Use of vitamin d for treating fibrous dysplasia
Vitamin D addresses the underlying causes of fibrous dysplasia by inhibiting fibrosis and promoting osteoblast maturation and bone mineralization, offering a non-surgical treatment with proven safety and effectiveness.
Patent Information
- Application Number
- PCT/KR2025/010823
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-23
- Filing Date
- 2025-07-22
- Publication Date
- 2026-01-29
AI Technical Summary
There is no effective treatment for fibrous dysplasia that directly modulates pathological matrix formation and osteogenic differentiation abnormalities, and existing treatments focus solely on symptom relief.
Vitamin D, particularly in its active form 1,25(OH)2D₃, is used to inhibit excessive cAMP production, promote osteogenic differentiation, and induce bone mineralization, thereby addressing the underlying causes of fibrous dysplasia.
Vitamin D restores affected bone tissue to a normal state by inhibiting fibrosis, promoting osteoblast maturation, and enhancing bone mineralization, providing a non-surgical treatment option with proven safety and effectiveness.
Smart Images

Figure KR2025010823_29012026_PF_FP_ABST
Abstract
Description
Use of vitamin D in the treatment of fibrous dysplasia
[0001] The invention disclosed in this specification relates to a treatment for fibrous dysplasia (FD).
[0002]
[0003] Fibrous dysplasia is a rare inherited bone disorder in which normal bone tissue is replaced by fibrous connective tissue. This disorder can lead to various complications, including bone deformities, pathological fractures, and chronic pain. Lesions can occur in a single bone (monostotic) or multiple bones (polyostotic), and in severe cases, can lead to functional problems such as facial bone hypertrophy, hearing, and visual impairment. The pathological hallmark of the disorder is immature, irregular bone trabeculae and an overabundant collagenous fibrous matrix, interspersed with undifferentiated osteoblasts and fibroblasts. This impedes normal bone remodeling and perpetuates immature bone formation.
[0004] Meanwhile, vitamin D is known to play a crucial role in bone formation and regeneration. In particular, 1,25(OH)2D₃, the active form of vitamin D, plays a crucial role in maintaining and strengthening bone health by regulating calcium and phosphorus metabolism. Furthermore, vitamin D has been shown to increase bone density and strength. Several previous studies have shown that vitamin D supplementation improves bone density and reduces the risk of fractures in patients with osteoporosis.
[0005]
[0006] The technical challenge of this specification is to find an effective ingredient that can treat fibrous dysplasia.
[0007] The technical task of this specification is to elucidate the therapeutic mechanism of the above effective ingredient.
[0008]
[0009] This specification discloses vitamin D as an active ingredient having a therapeutic effect on fibrous dysplasia. That is, the use of vitamin D for the treatment of fibrous dysplasia is provided.
[0010] This specification details the pathways through which vitamin D may work to treat fibrous dysplasia.
[0011]
[0012] As disclosed in this specification, vitamin D may be used for the treatment of fibrous dysplasia.
[0013]
[0014] Figure 1 is a schematic diagram showing the pathway by which vitamin D of the present invention, specifically 1,25(OH)2D3, the active form of vitamin D, is involved in the pathogenesis of fibrous dysplasia.
[0015] Figure 2 shows immunofluorescence images of fibrosis markers observed for each cell population of normal BMSCs (Normal). Control represents an untreated cell population; 1,25D3 represents a cell population treated with 1,25(OH)₂D₃; PGE2 represents a cell population treated with prostaglandin E₂; and PGE2 + 1,25D3 represents a cell population treated with both 1,25(OH)₂D₃ and prostaglandin E₂. COL1 represents Col1A1; COL3 represents Col3A1; and TGFβ1 represents TGF-β1.
[0016] Figure 3 shows immunofluorescence images of fibrosis markers observed for each cell population of FD patient-derived BMSCs (FD). Control represents an untreated cell population; 1,25D3 represents a cell population treated with 1,25(OH)₂D₃; PGE2 represents a cell population treated with prostaglandin E₂; and PGE2 + 1,25D3 represents a cell population treated with both 1,25(OH)₂D₃ and prostaglandin E₂. COL1 represents Col1A1; COL3 represents Col3A1; and TGFβ1 represents TGF-β1.
[0017] Figure 4 is a graph showing the relative expression levels of COL1A1 in normal BMSCs (Normal) and FD patient-derived BMSCs (FD). Control represents the untreated cell group; 1,25D3 represents the cell group treated with 1,25(OH)₂D₃; PGE2 represents the cell group treated with prostaglandin E₂; and PGE2 + 1,25D3 represents the cell group treated with both 1,25(OH)₂D₃ and prostaglandin E₂. Asterisks indicate statistical significance according to one-way ANOVA (**** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05).
[0018] Figure 5 is a graph showing the relative expression levels of COL3A1 in normal BMSCs (Normal) and FD patient-derived BMSCs (FD). Control represents the untreated cell group; 1,25D3 represents the cell group treated with 1,25(OH)₂D₃; PGE2 represents the cell group treated with prostaglandin E₂; and PGE2 + 1,25D3 represents the cell group treated with both 1,25(OH)₂D₃ and prostaglandin E₂. Asterisks indicate statistical significance according to one-way ANOVA (**** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05).
[0019] Figure 6 is a graph showing the relative expression levels of TGF-β1 in normal BMSCs (Normal) and FD patient-derived BMSCs (FD). Control represents the untreated cell group; 1,25D3 represents the cell group treated with 1,25(OH)₂D₃; PGE2 represents the cell group treated with prostaglandin E₂; and PGE2 + 1,25D3 represents the cell group treated with both 1,25(OH)₂D₃ and prostaglandin E₂. Asterisks indicate statistical significance according to one-way ANOVA (**** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05).
[0020] Figure 7 is a micrograph showing the results of a wound healing assay performed according to Experimental Example 2.4 to confirm the effect on cell migration and proliferation of normal BMSCs (Normal) and FD patient-derived BMSCs (FD). Control represents a cell group that was not treated at all; 1,25D3 represents a cell group treated with 1,25(OH)₂D₃; PGE2 represents a cell group treated with prostaglandin E₂; and PGE2 + 1,25D3 represents a cell group treated with both 1,25(OH)₂D₃ and prostaglandin E₂. 0 hrs represents a photograph taken 0 hours after wounding, and 16 hrs represents a photograph taken 16 hours after wounding.
[0021] Figure 8 is a graph showing the relative quantification of cell migration of normal BMSCs (Normal) and FD patient-derived BMSCs (FD). Control represents the untreated cell group; 1,25D3 represents the cell group treated with 1,25(OH)₂D₃; PGE2 represents the cell group treated with prostaglandin E₂; and PGE2 + 1,25D3 represents the cell group treated with both 1,25(OH)₂D₃ and prostaglandin E₂. The vertical axis represents the closure ratio (%) compared to the initial wound area. Asterisks indicate statistical significance according to one-way ANOVA (**** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05).
