Novel lactic acid bacteria and use thereof

Abstract

The present invention relates to the novel lactic acid bacteria Lactococcus lactis P22 KCCM 13443P, Bifidobacterium longum P26 KCCM 13444P, or a mixture thereof, and a use thereof. The strains and the mixture thereof, according to the present invention, may be usefully employed for the prevention, treatment, or mitigation of inflammatory disease, respiratory disease, or mental disorder.

Description

Novel lactic acid bacteria and their uses

[0001] The present invention relates to novel lactic acid bacteria, Lactococcus lactis P22 KCCM 13443P, Bifidobacterium longum P26 KCCM 13444P or a mixture thereof, and their uses.

[0002] Clostridium difficile (C. difficile) secretes toxins A and B, which can damage intestinal cells and mucosa or cause inflammation, and in severe cases, can lead to death. Even after using first-line treatment (metronidazole, vancomycin) and second-line treatment (fidaxomicin, nitazoxanide), the relapse rate is high, and patients are prone to a vicious cycle of repeated administration and side effects. Although fecal transplantation (FMT), which is highly resistant to patients, and expensive processed preparations (Rebyota, Vowst, etc.) have emerged as alternatives, there are high barriers to securing a supply source and cost, so there is a need to discover precise lactic acid bacteria that can reduce relapse and reduce the economic burden.

[0003] Clostridium symbiosum has long been considered a resident human microbe, but a disruption of the gut ecosystem can transform this potentially commensal bacterium into a lethal pathogen, highlighting the need for probiotic-based preventative strategies.

[0004] Recent reports suggest that gut microbiota imbalances can exacerbate respiratory infections and allergic reactions, and conversely, that probiotic administration can reduce airway inflammatory cytokines, potentially preventing or treating lung diseases. However, a significant unmet need remains in the respiratory disease field. In particular, the pharmaceutical market for asthma and chronic obstructive pulmonary disease, which rely on existing inhalers and steroids, is growing annually, and there is a pressing need for alternatives or complementary treatments that can replace or complement costly long-term treatments.

[0005] In this case, there are cases where fecal transplants from healthy people are performed or drugs processed from feces from healthy people, such as Rebyota, Biomictra, and Vowst, are used. However, fecal transplants are highly resistant to patients, and the economic cost of securing healthy people who can provide feces suitable for treatment is considerable. Drugs processed from feces also have a large economic burden.

[0006] Accordingly, there is a continuous need for the development of cost-effective probiotics (including live bacterial therapeutics) that are effective not only in preventing, treating, and improving infections caused by Clostridioides difficile or Clostridium symbiosum, but also in managing respiratory diseases, the demand for which is continuously increasing due to aging and climate change, while having a low recurrence rate.

[0007] The purpose of the present invention is to provide a Lactococcus lactis P22 strain deposited under the accession number KCCM 13443P.

[0008] Another object of the present invention is to provide a Bifidobacterium longum P26 strain deposited under accession number KCCM 13444P.

[0009] Another object of the present invention is to provide an antibacterial composition comprising Lactococcus lactis P22 strain, Bifidobacterium longum P26 strain or a mixture thereof.

[0010] Another object of the present invention is to provide a pharmaceutical composition comprising Lactococcus lactis P22 strain, Bifidobacterium longum P26 strain or a mixture thereof.

[0011] Another object of the present invention is to provide a food composition comprising Lactococcus lactis P22 strain, Bifidobacterium longum P26 strain or a mixture thereof.

[0012] Another object of the present invention is to provide a method for treating or improving an inflammatory disease, respiratory disease, or mental disorder by administering to a subject a Lactococcus lactis P22 strain, a Bifidobacterium longum P26 strain, or a mixture thereof.

[0013] One aspect of the present invention for achieving the above purpose relates to the Lactococcus lactis P22 strain deposited under accession number KCCM 13443P.

[0014] The Lactococcus lactis P22 of the present invention is characterized as a novel lactic acid bacterium isolated and identified from the feces of a healthy human.

[0015] In the Gram stain for identification and classification of Lactococcus lactis P22 of the present invention, it was positive, was a coccus that did not produce spores, and its 16S rDNA base sequence is as shown in SEQ ID NO: 1 attached to this specification. Therefore, Lactococcus lactis P22 of the present invention may include 16S rDNA of SEQ ID NO: 1.

[0016] Analysis of the 16S rDNA base sequence of the above sequence number 1 showed high homology with known Lactococcus lactis strains, and the whole genome analysis showed the highest molecular phylogenetic relationship of 98.8% with Lactococcus lactis ATCC19435 (Figs. 1 and 2). Next, it showed a 97.7% similarity with Lactococcus lactis NBRC100931 strain. Therefore, P22 was identified as Lactococcus lactis, named Lactococcus lactis P22, and deposited with the Korea Center for Microorganism Conservation on December 22, 2023 (KCCM 13443P).

[0017] The Lactococcus lactis P22 of the present invention is a gram-positive coccus. More specific physiological characteristics of Lactococcus lactis P22 can be analyzed according to conventional methods in the art, and specifically, Lactococcus lactis P22 can utilize D-ribose, D-xylose, D-galactose, D-glucose, D-fructose, D-mannose, mannitol, N-acetyl-glucosamine, amygdalin, arbutin, esculin, salicin, cellobiose, maltose, sucrose, trehalose, and xylitol as carbon sources.

[0018] Another aspect of the present invention relates to the Bifidobacterium longum P26 strain deposited under accession number KCCM 13444P.

[0019] The Bifidobacterium longum P26 of the present invention is characterized as a novel lactic acid bacterium isolated and identified from the feces of a healthy human.

[0020] In the Gram stain for identification and classification of Bifidobacterium longum P26 of the present invention, it is a positive, non-spore-producing rod-shaped bacterium, and its 16S rDNA base sequence is as shown in SEQ ID NO: 2 attached to this specification. Therefore, Bifidobacterium longum P26 of the present invention may include the 16S rDNA of SEQ ID NO: 2.

[0021] Analysis of the 16S rDNA base sequence of the above sequence number 2 showed high homology with known Bifidobacterium longum strains and, as a result of whole-genome analysis, it showed the highest molecular phylogenetic relationship of 98.6% with Bifidobacterium longum JCM1217 (Figs. 3 and 4). Next, it showed a 97.7% similarity with Bifidobacterium longum DSM20211 strain. Therefore, the lactic acid bacterium was identified as Bifidobacterium longum, named Bifidobacterium longumP26, and deposited with the Korea Center for Microbiological Conservation on December 22, 2023 (KCCM 13444P).

[0022] Bifidobacterium longum P26 of the present invention is a gram-positive rod. More specific physiological characteristics of Bifidobacterium longum P26 can be analyzed according to a conventional method in the art, and specifically, Bifidobacterium longum P26 can utilize D-glucose, D-mannitol, D-lactose, D-sucrose, D-maltose, salicin, D-xylose, L-arabinose, esculin, D-raffinose, and D-sorbitol as carbon sources.

[0023] Another aspect of the present invention relates to an antibacterial composition comprising Lactococcus lactis P22 strain, Bifidobacterium longum P26 strain or a mixture thereof.

[0024] In addition, another aspect of the present invention relates to a pharmaceutical composition for preventing or treating Clostridioides difficile or Clostridium symbiosum infection, comprising the antibacterial composition.

[0025] In one embodiment of the present invention, it was confirmed that the Lactococcus lactis P22, Bifidobacterium longum P26 or a mixture thereof inhibits Clostridioides difficile and / or Clostridium symbiosum (C. symbiosum) and inhibits the production of toxins secreted by Clostridioides difficile, and thus can be utilized for antibacterial purposes, and further, can be utilized for the prevention or treatment of Clostridioides difficile and / or Clostridium symbiosum infections.

[0026] The present invention relates to a pharmaceutical composition for preventing or treating inflammatory diseases, respiratory diseases or mental disorders, comprising Lactococcus lactis P22 strain, Bifidobacterium longum P26 strain or a mixture thereof.

[0027] In the present invention, inflammatory disease is a general term for diseases in which inflammation is the main lesion. The inflammatory disease of the present invention may be at least one selected from the group including arthritis, gout, hepatitis, obesity, keratitis, gastritis, enteritis, nephritis, colitis, diabetes, tuberculosis, bronchitis, pleurisy, peritonitis, spondylitis, pancreatitis, inflammatory pain, urethritis, cystitis, vaginitis, arteriosclerosis, sepsis, and periodontitis. More specifically, the inflammatory disease may be enteritis, but is not limited thereto.

[0028] The above enteritis is an inflammatory disease of the intestine caused by bacteria, viruses, protozoa, allergies, chemical toxins, drugs, etc., and the causative bacteria are known to include Staphylococcus aureus, Vibrio parahaemolyticus, Salmonella, Clostridioides difficile, and Clostridium symbiosum.

[0029] In particular, enteritis caused by Clostridioides difficile occurs when Clostridioides difficile is exposed orally, survives in the form of spores that are resistant to gastric acid, passes through the stomach, and is converted into a vegetative form after exposure to primary bile. Usually, 10 per 1 g of stool 6 10 inland 8 If the CFU (Colony Forming Unit) exceeds this number, Clostridioides difficile infection enteritis disease occurs.

[0030] The novel lactic acid bacteria of the present invention exhibit effective inhibitory effects against Clostridioides difficile and Clostridium symbiosum, and are therefore effective in treating inflammatory diseases.

[0031] In the present invention, "respiratory disease" refers to a general condition in which a structural or functional abnormality occurs in the entire airway system that transports and exchanges air from the nasal cavity to the lung parenchyma, causing discomfort or impairment in physiological activities such as breathing, gas exchange, and mucosal protection. When the airway epithelium is damaged by stimuli such as external antigens, smoking, fine dust, bacteria, viruses, and oxidative stress, epithelial cells, macrophages, and neutrophils secrete cytokines such as IL-1β, TNF-α, and TGF-β in the innate immune stage, and then, in the adaptive immune stage, the Th2 (IL-4, IL-5) or Th17 (IL-17, RORγt) family becomes dominant, differentiating allergic and inflammatory pathways. If the Th2 bias persists, allergic rhinitis and asthma occur due to increased IgE and eosinophil infiltration, and if Th17 and neutrophils / macrophages are activated for a long time, it progresses to chronic obstructive pulmonary disease through destruction of elastic fibers and airway remodeling. Simultaneous overactivation of Th2 and Th17 can lead to an overlapping syndrome of rhinitis, asthma, and chronic obstructive pulmonary disease (COPD), often with a worsening prognosis. In these cases, regulatory axes such as IL-10 and Foxp3 are suppressed, releasing the immune brake. Hypoxia and systemic oxidative stress can elevate TNF-α and IL-17 in the hippocampus and amygdala, leading to a disruption of the lung-brain axis that can lead to anxiety and depression.

[0032] The lactic acid bacteria of the present invention can significantly improve respiratory diseases and symptoms in that it normalizes immunological mechanisms such as Th2, Th17, TNF-α excess and IL-10, Foxp3 decrease, thereby restoring not only respiratory symptoms but also behavioral and neurological indicators in rhinitis, asthma, chronic obstructive pulmonary disease and / or their combined diseases.

[0033] Specifically, the respiratory disease may be one or more selected from the group consisting of rhinitis, asthma, chronic obstructive pulmonary disease, pharyngitis, tonsillitis, bronchitis, and pneumonia, but is not limited thereto.

[0034] The above "rhinitis" is an upper respiratory allergic disease that causes acute and chronic inflammation of the nasal mucosa due to an IgE-mediated hypersensitivity reaction to antigens (house dust mites, pollen, etc.), repeatedly causing sneezing, runny nose, nasal congestion, and itching.

[0035] Chronic obstructive pulmonary disease (COPD) is a progressive lower airway inflammatory disease characterized by alveolar destruction and airway remodeling due to persistent irritants such as smoking and fine dust. It manifests as chronic inflammation driven by neutrophils and macrophages, centered on Th17 / TNF-α, and can even lead to anxiety and depressive behavior.

[0036] The aforementioned "pharyngitis" is an inflammation of the upper respiratory tract mucosa caused by a virus or pathogen irritating the pharynx or tonsillar mucosa. Epithelial cells and subepithelial macrophages secrete IL-1β, IL-6, and TNF-α, causing vasodilation and pain. Persistent inflammation stimulates the hippocampus and amygdala stress circuits via the vagus and glossopharyngeal nerves, resulting in the symptom of "throat pain with anxiety."

[0037] The above "tonsillitis" is an inflammation of the lymphatic tissue in the palatine tonsils, which is characterized by swelling, redness, and pain due to viruses, pathogens, or repeated exposure antigens. In the acute stage, TNF-α and IL-6 are intensively secreted in the tonsillar epithelium, cortex, and stroma, and in recurrent tonsillitis, a Th1 bias in which IFN-γ is greater than IL-4 persists, showing the characteristics of aggressive biological defense but insufficient humoral immunity (antibody formation). An approach that suppresses the inflammatory circuit centered on TNF-α and IL-6 with the IL-10 and Foxp3 axis is necessary, and this is in the same context as the restoration of immune balance demonstrated by the lactic acid bacteria of the present invention as shown in one embodiment of the present invention.

