Celery plants resistant to fusarium race 4

Abstract

The present invention relates to a cultivated Apium graveolens L. dulce plant comprising a QTL on chromosome 2 which in seeds of deposit NCIMB 44402 is located between SEQ ID No. 1 and SEQ ID No. 2, which QTL confers resistance to Fusarium oxysporum f. sp. apii race 4 and to a cultivated Apium graveolens L. dulce plant comprising a QTL on chromosome 2 which is located between SEQ ID No. 1 and SEQ ID No. 2, which QTL confers resistance to Fusarium oxysporum f. sp. apii race 4. In seeds of deposit NCIMB 44402 the QTL on chromosome 2 is genetically linked to a marker comprising a SNP as presented in SEQ ID No. 2. The QTL on chromosome 2 is preferably genetically linked to a marker comprising a SNP as presented in SEQ ID No. 2 in the cultivated Apium graveolens L. dulce plant.

Description

[0001] CELERY PLANTS RESISTANT TO FUSARIUM RACE 4

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to a cultivated celery plant (Apium graveolens L. dulce) that is resistant to Fusarium oxysporumf sp. apii race 4. The invention further relates to a method for producing such a celery plant and to methods for identification and selection of such a celery plant. The invention also relates to seeds of such a celery plant, to propagation material suitable for producing such a celery plant, and to a food product comprising such a celery plant or part thereof. The invention further relates to a cell or a tissue culture that is produced from or can be regenerated into such a celery plant. The invention also relates to markers for identification of such celery plant and to use of said markers.

[0004] BACKGROUND OF THE INVENTION

[0005] Apium graveolens is a plant species belonging to the Apiaceae family, which comprises two important vegetable crops, namely celery and celeriac. Celery is usually cultivated outdoors in soil, and in this environment, it may be exposed to a variety of pathogenic organisms, including soil-borne pathogenic fungi. One of the most important diseases affecting celery production is Fusarium oxysporumf. sp. apii (herein abbreviated to F. oxysporumf. sp. apii, or FUS), which infects celery plants via the roots. There it causes a reduction in water uptake by the celery plant, and a discolouration of the inner roots. This results in yellowing, stunting and wilting of an infected celery plant, and ultimately in a complete loss of the plant. In this manner the pathogenic fungus may greatly reduce commercial celery production.

[0006] “Fusarium yellows”, as the disease caused by F. oxysporumf. sp. apii is named, is a monocyclic disease, which means that there is no secondary spread of the disease within the same season. Infected plants serve to increase the amount of inoculum available for the next season. Outbreaks of F. oxysporumf. sp. apii are very difficult to control with fungicides or by the use of crop rotation. Its dormant spores can survive in the soil for years, and the fungus can even survive and propagate in the roots of certain weeds. The pathogen can spread via seeds and seedlings, and it can also be introduced in disease-free fields by wind, water, or contaminated farm equipment. An additional problem is that existing genetic resistances may be broken by newly emerging pathogenic races, when the pathogen genetically evolves to circumvent the plant’s mode of resistance.

[0007] F. oxysporumf. sp. apii race 1 had first been identified in the 1930s, and it mostly affected old yellow celery varieties. The pathogen could subsequently, since the 1950s, be kept under control by using green celery cultivars such as Tall Utah 52-70, which were perfectly resistant to race 1. In 1976, celery growers were confronted with a new pathogenic race (F. oxysporumf. sp. apii race 2), which was virulent on both yellow and green celery cultivars. Breeders successfully identified the Ful resistance gene in celeriac accession PI 169001 (Orton et al., 1984, Plant Dis. 68: 574-578), which enabled the introduction of commercial celery cultivars resistant to race 2, such as Challenger, Stix, Sabroso, and Command. In 1984, F. oxysporumf. sp. apii race 3 was identified in California, but it did not lead to major outbreaks. In 2013, however, a new, highly virulent race of F. oxysporumf. sp. apii emerged in Camarillo (Ventura County, California, USA), which was also virulent on varieties with a strong race 2 resistance, causing severe symptoms that lead to significant economic losses for celery growers (Epstein et al., 2017, Phytopathology 107, 463-473; Henry et al., 2020, BMC Genomics 21, 730; Epstein et al., 2022a, Front. Plant Sci. 13, article 921516). This fourth pathogenic race (F. oxysporumf. sp. apii race 4, or FUS4) continues to spread geographically, and it is currently threatening celery cultivation not only in the United States, but also in China (Li et al., 2023, Plant Disease 107, 3649-4015). There is a high risk that race 4 may also spread to major European celery production regions and seed production regions (e.g. in Spain and Italy).

[0008] It is therefore of crucial importance for celery cultivation worldwide to identify a source of genetic resistance to FUS4. Many teams have been working on this challenge, and a first resistance to FUS4 was reported in patent application WO2022136652. However, this resistance is conferred by at least two different genomic regions located on chromosomes 4 and 5, which are in a preferred embodiment to be combined with a third genomic region on chromosome 7. The polygenic nature of this resistance makes it difficult to efficiently introduce it into commercial celery varieties by breeding. Epstein et al (2022b, Plant Breeding 1-9) identified a genetic resistance to both races 2 and 4 in accession Apium graveolens PI 181714, which they introgressed into Apium graveolens L. dulce. However, the genetic basis of this resistance was not identified. In variety patent applications US20230320298 and US20230320299, two celery varieties were disclosed that have a “moderate tolerance” (variety TBG 43) and a “very good tolerance” (variety TBG 45) to FUS4, respectively. However, also here genetic information about the reported resistance trait is entirely lacking, and it is unclear how the term “tolerance” relates to actual resistance against FUS4.