[0022] Figure 9 is a graph showing the relative quantification of cell proliferation rates of normal BMSCs (Normal) and FD patient-derived BMSCs (FD). Control represents the untreated cell group; 1,25D3 represents the cell group treated with 1,25(OH)₂D₃; PGE2 represents the cell group treated with prostaglandin E₂; and PGE2 + 1,25D3 represents the cell group treated with both 1,25(OH)₂D₃ and prostaglandin E₂. Asterisks indicate statistical significance according to one-way ANOVA (**** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05).
[0023] Figure 10 shows images of ALP staining performed on cells of normal BMSC (Normal) and FD patient-derived BMSC (FD) according to Experimental Example 2.5. Control represents a cell group that was not treated; 1,25D3 represents a cell group treated with 1,25(OH)₂D₃; PGE2 represents a cell group treated with prostaglandin E₂; and PGE2 + 1,25D3 represents a cell group treated with both 1,25(OH)₂D₃ and prostaglandin E₂.
[0024] Figure 11 shows images of ARS staining performed on cells of normal BMSCs (Normal) and FD patient-derived BMSCs (FD) according to Experimental Example 2.5. Control represents a cell group that was not treated at all; 1,25D3 represents a cell group treated with 1,25(OH)₂D₃; PGE2 represents a cell group treated with prostaglandin E₂; and PGE2 + 1,25D3 represents a cell group treated with both 1,25(OH)₂D₃ and prostaglandin E₂.
[0025] Figure 12 shows images of quantitative analysis of ALP staining of normal BMSCs (Normal) and FD patient-derived BMSCs (FD) according to Experimental Example 2.5. Control represents a cell group that was not treated; 1,25D3 represents a cell group treated with 1,25(OH)₂D₃; PGE2 represents a cell group treated with prostaglandin E₂; and PGE2 + 1,25D3 represents a cell group treated with both 1,25(OH)₂D₃ and prostaglandin E₂.
[0026] Figure 13 shows images of quantitative analysis of ARS staining of cells from normal BMSCs (Normal) and FD patient-derived BMSCs (FD) according to Experimental Example 2.5. Control represents a cell group that was not treated; 1,25D3 represents a cell group treated with 1,25(OH)₂D₃; PGE2 represents a cell group treated with prostaglandin E₂; and PGE2 + 1,25D3 represents a cell group treated with both 1,25(OH)₂D₃ and prostaglandin E₂.
[0027] Figure 14 shows the results of measuring the expression level of RUNX2 in normal BMSCs (Normal) and FD patient-derived BMSCs (FD) according to Experimental Example 2.6. Control represents a cell group that was not treated at all; 1,25D3 represents a cell group treated with 1,25(OH)₂D₃; PGE2 represents a cell group treated with prostaglandin E₂; and PGE2 + 1,25D3 represents a cell group treated with both 1,25(OH)₂D₃ and prostaglandin E₂. Asterisks indicate statistical significance according to one-way ANOVA (**** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05).
[0028] Figure 15 shows the results of measuring the OCN expression level of normal BMSCs (Normal) and FD patient-derived BMSCs (FD) according to Experimental Example 2.6. Control represents a cell group that was not treated at all; 1,25D3 represents a cell group treated with 1,25(OH)₂D₃; PGE2 represents a cell group treated with prostaglandin E₂; and PGE2 + 1,25D3 represents a cell group treated with both 1,25(OH)₂D₃ and prostaglandin E₂. Asterisks indicate statistical significance according to one-way ANOVA (**** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05).
[0029] Figure 16 shows the results of measuring the DMP1 expression level of normal BMSCs (Normal) and FD patient-derived BMSCs (FD) according to Experimental Example 2.6. Control represents a cell group that was not treated at all; 1,25D3 represents a cell group treated with 1,25(OH)₂D₃; PGE2 represents a cell group treated with prostaglandin E₂; and PGE2 + 1,25D3 represents a cell group treated with both 1,25(OH)₂D₃ and prostaglandin E₂. Asterisks indicate statistical significance according to one-way ANOVA (**** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05).
[0030] Figure 17 shows the results of measuring the SOST expression level of normal BMSCs (Normal) and FD patient-derived BMSCs (FD) according to Experimental Example 2.6. Control represents a cell group that was not treated at all; 1,25D3 represents a cell group treated with 1,25(OH)₂D₃; PGE2 represents a cell group treated with prostaglandin E₂; and PGE2 + 1,25D3 represents a cell group treated with both 1,25(OH)₂D₃ and prostaglandin E₂. Asterisks indicate statistical significance according to one-way ANOVA (**** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05).
[0031] Figure 18 is an image showing the results of immunofluorescence analysis performed to confirm osteogenesis in normal cell-derived organoids (Normal) and FD patient-derived organoids (FD) according to Experimental Example 3.3. Control represents untreated organoids; 1,25D3 represents organoids treated with 1,25(OH)₂D₃.
[0032] Figure 19 is a micrograph of normal cell-derived organoids (Normal) and FD patient-derived organoids (FD) taken according to Experimental Example 3.4. Control represents untreated organoids; 1,25D3 represents organoids treated with 1,25(OH)₂D₃.
[0033] Figure 20 is a micrograph taken after ALP staining for ALP analysis of normal cell-derived organoids (Normal) and FD patient-derived organoids (FD) according to Experimental Example 3.4. Control represents untreated organoids; 1,25D3 represents organoids treated with 1,25(OH)₂D₃.
[0034] Figure 21 is a micrograph taken after ARS staining for ARS analysis of normal cell-derived organoids (Normal) and FD patient-derived organoids (FD) according to Experimental Example 3.4. Control represents untreated organoids; 1,25D3 represents organoids treated with 1,25(OH)₂D₃.
[0035]
[0036] Hereinafter, the present invention will be described in more detail through specific embodiments and examples with reference to the attached drawings. It should be noted that the attached drawings include some, but not all, embodiments of the invention. The invention disclosed by this specification may be implemented in various ways and is not limited to the specific embodiments described herein. These embodiments are provided to satisfy the legal requirements applicable to this specification. Those skilled in the art will be able to think of many modifications and other embodiments of the invention disclosed herein. Therefore, the invention disclosed herein is not limited to the specific embodiments described herein, and it should be understood that modifications and other embodiments thereof are also included within the scope of the claims.
