ ID NO:75); prZmUbi1: promoter of the Zea mays Ubiquitin 1 gene (SEQ ID NO:133);cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)) of DBN161-P, the T-DNA of DBN162-P comprising prOsActl : rice Actl gene promoter (SEQ ID NO: 131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtLTP17 (SEQ ID NO: 66); cPTG-S-Z: com- codon optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: Cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil : promoter of com Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)) of DBN163-P, the T-DNA of DBN164-P comprising prOsActl : rice Actl gene promoter (SEQ ID NO: 131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtLTP18 (SEQ ID NO: 67); cPTG-S-Z: com-codon optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: Cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil : promoter of com Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)) of DBN165-P, the T-DNA of DBN166-P comprising prOsActl : rice Actl gene promoter (SEQ ID NO: 131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtLTP19 (SEQ ID NO: 68); cPTG-S-Z: com-codon optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: Cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil : promoter of com Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)) of DBN167-P, the T-DNA of DBN168-P comprising prOsActl : rice Actl gene promoter (SEQ ID NO: 131); cPAT: phosphinothricin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plastid transit peptide spAtLTP20 (SEQ ID NO: 69); cPTG-S-Z: com-codon optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: Cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil : promoter of com Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of nopaline synthase gene (SEQ ID NO: 78)) of DBN169-P.cPTG-S-Z: corn codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35s terminator (SEQ ID NO: 75); prZmUbil: promoter of the maize Ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of the nopaline synthase gene (SEQ ID NO: 78) were introduced into the maize genome, respectively, to obtain transgenic maize plants, respectively.

[0222] Agrobacterium-mediated corn transformation is briefly described as follows. Immature embryos are isolated from corn and contacted with an Agrobacterium suspension, wherein the Agrobacterium is capable of transferring the T-DNA nucleotide sequence of each vector to at least one cell of one of the embryos (Step 1: Infection Step). In this step, the embryos are preferably immersed in the Agrobacterium suspension (OD660=0.4-0.6, Infection Medium (MS salts 4.3 g / L, MS vitamins, Casein 300 mg / L, Sucrose 68.5 g / L, Glucose 36 g / L, Acetyl-sinapone (AS) 40 mg / L, 2,4-Dichlorophenoxyacetic acid (2,4-D) 1 mg / L, pH 5.3)) to initiate inoculation. The embryos are co-cultured with the Agrobacterium for a period of time (3 days) (Step 2: Co-cultivation Step). Preferably, the embryos are cultured on solid medium (MS salts 4.3 g / L, MS vitamins, Casein 300 mg / L, Sucrose 20 g / L, Glucose 10 g / L, Acetyl-sinapone (AS) 100 mg / L, 2,4-Dichlorophenoxyacetic acid (2,4-D) 1 mg / L, Agar 8 g / L, pH 5.8) after the infection step. Following this co-cultivation period, there can be an optional "recovery" step. In the "recovery" step, a recovery medium (MS salts 4.3 g / L, MS vitamins, Casein 300 mg / L, Sucrose 30 g / L, 2,4-Dichlorophenoxyacetic acid (2,4-D) 1 mg / L, Phytagar 3 g / L, pH 5.8) is provided with at least one antibiotic (Cefotaxime) known to inhibit the growth of Agrobacterium, but without the addition of a selection agent for plant transformants (Step 3: Recovery Step). Preferably, the embryos are cultured on solid medium with the antibiotic but without the selection agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the inoculated embryos are cultured on medium containing the selection agent (Mannose) and growing transformed callus is selected (Step 4: Selection Step). Preferably, the embryos are cultured on a selection solid medium (MS salts 4.3 g / L, MS vitamins, Casein 300 mg / L, Sucrose 30 g / L, Mannose 12.5 g / L, 2,4-Dichlorophenoxyacetic acid (2,4-D) 1 mg / L, Phytagar 3 g / L, pH 5.8) with the selection agent, resulting in the selective growth of transformed cells. Then, the callus is regenerated into plants (Step 5: Regeneration Step), preferably, callus grown on medium with the selection agent is cultured on solid medium (MS differentiation medium and MS rooting medium) to regenerate plants.