[0009] It is therefore an object of this invention to provide a cultivated celery plant with a new resistance to FUS4. It is also an object of this invention to provide a cultivated celery plant that carries a single QTL that confers resistance to FUS4. It is a further object of this invention to provide molecular markers to identify plants carrying the QTL of the invention.

[0010] The research leading to the present invention had as its aim to identify and characterize new sources of resistance to FUS4 that could be conveniently used in celery varieties that are commercially interesting. When a resistance inherits in a recessive way, both parents of a hybrid variety need to have the resistance for it to be expressed in the Fl. For a breeding program this means that the resistance needs to be introgressed in all the material for a certain market in which the disease is prevalent. It is thus advantageous if the resistance is inherited as a dominant or incompletely dominant trait. It is therefore also an object of this invention to provide a cultivated celery plant with a dominant or incompletely dominant, monogenic resistance to FUS4.

[0011] During the research leading to the present invention, a Quantitative Trait Locus (QTL) was identified that, when present in a celery plant, confers resistance to FUS4. It was observed that the presence of a specific QTL on chromosome 2 of the celery genome causes complete resistance to FUS4. Further fine-mapping of the QTL region revealed that said QTL is located between the positions that can be identified with marker sequences FUS4_1 (SEQ ID No. 1) and marker FUS4_2 (SEQ ID No. 2).

[0012] The invention thus relates to cultivated Apium graveolens L. dulce plant comprising a QTL on chromosome 2 which in seeds of deposit NCIMB 44402 is located between SEQ ID No. 1 and SEQ ID No. 2, which QTL confers resistance to Fusarium oxysporumf. sp. apii race 4. More in particular, the invention relates to a cultivated celery plant of the species Apium graveolens L. dulce comprising a QTL on chromosome 2 which is located between marker sequences SEQ ID No. 1 and SEQ ID No. 2, which QTL confers resistance to F. oxysporumf. sp. apii race 4.

[0013] In a further embodiment, the invention relates to a cultivated Apium graveolens L. dulce plant as defined above, wherein in seeds of deposit NCIMB 44402 the QTL on chromosome 2 is genetically linked to a marker comprising a SNP as presented in SEQ ID No. 2. More in particular the invention relates to a cultivated Apium graveolens L. dulce plant as defined above, wherein the QTL on chromosome 2 is genetically linked to a marker comprising a SNP as presented in SEQ ID No. 2.

[0014] In particular, the invention relates to a cultivated celery plant of the species Apium graveolens L. dulce comprising a QTL on chromosome 2 that confers resistance to F. oxysporumf. sp. apii race 4, which QTL is as comprised in a celery plant representative seed of which was deposited with the NCIMB under deposit number NCIMB 44402. A plant of the invention therefore has the same QTL as the QTL that is present in deposit NCIMB 44402.

[0015] With reference to the publicly available Api-gra_Ventura_vl genome assembly for Apium graveolens L. dulce (PMID 33095976; Song et al., 2020, Plant Biotechnol. 19: 731-744), the QTL region of the invention is located on chromosome 2 between positions 4,416,150 and 4,548,376. The location of the QTL is therefore also derivable from this public map and it is relative to said physical positions. The genetic distance between the two flanking markers (FUS4_1 and FUS4_2) is about 0.3 cM (Example 2).

[0016] Table 1 provides the sequences of the SEQ ID Nos. that can be used as markers, or that can be used to develop markers, to identify the presence of the QTL of the invention in a celery plant. Table 1 also lists the position of the SNP in each sequence, the derived (mutant) allele that is linked to the resistance trait, and the wildtype allele for each SNP, as well as the physical position of each SNP on the public Api-gra_Ventura_vl genome assembly.

[0017] Table 1: Molecular markers delimiting the QTL region (FUS4_1 and FUS4_2), and a marker genetically linked to the resistance trait of the invention in celery (FUS4_2).

[0018] Further genotyping revealed that SNP marker FUS4_2 (SEQ ID No. 2) is also the peak marker in the QTL region. It is therefore closely linked to the resistance trait of the invention, and the presence of the QTL that leads to resistance to FUS4 can therefore suitably be identified by a marker on chromosome 2 comprising the SNP presented in SEQ ID No. 2.

[0019] During the execution of the breeding activities said new resistance to FUS4 was introgressed into celery breeding lines. This material had a good level of resistance under the disease pressures that were tested, and it did not show a recessive type of inheritance. This means that a cross between two parents of which only one parent shows a high level of resistance (due to the homozygous presence of the resistance trait) will result in an Fl progeny population in which all plants still have a certain level of resistance. The best results, however, were obtained when both parents harbored the resistance trait of the invention and when the QTL was homozygously present. The inheritance of the resistance can therefore be called intermediate or incompletely dominant.

[0020] “Incompletely dominant” is intended to mean that the presence of a single copy of the QTL region of the invention (z.e. heterozygous for the resistance trait of the invention) are resistant to FUS4, but that the presence of two copies of said QTL results in a higher level of resistance to FUS4. The resistance level of heterozygous plants is higher than the mean difference between wildtype (susceptible) plants lacking said QTL on the one hand, and plants homozygously comprising said QTL on the other hand. In a preferred embodiment, the QTL of the invention is present in a homozygous state, because this provides a stronger resistance level to FUS4, due to its incompletely dominant mode of inheritance. The resistance trait of the invention is thus inherited in an incompletely dominant fashion. It can be combined in a celery plant’s genome with one or more other genes or QTLs that confer resistance to other pathogenic races of F. oxysporumf. sp. apii, to provide a celery plant that is resistant to multiple (and preferably all) pathogenic F. oxysporumf. sp. apii races that are known. Suitably, the resistance trait of the invention is combined with a gene or QTL conferring resistance to race 2.