[0037]
[0038] This specification provides a pharmaceutical composition for the treatment of fibrous dysplasia comprising:
[0039] Vitamin D; and
[0040] Pharmaceutically acceptable carrier.
[0041] As an example, the above vitamin D may be 1,25-dihydroxyvitamin D3.
[0042] In one embodiment, a pharmaceutical composition for treating fibrous dysplasia may have a selected function from the following:
[0043] Inhibits fibrosis in tissues where fibrous dysplasia has occurred;
[0044] Induces maturation of osteoblasts in tissues where fibrous dysplasia has occurred; and
[0045] Induces bone mineralization in tissues where fibrous dysplasia occurs.
[0046] As an example,
[0047] Inhibition of fibrosis in tissues with fibrous dysplasia can be measured by:
[0048] After administration of a pharmaceutical composition for treating fibrous dysplasia, the expression of selected biomarkers among COL1A1, COL3A1, and TGFβ1 is reduced.
[0049] As an example,
[0050] Induction of osteoblast maturation in tissues with fibrous dysplasia can be measured by one or more of the following:
[0051] Decreased alkaline phosphatase (ALP) staining intensity after administration of a pharmaceutical composition for the treatment of fibrous dysplasia of the stomach;
[0052] RUNX2 expression is reduced after administration of a pharmaceutical composition for the treatment of fibrous dysplasia; and
[0053] Increased expression of selected biomarkers among OCN, DMP1, and SOST after administration of a pharmaceutical composition for the treatment of fibrous dysplasia.
[0054] As an example,
[0055] Induction of bone mineralization in tissues affected by fibrous dysplasia can be measured by:
[0056] Increased Alizarin Red S (ARS) staining intensity after administration of a pharmaceutical composition for the treatment of fibrous dysplasia.
[0057] As an example,
[0058] Fibrous dysplasia can be caused by mutations in the GNAS gene in bone marrow mesenchymal stem cells (BMSCs).
[0059]
[0060] Hereinafter, the present invention will be described in more detail through specific embodiments and examples with reference to the attached drawings. It should be noted that the attached drawings include some, but not all, embodiments of the invention. The invention disclosed by this specification may be implemented in various ways and is not limited to the specific embodiments described herein. These embodiments are provided to satisfy the legal requirements applicable to this specification. Those skilled in the art will be able to think of many modifications and other embodiments of the invention disclosed herein. Therefore, the invention disclosed herein is not limited to the specific embodiments described herein, and it should be understood that modifications and other embodiments thereof are also included within the scope of the claims.
[0061] Fibrous Dysplasia (FD)
[0062] Overview of fibrous dysplasia
[0063] Fibrous dysplasia is a rare inherited bone disorder in which normal bone tissue is replaced by fibrous connective tissue. This disorder can lead to various complications, including bone deformities, pathological fractures, and chronic pain. Lesions can occur in a single bone (monostotic) or multiple bones (polyostotic), and in severe cases, can lead to functional problems such as facial bone hypertrophy, hearing, and visual impairment. The pathological hallmark of the disorder is immature, irregular bone trabeculae and an overabundant collagenous fibrous matrix, interspersed with undifferentiated osteoblasts and fibroblasts. This impedes normal bone remodeling and perpetuates immature bone formation.
[0064] GNAS gene mutation
[0065] Fibrous dysplasia is most often caused by somatic mutations in the GNAS gene, which arise in bone marrow-derived mesenchymal stem cells (BMSCs). This mutation constitutively activates Gα_s proteins, leading to excessive cAMP production, which in turn activates various abnormal signaling pathways. As a result, the normal osteogenic differentiation pathway is blocked; preosteoblasts remain immature; some cells differentiate into fibroblasts; and these fibroblasts continuously express fibrogenic factors such as TGF-β, COL1A1, COL3A1, and POSTN, forming a dense fibrous matrix. This tissue remodeling is a major factor in the disruption of the functional and mechanical stability of normal bone tissue.
[0066] There is no appropriate treatment
[0067] To date, there is no clear treatment for fibrous dysplasia other than surgical removal of the fibromas. Bisphosphonates, denosumab, tocilizumab, and other bone resorption inhibitors, as well as analgesics such as tanezumab and anti-BDNF antibodies, are being studied as potential treatments, but they all focus solely on symptom relief. No treatments have yet been developed that directly modulate pathological matrix formation and osteogenic differentiation abnormalities. Furthermore, the rarity of the disease and limited patient populations present challenges in clinical trials and validation.
[0068] Use of Vitamin D in the Treatment of Fibrous Dysplasia
[0069] Overview of the Uses of Vitamin D in the Treatment of Fibrous Dysplasia
[0070] This specification discloses the use of vitamin D in the treatment of fibrous dysplasia. Vitamin D, by intervening in a wide range of abnormal signaling pathways found in fibrous dysplasia tissue, restores the affected tissue to a normal state. Specifically, when administered to fibrous dysplasia-affected tissue, vitamin D inhibits excessive production of cAMP; promotes osteogenic differentiation and osteoblast maturation; promotes normal bone mineralization; inhibits fibroblast differentiation; and prevents fibroblasts from acting to cause tissue fibrosis. Vitamin D is essential for humans, has a proven safety profile in various diseases, and has the advantage of targeting and treating the fundamental pathological characteristics of fibrous dysplasia.
[0071] Vitamin D
[0072] This specification discloses vitamin D as an active ingredient in the treatment of fibrous dysplasia. Vitamin D can exist in several forms. For example, it can be inactive forms, such as vitamin D2 (ergocalciferol) or vitamin D3 (cholecalciferol); the active precursor, 25-hydroxyvitamin D (25(OH)D); or the active form, 1,25-dihydroxyvitamin D (1,25(OH)2D₃). Since vitamin D can be converted to its active form in the body, the form of vitamin D included in the treatment is not limited to a specific one.
[0073] Inhibition of cAMP overproduction
[0074] When vitamin D is administered to tissue affected by fibrous dysplasia, excessive cAMP production is suppressed, returning to normal levels. Given that fibrous dysplasia is caused by an abnormal signaling pathway driven by excessive cAMP production, this represents a direct therapeutic effect that can control osteogenic differentiation abnormalities.
[0075] Promotion of pre-osteogenic differentiation and osteoblast maturation
[0076] When vitamin D is administered to tissues affected by fibrous dysplasia, the pre-osteodifferentiation stage and osteoblast maturation are promoted, resulting in the formation of normal bone tissue. For example, in fibrous dysplasia-affected tissues administered with vitamin D, the expression of the early osteogenic marker RUNX2 (Runt-related transcription factor 2) is suppressed, and the expression of late osteogenic markers OCN (OsteoCalciN), DMP1 (Dentin Matrix Protein 1), and SOST (SclerOSTin) is restored to normal levels. This means that vitamin D administration promotes the differentiation of pre-osteoblasts into mature osteoblasts, thereby restoring normal bone tissue.