[0038] The above "Acute Bronchitis" is an inflammation of the lower respiratory tract mucosa caused by damage to the tracheal or bronchial epithelium through viral infection. IL-1β, IL-6, IL-8, and TNF-α stimulate the epithelium and nerve endings, causing a persistent cough. NF-κB is activated in the order of viral replication, epithelial necrosis, and innate immune receptor (TLR3 / 7, etc.) activation, which causes IL-8-mediated neutrophil gathering, accompanied by excessive mucus secretion and bronchial constriction. In particular, in smokers or the elderly with high IL-6 and IL-8 concentrations, the inflammatory response persists for a long time, tending to worsen into pneumonia or chronic obstructive pulmonary disease.

[0039] The above "pneumonia" is an alveolar suppurative and exudative inflammatory disease caused by bacteria, viruses, or fungi invading the lung parenchyma (alveoli and interstitium), making gas exchange difficult. Initially, alveolar macrophages and epithelium secrete IL-1β, IL-6, and TNF-α, followed by IL-17 and IL-22 secretion from Th17 cells, inducing a large influx of neutrophils to attempt to eliminate pathogens. However, if bacterial toxins and viral replication persist, excessive IL-17 production and leakage of oxidative enzymes and proteases accelerate lung parenchymal damage, potentially leading to organ damage.

[0040] In addition to the above diseases, diseases that can be cured through normalization of inflammatory response and restoration of immune balance through suppression of Th2, Th17, and TNF-α and restoration of IL-10 and Foxp3 can be prevented, treated, improved, or managed through application of the lactic acid bacteria of the present invention.

[0041] In the present invention, mental disorder, also referred to as mental illness or psychosis, refers to behavioral and mental abnormalities that cause problems in personal and social functioning, and may even include physical symptoms. Causes include congenital brain problems and serious stress factors.

[0042] The above mental disorder may be, but is not limited to, one or more selected from the group consisting of anxiety disorder, depression, stress-related disorder, mood disorder, sleep disorder, memory disorder, cognitive disorder, and attention disorder.

[0043] The above-mentioned "anxiety disorder" is a mental illness that causes disruption in daily life due to various forms of abnormal and pathological anxiety and fear. The amygdala is the area that detects threats and triggers a fear response, and when the activity of this amygdala increases abnormally, anxiety disorders occur. Furthermore, anxiety disorders occur when the function of the prefrontal cortex, which is responsible for rational judgment and emotional regulation, is impaired, making it difficult to effectively suppress excessive activity of the amygdala. Among neurotransmitters, dysfunction of the serotonin and GABA systems, which play a crucial role in emotional regulation, is also a major cause of anxiety disorders. Furthermore, Clostridioides difficile infection not only causes fever and abdominal pain, but also systemic inflammation through the gut-brain axis. Toxin-induced elevations of IL-1β and IL-6 and depletion of intestinal 5-HT precursors lead to persistent anxiety and feelings of isolation as symptoms. In addition, in upper and lower respiratory tract infectious inflammatory diseases such as rhinitis, asthma, chronic obstructive pulmonary disease, as well as pharyngitis, tonsillitis, bronchitis, and pneumonia, the hyperinflammatory response (elevated IL-1β, IL-6, TNF-α, IL-17) and physical discomfort due to hypoxia, dyspnea or airway edema, and dysphagia overactivate the sympathetic nervous system and the hypothalamic-pituitary-adrenal (HPA) axis, triggering panic attacks and anticipatory anxiety, which in turn increases the prevalence of anxiety disorders.

[0044] The above anxiety disorder may be one or more selected from the group including, but not limited to, generalized anxiety disorder, specific phobia, agoraphobia, social anxiety disorder, panic disorder, separation anxiety, and selective mutism.

[0045] The above "depression" is a disease that causes various cognitive and psychosomatic symptoms with decreased motivation and depression as the main symptoms, resulting in a decline in daily function. Depression due to decreased brain function can occur when the activity of the prefrontal cortex, which is responsible for emotional regulation, the hippocampus, which is important for memory and learning, and the nucleus accumbens, which is related to motivation and reward, is reduced or atrophied. In particular, chronic stress can suppress the production of neurites in the hippocampus, causing depression and memory loss. In addition, an imbalance of serotonin, norepinephrine, and dopamine can be a major cause of depression. In addition, infections with Clostridioides difficile and Clostridium symbiosum induce a decline in mood due to a decrease in gut diversity and toxin leakage. In addition, in upper and lower respiratory tract infectious inflammatory diseases such as rhinitis, asthma, chronic obstructive pulmonary disease, as well as pharyngitis, tonsillitis, bronchitis, and pneumonia, when inflammatory cytokines such as IL-6 and TNF-α are secreted, the hypothalamic-pituitary-adrenal (HPA) axis becomes overactivated, and physical stress such as hypoxia, chest tightness, dysphagia, and airway edema often overlap, resulting in extrinsic depressive symptoms including panic attacks.

[0046] The above depression may be at least one selected from the group including, but not limited to, Major Depressive Disorder, Persistent Depressive Disorder, Dysthymia, Disruptive Mood Dysregulation Disorder, Premenstrual Dysphoric Disorder, Substance / Medication Induced Depressive Disorder, Depressive Disorder due to Another Medical Condition, Other Specified Depressive Disorder, and Unspecified Depressive Disorder.

[0047] The above "stress-related disorders" include post-traumatic stress disorder (PTSD), which occurs after experiencing an extreme stressful event, and refers to a condition in which an excessive stress response persists. Stress activates the hypothalamic-pituitary-adrenal axis (HPA axis) in the brain, causing the secretion of the stress hormone cortisol. Chronic stress or extreme trauma can disrupt the regulatory function of the HPA axis, resulting in abnormal cortisol secretion. This overactivates the amygdala, the center of emotional regulation, and suppresses the functions of the prefrontal cortex, which makes rational decisions, and the hippocampus, which is responsible for memory, resulting in a fear response even to minor stimuli. Furthermore, patients infected with Clostridioides difficile and Clostridium symbiosum exhibit chronic stress responses, and PTSD-like reactions can be intensified by IL-1β induced by the toxins. In addition, in upper and lower respiratory tract infectious inflammatory diseases such as rhinitis, asthma, chronic obstructive pulmonary disease, as well as pharyngitis, tonsillitis, bronchitis, and pneumonia, hyperinflammatory responses (elevated IL-6, TNF-α), hypoxia, airway narrowing, and dysphagia continuously stimulate the hypothalamic-pituitary-adrenal (HPA) axis and the sympathetic nervous system, reinforcing the stress-induced rhinitis-anxiety loop or worsening stress disorders such as panic and anticipatory anxiety.

[0048] The above "mood disorder" includes bipolar disorder, which is characterized by recurrent episodes of depression and mania (an abnormally excited and elevated mood state), and refers to a condition in which the range of mood changes is very large and unpredictable, causing difficulties in daily life and social relationships.

[0049] Mood disorders are primarily caused by instability in the brain neural circuitry involved in emotion regulation. The connection between the amygdala, which processes emotions, and the prefrontal cortex, which controls rationality, weakens, leading to a malfunction in the emotional "switch." During periods of depression, overall brain activity is reduced, while during mania, extreme brain state changes occur, such as excessive activation of the dopamine system associated with the reward circuit. Gut-brain axis inflammation is a key variable in the mood regulation circuitry. Clostridium difficile infection-induced toxins induce IL-6, leading to dopaminergic circuit instability. Clostridium symbiosum-induced butyrate deficiency can reduce BDNF expression, disrupting mood regulation. In addition, in upper and lower respiratory tract infectious inflammatory diseases such as rhinitis, asthma, chronic obstructive pulmonary disease, as well as pharyngitis, tonsillitis, bronchitis, and pneumonia, excessive secretion of inflammatory cytokines such as IL-6 and TNF-α can cause overactivation of the hypothalamic-pituitary-adrenal (HPA) axis and the sympathetic nervous system, which can lead to mood disorders linked to mood fluctuations such as depression and anxiety.

[0050] The above "sleep disorder" includes insomnia, hypersomnia, narcolepsy, sleep-wake time disorders, and abnormal behavior during sleep. Sleep and wakefulness are processes in which various regions of the brain and neurotransmitters are precisely regulated, and are caused by dysfunctions in the neural circuits and neurotransmitter systems that precisely coordinate sleep and wakefulness. If there is a problem with this system, the quantity and quality of sleep are impaired, such as difficulty falling asleep, difficulty maintaining sleep, or waking up too early, resulting in conditions such as daytime fatigue and decreased concentration. Symptoms include cataplexy, hypnagogic hallucinations, dreams, sleep, paralysis, and sleep attacks, and there is also periodic somnolence, which involves recurring light sleep periods for about a week. Sleep-wake time disorders include jet lag and sleep disorders for night workers, and abnormal behavior during sleep include sleepwalking, night terrors, and nocturnal enuresis. The most persistent side effects of Clostridium difficile infection include extreme fatigue and sleep disturbances, with sleep fragmentation caused by inflammatory cytokines and intestinal pain. Furthermore, Clostridium symbiosum infection can decrease butyrate concentrations due to a decrease in SCFA-producing bacteria. A weakened butyrate-gut-brain axis can impair the synthesis and receptor signaling of the GABA neurotransmitter system, resulting in a decreased ability to maintain deep sleep. Furthermore, in upper and lower respiratory tract infectious inflammatory diseases such as rhinitis, asthma, chronic obstructive pulmonary disease, pharyngitis, tonsillitis, bronchitis, and pneumonia, increased secretion of inflammatory cytokines (IL-6, TNF-α, etc.), airway narrowing, dysphagia, nocturnal cough, and hypoxia all combine to significantly reduce sleep efficiency, frequently leading to sleep disorders such as chronic insomnia, nocturnal awakenings, and sleep apnea.

[0051] As a sleep center, the ventrolateral preoptic nucleus (VLPO) located in the hypothalamus of the brain secretes the inhibitory neurotransmitter GABA to suppress the arousal system and induce sleep.

[0052] Additionally, as the arousal center, several monoaminergic nuclei located in the brainstem and posterior hypothalamus are responsible for arousal, and activate the cerebral cortex by secreting neurotransmitters that promote arousal, such as norepinephrine, serotonin, and histamine.

[0053] Various sleep disorders occur when there is a problem with the switch or related neural circuit between the sleep center and the wake center.

[0054] The above-mentioned 'insomnia' is a state of 'brain hyperarousal', which refers to a state in which the sleep switch does not turn on properly or the wake switch does not turn off even at night. Stress, anxiety, and worry stimulate the sympathetic nervous system and continuously stimulate the wakefulness center. As a result, the brain does not 'turn off' even when lying down in bed and tries to maintain a state of constant wakefulness, making it difficult to fall asleep and easily waking up from even small stimuli. In addition, if the function of the inhibitory neurotransmitter GABA system is reduced, the wakefulness system cannot be sufficiently suppressed, worsening the state of hyperarousal. Furthermore, if orexin (or hypocretin), a neuropeptide that plays a crucial role in maintaining stable wakefulness, remains abnormally high even at night, it can cause continuous wakefulness and become a cause of insomnia.

[0055] The above insomnia includes sleep apnea, which is difficulty falling asleep; deep sleep disorder, which is difficulty sleeping even after falling asleep; and early morning awakening, which is waking up early in the morning.

[0056] Hypersomnia, also known as hypersomnia, is a sleep disorder characterized by extreme difficulty waking up from sleep. It can be caused by dysfunction in the brain's neural circuits that regulate the sleep-wake system. It includes narcolepsy, idiopathic hypersomnia, and recurrent hypersomnia.

[0057] 'Narcolepsy' is a disease in which unbearable drowsiness during the day occurs even after getting enough sleep at night. The main cause is the destruction or abnormality of the neurons in the hypothalamus that secrete orexin, which acts as a 'switch stabilizer' to maintain a stable state of wakefulness. Cataplexy, in which the body suddenly loses strength when experiencing strong emotions such as laughing, getting angry, or being surprised, is a characteristic symptom of narcolepsy. When orexin is deficient, the brainstem area that controls REM sleep is inappropriately activated by emotional stimulation, showing symptoms of sudden loss of muscle strength even though one is awake.

[0058] 'Idiopathic Hypersomnia' refers to cases where excessive sleepiness occurs for unknown reasons without narcolepsy, other sleep disorders, or internal medical diseases. Hypersensitivity of receptors for GABA, a representative neurotransmitter that suppresses brain activity and induces sleep, is also suggested.