[0021] The resistance trait of the invention can also be combined in a celery plant’s genome with one or more other genes or QTLs that confer resistance to other diseases that affect celery. Non-limiting examples of such diseases are Root and Crown Rot (caused by Rhizoctonia solani and Pythium spp). Early Blight (caused by Cercospora apii), Late Blight (caused by Septoria apii), and Celery Mosaic Virus (CeMV). The resistance trait of the invention can also be combined with another desired trait.

[0022] In one embodiment, the QTL that confers resistance to F. oxysporumf. sp. apii race 4 is introgressed from a celery plant comprising said QTL, representative seed of which was deposited with the NCIMB under deposit number NCIMB 44402.

[0023] The QTL as comprised in NCIMB 44402 is located on chromosome 2 between marker sequences SEQ ID No. 1 and SEQ ID No. 2. The QTL as comprised in NCIMB 44402 is furthermore linked to marker SEQ ID No. 2.

[0024] As used herein, a marker is genetically linked to, and can therefore be used for the identification of the QTL of the invention, when the marker and the resistance to FUS4 cosegregate in a segregating population resulting from a cross between a plant comprising the QTL of the invention and a plant lacking said QTL. A marker genetically linked to a QTL can be used for identification of that QTL because a linked marker is present in said QTL.

[0025] The phenotypic presence of the resistance can be tested using a bio-assay, as is explained further in Example 1. Essentially, this bio-assay comprises the inoculation of young celery plants, by removing the plants from soil, rinsing their roots, and placing their roots in a liquid medium with 5 x 106spores per milliliter of F. oxysporumf. sp. apii race 4 isolate 274-AC, for five minutes. The plants are not damaged, and after inoculation they are transplanted to sterilized soil and grown further at a constant temperature of 28 °C. The plants are watered regularly to keep the soil sufficiently moist. Seven to eight weeks after inoculation, the plants are examined for typical disease symptoms of “Fusarium yellows”: leaves are visually assessed, and the plants are cut at the base between the hypocotyl and the roots for a visual assessment of the vein. On the basis of this assessment, each plant is assigned to one of three categories based on the severity of its symptoms: “susceptible” (S), “intermediate” (IR), and “resistant” (R). Susceptible plants are completely wilted, yellow, or even dead (with almost no remaining roots, so they could very easily be pulled out of the soil), and with a reddish-brown discoloration of the veins at the hypocotyl base. Intermediately resistant plants have yellow older leaves but a green and upright shoot, which showed some signs of wilting, and at least part of the hypocotyl base remained free of vein discoloration. Resistant plants look perfectly healthy, without damage, wilting or vein discoloration.

[0026] Suitably, said QTL has been introgressed into the cultivated celery plant from NCIMB 44402, or from a progeny plant thereof that has retained the QTL.

[0027] “Introgression” of a QTL as used herein is intended to mean introduction of a QTL into a plant not carrying said QTL by means of crossing and selection in the first generation in which the trait becomes phenotypically visible, or in any later generation, or in the Fl generation, or any further generation, if molecular markers are used for detecting the QTL. In case of a dominant trait, the trait becomes visible in the Fl generation of the cross between a plant with the trait and a plant without the trait. In case of a recessive trait this is suitably the F2 generation.

[0028] The invention also relates a cell, a tissue, or a seed of a cultivated celery plant of the invention, which comprise on chromosome 2 the QTL region of the invention as defined herein.

[0029] The plant of the invention may be produced from a cross between any plant carrying the QTL with itself or from a cross with another plant. The plant that is used in this cross is optionally a plant grown from seed of deposit NCIMB 44402, or from progeny seed thereof which is a direct or further descendant through crossing a plant grown from the deposited seed with itself or with another plant for one or more subsequent generations, wherein the progeny seed has retained the QTL of the invention. Alternatively, the plant of the invention that is used in this cross may have been obtained from the plant of the invention, or from progeny thereof, by vegetative propagation or another form of multiplication. Progeny can also be a plant, a cutting, a seed, a cell, or a tissue. Progeny plants having retained the QTL are in fact the same as plants of the invention since they carry the QTL, that confers resistance to F. oxysporumf. sp. apii race 4.

[0030] The invention also relates to a celery seed comprising the QTL of the invention in its genome, wherein a plant grown from the seed is a celery plant with resistance to F. oxysporum f. sp. apii race 4.

[0031] The current invention also relates to propagation material capable of developing into and / or being derived from a celery plant comprising the QTL of the invention in its genome. Preferably, the propagation material is suitable for sexual reproduction, and it is in particular selected from the group consisting of a microspore, pollen, an ovary, an ovule, an embryo sac, and an egg cell; or it is suitable for vegetative reproduction, and is in particular selected from the group consisting of a cutting, a root, a stem, a cell, and a protoplast; or is suitable for tissue culture of regenerable cells, and is in particular selected from the group consisting of a leaf, pollen, an embryo, a cotyledon, a hypocotyl, a meristematic cell, a root, a root tip, an anther, a flower, a seed, and a stem; wherein the propagation material and the plant produced from the propagation material comprises in its genome the QTL of the invention that confers resistance to F. oxysporumf. sp. apii race 4.