[0077] Promotes bone cell mineralization
[0078] When vitamin D is administered to tissue affected by fibrous dysplasia, it promotes bone cell mineralization, thereby restoring normal bone tissue.
[0079] Inhibition of bone tissue fibrosis
[0080] When vitamin D is administered to tissues affected by fibrous dysplasia, bone fibrosis is inhibited. Specifically, the differentiation of preosteoblasts into fibroblasts is inhibited; the differentiation of fibroblasts into preosteoblasts is promoted; the proliferation and migration of profibrotic fibroblasts are suppressed; collagen accumulation is inhibited; and the expression of other fibrosis-related markers is suppressed.
[0081] Benefit #1 of Vitamin D as a Therapeutic Ingredient - Directly Involved in the Pathogenesis of Fibrous Dysplasia
[0082] As mentioned above, vitamin D is extensively involved in the pathogenesis and progression of fibrous dysplasia. Vitamin D can suppress the underlying causes of fibrous dysplasia and promote normal bone formation, thereby addressing the underlying causes of the disease. Therefore, vitamin D can be used as a direct treatment for fibrous dysplasia.
[0083] Benefit #2 of Vitamin D as a Therapeutic Ingredient - Proven Safety
[0084] Vitamin D has already proven its safety and effectiveness in treating a variety of diseases. Furthermore, its relatively low side effects, even with long-term use, make it an excellent treatment option.
[0085] Benefit #3 of Vitamin D as a Therapeutic Ingredient - Non-surgical Treatment Possible
[0086] As mentioned above, the only effective treatment for fibrous dysplasia is surgery to remove the affected tissue. In contrast, vitamin D can be administered orally or by injection, making it a non-surgical treatment option. This reduces the burden on patients and increases access to treatment.
[0087] Pharmaceutical composition for treating fibrous dysplasia comprising vitamin D
[0088] This specification discloses a pharmaceutical composition for the treatment of fibrous dysplasia, comprising vitamin D. The pharmaceutical composition comprises a therapeutically effective amount of vitamin D and a pharmaceutically acceptable carrier. The specific composition is disclosed in the [Possible Embodiments of the Invention] section.
[0089] Treatment of fibrous dysplasia using vitamin D
[0090] This specification discloses a method for treating fibrous dysplasia using vitamin D. The method comprises administering vitamin D to a patient with fibrous dysplasia. Specific details are disclosed in the [Possible Embodiments of the Invention] section.
[0091]
[0092] [Possible embodiments of the invention]
[0093] Fibrous dysplasia
[0094] Example 1, fibrous dysplasia
[0095] Fibrous dysplasia.
[0096] Example 2: Fibrous dysplasia due to GNAS mutation
[0097] In Example 1,
[0098] Fibrous dysplasia is caused by mutations in the GNAS gene in bone marrow mesenchymal stem cells (BMSCs).
[0099] Example 3, Symptoms of fibrous dysplasia
[0100] In any one of Examples 1 and 2,
[0101] Vitamin D
[0102] Example 4, Vitamin D
[0103] Vitamin D.
[0104] Example 5, Form of Vitamin D
[0105] In Example 4, the above vitamin D is one or more selected from the following:
[0106] Vitamin D1; Vitamin D2, or ergocalciferol; Vitamin D3, cholecalciferol; Vitamin D4, or 22-dihydroergocalciferol; Vitamin D5, or sitocalciferol; 25-hydroxyvitamin D (25(OH)D); and 1,25-dihydroxyvitamin D3, or calcitriol.
[0107] Treatment Mechanism for Fibrous Dysplasia #1 - Inhibition of Fibrosis
[0108] Example 6: Anti-fibrosis treatment mechanism
[0109] A mechanism for treating fibrous dysplasia by inhibiting fibrosis in tissues where fibrous dysplasia has occurred.
[0110] Example 7: Specific treatment mechanism
[0111] In Example 6, the inhibition of gastric fibrosis means one or more mechanisms selected from the following:
[0112] Inhibits fibrogenic differentiation; transforms fibroblasts into pre-osteoblasts; inhibits fibroblast differentiation into pro-fibrotic fibroblasts; inhibits the activity of pro-fibrotic fibroblasts; and inhibits collagenous matrix deposition.
[0113] Example 8, Activation of pro-fibrotic fibroblasts
[0114] In Example 7, the activity of the pro-fibrotic fibroblasts is at least one selected from the following:
[0115] Differentiate into pro-fibrotic fibroblasts; Pro-fibrotic fibroblasts migrate to other locations; and synthesize collagen.
[0116] Example 9: Evidence of a therapeutic mechanism for anti-fibrosis
[0117] In any one of Examples 6 to 8, the mechanism is measured by one or more selected from the following:
[0118] Decreased COL1A1 expression in tissues with fibrous dysplasia; decreased COL3A1 expression in tissues with fibrous dysplasia; decreased TGFβ1 expression in tissues with fibrous dysplasia; decreased numbers of fibroblasts and / or pro-fibrotic fibroblasts in tissues with fibrous dysplasia; increased numbers of osteoblastic precursor cells in tissues with fibrous dysplasia.
[0119] Treatment Mechanism for Fibrous Dysplasia #2 - Induction of Osteoblast Differentiation
[0120] Example 10: Treatment mechanism for inducing osteoblast differentiation
[0121] A mechanism for treating fibrous dysplasia by inducing osteoblast differentiation in tissues where fibrous dysplasia has occurred.
[0122] Example 11: Specific treatment mechanism
[0123] In Example 10, the induction of osteoblast differentiation refers to one or more mechanisms selected from the following:
[0124] Induces osteogenic differentiation; and induces osteoblast maturation.
[0125] Example 12: Evidence of induction of osteoblast differentiation
[0126] In any one of Examples 10 to 11, the mechanism is measured by one or more selected from the following:
[0127] Decreased expression of Runt-related transcription factor 2 (RUNX2) in tissues with fibrous dysplasia; decreased expression of ALkaline Phosphatase (ALP) in tissues with fibrous dysplasia; increased expression of OsteoPontiN (OPN) in tissues with fibrous dysplasia; increased expression of OsteoCalciN (OCN) in tissues with fibrous dysplasia; increased expression of Dentin Matrix Protein 1 (DMP1) in tissues with fibrous dysplasia; and increased expression of SclerOSTin (SOST) in tissues with fibrous dysplasia;
[0128] Treatment Mechanism for Fibrous Dysplasia #3 - Inducing Bone Mineralization
[0129] Example 13, Induction of bone mineralization
[0130] A mechanism for treating fibrous dysplasia by inducing bone mineralization in tissues where fibrous dysplasia has occurred.