[0059] 'Recurrent Hypersomnia' is a disease in which a state of extreme hypersomnia persists for several days to several weeks, and then a pattern of returning to normal completely before the next episode repeats, and it includes Kleine-Levin Syndrome. When symptoms appear, the hypothalamus, which is the center that regulates appetite, sleep, and emotions, and the limbic system, which is responsible for emotions and memory, especially the thalamus and temporal lobe, may temporarily and significantly decrease in function.

[0060] The above "memory impairment" refers to a condition in which one or more of the processes of memory acquisition (encoding), storage, and retrieval are partially or completely damaged, causing significant impairment in learning ability and daily life functions, and is caused by damage to specific neural mechanisms in the brain that create, store, and retrieve memories. One of the core mechanisms is the failure to 'storage' new memories. If the hippocampus is damaged due to stress or stroke, etc., anterograde amnesia occurs, in which new information cannot be converted to long-term memory, and if nerve cells are destroyed, comprehensive memory damage occurs, in which not only the storage of new memories but also existing stored memory files are deleted.

[0061] Furthermore, even when memories are fully stored in the brain, problems can arise due to problems with the "retrieval" process, which involves retrieving them. Furthermore, impaired prefrontal cortex function can lead to inability to recall specific information in a timely manner. Furthermore, impaired neuromodulators like acetylcholine can further deteriorate memory function, deteriorating the overall memory system and exacerbating memory impairment.

[0062] In addition, Clostridioides difficile infection can cause cognitive and memory dysfunction, and toxin-induced barrier destruction and microinflammation can suppress hippocampal neuroplasticity, resulting in memory impairment. In upper and lower respiratory tract infectious inflammatory diseases such as rhinitis, asthma, chronic obstructive pulmonary disease, as well as pharyngitis, tonsillitis, bronchitis, and pneumonia, persistent hypoxic conditions and increased inflammatory cytokines such as IL-6 and TNF-α suppress neuroplasticity in the hippocampus and prefrontal cortex, resulting in decreased concentration and memory loss, resulting in 'inflammatory memory impairment.'

[0063] The above "cognitive impairment" refers to a condition in which impairment occurs across the brain's higher-order mental functions, including not only memory but also language, spatial perception, judgment, and problem-solving skills. When toxic proteins accumulate and destroy nerve cells, the hippocampus may be damaged, beginning with initial memory decline. When concentrated in the frontal or temporal lobes, personality changes or language impairment may occur first. Furthermore, when nerve cells are damaged due to cerebral blood flow disturbance, executive function decline, such as decreased information processing speed or planning ability, may be prominent. Furthermore, when toxins from Clostridioides difficile or Clostridium symbiosum infection cross the blood-brain barrier, they can cause prolonged neuroinflammation, damaging functions such as the frontal lobe, and leading to cognitive impairment. In upper and lower respiratory tract infectious inflammatory diseases such as rhinitis, asthma, chronic obstructive pulmonary disease, as well as pharyngitis, tonsillitis, bronchitis, and pneumonia, persistent hypoxic conditions and excessive secretion of inflammatory cytokines such as IL-6 and TNF-α cause cerebral white matter degeneration and decreased hippocampal neuroplasticity, increasing the risk of cognitive dysfunction such as memory decline, executive function, and / or attention.

[0064] The above "attention deficit" refers to a condition in which the ability to selectively pay attention to internal and external stimuli, sustained attention, and attentional shifting is lower than expected at the developmental stage, resulting in significant difficulty maintaining concentration or filtering out distracting stimuli during goal-directed behavior, learning, and problem-solving. It may be caused by developmental delay and functional decline in the prefrontal cortex-striatal neural circuit, and the dysfunction of this circuit may fundamentally result from an imbalance of two neurotransmitters: dopamine, which controls motivation and reward, and norepinephrine, which regulates arousal and concentration. In addition, in Clostridioides difficile and Clostridium symbiosum infections, changes in the Clostridium microbial flora are associated with attentional difficulties or hyperactivity. In upper and lower respiratory tract infectious inflammatory diseases such as rhinitis, asthma, chronic obstructive pulmonary disease, as well as pharyngitis, tonsillitis, bronchitis, and pneumonia, persistent hypoxic conditions and increased levels of inflammatory cytokines such as IL-6 and TNF-α can reduce dopamine neurotransmission, causing or worsening 'attention disorder', which is a decline in attention.

[0065] In one embodiment of the present invention, Lactococcus lactis P22, Bifidobacterium longum P26 or a mixture thereof was treated to a model mouse for anxiety and depression disease induced by Clostridioides difficile infection and a model mouse for anxiety and depression disease induced by Clostridium symbiosum infection to confirm the effect of improving mental disorders. As a result, it was confirmed that anxiety and depressive behaviors caused by stress were significantly improved and that the expression of brain-derived neurotrophic factor (BDNF), an anti-depressant indicator, was increased. Through the above results, it was confirmed that a pharmaceutical composition containing the novel lactic acid bacteria Lactococcus lactis P22, Bifidobacterium longum P26 or a mixture thereof is effective in the prevention and treatment of mental disorders.

[0066] Specifically, in the pharmaceutical composition, the mixture may be a mixture of Lactococcus lactis P22 strain and Bifidobacterium longum P26 strain in a colony forming unit (CFU) ratio of 0.2:1 to 5:1, specifically 0.5:1 to 4:1, and more specifically 1:1 to 4:1, but is not limited thereto.

[0067] In one embodiment of the present invention, it was confirmed that the mixture of Lactococcus lactis P22 and Bifidobacterium longum P26 was treated on a mouse model of enteritis or depression and anxiety disorder, and that it had excellent effects in preventing and treating inflammatory diseases, respiratory diseases, and / or mental disorders such as depression and anxiety.

[0068] In addition, specifically, the Lactococcus lactis P22 strain or the Bifidobacterium longum P26 strain, or the mixture thereof, may be a live cell thereof, a dead cell thereof, a culture thereof, a lysate thereof, or an extract thereof, respectively, but may be applied without limitation as long as it is in a form that can achieve the desired effect.

[0069] In the present invention, live cells refer to the novel lactic acid bacteria of the present invention themselves, dead cells refer to lactic acid bacteria sterilized by heating, pressurization, or drug treatment, and lysate refers to lactic acid bacteria destroyed by enzyme treatment, homogenization, or ultrasonic treatment.

[0070] In the present invention, the extract refers to a product obtained by extracting lactic acid bacteria with a known extraction solvent.

[0071] In the present invention, a culture or culture solution refers to a product obtained by culturing lactic acid bacteria in a known medium, and the product may include a novel lactic acid bacteria. The medium may be selected from known liquid media or solid media, and may be, for example, MRS liquid media, GAM liquid media, MRS agar media, GAM agar media, or BL agar media, but is not limited thereto.

[0072] The pharmaceutical composition according to the present invention can be formulated into a pharmaceutical formulation using methods well known in the art to provide rapid, sustained, or delayed release of the active ingredient after administration to a mammal. In preparing the formulation, the pharmaceutical composition according to the present invention may additionally include a pharmaceutically acceptable carrier, provided that it does not inhibit the activity of the novel lactic acid bacteria.

[0073] Another aspect of the present invention relates to a food composition for preventing or improving inflammatory diseases, respiratory diseases or mental disorders, comprising Lactococcus lactis P22 strain, Bifidobacterium longum P26 strain or a mixture thereof.

[0074] The above inflammatory disease is the same as described above, and specifically, the above inflammatory disease may be enteritis.

[0075] The above respiratory disease is the same as described above, and specifically, the above respiratory disease may be at least one selected from the group consisting of rhinitis, asthma, chronic obstructive pulmonary disease, pharyngitis, tonsillitis, bronchitis, and pneumonia.

[0076] The above mental disorder is the same as described above, and specifically, the above mental disorder may be at least one selected from the group consisting of anxiety disorder, depression, stress-related disorder, mood disorder, sleep disorder, memory disorder, cognitive disorder, and attention disorder.

[0077] Specifically, in the food composition, the mixture may be a mixture of Lactococcus lactis P22 strain and Bifidobacterium longum P26 strain in a colony forming unit (CFU) ratio of 0.2:1 to 5:1, specifically 0.5:1 to 4:1, and more specifically 1:1 to 4:1, but is not limited thereto.

[0078] There are no specific restrictions on the types of the above foods. Foods to which lactic acid bacteria can be added include dairy products including sausages, meat, bread, chocolate, snacks, candies, confectionery, ramen, pizza, other noodles, gum, ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes. When formulated as a beverage, the liquid ingredients added in addition to the novel lactic acid bacteria are not limited to this, but may contain various flavorings or natural carbohydrates as additional ingredients, as in conventional beverages. The above-mentioned natural carbohydrates may be monosaccharides (e.g., glucose, fructose, etc.), disaccharides (e.g., maltose, sucrose, etc.), and polysaccharides (e.g., conventional sugars such as dextrin, cyclodextrin, etc.), and sugar alcohols such as xylitol, sorbitol, and erythritol.

[0079] Specifically, the lactic acid bacteria included in the food composition of the present invention may be live cells, killed cells, cultures, lysates, or extracts thereof, but any form of lactic acid bacteria capable of achieving a preventive or therapeutic effect on inflammatory diseases, respiratory diseases, or mental disorders may be used without limitation. The live cells, killed cells, cultures, lysates, and extracts are the same as those described above.

[0080] Furthermore, specifically, the food may be a health functional food. The health functional food emphasizes the bioregulatory function of the food, and is a food that has been given added value by utilizing physical, biochemical, and biotechnological methods to function and manifest for a specific purpose. The ingredients of such health functional foods are designed and processed to sufficiently exert the body's regulatory functions related to biological defense, regulation of body rhythms, and prevention and recovery from diseases. The food may contain food additives, sweeteners, or functional ingredients that are acceptable as food.

[0081] When the Lactococcus lactis P22 strain or Bifidobacterium longum P26 strain of the present invention, or a mixture thereof, is used in a health functional food (or health functional beverage additive), the novel lactic acid bacteria may be added as is or used together with other foods or food ingredients, and may be used appropriately according to a conventional method. The mixing amount of the Lactococcus lactis P22, Bifidobacterium longum P26 strain of the present invention, or a mixture thereof, may be appropriately determined depending on the purpose of use (prevention, health or improvement, therapeutic treatment).

[0082] Another aspect of the present invention relates to a method for preventing or treating an inflammatory disease, respiratory disease or mental disorder, comprising administering to a subject a composition comprising the strain or a mixture of the strains.

[0083] The above inflammatory disease is the same as described above, and specifically, the above inflammatory disease may be enteritis.

[0084] The above respiratory disease is the same as described above, and specifically, the above respiratory disease may be at least one selected from the group consisting of rhinitis, asthma, chronic obstructive pulmonary disease, pharyngitis, tonsillitis, bronchitis, and pneumonia.

[0085] The above mental disorder is the same as described above, and specifically, the above mental disorder may be at least one selected from the group consisting of anxiety disorder, depression, stress-related disorder, mood disorder, sleep disorder, memory disorder, cognitive disorder, and attention disorder.

[0086] The above-mentioned entity refers to an animal, and may be specifically a mammal that can exhibit beneficial effects from treatment using the lactic acid bacteria of the present invention. Specific examples of such entities include, but are not limited to, primates such as humans.

[0087] The Lactococcus lactis P22 strain, the Bifidobacterium longum P26 strain, or a mixture thereof of the present invention is excellent in preventing, treating, or improving inflammatory diseases, respiratory diseases, or mental disorders. In particular, the lactic acid bacteria of the present invention can manage complex diseases, and thus have high potential for use in the treatment of diseases and improvement of clinical symptoms.

[0088] The effects of the present invention are not limited to the above effects, and should be understood to include all effects that can be inferred from the detailed description of the present invention or the composition of the invention described in the claims.

[0089] Figure 1 shows the phylogenetic characteristics of the Lactococcus lactis P22 strain.

[0090] Figure 2 shows the results of comparing the whole genome of Lactococcus lactis P22 strain with similar strains.

[0091] Figure 3 shows the phylogenetic characteristics of the Bifidobacterium longum P26 strain.

[0092] Figure 4 shows the results of comparing the whole genome of Bifidobacterium longum P26 strain with similar strains.

[0093] Figure 5 shows a schematic diagram of an experiment in a rhinitis / asthma animal model.

[0094] Figure 6 shows a schematic diagram of an experiment in an animal model of chronic obstructive pulmonary disease (COPD).

[0095] Figure 7 shows a schematic diagram of an experiment in an animal model of rhinitis / asthma and COPD.

[0096] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are only illustrative of the present invention, and the present invention is not limited to the following examples.

[0097] Example 1. Isolation and identification of lactic acid bacteria

[0098] 1-1. Isolation of lactic acid bacteria from human feces

[0099] Healthy human feces were suspended in GAM broth (Nissui Pharmaceutical, Japan). The supernatant was then transferred to GAM or BL agar medium (Nissui Pharmaceutical, Japan) and anaerobically cultured at 37°C for approximately 48 h. The strains that formed colonies were then isolated.