[0032] In one embodiment, said propagation material is derived from a celery plant, representative seed of which was deposited with the NCIMB under deposit number NCIMB 44402, or from a progeny plant thereof.

[0033] The invention further relates to a cell comprising the QTL of the invention as defined herein. A cell of the invention can be obtained from, or be present in, a plant of the invention. Such a cell may either be isolated from, or is a part of the complete plant, or from a part thereof, and still constitutes a cell of the invention because such a cell comprises the QTL of the invention that confers resistance to F. oxysporumf. sp. apii race 4. A cell of the invention may also be a regenerable cell that can regenerate into a new plant of the invention.

[0034] Germplasm of plants of the invention can be used in a breeding program for the development of celery plants having resistance to F. oxysporumf. sp. apii race 4. The germplasm is constituted by all inherited characteristics of an organism and according to the invention it encompasses at least the resistance trait of the invention.

[0035] Celery plants of the invention or parts thereof, in particular the stalks or sticks of such a celery plant, can be packaged and commercialized as a food product.

[0036] The celery plants comprising the QTL of the invention conferring resistance to F. oxysporumf. sp. apii race 4, may have acquired said QTL from a suitable source, either by conventional breeding, or by genetic modification, in particular by cisgenesis or transgenesis. Cisgenesis is genetic modification of plants with a natural gene, coding for an (agricultural) trait, from the crop plant itself or from a sexually compatible donor plant. Transgenesis is genetic modification of a plant with a gene from a non-crossable species, or with a synthetic gene.

[0037] The invention also relates to a marker for the identification of the QTL on chromosome 2 in a celery plant, which marker is the G / T SNP presented in SEQ ID No. 2. The SNP presented in marker FUS4_2 (SEQ ID No. 2) is genetically linked to said QTL on chromosome 2 and to the resistance trait of the invention in celery. This marker can be used to screen for the presence of the QTL in cultivated plants, such as celery varieties, but also in wild celery plants and accessions. The wildtype marker allele that is not genetically linked to the resistance QTL comprises G, whereas the marker allele that is genetically linked to the QTL comprises T. A marker can be defined as a reference sequence that comprises a modification(s) that can be detected using any suitable method known. The term “marker”, “molecular marker”, "genetic marker" or “DNA marker” refers to a feature of an organism’s genome (e.g. a nucleotide or a polynucleotide sequence that is present in an organism’s genome) that is associated with one or more loci of interest. Preferably, a genetic marker is polymorphic in a population of interest. Genetic markers include, for example, single nucleotide polymorphisms (SNPs), indels (i.e. insertions / deletions), simple sequence repeats (SSRs), restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNAs (RAPDs), cleaved amplified polymorphic sequence (CAPS) markers, Diversity Arrays Technology (DArT) markers, and amplified fragment length polymorphisms (AFLPs), among many other examples. Genetic markers can, for example, be used to locate genetic loci containing alleles on a chromosome that contribute to variability of phenotypic traits. The term “marker” or “genetic marker” can also refer to a polynucleotide sequence complementary to a genomic sequence, such as a sequence of a nucleic acid used as a probe. The term “marker” then refers to a physical entity that can be used in molecular biological techniques for detecting the mutation.

[0038] This invention further relates to the use of a marker for the identification of a celery plant according to the invention that is resistant to F. oxysporumf. sp. apii race 4. A marker genetically linked to the resistance trait of the invention is in particular useful for screening plants in an early developmental stage in which the phenotype is not yet visible, or in situations wherein a bio-assay with the pathogen cannot readily be performed.

[0039] A plant of the invention can be identified by screening a celery plant population for the presence of the QTL of the invention, and by identifying a celery plant that comprises the SNP presented in marker FUS4_2 (SEQ ID No. 2) as a celery plant of the invention.

[0040] This invention also relates to a method for selecting a celery plant with resistance to F. oxysporumf. sp. apii race 4, comprising identifying the presence of the QTL on chromosome 2 of the invention, and selecting a plant that comprises said QTL as a celery plant resistant to F. oxysporumf. sp. apii race 4. Suitably, identifying the presence of the QTL on chromosome 2 is done by using a marker comprising the G>T SNP presented in SEQ ID No. 2 for the identification of said QTL.

[0041] In the context of the present invention, a marker allows the unambiguous detection of the QTL region that is genetically linked to resistance to F. oxysporumf. sp. apii race 4 in celery, and the selection of celery plants that harbor in their genome said resistance trait at any stage of their life cycle, even when the plants are only in the seedling stage. Marker-assisted breeding and selection greatly increases the speed with which a trait can be introduced into different genetic backgrounds, and with which it can be commercialized. Methods for detecting markers and specific alleles are abundantly known in the field. In general, these methods allow to distinguish between two different alleles of a marker, on a specific chromosome. Detection of a polymorphism can be achieved by electrophoretic techniques, but the widespread availability of DNA sequencing often makes it easier to simply sequence amplified products directly. Once the polymorphic sequence difference is known, rapid assays for the detection of a polymorphism can be designed for progeny testing, generally involving some version of PCR amplification of specific alleles.

[0042] In particular examples, PCR detection and quantification is carried out using two labeled Anorogenic oligonucleotide forward primers and an unlabeled common reverse primer, for example, KASP™. To enable the unambiguous detection of the QTL region linked to the FUS4 resistance trait in celery breeding, and the selection of plants comprising said QTL region in their genome at any stage of their life cycle, primers were designed for the two anking markers that were found to delimit said QTL region, for use in a KASP™ assay. Table 2 provides a list of KASP primers that are suitable for the identification of the two Ranking markers delimiting the QTL region, and for the identification of the marker that is genetically linked to the FUS4 resistance trait in celery. The person skilled in the art of molecular biology may of course also use other types of markers, and the primers listed here are merely illustrative and not limiting in any way.