[0223] The resistant calli obtained by screening are transferred to the MS differentiation medium (MS salt 4.3 g / L, MS vitamin, casein 300 mg / L, sucrose 30 g / L, 6-benzyladenine 2 mg / L, mannose 5 g / L, phytagel 3 g / L, pH 5.8) and cultured to differentiate at 25°C. The seedlings differentiated are transferred to the MS rooting medium (MS salt 2.15 g / L, MS vitamin, casein 300 mg / L, sucrose 30 g / L, indole-3-acetic acid 1 mg / L, phytagel 3 g / L, pH 5.8) and cultured at 25°C until about 10 cm high, and then moved to a greenhouse for culture until seed setting. In the greenhouse, the seedlings are cultured at 28°C for 16 hours and at 20°C for 8 hours every day.

[0224] 4. Taqman probe fluorescent quantitative PCR method for verifying transgenic plants

[0225] The transgenic corn plants are verified by Taqman probe fluorescence quantitative PCR method. The transgenic corn plants into which the recombinant expression vectors DBN137-P, DBN138-P, DBN139-P, DBN140-P, DBN141-P, DBN142-P, DBN143-P, DBN144-P, DBN145-P, DBN146-P, DBN147-P, DBN148-P, DBN149-P, DBN150-P, DBN151-P, DBN152-P, DBN153-P, DBN154-P, DBN155-P, DBN156-P, DBN157-P, DBN158-P, DBN159-P, DBN160-P, DBN161-P, DBN162-P, DBN163-P of the plastid transit peptide spAtCLP4, spAtCLP5, spAtCLP6, spAtCLP7, spAtCLP8, spAtCLP9, spAtCLP10, spAtCLP11, spAtCLP12, spAtCLP13, spAtCLP14, spAtCLP15, spAtCLP16, spPhCTP2, spAtCTP4, spAtLTP1, spAtLTP2, spAtLTP3, spAtLTP4, spAtLTP5, spAtLTP6, spAtLTP7, spAtLTP12, spAtLTP13, spAtLTP15, spAtLTP17, spAtLTP18 are connected with the cPTG-S-Z gene respectively; the transgenic corn plants into which the positive control vector DBN171-P of the plastid transit peptide spAtCLP2 connected with the cPTG-S-Z gene are detected and analyzed. The copy number of the cPMI gene is detected by Taqman probe fluorescence quantitative PCR method to determine the copy number of the cPTG-S-Z gene. At the same time, the wild type corn variety DBN567 is used as a negative control, and the above method is used for detection and analysis. The experiment is set for 3 times of repetition, and the average value is taken.

[0226] The following primers and probes are used to detect the cPMI gene sequence:

[0227] Primer 3: gctgtaagagcttactgaaaaaattaaca, as shown in SEQ ID NO: 140 in the sequence listing;

[0228] Primer 4: cgatctgcaggtcgacgg, as shown in SEQ ID NO: 141 in the sequence listing;

[0229] Probe 2: tctcttgctaagctgggagctcgatcc, as presented in SEQ ID NO: 142 of the Sequence Listing.

[0230] By analyzing the experimental results of the cPMI gene copy number, it is further confirmed that the corresponding sequence introduced has been integrated into the chromosome set of the detected corn plants, and a transgenic corn plant with a single copy of the introduced cPTG-S-Z gene is obtained for herbicide tolerance effect detection.