[0100] 1-2. Identification of isolated lactic acid bacteria

[0101] The physiological characteristics and 16S rDNA sequences of strains isolated from human feces were analyzed to identify the strains and assign strain names. The assigned strain names of the lactic acid bacteria are shown in Table 1 below. Specifically, one species of Lactobacillus plantarum (No. 1 in Table 1), two species of Lactococcus lactis (No. 2 and 3 in Table 1), two species of Lactobacillus gasseri (No. 4 and 12 in Table 1), two species of Bifidobacterium longum (No. 5 and 6 in Table 1), one species of Lactobacillus fermentum (No. 7 in Table 1), two species of Bifidobacterium adolescentis (No. 8 and 9 in Table 1), and one species of Bifidobacterium pseudocatenulatum (No. 10 in Table 1). There were one species of Lactobacillus casei (No. 11 in Table 1), two species of Lactobacillus reuteri (No. 13 and 14 in Table 1), one species of Lactobacillus acidophilus (No. 15 in Table 1), one species of Bifidobacterium catenulatum (No. 16 in Table 1), two species of Bifidobacterium animalis (No. 17 and 18 in Table 1), and two species of Bifidobacterium bifidum (No. 19 and 20 in Table 1).

[0102] Management number Strain name Management number Strain name 1Lactobacillus plantarumP2111Lactobacillus caseiP312Lactococcus lactisP2212Lactobacillus gasseriP323Lactococcus lactisP2313Lactobacillus reuteriP334Lactobacillus gasseriP2414Lactobacillus reuteriP345Bifidobacterium longumP2515Lactobacillus acidophilusP356Bifidobacterium longumP2616Bifidobacterium catenulatumP367Lactobacillus fermentumP2717Bifidobacterium animalisP378Bifidobacterium adolescentisP2818Bifidobacterium animalisP389Bifidobacterium adolescentisP2919Bifidobacterium bifidumP3910Bifidobacterium pseudocatenulatumP3020Bifidobacterium bifidumP40

[0103] Example 2. Measurement of the activity of lactic acid bacteria on the expression of IL-10 and IL-17 in splenocytes treated with TGF-β and IL-6.

[0104] The spleens of C57BL / 6J mice were isolated, finely chopped, ground, passed through a sieve, suspended in RPMI 1640 exclusion medium containing 10% FCS, and CD4 T cells were isolated using a CD4 T cell isolation kit (MiltenyiBiotec, Bergisch Gladbach, Germany). The isolated CD4 T cells were seeded in 12-well plates at a density of 5 x 10 per well. 5 After saturating the cells with water and treating with IL-6 and TGF-β, lactic acid bacteria (1Х10 5CFU / mL) and cultured for 3 days. Afterwards, IL-10 and IL-17 in the supernatant were measured using an ELISA kit (R&D system, USA).

[0105] IL-10 inducing activityIL-17 inhibitory activity1Lactobacillus plantarumP21++2Lactococcus lactisP22+++++3Lactococcus lactisP23+++4Lactobacillus gasseriP24++5Bifidobacterium longumP25+++6Bifidobacterium longumP26++++++7Lactobacillus fermentumP27++8Bifidobacterium adolescentisP28+++9Bifidobacterium adolescentisP29+++10Bifidobacterium pseudocatenulatumP30++11Lactobacillus caseiP31++12Lactobacillus gasseriP32-++13Lactobacillus reuteriP33+++14Lactobacillus reuteriP34++15Lactobacillus acidophilusP35++16Bifidobacterium catenulatumP36++17Bifidobacterium animalisP37+++18Bifidobacterium animalisP38+++19Bifidobacterium bifidumP39-+20Bifidobacterium bifidumP40++* Final concentration of lactic acid bacteria treated: 1Х10 5CFU / ml* +++: >50%; ++: 26~50%; +: 1~25%; -: 0~-25%.* IL-10 induction activity (%) = 100 x (IL-10 expression level of cells treated with lactic acid bacteria - IL-10 expression level of cells treated with saline only) / (IL-10 expression level of cells treated with saline only)* IL-17 inhibition activity (%) = 100 x (IL-17 expression level of cells treated with saline only - IL-17 expression level of cells treated with lactic acid bacteria) / (IL-17 expression level of cells treated with saline only)

[0106] Example 3. Measurement of TNF-α and IL-6 expression levels, antioxidant activity, and anti-E. coli activity in macrophages.

[0107] 3-1. Measurement of TNF-α and IL-6 expression levels in macrophages

[0108] C57BL / 6 mice (male, 6 weeks old, 19-22 g) were administered 2 ml of sterile 4% thioglycolate into the abdominal cavity, anesthetized 4 days later, 8 ml of RPMI 1640 medium was administered into the abdominal cavity, and 5-10 minutes later, the RPMI medium (macrophages) in the abdominal cavity were removed, centrifuged at 1000 x g for 10 minutes, washed twice with RPMI 1640 medium, and the macrophages were added to each well at 0.5 x 10 6 were transplanted into 24-well plates with the number of isolated lactic acid bacteria (final treatment concentration: 1x10 5 CFU / mL) and heat-treated Clostridiodes difficile (1x10), an inflammatory response inducer 4 The strain heat-treated at 90°C for 30 minutes (CFU / mL) was added, cultured in a CO2 / air incubator for 24 hours, and the supernatant was obtained. The expression levels of TNF-α and IL-6 were measured using an ELISA kit (R&D system, USA).

[0109] 3-2. Measurement of antioxidant activity (in vitro)

[0110] DPPH (2,2-Diphenyl-1-picrylhydrazyl) was dissolved in ethanol to make a concentration of 0.2 mM to prepare a DPPH solution. Lactic acid bacteria suspension (1Х10) was added to 0.1 ml of the DPPH solution. 5 CFU / ㎖) was added and cultured at 37°C for 20 minutes. The culture was centrifuged at 3000 rpm for 5 minutes to obtain the supernatant. Afterwards, the absorbance of the supernatant was measured at 517 nm, and the antioxidant activity of the lactic acid bacteria was calculated.

[0111] 3-3. Measurement of anti-E. coli activity

[0112] Lactic acid bacteria (1x10) were previously cultured in 5 mL of BHI medium. 5 CFU / mL) were cultured, and E. coli (1x10 5 Each of the 100 CFU / mL was transplanted and cultured under anaerobically conditions at 37°C for 24 hours. These were transplanted onto DHL agar medium and cultured aerobically for 24 hours, and the number of grown E. coli colonies was measured.

[0113] 저해활성TNF-αIL-6DPPH대장균1Lactobacillus plantarumP21++--2Lactococcus lactisP22++++++++++++3Lactococcus lactisP23+++-+4Lactobacillus gasseriP24++-+5Bifidobacterium longumP25+++--6Bifidobacterium longumP26+++++++++++7Lactobacillus fermentumP27+++-8Bifidobacterium adolescentisP28+++--9Bifidobacterium adolescentisP29+++--10Bifidobacterium pseudocatenulatumP30++--11Lactobacillus caseiP31+++-12Lactobacillus gasseriP32++++-+13Lactobacillus reuteriP33+++--14Lactobacillus reuteriP34++++15Lactobacillus acidophilusP35+++++16Bifidobacterium catenulatumP36++--17Bifidobacterium animalisP37++--18Bifidobacterium animalisP38+++++-19Bifidobacterium bifidumP39++++-20Bifidobacterium bifidumP40++--* 유산균의 처리 최종 농도: 1Х10 5CFU / ml* +++: >50%; ++: 26~50%; +: 1 to 25%; -: 0 to -25%; --: -50 ~ -26%.* TNF-α or IL-6 inhibition rate (%) = 100 x (TNF-α or IL-6 expression level of cells treated only with Clostridiodes difficile - TNF-α or IL-6 expression level of cells treated with lactic acid bacteria and Clostridiodes difficile together) / (TNF-α or IL-6 expression level of cells treated only with Clostridiodes difficile)* DPPH inhibition rate (%) = 100 x (Optical absorbance of supernatant treated only with vehicle -Optical absorbance of supernatant treated with lactic acid bacteria (Lactococcus lactis P22 and Bifidobacterium longum P26)) / (Optical absorbance of supernatant treated only with vehicle)* E. coli inhibition rate (%) = 100 x (Number of colonies on agar medium cultured with only E. coli - Number of colonies on medium cultured with lactic acid bacteria and E. coli together) (Number of colonies on agar plate transplanted) / (Number of colonies on agar plate transplanted with only E. coli cultured)

[0114] As shown in the table above, it was confirmed that Lactococcus lactisP22 and Bifidobacterium longumP26 strains suppressed TNF-α and IL-6 expression and had excellent antioxidant and anti-colitis activities.

[0115] Example 4. Physiological characteristics of the novel lactic acid bacteria Lactococcus lactis P22

[0116] Among the strains listed in Table 1 above, Lactococcus lactis P22 is a Gram-positive coccus and does not produce spores. As a result of performing 16S rDNA sequence and whole genome analysis of Lactococcus lactis P22, the GC content was 35.0%, and no Lactococcus lactis strain with the same genome was found. It showed 98.8% homology with the known Lactococcus lactis ATCC19435, confirming that it has the highest molecular phylogenetic relationship with Lactococcus lactis (SEQ ID NO: 1, Figs. 1 and 2).

[0117] Figure 1 shows the phylogenetic characteristics of Lactococcus lactis P22 KCCM 13443P, and Figure 2 shows the results of comparing the whole genome of Lactococcus lactis P22 KCCM 13443P strain with similar strains. Figure 2 calculates the gene-level similarity by comparing the genomes pairwise based on the Lactococcus lactis P22 strain, and calculates the percentage of genes with homology and displays them in color. The closer to blue, the higher the similarity, and the closer to red, the less similar.

[0118] Among the physiological characteristics of Lactococcus lactis P22, carbon source utilization was analyzed using the API 50CH Kit and API 20A Kit (manufacturer: BioMerieux, USA). The results are shown in Table 4 below, where "+" indicates positive carbon source utilization, and "-" indicates negative carbon source utilization.

[0119] Carbon source P22--glycerol-erythritol-D-arabinose-L-arabinose-D-ribose+D-xylose+L-xylose-D-adonitol-methyl-β-D-xylopyranoside-D-galactose+D-glucose+D-fructose+D-mannose+L-sorbose-L-rhamnose-dulcitol-inositol-mannitol (mannitol) + sorbitol - α-methyl-D-mannoside - α-methyl-D-glucoside - N-acetyl-glucosamine + amygdalin + arbutin + esculin + salicin + cellobiose + maltose + lactose - melibiose - sucrose + trehalose + inulin - melezitose - raffinose - starch - glycogen - xylitol + gentiobiose (gentiobiose)-D-turanose-D-lyxose-D-tagatose-D-fucose-L-fucose-D-arabitol-L-arabitol-gluconate-2-keto-gluconate-5-keto-gluconate-

[0120] The above novel strain Lactococcus lactis P22 was patented and deposited with the Korea Microbiological Conservation Center (Address: Yulim Building, 45 Hongje-nae 2-ga-gil, Seodaemun-gu, Seoul, Republic of Korea) and assigned the accession number KCCM13443P.

[0121] Example 5. Physiological characteristics of the novel lactic acid bacterium Bifidobacterium longum P26

[0122] Among the strains listed in Table 1 above, Bifidobacterium longum P26 is a Gram-positive rod that does not produce spores. As a result of performing 16S rDNA base sequence and full-length genetic analysis of Bifidobacterium longum P26, the GC content was 60.2%, and no Bifidobacterium longum strain with the same genome was found. It showed 98.6% homology with the known Bifidobacterium longum JCM1217, confirming the highest molecular phylogenetic relationship with Bifidobacterium longum (SEQ ID NO: 2, FIGS. 3 and 4).

[0123] Figure 3 shows the phylogenetic characteristics of Bifidobacterium longum P26 KCCM 13444P, and Figure 4 shows the results of comparing the whole genome of Bifidobacterium longum P26 KCCM 13444P strain with similar strains. Figure 4 calculates the gene-level similarity by comparing the genomes pairwise based on the Bifidobacterium longum P26 strain, and calculates the percentage of genes with homology and displays them in color. The closer to blue, the higher the similarity, and the closer to red, the less similar.

[0124] Among the physiological characteristics of Bifidobacterium longum P26, carbon source utilization was analyzed using the API 50CH Kit and API 20A Kit (manufacturer: BioMerieux, USA). The results are shown in Table 5 below, where "+" indicates positive carbon source utilization, and "-" indicates negative carbon source utilization.

[0125] In addition, the biochemical characteristics (CAT, Spore, Gram, Cocci) of Bifidobacterium longum P26 were analyzed using the API 20A Kit, and the results are shown in Table 5.