[0043] The presence or absence of marker FUS4_1 in the genome of a celery plant can be investigated in a KASP™ assay by using the primers listed in SEQ ID No. 3, SEQ ID No. 4 and SEQ ID No. 5. For investigating the presence or absence of marker FUS4_2 the primers listed in SEQ ID No. 6, SEQ ID No. 7 and SEQ ID No. 8 can be used.

[0044] Table 2: KASP primers suitable for the identification of flanking markers delimiting the QTL region, and for the identification of markers genetically linked to the resistance trait of the invention in celery.

[0045] This invention further relates to a method for producing a cultivated celery plant resistant to F. oxysporumf. sp. apii race 4, said method comprising: a) crossing a celery plant according to the invention with another celery plant to obtain a first generation population; b) optionally performing one or more rounds of selfing and / or crossing of a plant of the first generation population to obtain a further generation population; c) selecting from among the plants resulting from the first generation population of step a) or from the further generation population of step b) a plant that comprises the QTL on chromosome 2 of the invention as a plant that is resistant to F. oxysporumf. sp. apii race 4 (Example 3).

[0046] In one embodiment, selecting a plant comprising the QTL on chromosome 2 is done by using a molecular marker genetically linked to the QTL, preferably the G>T SNP presented in SEQ ID No. 2 for the identification of said QTL.

[0047] This invention also relates to a method for producing a cultivated celery plant resistant to F. oxysporumf. sp. apii race 4, said method comprising: a) crossing a celery plant grown from seed deposited under NCIMB accession number NCIMB 44402, or a progeny plant thereof that has retained the QTL on chromosome 2, with another celery plant to obtain a first generation population; b) optionally performing one or more rounds of selfing and / or crossing of the plant resulting from the cross to obtain a further generation population; c) selecting from among the plants resulting from the first generation population of step a) or from the further generation population of step b) a plant that comprises the QTL on chromosome 2 of the invention, which plant is resistant to F. oxysporumf. sp. apii race 4.

[0048] This invention also relates to a method for the production of cultivated hybrid celery seed harboring resistance to F. oxysporumf. sp. apii race 4, comprising crossing a first celery parent plant with a second celery parent plant and harvesting the resultant hybrid seed, wherein the first celery parent plant and / or the second celery parent plant are plants comprising the QTL on chromosome 2 according to the invention in a homozygous state, wherein said QTL is responsible for resistance to F. oxysporumf. sp. apii race 4 in the hybrid plant that is grown from the seed. This invention also relates to the cultivated hybrid celery seed harboring resistance to F. oxysporumf. sp. apii race 4 produced by this method. Due to the incompletely dominant mode of inheritance, higher levels of resistance are achieved when the resistance trait of the invention is present homozygously. In a preferred embodiment, both parents therefore comprise the QTL on chromosome 2 according to the invention in a homozygous state, resulting in a hybrid Fl population that comprises the QTL on chromosome 2 according to the invention in a homozygous state.

[0049] Plants of the invention can be produced by using tissue culture or by using vegetative propagation. Plants of the invention can also be produced by using a doubled haploid generation technique to generate a doubled haploid line that is completely homozygous, and that therefore homozygously comprises the QTL of the invention, and that is resistant to F. oxysporum / . sp. apii race 4.

[0050] The invention further relates to a method for the production of a celery plant comprising the QTL of the invention, wherein said QTL confers resistance to F. oxysporum f sp. apii race 4, which method comprises growing a seed comprising said QTL into the said plant.

[0051] The invention also relates to a method of growing a celery plant resistant to F. oxysporum . sp. apii race 4 and / or a celery plant comprising a QTL on chromosome 2 which is located between marker FUS4_1 (SEQ ID No. 1) and marker FUS4_2 (SEQ ID No. 2), comprising the step of germinating a celery seed of the invention under suitable conditions into a celery plant of the invention.

[0052] This invention also relates to a QTL on chromosome 2 of the celery genome, which QTL confers resistance to F. oxysporum / . sp. apii race 4, and which QTL comprises a nucleotide sequence flanked by SEQ ID Nos. 1 and 2 and comprising a SNP as presented in SEQ ID No. 2.

[0053] Suitably, the resistance trait of the invention may be combined with another desired trait in a celery plant’s genome. This can be achieved with a method comprising the following steps: a) crossing a celery plant comprising the QTL of the invention that confers resistance to F. oxysporum / . sp. apii race 4, representative seed of which was deposited with the NCIMB as NCIMB 44402, with a second celery plant that comprises the other desired trait to produce Fl progeny; b) selecting an Fl progeny that comprises said QTL for resistance to F. oxysporum / . sp. apii race 4 and that comprises the other desired trait; c) crossing the selected Fl progeny with either parent, to produce backcross progeny; d) selecting backcross progeny comprising said QTL for resistance to F. oxysporum / . sp. apii race 4 and the other desired trait; and e) optionally repeating steps c) and d) one or more times in succession to produce selected fourth or higher backcross progeny that comprises the other desired trait and has resistance to F. oxysporumf. sp. apii race 4

[0054] This method gives rise to a celery plant that has in its genome the resistance trait of the invention and the other desired trait. Said celery plant or parts thereof, in particular the stalks or sticks of such a celery plant, can be packaged and commercialized as a food product.