[0131] Example 14, Evidence of Induction of Bone Mineralization
[0132] In Example 13, the induction of bone mineralization is measured by one or more selected from the following:
[0133] Increased calcium concentration in tissues with fibrous dysplasia. Increased Alizarin Red S (ARS) staining intensity in tissues with fibrous dysplasia.
[0134] Pharmaceutical composition for treating fibrous dysplasia comprising vitamin D
[0135] Example 15, Pharmaceutical composition for treating fibrous dysplasia
[0136] A pharmaceutical composition for treating fibrous dysplasia according to any one of Examples 1 to 3, comprising:
[0137] A therapeutically effective amount of vitamin D of any one of Examples 4 to 5; and
[0138] Pharmaceutically acceptable carrier.
[0139] Example 16, therapeutic mechanism
[0140] In Example 15, the pharmaceutical composition induces one or more therapeutic mechanisms selected from the following in tissues in which fibrous dysplasia has occurred:
[0141] Any one of Examples 6 to 9, a mechanism of inhibition of fibrosis;
[0142] Any one of Examples 10 to 12, a mechanism for inducing osteoblast differentiation; and
[0143] A mechanism of inducing bone mineralization according to any one of Examples 13 to 14.
[0144] Example 17, Pharmaceutically acceptable carrier limitation
[0145] In any one of Examples 15 to 16, the pharmaceutically acceptable carrier is selected from the following:
[0146] Binders such as lactose, saccharose, sorbitol, mannitol, starch, amylopectin, cellulose, or gelatin; excipients such as dicalcium phosphate; disintegrants such as corn starch or sweet potato starch; lubricants such as magnesium stearate, calcium stearate, sodium stearyl fumarate, or polyethylene glycol wax; sweeteners; flavoring agents; syrups; liquid carriers such as fatty oils; water; sterile aqueous solutions; propylene glycol; polyethylene glycol; injectable esters such as ethyl oleate; suspending agents; emulsions; lyophilized preparations; preparations for external use; stabilizers; buffers; animal oils; vegetable oils; waxes; paraffin; starches; tragacanth; cellulose derivatives; polyethylene glycols; silicones; bentonites; silica; talc; zinc oxide; or suitable combinations of the above substances.
[0147] Treatment of fibrous dysplasia using vitamin D
[0148] Example 18, Method for treating fibrous dysplasia
[0149] Treatment of fibrous dysplasia, including:
[0150] A process of administering to a patient with fibrous dysplasia any one selected from Examples 4 to 5 or any one selected from Examples 15 to 17.
[0151] Example 19, therapeutic mechanism
[0152] In Example 18, by administering to a patient with fibrous dysplasia any one selected from Examples 4 to 5 or any one selected from Examples 15 to 17, the following selected therapeutic mechanism is induced:
[0153] Any one of Examples 6 to 9, a mechanism of inhibition of fibrosis;
[0154] Any one of Examples 10 to 12, a mechanism for inducing osteoblast differentiation; and
[0155] A mechanism of inducing bone mineralization according to any one of Examples 13 to 14.
[0156] Method for inducing a therapeutic mechanism for fibrous dysplasia using vitamin D
[0157] Example 20, method for inhibiting fibrosis
[0158] A method for inhibiting fibrosis in a tissue in which fibrous dysplasia has occurred, comprising:
[0159] A process of administering to a patient with fibrous dysplasia any one selected from Examples 4 to 5, or any one selected from Examples 15 to 17;
[0160] Here, the above fibrosis inhibition is any one selected from Examples 6 to 9.
[0161] Example 21, Induction of osteoblast differentiation
[0162] A method for inducing osteoblast differentiation in tissues with fibrous dysplasia, comprising:
[0163] A process of administering to a patient with fibrous dysplasia any one selected from Examples 4 to 5, or any one selected from Examples 15 to 17;
[0164] Here, the above osteoblast differentiation induction is any one selected from Examples 10 to 12.
[0165] Example 22, Induction of bone mineralization
[0166] A method for inducing bone mineralization in tissues with fibrous dysplasia, comprising:
[0167] A process of administering to a patient with fibrous dysplasia any one selected from Examples 4 to 5, or any one selected from Examples 15 to 17;
[0168] Here, the above bone mineralization induction is any one selected from Examples 10 to 12.
[0169]
[0170] [Experimental Example]
[0171] Hereinafter, the invention provided by this specification will be described in more detail through experimental examples and examples. These examples are intended solely to illustrate the subject matter disclosed by this specification, and it will be apparent to those skilled in the art that the scope of the subject matter disclosed by this specification is not limited by these examples.
[0172] Experimental Example 1. Experimental Method and Materials
[0173] Experimental Example 1.1. Obtaining Human-Derived Tissue
[0174] Fresh tissue samples were obtained from five patients with craniofacial fibrous dysplasia who underwent surgical resection of the lesion. Normal craniofacial bone samples were obtained from healthy volunteers who underwent cosmetic facial contouring surgery.
[0175] The collection and use of surgical tissues for research purposes was performed in accordance with the approved research plan by the Seoul National University Bundang Hospital Institutional Review Board (B-2111-718-302) and the Samsung Medical Center Institutional Review Board (2021-12-025).
[0176] The demographic and clinical characteristics of the donors are presented in the table below.
[0177] DiagnosisDonorGenderAgeSiteFibrous DysplasiaR1M18Nasal cavity / maxillary sinusFibrous DysplasiaR2M19ZygomaticomaxillaryFibrous DysplasiaR3F25Hemiface / mandibleFibrous DysplasiaR4M12MandibleFibrous DysplasiaR5M14Forehead / upper orbitNoneH1F28Zygomatic / mandibleNoneH2F23Hemiface / mandibleNoneH3M22Zygomatic / mandibleNoneH4M19Zygomatic / mandibleNoneH5F25Zygomatic / hemiface
[0178] R = patients with fibrous dysplasia, H = healthy volunteers
[0179] Experimental Example 1.2. Tissue Disintegration and Cell Separation
[0180] Fresh lesion tissue samples collected according to Experimental Example 1.1 were finely chopped and digested with 2 mg / mL collagenase D solution (Roche, Mannheim, Germany) in culture medium (Dulbecco's Modified Eagle Medium (DMEM; Gibco Life Technologies, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS) and 1% antibiotic-antimycotic mixture). The digestion process was performed with gentle shaking at 37°C for 4 h. The obtained cell suspension was then filtered through a 70 μm cell strainer, treated with 1x RBC Lysis Buffer (Invitrogen, San Diego, CA, USA), and then cryopreserved or cultured in T-shaped flasks at a density of 3 x 10^5 cells per flask.