[0126] Carbon source P26 L-tryptophan - Urea - D-glucose + D-mannitol + D-lactose + D-sucrose + D-maltose + Salicin + D-xylose + L-arabinose + Gelatin - Esculin + Glycerol - D-cellobiose - D-mannose - D-melezitose - D-raffinose + D-sorbitol + D-rhamnose - D-trehalose (D-trehalose)-CAT-Spore-Gram+Cocci-

[0127] The above novel strain Bifidobacterium longum P26 was patented and deposited with the Korea Microbiological Conservation Center (Address: Yulim Building, 45 Hongje-nae 2-ga-gil, Seodaemun-gu, Seoul, Republic of Korea) and assigned the accession number KCCM13444P.

[0128] Example 6. Preparation of P2226 (mixture of Lactococcus lactis P22 and Bifidobacterium longum P26)

[0129] L. lactis P22 and B. longum P26, selected from a collection of bacteria isolated from the feces of healthy volunteers, were cultured anaerobically in MRS medium in an anaerobic chamber at 37°C for 24 h.

[0130] Each of these strains was grown in a standard probiotic medium (edible MRS medium) at 2-4 Х10 9 The cells were cultured at a density of 10 CFU / mL and centrifuged to collect the cells. After collection, the cells were washed with 1% trehalose and freeze-dried. P2226 was prepared by mixing (4:1) the viability of freeze-dried P22 and P26, respectively, under anaerobic conditions on MRS and TOS agar media, based on the viable cell count.

[0131] Experimental Example 1. Confirmation of the growth inhibition activity of Lactococcus lactis P22 and Bifidobacterium longum P26 against Clostridioides difficile and Clostridium symbiosum.

[0132] Lactococcus lactis P22 (1x10) was pre-inoculated into 10 mL of BHI medium. 6 , 1x10 7 , 1x10 8 , or 1x10 9 CFU / mL) and Bifidobacterium longum P26 (1x10 6 , 1x10 7 , 1x10 8 , or 1x10 9 CFU / mL) were cultured, respectively, and Clostridioides difficile and Clostridium symbiosum (1x10 8 Each of (CFU / mL) was transplanted and cultured under anaerobic conditions at 37°C for 24 hours. The number of colonies of Clostridioides difficile and Clostridium symbiosum grown was measured, and the inhibition rate of lactic acid bacteria (Lactococcus lactis P22 or Bifidobacterium longum P26) was measured, and the results are shown in Table 6 below.

[0133] Inhibition rate (%) (CFU / mL) C. difficile C. symbiosum Lactococcus lactis P22000 1x10 6 41521x10 7 69721x10 8 81841x10 9 9592 Bifidobacterium longum P260001x10 6 23121x10 7 47521x10 8 62681x10 9 7885* Inhibition rate (%) = 100 x (Number of colonies on agar plates transplanted with a medium cultured with only C. difficile or C. symbiosum - Number of colonies on agar plates transplanted with a medium cultured with lactic acid bacteria (Lactococcus lactis P22 or Bifidobacterium longum P26) and C. difficile or C. symbiosum) / (Number of colonies on agar plates transplanted with a medium cultured with only C. difficile or C. symbiosum)

[0134] The growth inhibition rate of Clostridioides difficile and Clostridium symbiosum in the culture medium containing Lactococcus lactis P22 and Bifidobacterium longum P26 ranged from a low of 12% to a high of 95%, confirming that Lactococcus lactis P22 and Bifidobacterium longum P26 have the activity of inhibiting the growth of Clostridioides difficile and Clostridium symbiosum, suggesting that Lactococcus lactis P22 and Bifidobacterium longum P26 have a remarkably excellent effect in preventing, treating, and improving inflammatory diseases.

[0135] Experimental Example 2. Confirmation of the growth inhibition activity of P2226 against Clostridioides difficile and Clostridium symbiosum.

[0136] A mixture (1x10) of Lactococcus lactis P22 and Bifidobacterium longum P26 with colony forming unit (CFU) ratios of 4:1, 1:1, and 1:4, respectively, was pre-inoculated into 10 mL of BHI medium. 8CFU / mL) and cultured Clostridioides difficile and Clostridium symbiosum (1x10 8 CFU / mL) were transplanted and cultured for 24 hours under anaerobic conditions at 37°C. These were transplanted onto DHL agar medium and cultured aerobically for 24 hours, and the number of colonies of Clostridioides difficile and Clostridium symbiosum grown was measured, and the inhibition rate of lactic acid bacteria (a mixture of Lactococcus lactis P22 and Bifidobacterium longum P26) was measured, and the results are shown in Table 7 below.

[0137] Non-inhibitory rate of colony forming units (%)P22(1x10 8 CFU / mL)P26(1x10 8 CFU / mL)Saline solutionC. difficile(1x10 8 CFU / mL)C. symbiosum(1x10 8 CFU / mL)410748811067651406274* Inhibition rate (%) = 100 x (Number of colonies on agar plates transplanted with media cultured with only C. difficile or C. symbiosum - Number of colonies on agar plates transplanted with media cultured with lactic acid bacteria (Lactococcus lactis P22 and Bifidobacterium longum P26) and C. difficile or C. symbiosum) / (Number of colonies on agar plates transplanted with media cultured with only C. difficile or C. symbiosum)

[0138] A mixture of Lactococcus lactis P22 and Bifidobacterium longum P26 also exhibited excellent growth inhibition rates against Clostridioides difficile and Clostridium symbiosum, and was confirmed to have growth-inhibiting activity. This suggests that a mixture of Lactococcus lactis P22 and Bifidobacterium longum P26 also has excellent effects in preventing, treating, and improving inflammatory diseases.

[0139] Experimental Example 3. Confirmation of inhibition of toxin A and toxin B expression secreted by Clostridioides difficile by Lactococcus lactis P22 and Bifidobacterium longum P26.

[0140] Pre-cultured Lactococcus lactis P22 and Bifidobacterium longum P26 (1x10) in 10 mL of BHI medium 8 CFU / mL) each to Clostridioides difficile (1x10 8 CFU / mL) were transplanted and cultured under anaerobic conditions at 37°C for 24 h, and then centrifuged (5000×g, 10 min) to obtain the cells. Clostridioides difficile DNA was extracted using the QIAamp Power Fecal Pro DNA kit (Cat. 51804, Qiagen), and DNA amplification was performed via qPCR using TB Green Premix Ex Taq II (Product No. RR820A, Takara) and the Rotor-Gene Q 5plex platform (Product No. 9001570, Qiagen). Amplification was performed using primers targeting toxin A (TcdA) and toxin B (TcdB) sequences, and the primers are shown in Table 8. The 16S rRNA gene was used as a housekeeping gene to normalize the relative DNA levels of the samples. The reaction conditions were 95°C for 30 seconds, 95°C for 15 seconds, 60°C for 20 seconds, 72°C for 20 seconds, and 40 cycles, and the results of measuring the expression level of the toxin are shown in Table 9.

[0141] Sequence number Gene direction Base sequence (5'-3') 3 Toxin A Forward (F) 5' - TCTACCACTGAAGCATTAC - 3' 4 Reverse (R) 5' - TAGGTACTGTAGGTTTATTG - 3' 5 Toxin B Forward (F) 5' - ATATCAGAGACTGATGAG - 3' 6 Reverse (R) 5' - TAGCATATTCAGAGAATATTGT - 3'

[0142] Toxin A (fold change)Toxin B (fold change)NC (saline treatment)11Lactococcus lactis P220.210.11Bifidobacterium longum P260.460.39

[0143] When Clostridioides difficile was transplanted onto a medium cultured with Lactococcus lactis P22 and Bifidobacterium longum P26, the amounts of toxins A and B secreted by Clostridioides difficile were significantly lower than those in the general medium, confirming the effect of inhibiting the expression of toxins A and B secreted by Clostridioides difficile, suggesting that it is significantly effective in the prevention, treatment, and improvement of Clostridioides difficile infection.

[0144] Experimental Example 4. Confirmation of the anti-enteritis effects of Lactococcus lactis P22 and Bifidobacterium longum P26.

[0145] 4-1. Production of infected mice and administration of lactic acid bacteria

[0146] 4-1-1. Preparation of Clostridioides difficile infection model mice and administration of lactic acid bacteria (Lactococcus lactis P22 and Bifidobacterium longum P26)

[0147] Clostridioides difficile (1Х10 8 CFU / mouse / day) was administered orally once daily for 5 days. Then, from the next day, Lactococcus lactis P22 and Bifidobacterium longum P26 (1x10 8 or 1x10 9 CFU / mouse / day) were administered orally alone or as a mixture for 5 days.

[0148] 4-1-2. Preparation of Clostridium symbiosum infection model mice and administration of lactic acid bacteria (Lactococcus lactis P22 and Bifidobacterium longum P26)

[0149] Clostridium symbiosum (1Х10 8CFU / mouse / day) was administered orally once daily for 5 days. Then, from the next day, Lactococcus lactis P22 and Bifidobacterium longum P26 (1x10 8 or 1x10 9 CFU / mouse / day) were administered orally alone or as a mixture for 5 days.

[0150] 4-1-3. Preparation of Clostridioides difficile infection model mice with intestinal dysbiosis and administration of lactic acid bacteria (Lactococcus lactis P22 and Bifidobacterium longum P26)

[0151] Mice were orally administered antibiotics (kanamycin, 40 mg / kg, gentamicin, 3.5 mg / kg, colistin, 4.2 mg / kg, metronidazole, 21.5 mg / kg, vancomycin, 4.5 mg / kg) for 3 days, and then antibiotics were administered at 2-day intervals. Then, clindamycin (10 mg / kg) was injected intraperitoneally 2 days later, and Clostridioides difficile (1X10 6 CFU / mouse / day) was administered. Then, from the next day, Lactococcus lactis P22 and Bifidobacterium longum P26 (1x10 8 or 1x10 9 CFU / mouse / day) alone (1x10 8 or 1x10 9 CFU / mouse / day) or mixture (1x10 9 CFU / mouse / day) was administered orally for 5 days.

[0152] 4-1-4. Preparation of Clostridioides difficile infection model mice with intestinal dysbiosis and administration of fecal suspension from healthy humans

[0153] Mice were orally administered antibiotics (kanamycin, 40 mg / kg, gentamicin, 3.5 mg / kg, colistin, 4.2 mg / kg, metronidazole, 21.5 mg / kg, vancomycin, 4.5 mg / kg) for 3 days, and then antibiotics were administered at 2-day intervals. Then, clindamycin (10 mg / kg) was injected intraperitoneally 2 days later, and Clostridioides difficile (1X10 6 CFU / mouse / day) was administered. Then, from the next day, a fecal suspension of a healthy person (1x10 9 CFU / mouse / day) was administered orally for 5 days.

[0154] 4-1-5. Preparation of fecal suspension for fecal transplantation

[0155] Fresh feces were obtained from a healthy woman in her 30s, immediately suspended in saline solution (less than 2 hours), filtered through sterile gauze, centrifuged at 500 rpm for 5 minutes at 4°C, and the supernatant was diluted 5x10 with saline solution. 8 When diluted to CFU / mL and made into a fecal suspension, 0.2 mL was administered to mice.

[0156] 4-2. Behavioral experiment

[0157] Starting from the day after the final administration of Lactococcus lactis P22, Bifidobacterium longum P26, or fecal suspension, the following behavioral experiments were performed one at a time daily.

[0158] Elevated Plus Maze Task (EPMT)

[0159] The elevated plus maze test apparatus is a black plexiglass apparatus with two open arms (30 x 7 cm) and two enclosed arms (30 x 7 cm) with 20-cm-high walls, each 50 cm above the floor and extending 7 cm from a central platform. The test was conducted in a room with a brightness of 20 lux and a video camera installed above, recording the movements of rats placed in the elevated plus maze.

[0160] Specifically, C57BL / 6 mice (male, 19–22 g) were placed in the center of the elevated plus maze, with their heads facing the open passage. The time and number of times they spent in the open and closed passages for 5 min were measured. Arm entry into the passage was recognized as entering with all four paws. After each behavioral test, any remaining odor was removed with 70% ethanol.

[0161] According to published test results interpretations, a decrease in time spent in the open arm (OT) is interpreted as indicating symptoms of a mental disorder such as anxiety or depression.

[0162] Tail Suspension Test (TST)

[0163] A fixture was installed at the end of a 50 cm high desk and the mouse was hung approximately 1 cm from the tip of its tail. The immobility time (IT) of the experimental animal was measured for a total of 6 minutes.

[0164] Open field test

[0165] To evaluate the basic motility and movement of mice, mice were placed one by one in an OFT box (40 cm wide, 40 cm long, 43 cm high) and measured in a laboratory equipped with a camera for 10 minutes. Using the EthoVision program, the total distance moved (TD), distance moved in the central area (DC), and time spent in the central area (TC) were measured.

[0166] 4-2-1. Behavioral experiment on mice infected with Clostridioides difficile

[0167] The results of the behavioral experiment on mice infected with Clostridioides difficile are shown in Table 10.