[0055] Optionally, selfing steps are performed after any of the crossing or backcrossing steps. Selection for a plant comprising the QTL of the invention and the other desired trait can alternatively be done following any crossing or selfing step of the method.

[0056] Suitably, the “other desired trait” is resistance to another disease that affects celery. Non-limiting examples of such diseases are F. oxysporumf. sp. apii race 2, Root and Crown Rot (caused by Rhizoctonia solani and Pythium spp), Early Blight (caused by Cercospora apii), Late Blight (caused by Septoria apii), and Celery Mosaic Virus (CeMV).

[0057] DEPOSIT

[0058] Seeds of Apium graveolens L. dulce homozygously comprising the quantitative trait locus (QTL) on chromosome 2 conferring the resistance trait of the invention, were deposited with NCIMB Ltd, Wellheads Place, Dyce, Aberdeen AB21 7GB United Kingdom on 11 July 2024 under deposit accession number NCIMB 44402.

[0059] SEQUENCE INFORMATION

[0060] SEQ ID No: 1 Genetic SNP marker LUS4_1. A genomic fragment of Apium graveolens L. dulce chromosome 2 is presented (positive strand), wherein the position of the SNP comprising a change from C to T is indicated as [C / T]. In this sequence C is the wildtype and T the mutation.

[0061] TTAAGAATATAAAAATGACCAACACGAACCGAGAAATCAAAAATATTTTTAAATATTT TATTTAAAAACACATTTATCAGGCAACTTCGAAATTTCACGT[C / T]AATGGTGATTTAT AGAAATTGATATCATGTGTAGGATAGCCACGGCTTTGTCACTTTCTGTTAGATAGTATT AAATACAAATTGATCAAAAAAAGTAGTT

[0062] SEQ ID No: 2 Genetic SNP marker LUS4_2. In this sequence G is the wildtype and T the mutation.

[0063] GAGAGAGGAGAGGAGAACCTGAGGGAGCTTAACAGTGGTAGAAGCAGCAACAATGG CATAACCAAGAAGCTTAGAAATGAGAGGAAGCAAGCAATCTTTA[G / T]GGGGAATAG AACCATTACTGAGTGATTGAAAAGCACAAGTGAAGTCCATTCCAAGAAATTGCATTGG GATCTTGTCCATCATTCTGATCTGCAAACTCAA SEQ ID No: 3 Forward primer that specifically recognizes the wildtype allele of the SNP in SEQ ID No: 1. Suitably it is labelled with FAM dye and used in a KASP™ marker assay in combination with SEQ ID No: 4 and SEQ ID No: 5.

[0064] GAAGGTGACCAAGTTCATGCTCAGGCAACTTCGAAATTTCACGTC

[0065] SEQ ID No: 4 Forward primer that specifically recognizes the mutant allele of the SNP in SEQ ID No: 1. Suitably it is labelled with VIC dye and used in a KASP™ marker assay in combination with SEQ ID No: 3 and SEQ ID No: 5.

[0066] GAAGGTCGGAGTCAACGGATTATCAGGCAACTTCGAAATTTCACGTT

[0067] SEQ ID No: 5 Common reverse primer (without a fluorophore label) that can be used in a KASP™ marker assay in combination with SEQ ID No: 3 and SEQ ID No: 4, to distinguish between the wildtype and mutant alleles of the SNP in SEQ ID No: 1.

[0068] ACAAAGCCGTGGCTATCCTACACAT

[0069] SEQ ID No: 6 Forward primer that specifically recognizes the wildtype allele of the SNP in SEQ ID No: 2. Suitably it is labelled with FAM dye and used in a KASP™ marker assay in combination with SEQ ID No: 7 and SEQ ID No: 8.

[0070] GAAGGTGACCAAGTTCATGCTAAATGAGAGGAAGCAAGCAATCTTTAG

[0071] SEQ ID No: 7 Forward primer that specifically recognizes the mutant allele of the SNP in SEQ ID No: 2. Suitably it is labelled with VIC dye and used in a KASP™ marker assay in combination with SEQ ID No: 6 and SEQ ID No: 8.

[0072] GAAGGTCGGAGTCAACGGATTGAAATGAGAGGAAGCAAGCAATCTTTAT

[0073] SEQ ID No: 8 Common reverse primer (without a fluorophore label) that can be used in a

[0074] KASP™ marker assay in combination with SEQ ID No: 6 and SEQ ID No: 7, to distinguish between the wildtype and mutant alleles of the SNP in SEQ ID No: 2.

[0075] GTGCTTTTCAATCACTCAGTAATGGTTCTA

[0076] The present invention will be further elucidated in the Examples that follow and that are provided for illustration purposes only and are in no way intended to limit the invention in any way. EXAMPLES

[0077] EXAMPLE 1

[0078] Bio-assay for testing resistance to Fusarium oxysporum f. sp. apii race 4

[0079] The phenotypic presence of the resistance trait of the invention can be tested using a bio-assay. Celery plants were tested for resistance against FUS4 with a bio-assay that was performed essentially as described by Epstein et al. (2017), using 15 plants per accession at a constant (day and night) temperature of 28 °C. The protocol included the inoculation of young celery plants with a suspension of Fusarium conidia spores. Resistance to FUS4 was assayed using spores from F. oxysporum f sp. apii race 4 isolate 274-AC, which had been provided by the Department of Plant Pathology, University of California Davis (USA) in 2015, and which has been described in detail in the publication of Epstein et al. (2017). This publicly available isolate had originally been collected from an infected celery plant in Camarillo, California (USA), in 2013.