[0181] Undigested residues were retained in growth medium for primary explant culture. Approximately two weeks after tissue attachment, cells were harvested and cryopreserved or re-plated onto new culture dishes.
[0182] Normal bone tissue samples, intended as controls, were used to isolate bone marrow-derived mesenchymal stromal cells (BMSCs). Bone marrow was scraped from the basal medium, pipetted, and serially passed through needles of increasingly smaller diameters. Cells were then cryopreserved or replated for culture.
[0183] Experimental Example 1.3. Organoid Culture
[0184] About 5 Х 10 FD patient-derived cells or normal cells according to Experimental Example 1.2 4 Dogs were mixed with Corning® Matrigel® Matrix for Organoid Culture (BD Biosciences, San Jose, CA, USA) at a 1:1 volume ratio and placed in ultra-low attachment 6-well plates (Stemcell Technologies, Vancouver, BC, Canada). The plates were allowed to polymerize for 30 min at 37°C in an incubator with 5% CO2. After culturing in growth medium for 5 days, 10 nM parathyroid hormone (PTH) was treated to stimulate cAMP production, and differentiation was performed for 21 days in osteogenic differentiation induction (OI) medium (DMEM, 10% FBS, 10 nM dexamethasone, 50 μg / mL ascorbic acid, 10 mM sodium β-glycerophosphate, 1% antibiotic-antimycotic). According to the experimental group, 100 μM 1,25(OH)2D₃ was treated to the organoid osteogenic differentiation medium formed for 5 days.
[0185] Experimental Example 1.4. mRNA Extraction and RT-qPCR
[0186] Cells prepared according to Experimental Example 1.2 were seeded at 2 Х 10 per well. 5 Cells were plated in 6-well plates at a density of 100 μg / cm. After the cells were allowed to attach for 24 hours, different substances were treated according to the cell population in the growth medium. mRNA of each cell population according to the experimental example was extracted, and cDNA was synthesized using the cDNA Synthesis Kit from Thermo Scientific (Waltham, MA, USA). mRNA expression was quantified by real-time PCR (RT-PCR) using Power SYBR Green® PCR Master Mix on a QuantStudio® 7 Flex PCR System (Applied Biosystems, Waltham, MA, USA). The primers used to quantify each gene are shown in the table below.
[0187] Gene NameForward Primer (5'-to-3')Reverse Primer (5'-to-3')COL1A1GTGCGAATGACGTGATCTGTGA(SEQ ID NO: 1)CGGTGGTTTCTTGGTCGGT(SEQ ID NO: 9)COL3A1TGGTCTGCAAGGAATGCCTGGA(SEQ ID NO: 2)TCTTTCCCTGGGACACCATCAG(SEQ ID NO: 10)TGFβ1TCGCCAGAGTGGTTTATCTT(SEQ ID NO: 3)TAGTGAACCCGTTGATGTCC(SEQ ID NO: 11)RUNX2TGGTTACTGTCATGGCGGGTA(SEQ ID NO: 4)TCTCAGATCGTTGAACCTTTGCTA(SEQ ID NO: 12)OCNCACTCCTCGCCCTATTGGC(SEQ ID NO: 5)CCCTCCTGCTTGGACACAAAG(SEQ ID NO: 13)DMP1GATCAGCATCCTGCTCATGTT(SEQ ID NO: 6)AGCCAAATGACCCTTCCATTC(SEQ ID NO: 14)SOSTCCCTTTGAGACCAAAGACGTG(SEQ ID NO: 7)GGCCCATCGGTCACGTAG(SEQ ID NO: 15)GAPDHACAGTTGCCATGTAGACC(SEQ ID NO: 8)TTTTTGGTTGAGCACAGG(SEQ ID NO: 16)
[0188] 실험예 1.5. 상처 치유 분석(Wound Healing Assay)
[0189] 세포를 12-웰 플레이트의 웰 당 5 to 10 4Cells were plated at a density of 100 μL and cultured until they contacted each other (confluence was reached). A 200 μL pipette tip was then used to create a uniform scratch on the cell monolayer. The cells were washed with phosphate-buffered saline (PBS) and treated with different substances according to the cell population in growth medium. Images were captured using an inverted microscope at 0 and 16 hours after wounding. Cell migration rate was measured using ImageJ software (version 1.
[0190] The wound area was measured using 54i) and the wound closure rate (%) was expressed as the closed ratio compared to the initial wound area.
[0191] Experimental Example 1.6. Proliferation Assay
[0192] Cells were plated at a density of 5 Х 10³ per well in a 96-well plate, allowed to adhere for 24 hours, and then treated with different substances according to the cell group in growth medium. After 24 hours, the proliferation rate was evaluated using MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) solution (Invitrogen). Specifically, cells were reacted with 0.5 mg / mL MTT solution at 37 °C for 4 hours, and the produced formazan crystals were dissolved in DMSO (dimethyl sulfoxide) and the absorbance was measured at 570 nm.
[0193] Experimental Example 1.7. Immunofluorescence Analysis
[0194] Cells were seeded at 5 Х 10 per well in 12-well plates 4Cells were plated at a density of 10 μg / cm and allowed to adhere for 24 hours. Then, different substances were treated according to the cell group in growth medium. After 8 hours, the cells were fixed with 4% paraformaldehyde for 10 minutes at room temperature, permeabilized with 0.5% Triton X-100, and blocked with UltraCruz® blocking reagent (Santa Cruz Biotech, Santa Cruz, CA, USA) for 30 minutes at room temperature. Then, the primary antibodies (anti-COL1, anti-COL3, anti-TGFβ1; all from Santa Cruz, 1:100 dilution in blocking solution) were reacted overnight at 4 °C. The following day, the secondary antibodies labeled with Alexa Fluor® (Invitrogen, 1:250 dilution in blocking solution) were reacted for 1 hour at room temperature, and then the cells were mounted with Vectashield mounting medium (VMR) containing DAPI. After mounting and stabilization overnight, final fluorescence images were taken using a Zeiss LSM800 confocal microscope.
[0195] Experimental Example 1.8. Alkaline Phosphatase Assay
[0196] Cells were plated at a density of 5 × 10³ per well in a 96-well plate and cultured in growth medium until 60% confluence was reached. They were then treated with 100 nM 1,25(OH)2D₃ or 100 nM PGE2 in osteogenic differentiation induction medium (DMEM + 10% FBS, 10 nM dexamethasone, 50 μg / mL ascorbic acid, 10 mM sodium β-glycerophosphate, 1% antibiotic-antimycotic). Fresh medium was replaced every 3 days, and this treatment was continued for 2 weeks. Cells were fixed with 4% paraformaldehyde for 10 minutes at room temperature and then reacted with ALP staining solution (Takara Bio, Tokyo, Japan) for 30 minutes. Stained cells were observed under an optical microscope, and for quantitative analysis, the dye was eluted from the stained cells with DMSO, and the absorbance of the eluate was measured using a spectrophotometer.