[0168] C. difficile-infected mice OT (%) Immobility time (IT) (s) Total distance moved (TD) (m) Median residence time (TC) (s) Median distance moved (DC) (m) NC (normal group) 19.8 27.1 28.5 145 7.5 Enteritis group 7.1 41.8 19.9 4 22.1 Enteritis bacteria / P22 (1x10 8 )16.633.325.21055.1 Enterobacteriaceae / P22(1x10 9 )17.831.626.51286.3 Enterobacteriaceae / P26(1x10 8 )15.134.722.4934.9 Enteritis bacteria / P26(1x10 9 )16.532.224.71095.2 Enterobacteriaceae / Mix(4:1)17.930.826.61296.4* Time spent in open arms (OT) = [Time spent in open arms / (Time spent in open arms+Time spent in closed arms)]x100

[0169] 4-2-2. Behavioral Experiments on Mice Infected with Clostridium Symbiosum

[0170] The results of the behavioral experiment on mice infected with Clostridium symbiosum are shown in Table 11.

[0171] C. symbiosum-infected mice OT (%) Immobility time (IT) (s) Total distance moved (TD) (m) Median dwell time (TC) (s) Median distance moved (DC) (m) NC (normal group) 19.5 27.4 31.2 13 57.8 Enteritis group 9.8 38.2 22.1 4 14.7 Enteritis bacteria / P22 (1x10 8 )15.332.527.11156.2 Enterobacteriaceae / P22(1x10 9 )17.930.529.21277.1 Enteritis bacteria / P26(1x10 8 )13.833.527.51015.2 Enterobacteriaceae / P26(1x10 9 )15.732.128.11196.3 Enterobacteriaceae / Mix(4:1)17.930.429.41317.2* Time spent in open arms (OT) = [Time spent in open arms / (Time spent in open arms+Time spent in closed arms)]x100

[0172] 4-2-3. Behavioral Experiments on Clostridioides Difficile-Infected Mice with Intestinal Dysbiosis

[0173] The results of the behavioral experiment on mice infected with Clostridioides difficile with intestinal dysbiosis are shown in Table 12.

[0174] C. difficile-infected mice with gut dysbiosis OT (%) Immobility time (IT) (s) Total distance traveled (TD) (m) Median residence time (TC) (s) Median distance traveled (DC) (m) NC (normal group) 20.1 26.5 28.6 19 5 8.4 Enteritis group 8.5 46.7 27.4 5 34.3 Enteritis bacteria / P22 (1x10 8 )15.532.627.71426.2 Enterobacteriaceae / P22(1x10 9 )16.931.227.61546.9 Enteritis bacteria / P26(1x10 8 )14.333.528.11375.3 Enterobacteriaceae / P26(1x10 9)16.132.128.51485.8 Enterobacteriaceae / Mix(4:1)17.231.028.31597.1 Enterobacteriaceae / Faecal Transplant(1x10 9 )15.931.827.91476.5* Time spent in open arms (OT) = [Time spent in open arms / (Time spent in open arms + Time spent in closed arms)] x 100

[0175] As shown in Tables 10 to 12, mice administered Lactococcus lactis P22 and Bifidobacterium longum P26 and their mixtures showed more time spent in the open passage, total distance traveled, median residence time, and median distance traveled than the enteritis group, and showed less immobility time, showing results closer to the normal group.

[0176] This suggests that Lactococcus lactis P22 and Bifidobacterium longum P26 and their mixtures are effective in preventing, treating, and improving depressive and anxiety disorders and mental disorders.

[0177] 4-3. Identification of inflammatory, anti-inflammatory, and antidepressant markers in mice administered Lactococcus lactis P22 and Bifidobacterium longum P26.

[0178] Indicator measurement using ELISA kit

[0179] After completing the behavioral experiment, mice were sacrificed, and brain tissue (hippocampus) and intestinal tissue (colon) were isolated. The tissues were homogenized with RIPA lysis buffer, and the amounts of TNF-α, IL-1β, IL-2, IL-6, IL-10, IL-17, and BDNF in the centrifuged supernatant were measured using an ELISA kit. The ELISA test method was performed according to the manufacturer's instructions (TNF-α (DY410, R&D system), IL-1β (DY401, R&D system), IL-6 (DY406, R&D system), IL-2 (DY402, R&D system), IL-17 (DY421, R&D system), IL-10 (DY417, R&D system), BDNF (DY248, R&D system), MPO (myeloperoxidase; DY3667, R&D system)).

[0180] 4-3-1. Identification of inflammatory, anti-inflammatory, and antidepressant markers in Clostridioides difficile-infected mice.

[0181] The levels of MPO, TNF-α, IL-1β, IL-2, IL-6, IL-10, IL-17, and BDNF in Clostridioides difficile-infected mice that completed the behavioral experiment were measured using an ELISA kit. The measurement method was the same as the method for measuring indicators using the ELISA kit above. The results for the brain tissue (hippocampus) are shown in Table 13, and the results for the intestinal tissue are shown in Table 14.

[0182] C. difficile-infected mice (pg / mg) TNF-α IL-1 β IL-6 IL-10 BDNF NC (normal group) 7.1 8.2 6.3 14.6 8.8 Enteritis group 12.9 15.7 12.2 8.9 4.5 Enteritis bacteria / P22 (1x10 8 )8.99.88.513.28.1 Enteritis bacteria / P22(1x10 9 )7.89.17.514.58.4 Enteritis bacteria / P26(1x10 8 )9.410.18.212.87.5 Enterobacteriaceae / P26(1x109 )8.19.37.413.98.2 Enteritis bacteria / Mix(4:1)7.88.97.214.78.7

[0183] C. difficile-infected mice (pg / mg) MPOTNF-α IL-2 IL-6 IL-10 IL-17 NC (normal group) 436.19.5 12.4 13.46.2 Enteritis group 129 18.8 30.2 25.7 8.5 8.1 Enteritis bacteria / P22 (1x10 8 )679.514.716.110.47.1 Enteritis bacteria / P22(1x10 9 )598.913.215.211.96.4 Enteritis bacteria / P26(1x10 8 )699.214.515.810.27.2 Enteritis bacteria / P26(1x10 9 )648.813.114.911.46.4 Enteritis bacteria / Mix (4:1)588.213.014.212.16.5

[0184] As shown in Tables 13 and 14, mice administered Lactococcus lactis P22 and Bifidobacterium longum P26 and their mixture showed lower levels of inflammatory markers TNF-α, MPO, IL-1β, IL-2, and IL-6 compared to the enteritis group, and higher levels of anti-inflammatory marker IL-10. In addition, BDNF, an anti-depressant marker, showed higher levels compared to the enteritis group, showing results closer to the normal group. This suggests that Lactococcus lactis P22 and Bifidobacterium longum P26 and their mixture are excellent in the prevention, treatment, and improvement of inflammatory diseases and mental disorders.

[0185] 4-3-2. Identification of Inflammatory, Anti-Inflammatory, and Antidepressant Indicators in Clostridium Symbiosum-Infected Mice

[0186] The levels of MPO, TNF-α, IL-1β, IL-2, IL-6, IL-10, IL-17, and BDNF in Clostridium symbiosum-infected mice that completed the behavioral experiment were measured using an ELISA kit. The measurement method was the same as the method for measuring indicators using the ELISA kit above. The results for brain tissue (hippocampus) are as shown in Table 15, and the results for intestinal tissue are as shown in Table 16.

[0187] C. symbiosum-infected mice (pg / mg)TNF-αIL-1βIL-6IL-10BDNFNC (normal group)6.88.96.213.58.5Enteritis group13.514.714.29.64.2Enteritis bacteria / P22 (1x10 8 )8.210.28.912.17.2 Enteritis bacteria / P22(1x10 9 )7.19.08.112.58.1 Enteritis bacteria / P26(1x10 8 )9.210.49.311.86.9 Enterobacteriaceae / P26(1x10 9 )7.99.88.512.47.8 Enteritis bacteria / Mix(4:1)6.98.87.912.38.1

[0188] C. symbiosum-infected mice (pg / mg) MPOTNF-α IL-2 IL-6 IL-10 IL-17 NC (normal group) 456.9 9.8 11.7 12.7 6.5 Enteritis group 115 19.7 28.0 23.5 9.3 9.6 Enteritis bacteria / P22 (1x10 8 )617.914.514.511.47.3 Enterobacteriaceae / P22(1x10 9 )537.411.612.412.16.8 Enterobacteriaceae / P26(1x10 8 )729.214.214.910.57.9 Enteritis bacteria / P26(1x10 9 )618.212.312.811.87.0 Enteritis bacteria / Mix(4:1)487.511.512.312.46.7

[0189] As shown in Tables 15 and 16 above, mice administered Lactococcus lactis P22 and Bifidobacterium longum P26 and their mixture showed lower levels of inflammatory markers TNF-α, MPO, IL-1β, IL-2, IL-6, and IL-17 compared to the enteritis group, and higher levels of anti-inflammatory marker IL-10. In addition, BDNF, an anti-depressant marker, showed higher levels compared to the enteritis group, showing results closer to the normal group. This suggests that Lactococcus lactis P22 and Bifidobacterium longum P26 and their mixture are excellent in the prevention, treatment, and improvement of inflammatory diseases and mental disorders.

[0190] 4-3-3. Identification of Inflammatory, Anti-Inflammatory, and Antidepressant Markers in Clostridioides difficile-Infected Mice with Intestinal Dysbiosis

[0191] The levels of TNF-α, IL-1β, IL-2, IL-6, IL-10, IL-17, and BDNF in Clostridioides difficile-infected mice with intestinal dysbiosis that had completed behavioral experiments were measured using ELISA kits. The measurement method was the same as the method for measuring indicators using the ELISA kit above. The results for brain tissue (hippocampus) are as shown in Table 17, and the results for intestinal tissue are as shown in Table 18.

[0192] C. difficile-infected mice (pg / mg) TNF-α IL-1 β IL-6 IL-10 BDNF NC (normal group) 7.1 8.2 6.3 14.6 8.8 Enteritis group 12.9 15.7 12.2 8.9 4.5 Enteritis bacteria / P22 (1x10 8 )8.99.88.513.28.1 Enteritis bacteria / P22(1x10 9 )7.89.17.514.58.4 Enteritis bacteria / P26(1x10 8 )9.410.18.212.87.5 Enterobacteriaceae / P26(1x10 9 )8.19.37.413.98.2 Enteritis bacteria / Mix(4:1) (1x10 9 )7.88.97.214.78.7 Enterobacteriaceae / FMT(1x10 9)9.19.98.813.57.6

[0193] C. difficile-infected mice with gut dysbiosis (pg / mg)MPOTNF-αIL-2IL-6IL-10IL-17NC (normal group)376.86.811.812.45.7enteritis group14519.228.425.57.39.4enteritis / P22 (1x10 8 )7210.313.617.39.77.8 Enteritis bacteria / P22(1x10 9 )639.210.415.910.86.2 Enteritis bacteria / P26(1x10 8 )8911.415.219.29.48.4 Enteritis bacteria / P26(1x10 9 )6910.514.516.58.17.3 Enterobacteriaceae / Mix (4:1) (1x10 9 )619.110.215.211.16.2 Enterobacteriaceae / FMT(1x10 9 )7210.211.816.810.36.9

[0194] As shown in Tables 17 and 18 above, mice administered Lactococcus lactis P22 and Bifidobacterium longum P26 and their mixtures showed lower levels of inflammatory markers TNF-α, MPO, IL-1β, IL-2, IL-6, and IL-17 compared to the enteritis group, and higher levels of anti-inflammatory marker IL-10. In addition, BDNF, an antidepressant marker, showed higher levels compared to the enteritis group.

[0195] In addition, when compared to mice administered fecal suspension, the numerical values ​​were confirmed to be similar or closer to the normal group, suggesting that Lactococcus lactis P22 and Bifidobacterium longum P26 and their mixture are excellent in preventing, treating and improving inflammatory diseases and mental disorders.

[0196] Experimental Example 5. Inhibitory Effects of Toxin A and Toxin B on Intestinal Dysbiosis in Clostridioides difficile-Infected Mice Following Administration of a Mixture of Lactococcus Lactis P22 and Bifidobacterium Longum P26 and Human Fecal Suspension

[0197] Feces from mice infected with Clostridioides difficile with intestinal dysbiosis that were administered lactic acid bacteria (Lactococcus lactis P22 and Bifidobacterium longum P26) or fecal suspension as prepared and as in 4-1-3 and 4-1-4 above were suspended in DNA / RNA Shield reagent (KSS Kyungsik Science, Seoul), and bacterial DNA was extracted using QIAamp Power Fecal Pro DNA kit (Cat. 51804, Qiagen). DNA amplification was performed via qPCR using TB Green Premix Ex Taq II (Product No. RR820A, Takara) and Rotor-Gene Q 5plex platform (Product No. 9001570, Qiagen).