[0080] After 7 to 8 weeks of incubation, the plants were scored for typical “Fusarium yellows” symptoms: leaves were visually assessed, and the plants were cut at the base between the hypocotyl and the roots for a visual assessment of the vein. On the basis of this assessment, each plant was assigned to one of three categories based on the severity of its symptoms: “susceptible” (S), “intermediate” (IR), and “resistant” (R). Susceptible plants were completely wilted, yellow, or even dead (with almost no remaining roots, so they could very easily be pulled out of the soil), and with a reddish-brown discoloration of the veins at the hypocotyl base. Intermediately resistant plants had yellow older leaves but a green and upright shoot, which showed some signs of wilting, and at least part of the hypocotyl base remained free of vein discoloration . Resistant plants looked perfectly healthy, without damage, wilting or vein discoloration.

[0081] EXAMPLE 2

[0082] Mapping of the FUS4 resistance trait on chromosome 2

[0083] Celery plants resistant to FUS4 were observed in internal breeding material. A specific celery plant resistant to FUS4 (line 28030) was crossed (as a father) to a wildtype celery plant (line 12433;3, Apium graveolens dulce susceptible to FUS4) as a mother, and from this cross a segregating F2 progeny population of 346 plants was derived.

[0084] In this population, the resistance trait was observed to segregate in a monogenic incompletely dominant fashion, as determined by disease tests on a subset of 150 F2 plants.

[0085] The 346 F2 plants were genotyped using a set of 694 molecular markers that were distributed evenly across all eleven chromosomes of the celery genome. Phenotyping was performed in the F3 generation to be able to have replicates. Thus, all F2 plants were selfed, and their F3 seeds were harvested. From each F2 plant, 45 F3 seeds were used. These F3 seeds were sown and grown in three batches of 15 plants, in three different greenhouse compartments, and they were tested for their resistance to FUS4 in a disease resistance experiment, using the bio-assay described in Example 1. Two celery accessions with intermediate resistance and one accession susceptible to FUS4 were used as controls in this experiment, along with the original resistant father line and the susceptible mother line. Based on the resistance scoring (R, IR and S), a disease index (DI) was calculated per batch of 15 F3 plants, by multiplying the number of R-scores by 1, the number of IR scores by 0.5, and the number of S-scores by zero, adding up these three values, and dividing the sum by the total number of plants (z.e. usually 15, unless some of the seeds had failed to germinate). A DI of 1 corresponded to complete resistance, whereas a DI of zero was indicative of complete susceptibility.

[0086] Based on the genotyping results in the F2 generation and on the phenotypical analysis in the F3 generation, a QTL mapping study was performed in which the genetic linkage of the resistance to FUS4 was investigated to a set of molecular markers that were distributed evenly across all eleven chromosomes of the celery genome. In this study, a QTL region of 8.1 cM was identified on chromosome 2 that was closely linked to FUS4 resistance in celery plants.

[0087] Further fine-mapping allowed a narrowing down of the QTL region, to a subregion that was flanked by marker FUS4_1 (SEQ ID No. 1) and marker FUS4_2 (SEQ ID No. 2). With reference to the public Api-gra_Ventura_vl genome assembly (PMID 33095976; Song et al., 2020, Plant Biotechnol. 19: 731-744), the most finely mapped QTL region of the invention was found to be located on chromosome 2 between positions 4,416,150 and 4,548,376. The genetic distance between the two flanking markers (FUS4_1 and FUS4_2) was observed to be about 0.3 cM.

[0088] On average, plants lacking the QTL region of the invention had a DI = 0.163 in the above-described bio-assay. Plants harboring a single copy of the QTL region of the invention (z.e. heterozygous) had a DI = 0.631, and plants homozygous for the QTL region of the invention had a DI = 0.809. This observation further confirmed the incompletely dominant behavior of the resistance trait.

[0089] Further research resulted in the identification of additional markers for identification of the presence of the QTL. The resistance trait was found to be genetically linked to marker FUS4_2 (SEQ ID No. 2), which was also the peak marker.

[0090] EXAMPLE 3

[0091] Introduction of the FUS4 resistance trait into other celery plants

[0092] Plants of the invention that were deposited under NCIMB accession number NCIMB 44402 were crossed with wildtype celery plants that were susceptible to FUS4. Among the F2 progeny, celery plants were identified that showed the same characteristics as the parent plant of NCIMB accession number 44402, more specifically having the FUS4 resistance trait of the invention in a homozygous state. These plants were selected using the KASP primers developed in

[0093] Example 2 and presented in Table 2.

[0094] Further development of these plants resulted in lines and hybrid varieties with the FUS4 resistance trait of the invention, as found in NCIMB accession number NCIMB 44402.

Claims

CLAIMS1. A cultivated Apium graveolens L. dulce plant comprising a QTL on chromosome 2 which in seeds of deposit NCIMB 44402 is located between SEQ ID No. 1 and SEQ ID No. 2, which QTL confers resistance to Fusarium oxysporumf. sp. apii race 4.

2. A cultivated Apium graveolens L. dulce plant comprising a QTL on chromosome 2 which is located between SEQ ID No. 1 and SEQ ID No. 2, which QTL confers resistance to Fusarium oxysporumf. sp. apii race 4.

3. A cultivated Apium graveolens L. dulce plant as claimed in claim 1 or 2, wherein in seeds of deposit NCIMB 44402 the QTL on chromosome 2 is genetically linked to a marker comprising a SNP as presented in SEQ ID No. 2.