[0231] 5. Herbicide tolerance effect detection of the transgenic corn plants

[0232] (1) Herbicide tolerance effect detection of the transgenic corn T0 generation plants

[0233] The recombinant expression vectors DBN137-P, DBN138-P, DBN139-P, DBN140-P, DBN141-P, DBN142-P, DBN143-P, DBN144-P, DBN145-P, DBN146-P, DBN147-P, DBN148-P, DBN149-P, DBN150-P, DBN151-P, DBN152-P, DBN153-P, DBN154-P, DBN155-P, DBN156-P, DBN157-P, DBN158-P, DBN159-P, DBN160-P, DBN161-P, DBN162-P, DBN163-P, in which the plastid transit peptides spAtCLP4, spAtCLP5, spAtCLP6, spAtCLP7, spAtCLP8, spAtCLP9, spAtCLP10, spAtCLP11, spAtCLP12, spAtCLP13, spAtCLP14, spAtCLP15, spAtCLP16, spPhCTP2, spAtCTP4, spAtLTP1, spAtLTP2, spAtLTP3, spAtLTP4, spAtLTP5, spAtLTP6, spAtLTP7, spAtLTP12, spAtLTP13, spAtLTP15, spAtLTP17, spAtLTP18 are respectively connected to the cPTG-S-Z gene, are transformed into transgenic maize T0 generation plants of the maize chromosome, transgenic maize T0 generation plants of the positive control vector DBN171-P and plants of the negative control wild type maize variety DBN567, and 16 plants of each are selected. On the 18th day after sowing, three PPO inhibitor herbicides and their corresponding spraying concentrations are used to spray to detect the herbicide tolerance of the maize plants, and the three PPO inhibitor herbicides and their corresponding spraying concentrations are 2 times field concentration of oxyfluorfen (360 g ai / ha), 2 times field concentration of saflufenacil (50 g ai / ha) and 2 times field concentration of flumioxazin (110 g ai / ha) respectively.

[0234] The herbicide tolerance of the transgenic maize was observed after 3 DAT of herbicide spraying. One skilled in the art should know that the damage degree of each plant to herbicide can be evaluated according to the average plant damage percentage grade (average plant damage percentage = leaf damage area / total leaf area x 100%), i.e. the phytotoxicity grade: 0 grade for the growth condition and spraying of blank solvent (water) being basically consistent; 1 grade for the average plant damage percentage being less than 10%; 2 grade for the average plant damage percentage being more than 10%; 3 grade for the average plant damage percentage being 100%. The resistance performance of each transformation event of the recombinant expression vector was scored according to the formula X = [∑(N x S) / (T x M)] x 100. (X-phytotoxicity score, N-number of plants with the same damage grade, S-number of phytotoxicity grades, T-total number of plants, M-highest phytotoxicity grade), and the resistance was evaluated according to the score: highly resistant plants (0-15 points), medium resistant plants (16-33 points), low resistant plants (34-67 points), non-resistant plants (68-100 points). The experimental results are shown in Table 7.

[0235] Table 7 Experimental results of PPO inhibitor herbicide tolerance of transgenic maize T0 plants

[0236] The results of Table 7 show that the negative control wild type corn variety DBN567 is not tolerant to oxyfluorfen, bensulfuron-methyl or flumioxazin herbicides; the transgenic corn T0 generation plants of the positive control vector DBN171-P containing the positive control plastid transit peptide spAtCLP2 are resistant to 2 times field concentration of oxyfluorfen, bensulfuron-methyl and flumioxazin; the transgenic corn T0 generation plants of the recombinant expression vectors DBN137-P, DBN138-P, DBN139-P, DBN140-P, DBN141-P, DBN142-P, DBN143-P, DBN144-P, DBN145-P, DBN146-P, DBN147-P, DBN148-P, DBN149-P, DBN150-P, DBN151-P, DBN152-P, DBN153-P, DBN154-P, DBN155-P, DBN156-P, DBN157-P, DBN158-P, DBN159-P, DBN160-P, DBN161-P, DBN162-P, DBN163-P containing the plastid transit peptides spAtCLP4, spAtCLP5, spAtCLP6, spAtCLP7, spAtCLP8, spAtCLP9, spAtCLP10, spAtCLP11, spAtCLP12, spAtCLP13, spAtCLP14, spAtCLP15, spAtCLP16, spPhCTP2, spAtCTP4, spAtLTP1, spAtLTP2, spAtLTP3, spAtLTP4, spAtLTP5, spAtLTP6, spAtLTP7, spAtLTP12, spAtLTP13, spAtLTP15, spAtLTP17, spAtLTP18 respectively linked to the cPTG-S-Z gene show excellent resistance to 2 times field concentration of PPO inhibitor herbicides, 22 of the recombinant expression vectors show high or medium resistance to 2 times field concentration of oxyfluorfen, 16 of the recombinant expression vectors show high or medium resistance to 2 times field concentration of bensulfuron-methyl, 26 of the recombinant expression vectors show high or medium resistance to 2 times field concentration of flumioxazin, and the technical effects of the plastid transit peptides are superior to the herbicide resistance of the transgenic corn T0 generation plants of the positive control vector DBN171-P containing the positive control plastid transit peptide spAtCLP2.