[0197] Experimental Example 1.9. Alizarin Red S Assay
[0198] ARS analysis was performed by culturing and processing cells in the same manner as the ALP analysis according to Experimental Example 1.8, but with a longer osteogenic differentiation induction period of 3 weeks. Cells were fixed with 4% paraformaldehyde for 10 minutes and then reacted with 2% Alizarin Red S solution (VWR International, Radnor, PA, USA) for 1 hour. The stained cells were observed under a light microscope, and the degree of calcium deposition was assessed by the red-stained mineral nodules. Quantitative analysis was performed by eluting the dye with DMSO and measuring its absorbance, as in the ALP analysis.
[0199] Example 1.10. Statistical Analysis
[0200] Statistical analysis and data visualization were performed using GraphPad Prism 8. Statistical significance was tested using one-way ANOVA, and all quantitative results are presented as the mean ± standard deviation of five independent experiments (each experiment was performed in triplicate unless otherwise specified). A p value less than 0.05 was considered statistically significant.
[0201] Experimental Example 2. Confirmation of the therapeutic effect of vitamin D on cells derived from patients with fibrous dysplasia.
[0202] Experimental Example 2.1. Experimental Overview and Experimental Groups
[0203] For cells derived from patients with fibrous dysplasia and normal cells obtained according to Experimental Examples 1.1 and 1.2, changes accompanying the pathogenesis of fibrous dysplasia, such as expression of factors related to fibrous dysplasia, cell mobility and proliferation, were extensively observed by treating with vitamin D.
[0204] Each cell type is as follows: Normal = bone marrow-derived mesenchymal stromal cells (BMSCs) isolated from normal bone tissue samples according to Experimental Example 1.2; and FD: cells derived from fibrous dysplasia lesion tissues according to Experimental Example 1.2.
[0205] In addition, cells were divided into the following groups according to the substances treated: Control = control group without any treatment; 1,25D3 = cell group treated with 100 nM vitamin D, specifically 1,25(OH)2D₃; PEG2 = cell group treated with 10 nM prostaglandin E2 (PGE₂); and PEG2 + 1,25D3 = cell group treated with 100 nM 1,25(OH)2D₃ and 10 nM prostaglandin E2 together.
[0206] For example, in the case of the Normal, 1,25D3 cell group, it refers to a cell group treated with 100 nM 1,25(OH)2D₃ in bone marrow-derived cells isolated from a normal bone tissue sample.
[0207] The timing of material treatment to each cell followed each method of Experimental Example 1.
[0208] Experimental Example 2.2. cAMP Quantitative Analysis Experiment
[0209] cAMP protein expression levels were purified from FD cells derived from individual patients. Specifically, proteins isolated from FD cells treated with vitamin D (1,25(OH)2D₃) and untreated control cells using 0.1 M HCl / 0.5% Triton X-100 were quantified and compared using a cAMP assay kit (ab65355; Abcam, Boston, MA, USA).
[0210] The experimental results are shown in the following table:
[0211] Control (pmole / mg)1,25(OH)2D3(pmol / mg)FD1409.35312.20FD2661.32374.82FD3277.94186.77
[0212] Experimental results showed that cAMP expression was high in FD cells (Control), indicating that patient-derived cells can induce fibrous dysplasia. Furthermore, cAMP expression was significantly reduced in cells treated with vitamin D, suggesting that vitamin D may exert its therapeutic effect in fibrous dysplasia by suppressing cAMP expression itself. Experimental Example 2.3. Analysis of Fibrotic Factor Expression
[0213] Each cell group was treated according to Experimental Example 1.4 to confirm the expression level of mRNA related to fibrous dysplasia, and immunofluorescence analysis was performed according to Experimental Example 1.7 to compare the expression levels of fibrogenic factors.
[0214] The experimental results are shown in Figs. 2 to 6. Histological analysis of FD cells showed that the expression of major pro-fibrotic markers, COL1, COL3, and TGFβ1, was significantly increased compared to normal cells (Figs. 2 and 3). Under low-dose stimulation with PGE2, the expression of these markers was significantly increased, which was effectively suppressed by 1,25(OH)2D₃ treatment. This difference was particularly evident in FD cells, which showed a stronger fibrotic phenotype than normal cells. Analysis of mRNA expression levels also confirmed these histological observations, and treatment with 1,25(OH)2D₃ significantly suppressed the expression profiles of COL1A1, COL3A1, and TGFβ1 (Figs. 4 to 6).
[0215] Experimental Example 2.4. Wound Healing and Proliferation Analysis
[0216] To elucidate the regulatory effect of 1,25(OH)2D₃ on the fibrosis-promoting phenotype, wound healing and proliferation analyses were performed by treating each cell group according to Experimental Examples 1.5 and 1.6.
[0217] The experimental results are shown in Figures 7 to 9. The migration analysis results showed that FD cells had higher mobility than normal cells, with both the migration distance and speed increasing (Figures 7 and 8). When FD cells were treated with vitamin D, the migration ability of FD-derived cells was significantly reduced regardless of the presence or absence of PGE2 stimulation. The proliferation analysis results showed that FD cells had an increased proliferation ability compared to normal cells, and that this proliferation ability was significantly inhibited when vitamin D was administered to FD cells (Figure 9).
[0218] These results demonstrate that vitamin D effectively inhibits proliferation and motility of FD cells, suggesting that vitamin D may be utilized to alleviate the pro-fibrotic phenotype associated with FD.
[0219] Experimental Example 2.5. ALP and ARS Analysis
[0220] ALP analysis and ARS analysis were performed for each cell group according to Experimental Examples 1.8 and 1.9.
[0221] The experimental results are shown in Figs. 10 and 11.
[0222] ALP analysis revealed that FD cells administered with vitamin D exhibited significantly lower ALP activity compared to FD cells not administered with vitamin D (Fig. 10). This suggests suppression of hyperactivity, suggesting that vitamin D can effectively alleviate hyperactivity in FD-derived cells and normalize the osteogenic differentiation process.
[0223] ARS analysis revealed that mineralization significantly increased in FD cells administered with vitamin D compared to FD cells not administered with vitamin D, as confirmed by increased ARS staining intensity (Fig. 11). Vitamin D administration significantly enhanced the mineralization capacity of FD cells, suggesting that vitamin D may promote the formation of mineralized bone tissue in FD lesion-affected tissues, thereby reconstructing bone tissue.