[0198] Primers targeting Toxin A (TcdA) and Toxin B (TcdB) sequences (Table 8) were used to amplify the amplified DNA. The 16S rRNA gene was used as a housekeeping gene to normalize the relative DNA levels of the samples. The reaction conditions were 95°C for 30 s, 95°C for 15 s, 60°C for 20 s, and 72°C for 20 s, for 40 cycles. The results of measuring the expression levels of the toxins are shown in Table 19.

[0199] C. difficile-infected mice with gut dysbiosis (fold change) Toxin AToxin BNC (normal group) 11 enteritis group 98.351.7 enteritis bacteria / P22 (1x10 8 )1.91.2 Enterobacteriaceae / P22(1x10 9 )1.20.5 Enterobacteriaceae / P26(1x10 8 )3.86.3 Enterobacteriaceae / P26(1x10 9 )2.53.6 Enterobacteriaceae / Mix(4:1) (1x10 9 )1.20.3 Enterobacteriaceae / FMT(1x10 9 )2.95.2

[0200] As shown in Table 19 above, the levels of toxin A and toxin B in the feces of mice administered with Lactococcus lactis P22 and Bifidobacterium longum P26 and their mixture were significantly lower, close to or lower than normal levels.

[0201] In addition, when compared to mice administered fecal suspension, the numerical values ​​were confirmed to be similar or closer to the normal group, suggesting that Lactococcus lactis P22 and Bifidobacterium longum P26 and their mixture are excellent in preventing, treating and improving Clostridioides difficile infection.

[0202] Experimental Example 6. Effects of P2226 on rhinitis, asthma, and depression in an animal model of rhinitis / asthma.

[0203] C57BL / 6J mice (8 weeks old, 21-23 g) were randomly divided into four groups (NC, OV, OP, OA; n = 8 per group). On days 1, 7, and 14, ovalbumin (OVA, 20 μg) diluted in potassium aluminum sulfate solution (2 mg / 200 μL) was injected intraperitoneally into the three groups (OV, OP, and OA). The sensitized mice were intranasally administered OVA (10 μL / mouse, 10 mg / mL dissolved in saline) daily from day 21 to day 27. From day 28 to day 34, test substances (OV, saline; OP, 1X10 9 CFU / mouse of P2226; OA, azelastine 1 mg / kg) was administered intragastrically once daily. The NC (normal control group) was administered saline instead of OVA and the test substance.

[0204] On the 34th day, the number of sneezes and nose-scratching (nose-rubbing behavior) was measured for 10 minutes after the final administration of the test substance. The following day, behavioral experiments were conducted, including depression-like behaviors (TC, TD, DC) in the open-field test (OFT), OT in the elevated plus maze test (EPMT), and immobility time (IT) in the tail suspension test (TST). The behavioral experiment method is the same as described in 4-2 above. In addition, a schematic diagram of this experiment is shown in Figure 5.

[0205] After the behavioral experiment, mice were anesthetized, and blood, lung tissue, bronchoalveolar lavage fluid (BALF), and hippocampal tissue were collected. Serum was separated from the collected blood by centrifugation and used as an analytical sample.

[0206] Biomarkers were measured using qPCR. Specifically, mRNA (2 μg) was isolated from the frontal lobe and thalamus using the RNeasy Mini kit, and cDNA was synthesized using a cDNA synthesis kit (TaKaRa). Real-time qPCR for TNF-α, IL-10, IL-1β, IL-4, IL-5, IL-17, TGF-β, IFN-γ, Foxp3, TGF-β, GATA-3, RORγT, and β-actin was performed using SYBER premix Ex Taq II (TaKaRa). PCR was performed under the following conditions: initial denaturation at 95 °C for 30 s, denaturation at 95 °C for 15 s, binding at 60 °C for 30 s, extension at 72 °C for 30 s, and 40 cycles. Gene expression levels were calculated as fold changes relative to β-actin. The primer sequences used for PCR are as shown in Table 20, and the results are as shown in Table 21.

[0207]

[0208] Additionally, inflammatory markers, anti-inflammatory markers, and antidepressant markers were identified using ELISA kits.

[0209] After completing the behavioral experiment, mice were sacrificed, and blood and BALF were separated, followed by nasal, lung, and hippocampal tissues. Serum was separated from the collected blood by centrifugation, and bronchoalveolar lavage fluid (BALF), nasal, lung, and hippocampal tissues were homogenized with RIPA lysis buffer, and the amounts of TNF-α, IL-4, IL-10, IL-17, serotonin, IgE, and BDNF in the centrifuged supernatant were measured using an ELISA kit (R&D system). The ELISA test method was performed according to the manufacturer's instructions. The results are shown in Table 21.

[0210] NCOVOPOA Behavioral Experiment Number of sneezes, nose-rubbing (rubbing) Sneezing / Nose-rubbing counts, SNR counts)4.5±0.619.8±1.59.2±0.717.6±2.2 Median dwell time (TC) (s)102.8±9.858.5±4.885.6±7.672.3±6.2 Total distance traveled (TD) (m)38.5±4.132.4±2.937.3±2.435.9±4.1 Median distance traveled (DC) (m)4.7±0.31.9±0.23.9±0.33.6±0.5 Time spent in open passage (OT) (%)12.8±1.17.7±0.311.8±2.110.9±1.4 Immobility time (IT) (s)75.8±4.9154.8±11.989.2±6.9113.5±14.2nasalIL-4 (fold change)1.0±0.11.5±0.10.7±0.11.2±0.0GATA3 (fold change)1.0±0.01.6±0.21.2±0.11.3±0.2TNF-α (fold change)1.0±0.11.7±0.11.1±0.11.4±0.1TGF-β (fold change)1.0±0.11.6±0.21.2±0.01.4±0.1IL-17 (fold change)1.0±0.04.2±0.31.4±0.11.7±0.3RORγt (fold change)1.0±0.13.1±0.21.3±0.12.5±0.5IL-10 (fold change)1.0±0.10.7±0.11.3±0.21.1±0.1Foxp3 (fold change)1.0±0.10.6±0.11.1±0.10.9±0.1IL-5 (fold change)1.0±0.01.8±0.20.9±0.21.4±0.2IL-1β (fold change)1.0±0.13.1±0.31.4±0.12.2±0.3Bronchoalveolar lavage fluid (BALF)IL-4 (fold change)1.0±0.111.2±1.73.4±0.25.6±0.6IL-5 (fold change)1.0±0.119.1±1.33.7±0.49.2±1.3IL-10 (fold change)1.0±0.10.6±0.11.2±0.10.9±0.1IL-17 (fold change)1.0±0.12.7±0.31.3±0.01.6±0.3TNF-α (fold change)1.0±0.12.9±0.21.4±0.22.0±0.4폐(lung)IL-4 (fold change)1.0±0.121.1±1.64.4±0.56.3±0.3IL-5 (fold change)1.0±0.018.3±1.217.1±1.919.4±1.8IL-10 (fold change)1.0±0.10.6±0.01.2±0.10.9±0.2IL-17 (fold change)1.0±0.12.8±0.31.6±0.22.5±0.4TNF-α (fold change)1.0±0.12.2±0.21.4±0.22.0±0.3혈액(blood)IL-4 (pg / mg)4.3±0.217.5±1.33.6±0.510.9±1.4IgE (pg / mg)40.2±3.488.4±4.962.3±4.774.5±6.2IL-10 (pg / mg)18.5±1.213.4±1.119.5±2.414.8±1.7IL-17 (pg / mg)28.8±2.845.8±4.231.5±4.235.4±4.7해마(hippocampus)세로토닌 (pg / mg)9.2±0.45.3±0.39.1±0.66.8±0.9BDNF (pg / mg)265.4±20.5213.8±22.4258.5±11.4222.1±19.3TNF-α (pg / mg)51.6±2.677.4±3.955.8±3.767.3±7.4IL-10 (pg / mg)112.8±9.658.9±5.297.1±7.273.5±6.9IL-17 (pg / mg)52.5±4.883.8±5.256.3±4.673.4±8.2IL-4 (pg / mg)8.1±0.616.9±1.97.5±0.312.7±0.9.

[0211] As shown in Table 21, when P2226 (OP) was administered to rhinitis and / or asthma, the number of sneezing and nose scratching (rubbing) was reduced by more than half, alleviating upper airway hyperresponsiveness, and all behavioral indices were close to those of the normal group (NC), confirming improvement in anxiety and / or depressive-like behavior. In addition, in the nasal cavity, BALF, and lung tissues, the expression of Th2 (IL-4, IL-5, GATA-3), Th17 (IL-17, RORγt), and inflammation (TNF-α, IL-1β)-related genes and proteins was significantly reduced, and the anti-inflammatory cytokine IL-10 and regulatory T cell indicator Foxp3 were restored, confirming improvement in inflammation and normalization of the immune environment.

[0212] In addition, it was confirmed that serum IgE and IL-4, hippocampal TNF-α and IL-17 decreased, and serotonin, BDNF, and IL-10 increased, resulting in simultaneous improvement in systemic allergy and depression indices.

[0213] The above results suggest that P2226 of the present invention is a highly functional composition capable of simultaneously treating airway inflammation such as rhinitis and asthma, and accompanying anxiety and / or depression symptoms.

[0214] Experimental Example 7. Effects of improving COPD and depression in an animal model of chronic obstructive pulmonary disease (COPD).

[0215] Mice (8 weeks old, 21-23 g) were randomly divided into three groups (NC, PE, and PP; n = 8 per group) and anesthetized with 750 mg / kg urethane (dissolved in sterile saline) by intraperitoneal injection on day 20. After that, the [PE and PP] groups were intratracheally administered 25 U porcine pancreatic elastase (25 units / 100 g mouse, dissolved in 0.1 mL saline), and the NC group was intratracheally administered saline. From day 28 to day 34, the test substances (PE, saline; PP, 1X10 9CFU / mouse of P2226) was administered intragastrically once a day. The NC (normal control group) was administered saline instead of porcine pancreatic elastase and the test substance.

[0216] On the 34th day, the number of sneezes and nose-scratching (nose rubbing) was measured for 1 hour after the final administration of the test drug. The following day, behavioral experiments were conducted, including measures of depression-like behaviors (TC, TD, DC) in the open-field test (OFT), OT in the elevated plus maze test (OPMT), and immobility time (IT) in the tail suspension test (TST). The behavioral experiment method is the same as described in 4-2 above. A schematic diagram of this experiment is also shown in Figure 6.

[0217] After the behavioral experiment, the mice were anesthetized, and blood, lung tissue, bronchoalveolar lavage fluid (BALF), and hippocampal tissue were collected. Serum was separated from the collected blood by centrifugation and used as an analytical sample. The expression level of each biomarker gene was then calculated as a fold change relative to β-actin using qPCR. In addition, inflammatory, anti-inflammatory, and antidepressant markers were identified using ELISA kits. The measurement methods using qPCR and ELISA were the same as those in Experimental Example 6, and the results are shown in Table 22.

[0218] NCPEPP(행동실험)재채기, 코 긁기(비빔) 횟수 Sneezing / Nose-rubbing counts, SNR counts)3.8±0.48.9±1.34.7±0.6TC (s)96.7±9.178.6±9.289.7±9.1TD (m)39.8±4.633.6±5.238.6±4.2DC (m)4.1±0.62.6±0.43.7±0.2OT(%)14.7±0.99.5±1.213.7±2.8IT(s)94.7±8.7134.5±11.499.8±11.5비강(nasal)IL-4 (fold change)1.0±0.11.1±0.10.9±0.1TNF-α(fold change)1.0±0.11.3±0.11.1±0.1IL-17(fold change)1.0±0.01.5±0.11.2±0.1IL-10(fold change)1.0±0.10.8±0.11.1±0.0IL-5(fold change)1.0±0.11.3±0.11.0±0.1기관지폐포세척액(BALF)IL-4 (fold change)1.0±0.21.3±0.11.2±0.1IL-5(fold change)1.0±0.11.4±0.21.3±0.1IL-10(fold change)1.0±0.10.6±0.21.1±0.1IL-17(fold change)1.0±0.04.3±0.31.4±0.2TNF-α(fold change)1.0±0.13.5±0.21.6±0.3폐(lung)IL-4 (fold change)1.0±0.21.3±0.31.1±0.1IL-5(fold change)1.0±0.11.4±0.41.1±0.3IL-10(fold change)1.0±0.20.6±0.11.3±0.2IL-17(fold change)1.0±0.29.4±1.51.3±0.5TNF-α(fold change)1.0±0.12.8±0.41.2±0.3TGF-β(fold change)1.0±0.11.7±0.21.1±0.3GATA3(fold change)1.0±0.01.1±0.11.1±0.1RORγt(fold change)1.0±0.14.9±0.61.2±0.4Foxp3(fold change)1.0±0.00.7±0.11.1±0.1BloodTNF-α (pg / mg)54.3±0.576.7±0.959.1±0.2IL-10 (pg / mg)17.7±1.912.1±1.518.8±2.5IL-17 (pg / mg)19.2±2.241.5±5.723.1±3.2HippocampusSerotonin (pg / mg)8.6±0.74.7±0.68.9±0.7BDNF (pg / mg)212.0±14.3176.7±10.8206.8±12.1TNF-α (pg / mg)46.5±3.268.9±6.951.3±4.2IL-10 (pg / mg)126.8±14.867.8±5.3117.9±10.4IL-17(pg / mg)48.7±0.482.9±5.952.5±3.9IL-4(pg / mg)7.5±0.512.6±2.18.2±0.6.