4. A cultivated Apium graveolens L. dulce plant as claimed in any one of the claims 1 to 3, wherein the QTL on chromosome 2 is genetically linked to a marker comprising a SNP as presented in SEQ ID No. 2.

5. A cultivated Apium graveolens L. dulce plant as claimed in any one of the claims 1 to 4, wherein the QTL is as comprised in the genome of an Apium graveolens L. dulce plant representative seed of which was deposited with the NCIMB under deposit number NCIMB 44402.

6. A cultivated Apium graveolens L. dulce plant as claimed in any one of the claims 1 to 5, wherein the QTL is introgressed from NCIMB 44402, or from a progeny plant thereof that has retained the QTL as defined in any one of the claims 1 to 3.

7. A cell of a cultivated Apium graveolens L. dulce plant according to claims 1 to 6, which cell comprises the QTL on chromosome 2 as defined in any one of the claims 1 to 6 in its genome.

8. An Apium graveolens L. dulce seed comprising the QTL on chromosome 2 as defined in any one of the claims 1 to 6 in its genome, wherein a plant grown from the seed is a plant as claimed in any one of the claims 1 to 6.

9. Propagation material capable of developing into and / or being derived from an Apium graveolens L. dulce plant according to claims 1 to 6, wherein the propagation material is suitable for sexual reproduction, and is in particular selected from the group consisting of a microspore, pollen, an ovary, an ovule, an embryo sac, and an egg cell; or is suitable for vegetative reproduction, and is in particular selected from the group consisting of a cutting, a root, a stem, a cell, and a protoplast; or is suitable for tissue culture of regenerable cells, and is in particular selected from the group consisting of a leaf, pollen, an embryo, a cotyledon, a hypocotyl, a meristematic cell, a root, a root tip, an anther, a flower, a seed, and a stem; wherein the plant produced from the propagation material comprises the QTL on chromosome 2 as defined in any one of the claims 1 to 4 that confers resistance to Fusarium oxysporumf. sp. apii race 4.

10. Marker for the identification in an Apium graveolens L. dulce plant of the QTL on chromosome 2 as defined in any one of the claims 1 to 6, which marker comprises the SNP presented in SEQ ID No. 2.

11. Use of a marker as claimed in claim 10 for the identification of an Apium graveolens L. dulce plant resistant to Fusarium oxysporumf. sp. apii race 4.

12. Method for selecting an Apium graveolens L. dulce plant resistant to Fusarium oxysporumf. sp. apii race 4, comprising detecting the presence of the QTL on chromosome 2 as defined in any one of the claims 1 to 6, and selecting a plant that comprises said QTL as a celery plant resistant to Fusarium oxysporumf. sp. apii race 4.

13. Method as claimed in claim 12, wherein the presence of the QTL on chromosome 2 is detected by using a marker comprising the SNP presented in SEQ ID No. 2 for the identification of said QTL.

14. Method for producing a cultivated Apium graveolens L. dulce plant resistant to Fusarium oxysporumf. sp. apii race 4, said method comprising: a) crossing a celery plant according to any one of the claims 1 to 6 with another celery plant to obtain a first generation population; b) optionally performing one or more rounds of selfing and / or crossing of a plant of the first generation population to obtain a further generation population; c) selecting from among the plants resulting from the first generation population of step a) or from the further generation population of step b) a plant that comprises the QTL on chromosome 2 as defined in any one of the claims 1 to 4 as a plant that is resistant to Fusarium oxysporumf. sp. apii race 4.

15. Method as claimed in claim 12, wherein the plant comprising the QTL on chromosome 2 is selected by using a molecular marker genetically linked to the QTL, preferably a marker comprising the SNP presented in SEQ ID No. 2 for the identification of said QTL.

16. Method as claimed in claim 14 or 15, wherein the celery plant according to any one of the claims 1 to 4 in step a) is a celery plant grown from seed deposited under NCIMB accession number NCIMB 44402, or a progeny plant thereof that has retained the QTL on chromosome 2.

17. Method for the production of cultivated hybrid Apium graveolens L. dulce seed harboring resistance to Fusarium oxysporumf. sp. apii race 4, comprising crossing a first celery parent plant with a second celery parent plant and harvesting the resultant hybrid seed, wherein the first celery parent plant and / or the second celery parent plant are plants comprising the QTL on chromosome 2 as defined in any one of the claims 1 to 6 in a homozygous state.

18. The cultivated hybrid Apium graveolens L. dulce seed harboring resistance to Fusarium oxysporumf. sp. apii race 4 and comprising the QTL on chromosome 2 as defined in any one of the claims 1 to 4 in its genome, produced by the method of claim 17.

19. A QTL on chromosome 2 of the Apium graveolens L. dulce genome, which confers resistance to Fusarium oxysporumf. sp. apii race 4, which QTL comprises a nucleotide sequence flanked by SEQ ID Nos. 1 and 2 and comprising the SNP presented in SEQ ID No. 2.

20. Method for the production of a celery plant comprising the QTL on chromosome 2 as defined in any one of the claims 1 to 6, which method comprises growing a seed comprising saidQTL into the said plant.

21. Method of growing a celery plant resistant to F. oxysporumf. sp. apii race 4 and / or a celery plant comprising the QTL on chromosome 2 as defined in any one of the claims 1 to 6, comprising the step of germinating a celery seed of the invention under suitable conditions into a celery plant of the invention.

Images