[0224] Experimental Example 2.6. Analysis of Bone Formation Marker Expression
[0225] Each cell group was treated according to Experimental Example 1.4 to confirm the mRNA expression level of bone formation markers.
[0226] The experimental results are shown in Figures 12 to 17. FD cells showed higher expression of RUNX2 (Runt-related transcription factor 2), an early bone formation marker, than normal cells, but the expression level was significantly suppressed when vitamin D was administered. On the other hand, FD cells showed lower expression of osteocalcin (OCN), dentin matrix protein 1 (DMP1), and sclerostin (SOST), which are late bone formation markers, than normal cells, but the expression level was restored to normal cells when vitamin D was administered.
[0227] OCN, DMP1, and SOST are key components of the ECM of bone tissue and are synthesized by mature osteoblasts during late osteogenesis. Therefore, their increased expression suggests that FD-derived cells transition to a mature osteoblast / osteocyte phenotype after vitamin D treatment. These results suggest that vitamin D induces differentiation and maturation of FD-derived cells toward an osteogenic phenotype, which may contribute to normal bone remodeling and mineralization recovery in the tissue.
[0228] Experimental Example 3. Confirmation of the therapeutic effect of vitamin D on organoids derived from patients with fibrous dysplasia.
[0229] Experimental Example 3.1 Experimental Overview and Experimental Groups
[0230] Organoids of cells derived from FD patients or normal cells were prepared according to Experimental Example 1.3, and the effects of vitamin D administration were confirmed. The FD patient-derived organoids were prepared with reference to the contents disclosed in the paper Kim, H.-Y., Charton, C., Shim, JH, Lim, SY, Kim, J., Lee, S., Ohn, JH, Kim, BK, & Heo, CY (2024). Patient-Derived Organoids Recapitulate Pathological Intrinsic and Phenotypic Features of Fibrous Dysplasia. Cells, 13(9), 729. https: / doi.org / 10.3390 / cells13090729 (hereinafter referred to as Kim et al.).
[0231] According to Kim et al., scRNA-seq analysis of FD patient-derived organoids revealed diverse cell types, including fibroblasts (two types), myofibroblasts, osteoblasts, proliferating cells (G1 / S and G2 / M), myogenic cells, macrophages, and dendritic cells. Furthermore, the scRNA-seq analysis revealed molecular markers and an environment similar to those of FD lesion-bearing tissues. Therefore, these FD patient-derived organoids are suitable for use as model tissues for FD lesions.
[0232] Organoid experimental groups are divided as follows: Normal cell organoid control group (Normal Control); Organoids treated with 1,25(OH)2D₃ on day 5 of normal cell organoid formation (Spheroid stage) (Normal 1,25D3); FD patient-derived organoid control group (FD, Control); Organoids treated with 1,25(OH)2D₃ on day 5 of FD patient-derived organoid formation (Spheroid stage) (FD 1,25D3).
[0233] Experimental Example 3.2. Determining Osteogenesis in Organoid Models
[0234] For each organoid in Experimental Example 3.1, immunofluorescence analysis was performed with reference to Experimental Example 1.7.
[0235] The experimental results are shown in Fig. 18. Immunofluorescence analysis results, similar to Experimental Example 2.3, confirmed that the expression of COL1, COL3, and TGFβ1 was significantly reduced in FD-derived organoids after vitamin D treatment. This suggests that vitamin D inhibits the expression of fibrogenic factors and prevents the accumulation of abnormal fibrous tissue in FD lesions.
[0236] Experimental Example 3.3. Determining Mineralization in Organoid Models
[0237] For each organoid in Experimental Example 3.1, ALP analysis and ARS analysis were performed with reference to Experimental Example 1.8 and Experimental Example 1.9.
[0238] The experimental results are shown in Figs. 19 to 21. As a result of evaluating ALP activity, similar to Experimental Example 2.5, the activity of FD organoids treated with vitamin D was significantly lower than that of FD organoids not treated (Fig. 20). This indicates that the activity of osteoblasts was normalized. As a result of ARS staining, similar to Experimental Example 2.5, FD organoids treated with vitamin D showed higher formation of mineralized bone tissue than FD organoids not treated with vitamin D (Fig. 21). This indicates that vitamin D promotes osteogenesis in FD organoids.
[0239]
[0240] This specification discloses vitamin D as an active ingredient with therapeutic effects against fibrous dysplasia. Specifically, it provides uses of vitamin D for the treatment of fibrous dysplasia. As disclosed in this specification, vitamin D can be used for the treatment of fibrous dysplasia.
Claims
1. A pharmaceutical composition for the treatment of fibrous dysplasia comprising: Vitamin D; and Pharmaceutically acceptable carrier.
2. A pharmaceutical composition for treating fibrous dysplasia, wherein the vitamin D in the first paragraph is 1,25-dihydroxyvitamin D3.
3. In the first paragraph, the pharmaceutical composition for treating fibrous dysplasia has a function selected from the following: Inhibits fibrosis in tissues where fibrous dysplasia has occurred; Induces maturation of osteoblasts in tissues where fibrous dysplasia has occurred; and Induces bone mineralization in tissues where fibrous dysplasia occurs.
4. In paragraph 3, Inhibition of fibrosis in tissues with fibrous dysplasia was measured by: After administration of a pharmaceutical composition for treating fibrous dysplasia, the expression of selected biomarkers among COL1A1, COL3A1, and TGFβ1 is reduced.
5. In paragraph 3, Induction of osteoblast maturation in tissues with fibrous dysplasia is measured by one or more of the following: Decreased alkaline phosphatase (ALP) staining intensity after administration of a pharmaceutical composition for the treatment of fibrous dysplasia of the stomach; RUNX2 expression is reduced after administration of a pharmaceutical composition for the treatment of fibrous dysplasia; and Increased expression of selected biomarkers among OCN, DMP1, and SOST after administration of a pharmaceutical composition for the treatment of fibrous dysplasia.
6. In paragraph 3, Induction of bone mineralization in tissues affected by fibrous dysplasia was measured by: Increased Alizarin Red S (ARS) staining intensity after administration of a pharmaceutical composition for the treatment of fibrous dysplasia.
7. In paragraph 1, Fibrous dysplasia is caused by mutations in the GNAS gene in bone marrow mesenchymal stem cells (BMSCs).
Citation Information
Patent Citations
Pharmarceutical composition for preventiing or treating of bone related disorder
KR1020180131964A
Checking printout at host device
KR1020240032422A