[0219] As shown in Table 22, for chronic obstructive pulmonary disease (COPD), when P2226 was administered, the number of sneezes and nose scratching (rubbing) decreased, and all behavioral indicators were significantly improved, confirming that respiratory symptoms and depressive-like behaviors were simultaneously alleviated.

[0220] In addition, inflammatory and Th17 / Th2 markers such as TNF-α, IL-17, IL-4 / 5, and RORγt were significantly reduced in nasal, BALF, and lung tissues, and IL-10 and Foxp3 were restored, indicating suppression of lung inflammation and restoration of immune balance. Furthermore, serum inflammatory cytokines, hippocampal inflammatory markers (TNF-α, IL-17), and antidepressant markers (serotonin, BDNF, IL-10) also returned to normal levels, confirming the simultaneous improvement of systemic and / or mental symptoms through the lung-brain axis.

[0221] The above results suggest that P2226 of the present invention can simultaneously improve chronic obstructive pulmonary disease and related mental stress symptoms (anxiety, depression, etc.), and thus has high potential for use as an integrated treatment.

[0222] Experimental Example 8. Improvement of rhinitis / asthma, COPD, and depression in animal models of rhinitis / asthma and COPD.

[0223] Mice (8 weeks old, 21-23 g) were randomly divided into three groups (NC, OvP, and OpP; n = 8 per group). Both groups (OvP and OpP) received intraperitoneal injections of OVA (20 μg) diluted in potassium aluminum sulfate solution (2 mg / 200 μL) on days 1, 7, and 14. The NC group was treated with saline instead of OVA. On day 20, the mice were anesthetized with an intraperitoneal injection of 750 mg / kg urethane (dissolved in sterile saline) and then administered 25 U porcine pancreatic elastase (25 units / 100 g mouse [OvP and OpP groups], dissolved in 0.1 mL saline). The NC group received intratracheal saline. The OvP and OpP groups were administered intranasally OVA (10 μL / nostril, 10 mg / mL dissolved in saline) daily from day 21 to day 27. Test substances (OvP, saline; OpP, 1Х10 9 CFU / mouse of P2226) was administered orally once daily from day 28 to day 34. The NC (normal control group) was administered saline instead of OVA, PE, and test substances.

[0224] On the 34th day, the number of sneezes and nose scratches (nose rubbing movements) was measured for 10 minutes after the final administration of the test substance. The following day, as a behavioral experiment, depression-like behaviors (TC, TD, DC) were measured in the open field test (OFT), OT in the elevated plus maze test (OPMT), and immobility time (IT) in the tail suspension test (TST). The method of the behavioral experiment is the same as that in 4-2 above. In addition, a schematic diagram of this experiment is shown in Figure 7.

[0225] After the behavioral experiment, the mice were anesthetized, and blood, lung tissue, bronchoalveolar lavage fluid (BALF), and hippocampal tissue were collected. Serum was separated from the collected blood by centrifugation and used as an analytical sample. The expression level of each biomarker gene was then calculated as a fold change relative to β-actin using qPCR. In addition, inflammatory, anti-inflammatory, and antidepressant markers were identified using ELISA kits. The measurement methods using qPCR and ELISA were the same as those in Experimental Example 6, and the results are shown in Table 23.

[0226] NCOvPOpP(행동실험)재채기, 코 긁기(비빔) 횟수 Sneezing / Nose-rubbing counts, SNR counts)4.1±0.520.2±3.79.8±1.6TC (s)105.8±11.257.5±3.984.9±10.3TD (m)37.9±4.729.8±4.236.9±3.6DC (m)4.8±3.81.3±0.13.8±0.2OT(%)11.7±2.36.9±0.810.6±2.1IT(s)93.5±7.3164.5±12.3106.2±8.1비강(nasal)IL-4 (fold change)1.0±0.21.6±0.20.8±0.1GATA3 (fold change)1.0±0.11.5±0.21.3±0.1TNF-α (fold change)1.0±0.11.9±0.31.3±0.1TGF-β (fold change)1.0±0.11.7±0.21.2±0.0IL-17 (fold change)1.0±0.34.9±0.41.4±0.5RORγt (fold change)1.0±0.23.7±0.51.5±0.3IL-10 (fold change)1.0±0.10.6±0.11.2±0.1Foxp3 (fold change)1.0±0.10.5±0.21.2±0.0IL-5 (fold change)1.0±0.21.9±0.21.1±0.1기관지폐포세척액(BALF)IL-4 (fold change)1.0±0.215.2±2.33.1±0.4IL-5 (fold change)1.0±0.328.1±3.45.5±0.3IL-10 (fold change)1.0±0.10.5±0.11.1±0.1IL-17 (fold change)1.0±0.13.1±0.41.4±0.3TNF-α (fold change)1.0±0.13.0±0.31.3±0.4폐(lung)IL-4 (fold change)1.0±0.228.8±3.64.9±0.7IL-5 (fold change)1.0±0.225.4±1.96.2±0.9IL-10 (fold change)1.0±0.10.5±0.11.1±0.1IL-17 (fold change)1.0±0.213.2±2.64.7±1.4TNF-α (fold change)1.0±0.23.1±0.41.3±0.2TGF-β (fold change)1.0±0.11.8±0.21.1±0.1GATA3 (fold change)1.0±0.21.6±0.21.1±0.1RORγt (fold change)1.0±0.28.4±0.91.7±0.3Foxp3 (fold change)1.0±0.20.5±0.10.9±0.1Blood(blood)IL-4 (pg / mg)4.2±0.623.9±3.88.6±1.2IgE (pg / mg)38.6±5.289.6±9.149.5±7.3IL-10 (pg / mg)20.5±1.212.1±0.820.9±3.5IL-17 (pg / mg)27.5±2.948.7±5.733.2±4.2HippocampusSerotonin (pg / mg)9.4±0.85.1±0.49.0±1.5BDNF (pg / mg)255.6±10.2201.8±10.9249.7±13.3TNF-α (pg / mg)52.3±4.781.3±7.257.2±6.3IL-10 (pg / mg)109.4±8.853.7±6.896.3±10.1IL-17(pg / mg)53.6±4.390.1±7.757.1±6.2IL-4 (pg / mg)8.2±0.617.4±2.77.9±1.5.

[0227] As shown in Table 23, in the complex disease of rhinitis, asthma, and chronic obstructive pulmonary disease, P2226 administration was confirmed to have an effect of alleviating the symptoms of rhinitis, asthma, and chronic obstructive pulmonary disease. The frequency of sneezing and nose scratching (rubbing) was reduced by more than half, alleviating upper airway hyperresponsiveness, and all behavioral indicators were significantly improved. In addition, Th2 and Th17 cytokines were broadly suppressed in the nasal cavity, BALF, and lung tissue, and IL-10 and Foxp3 were restored, simultaneously alleviating allergic inflammation and COPD-related inflammation. In addition, serum IgE, IL-4, and hippocampal TNF-α, IL-17 were decreased, and serotonin and BDNF were increased, confirming the effect of simultaneous improvement of systemic and / or psychiatric symptoms.

[0228] The above results suggest that P2226 of the present invention can consistently improve multiple respiratory diseases and related mental symptoms.

[0229] That is, P2226 of the present invention suppressed Th2, Th17-related cytokines and TNF-α in all respiratory disease-related models, and restored IL-10 and Foxp3, thereby normalizing hyperinflammation throughout the airways, lungs, and brain, thereby simultaneously alleviating respiratory clinical signs and anxiety and / or depressive behaviors. This indicates that the lactic acid bacteria of the present invention can manage complex diseases, and thus has high potential for use in treatment and clinical improvement.

[0230] The foregoing description of the present invention is for illustrative purposes only, and those skilled in the art will readily appreciate that the present invention can be readily modified into other specific forms without altering the technical spirit or essential characteristics of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive. For example, each component described as a single entity may be implemented in a distributed manner, and similarly, components described as distributed may be implemented in a combined manner.

[0231] The scope of the present invention is indicated by the claims set forth below, and all changes or modifications derived from the meaning and scope of the claims and their equivalent concepts should be interpreted as being included in the scope of the present invention.

[0232] [Accession number]

[0233] Name of depositor: Korea Center for Microbiological Conservation (KCCM)

[0234] Accession number: KCCM13443P

[0235] Date of acceptance: 20231222

[0236]

[0237] Name of depositor: Korea Center for Microbiological Conservation (KCCM)

[0238] Accession number: KCCM13444P

[0239] Date of acceptance: 20231222

[0240]

[0241]

[0242]

[0243]

[0244]

Claims

1. Lactococcus lactis P22 strain deposited under accession number KCCM 13443P.

2. In paragraph 1, The above strain is a Lactococcus lactis P22 strain comprising a 16S rDNA base sequence of sequence number 1.

3. Bifidobacterium longum P26 strain deposited under accession number KCCM 13444P.

4. In paragraph 3, The above strain is a Bifidobacterium longum P26 strain comprising the 16S rDNA base sequence of sequence number 2.

5. An antibacterial composition comprising Lactococcus lactis P22 strain, Bifidobacterium longum P26 strain or a mixture thereof.

6. A pharmaceutical composition for preventing or treating Clostridioides difficile or Clostridium symbiosum infection, comprising the composition of paragraph 5.

7. A pharmaceutical composition for preventing or treating inflammatory diseases, respiratory diseases or mental disorders, comprising Lactococcus lactis P22 strain, Bifidobacterium longum P26 strain or a mixture thereof.

8. In paragraph 7, A pharmaceutical composition wherein the inflammatory disease is enteritis.

9. In paragraph 7, A pharmaceutical composition, wherein the above respiratory disease is at least one selected from the group consisting of rhinitis, asthma, chronic obstructive pulmonary disease, pharyngitis, tonsillitis, bronchitis, and pneumonia.

10. In paragraph 7, A pharmaceutical composition, wherein the above mental disorder is at least one selected from the group consisting of anxiety disorder, depression, stress-related disorder, mood disorder, sleep disorder, memory disorder, cognitive disorder, and attention disorder.

11. In paragraph 7, The above mixture is a pharmaceutical composition in which Lactococcus lactis P22 and Bifidobacterium longum P26 are mixed in a colony forming unit (CFU) ratio of 0.2:1 to 5:

1.

12. In paragraph 7, A pharmaceutical composition wherein the above Lactococcus lactis P22 or Bifidobacterium longum P26 is a live cell thereof, a dead cell thereof, a culture thereof, a lysate thereof or an extract thereof.

13. A food composition for preventing or improving inflammatory diseases, respiratory diseases or mental disorders, comprising Lactococcus lactis P22 strain, Bifidobacterium longum P26 strain or a mixture thereof.

14. In the above 13th paragraph, The above inflammatory disease is enteritis, food composition.

15. In paragraph 13, A food composition, wherein the above respiratory disease is at least one selected from the group consisting of rhinitis, asthma, chronic obstructive pulmonary disease, pharyngitis, tonsillitis, bronchitis, and pneumonia.

16. In paragraph 13, A food composition wherein the above mental disorder is at least one selected from the group consisting of anxiety disorder, depression, stress-related disorder, mood disorder, sleep disorder, memory disorder, cognitive disorder, and attention disorder.

17. In Article 13 The above mixture is a food composition in which Lactococcus lactis P22 and Bifidobacterium longum P26 are mixed in a colony forming unit (CFU) ratio of 0.2:1 to 5:

1.

18. In Article 13 A food composition wherein the above Lactococcus lactis P22 or Bifidobacterium longum P26 is a live cell thereof, a dead cell thereof, a culture thereof, a lysate thereof or an extract thereof.

19. A method for treating an inflammatory disease, respiratory disease or mental disorder, comprising administering to a subject a Lactococcus lactis P22 strain, a Bifidobacterium longum P26 strain or a mixture thereof.

20. A method for improving an inflammatory disease, respiratory disease or mental disorder, comprising administering to a subject a Lactococcus lactis P22 strain, a Bifidobacterium longum P26 strain or a mixture thereof.

21. Use of Lactococcus lactis P22 strain, Bifidobacterium longum P26 strain or a mixture thereof for the treatment of inflammatory diseases, respiratory diseases or mental disorders.

22. Use of Lactococcus lactis P22 strain, Bifidobacterium longum P26 strain or a mixture thereof for improving inflammatory diseases, respiratory diseases or mental disorders.

Images