[0237] (2) Herbicide resistance effect detection of transgenic corn T1 generation plants

[0238] The recombinant expression vectors DBN137-P, DBN138-P, DBN139-P, DBN140-P, DBN141-P, DBN142-P, DBN143-P, DBN144-P, DBN145-P, DBN146-P, DBN147-P, DBN148-P, DBN149-P, DBN150-P, DBN151-P, DBN152-P, DBN153-P, DBN154-P, DBN155-P, DBN156-P, DBN157-P, DBN158-P, DBN159-P, DBN160-P, DBN161-P, DBN162-P, DBN163-P, in which the plastid transit peptides spAtCLP4, spAtCLP5, spAtCLP6, spAtCLP7, spAtCLP8, spAtCLP9, spAtCLP10, spAtCLP11, spAtCLP12, spAtCLP13, spAtCLP14, spAtCLP15, spAtCLP16, spPhCTP2, spAtCTP4, spAtLTP1, spAtLTP2, spAtLTP3, spAtLTP4, spAtLTP5, spAtLTP6, spAtLTP7, spAtLTP12, spAtLTP13, spAtLTP15, spAtLTP17, spAtLTP18 are respectively connected to the cPTG-S-Z gene, are respectively transformed into transgenic maize T1 generation plants of the maize chromosome, transgenic maize T1 generation plants of the positive control vector DBN171-P, and plants of the negative control wild type maize variety DBN567, and 16 plants of each are selected. On the 18th day after sowing, three PPO inhibitor herbicides and their corresponding spraying concentrations are used to spray to detect the herbicide tolerance of the maize plants, the three PPO inhibitor herbicides and their corresponding spraying concentrations are 4 times field concentration of oxyfluorfen (720 g ai / ha), 4 times field concentration of bensulfuron-methyl (100 g ai / ha), and 4 times field concentration of flumioxazin (220 g ai / ha) respectively.

[0239] The herbicide tolerance of the transgenic maize was observed after 3 DAT and 7 DAT of herbicide spraying. One skilled in the art should know that the degree of herbicide damage to each plant can be evaluated according to the average plant damage percentage grade (average plant damage percentage = leaf damage area / total leaf area x 100%), i.e. the phytotoxicity grade: 0 grade for the growth condition and spraying of blank solvent (water) being basically consistent; 1 grade for the average plant damage percentage being less than 10%; 2 grade for the average plant damage percentage being more than 10%; 3 grade for the average plant damage percentage being 100%. The resistance performance of each transformation event of the recombinant expression vector was scored according to the formula X = [∑(N x S) / (T x M)] x 100. (X - phytotoxicity score, N - the number of plants with the same damage level, S - the number of phytotoxicity grades, T - the total number of plants, M - the highest phytotoxicity grade), and the resistance was evaluated according to the score: highly resistant plants (0-15 points), moderately resistant plants (16-33 points), low resistant plants (34-67 points), non-resistant plants (68-100 points). The experimental results are shown in Table 8.

[0240] Table 8 Experimental results of the tolerance of transgenic maize T1 plants to PPO inhibitor herbicides

[0241] The results of Table 8 show that the negative control wild type corn variety DBN567 is low resistant to the herbicides ethoxyfen-ethyl, bensulfuron-methyl or flumioxazin at 4 times field concentration; the transgenic corn T1 generation plants of the positive control vector DBN171-P containing the positive control plastid transit peptide spAtCLP2 are resistant to the herbicides ethoxyfen-ethyl, bensulfuron-methyl and flumioxazin at 4 times field concentration; the transgenic corn T1 generation plants of the recombinant expression vectors DBN137-P, DBN138-P, DBN139-P, DBN140-P, DBN141-P, DBN142-P, DBN143-P, DBN144-P, DBN145-P, DBN146-P, DBN147-P, DBN148-P, DBN149-P, DBN150-P, DBN151-P, DBN152-P, DBN153-P, DBN154-P, DBN155-P, DBN156-P, DBN157-P, DBN158-P, DBN159-P, DBN160-P, DBN161-P, DBN162-P, DBN163-P, respectively linked to the cPTG-S-Z gene of the plastid transit peptides spAtCLP4, spAtCLP5, spAtCLP6, spAtCLP7, spAtCLP8, spAtCLP9, spAtCLP10, spAtCLP11, spAtCLP12, spAtCLP13, spAtCLP14, spAtCLP15, spAtCLP16, spPhCTP2, spAtCTP4, spAtLTP1, spAtLTP2, spAtLTP3, spAtLTP4, spAtLTP5, spAtLTP6, spAtLTP7, spAtLTP12, spAtLTP13, spAtLTP15, spAtLTP17, spAtLTP18 show excellent tolerance to the PPO inhibitor herbicides at 4 times field concentration, 23 of the recombinant expression vectors are high or medium resistant to ethoxyfen-ethyl at 4 times field concentration, 24 of the recombinant expression vectors are high or medium resistant to bensulfuron-methyl at 4 times field concentration, 26 of the recombinant expression vectors are high or medium resistant to flumioxazin at 2 times field concentration, the technical effects of the plastid transit peptides are superior to the herbicide tolerance of the transgenic corn T1 generation plants of the positive control plastid transit peptide spAtCLP2.

[0242] In summary, the present application provides a novel universal plastid transit peptide which can effectively localize exogenous proteins in plant plastids, improve localization efficiency, reduce operation complexity, and avoid adverse effects on plant cells. Specifically, the plastid transit peptide disclosed in the present application has good universality and can localize proteins encoded by protoporphyrinogen oxidase (PPO) genes and 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) genes, and has a wide application prospect in the field of protein transport and protein localization. Considering the advancement of the technical solution of the present application, it has a wide application in the fields of plant molecular biology, plastid biology, and protein transport technology. Therefore, the technical solution of the present application has important application value in the technical field. With the increasing demand for efficient and safe agricultural production worldwide, the plastid transit peptide disclosed in the present application can be widely used in biological breeding and plant production, for example, to improve the disease resistance and stress resistance of crops and improve agricultural production efficiency.

[0243] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present application and are not limiting. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present application.

Claims

1. A plastid transit peptide, characterized in that The amino acid sequence of the plastid transit peptide has at least 90% sequence identity to any one of SEQ ID NO: 1 to SEQ ID NO:

36.

2. The plastid transit peptide of claim 1, wherein The amino acid sequence of the plastid transit peptide comprises at least one of SEQ ID NO: 1 to SEQ ID NO:

36.

3. A nucleotide sequence, characterized in that The plastid transit peptide of claim 1 or 2.

4. The nucleotide sequence according to claim 3, characterized in that The sequence comprises at least one of SEQ ID NO: 37 to SEQ ID NO:

72.

5. A composition characterized in that The composition of claim 5 or 6 operably linked to an expressible promoter.

6. The composition of claim 5, wherein The promoter is a constitutive promoter, a tissue-specific promoter, or an inducible promoter.

7. An expression cassette comprising The promoter is a Cauliflower Mosaic Virus 35S promoter, a Brassica eukaryotic elongation factor gene 1 alpha promoter, an Arabidopsis thaliana ubiquitin 10 gene promoter, a Glycine max tsfl gene promoter, a rice Actl gene promoter, or a maize ubiquitin 1 gene promoter.

8. The expression cassette of claim 7, wherein The expression cassette of any one of claims 7-9.

9. The expression cassette of claim 7 or 8, wherein The expression cassette of any one of claims 7-9, and the plant material is selected from the group consisting of a plant cell, a plant tissue, a plant tissue culture, a callus culture, or a plant part.

10. An expression vector comprising the nucleic acid of claim 9. The plant material is selected from the group consisting of maize, soybean, Arabidopsis thaliana, cotton, Brassica, rice, sorghum, wheat, barley, millet, tobacco, sunflower, sugarcane, or oat.

11. A plant material, characterized in that The use of the plastid transit peptide of claim 1 or 2 to target a polypeptide or protein operably linked thereto to a plant plastid.

12. The plant material of claim 11, characterized by The plant plastid is a chloroplast, chromoplast, leucoplast, amyloplast, statolith, elaioplast, or proteoplast.

13. A method of targeting a polypeptide or protein to the plastids of a plant, characterized in that, The use of the plastid transit peptide of claim 1 or 2 to target a polypeptide or protein operably linked thereto to a plant plastid.

14. The method of targeting a polypeptide or protein to the plastids of a plant of claim 13, wherein The plant is selected from the group consisting of maize, soybean, Arabidopsis thaliana, cotton, Brassica, rice, sorghum, wheat, barley, millet, tobacco, sunflower, sugarcane, or oat.

15. A method of producing transgenic plant material, comprising: The use comprises enhancing a plant's tolerance to a herbicide. The enhancing a plant's tolerance to a herbicide comprises operably linking the plastid transit peptide of claim 1 or 2 to a nucleotide sequence of a herbicide tolerance gene, and introducing the linked composition into a plant material or a plant.

17. Use of a plastid transit peptide according to claim 16 for targeting a polypeptide or protein operably linked to be directed to the plastids of a plant, characterized in that, 20. The use of the plastid transit peptide of claim 19 to target a polypeptide or protein operably linked thereto to a plant plastid, wherein the herbicide tolerance gene is a protox gene, a 5-enolpyruvylshikimate-3-phosphate synthase gene.

18. Use of a plastid transit peptide according to claim 16 or 17 for targeting a operably linked polypeptide or protein to guide to a plant plastid, characterized in that, ​ 19. Use of a plastid transit peptide according to claim 18 for targeting a operably linked polypeptide or protein to guide to a plant plastid, characterized in that, ​ ​ 21. Use of a plastid transit peptide of claim 19 for targeting an operably linked polypeptide or protein to guide to a plastid of a plant, the herbicide being a protox inhibitor herbicide, a 5-enolpyruvylshikimate-3-phosphate synthase class herbicide, Preferably, the protox inhibitor herbicide is oxyfluorfen, bensulfuron-methyl or flumioxazin, Preferably, the 5-enolpyruvylshikimate-3-phosphate synthase class herbicide is glyphosate.

22. Use of a plastid transit peptide according to claim 16 or 17 for targeting a polypeptide or protein operably linked to be directed to the plastids of a plant, characterized in that, The use includes identifying the activity of a plastid transit peptide in a plant.

23. Use of a plastid transit peptide according to claim 22 for targeting a polypeptide or protein operably linked to be directed to the plastids of a plant, characterized in that, The identifying the activity of a plastid transit peptide in a plant includes operably linking the plastid transit peptide of claim 1 or 2 to a nucleotide sequence of a herbicide tolerance gene and introducing the operably linked sequence into plant material or a plant and detecting tolerance of the plant to the herbicide.

24. A method of obtaining a plant commodity, plant product, or processed agricultural product, characterized in that, The use includes processing a harvest of the plant of claim 15 to obtain a plant commodity, plant product or processed agricultural product.

Citation Information

Patent Citations

  • Plastid transit peptides derived from lower photosynthetic eukaryotes and methods

    CN102471778A

  • Herbicide resistance protein and coding gene and application thereof

    CN105925590A

  • Application of protoporphyrinogen oxidase

    CN115336534A

  • Herbicide tolerance protein as well as coding gene and application thereof

    CN115340987A

  • Herbicide tolerance achieved through plastid transformation

    US20020073443A1