Gold-labeled chain length-mediated gold colloid test strip sensor, and preparation method therefor and use thereof
By designing complementary gold-labeled probes and optimizing sodium chloride concentration, two test strips were constructed, solving the problems of high cost and false positives in existing SNP detection equipment, and achieving rapid and accurate SNP site detection.
Patent Information
- Application Number
- PCT/CN2024/108437
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-07-30
- Publication Date
- 2026-02-05
AI Technical Summary
Existing SNP detection methods require expensive specialized equipment or complex operations, and are prone to false positive results, making it difficult to achieve rapid, visualized, and low-cost detection.
Two gold-labeled probes were designed to be completely complementary to wild-type sites (T/T) and mutant sites (C/C), respectively. The chain length of the gold-labeled probes and the sodium chloride concentration were optimized to construct two test strips. By applying samples to different test strips, SNP sites can be distinguished, eliminating false positive results.
It enables rapid, accurate, visualized, and low-cost SNP detection, effectively distinguishing SNP sites and avoiding false positive results.
Smart Images

Figure CN2024108437_05022026_PF_FP_ABST
Abstract
Description
Gold chain length-mediated colloidal gold test paper sensor, its preparation method and application Technical Field
[0001] This invention relates to the field of molecular detection technology, and in particular to a colloidal gold test paper sensor mediated by gold chain length, its preparation method, and its application. Background Technology
[0002] Human genome mutations are closely related not only to hereditary diseases but also to susceptibility to non-hereditary diseases. Furthermore, the types of mutations in the genome significantly affect drug and treatment responses, making their detection crucial. The most prevalent and stably inherited type of sequence variation in the human genome is the single nucleotide polymorphism (SNP). Studies have shown a close relationship between the development and treatment response of some tumors and SNPs; therefore, SNP analysis can effectively assist in the early diagnosis, risk assessment, and personalized medicine of malignant tumors. Currently, conventional SNP detection methods mainly include DNA sequencing, allele-specific DNA hybridization, fluorescence resonance energy transfer based on molecular beacons, electrochemical typing, and mass array methods. These methods can accurately detect SNP mutations (or typing), but their limitations include the need for expensive specialized equipment or complex operations by skilled technicians, thus limiting their applicability. For many applications (such as initial disease screening), rapid, visual, and low-cost detection methods are required; therefore, methods that can directly visualize SNPs without the aid of specialized equipment are the optimal choice.
[0003] As a visual testing tool, test strips rely on the visual observation of the test line to determine the result. For a negative result, the test line should not have any visible color; otherwise, false positives will occur, affecting the interpretation of the result. Therefore, there is an urgent need for a test strip that can effectively avoid false positive results.
[0004] Summary of the Invention
[0005] In view of this, the purpose of this invention is to provide a colloidal gold test strip sensor mediated by gold-labeled chain length, its preparation method and application. The colloidal gold test strip sensor mediated by gold-labeled chain length provided by this invention can effectively avoid false positive results, has high accuracy, and has the advantages of being fast, visual and low cost.
[0006] To achieve the above objectives, the present invention provides the following technical solution:
[0007] A colloidal gold test strip sensor mediated by gold-labeled chain length, the colloidal gold test strip sensor includes a first gold-labeled test strip and a second gold-labeled test strip; both the first and second gold-labeled test strips include a sample pad, a conjugate pad, a nitrocellulose membrane, and an absorbent pad, which are fixed to a PVC base plate from left to right.
[0008] The conjugate pad is immobilized with a gold-labeled probe, wherein the first gold-labeled test strip has a first gold-labeled probe immobilized on the conjugate pad, the first gold-labeled probe containing the nucleotide sequence shown in SEQ ID NO.1; the second gold-labeled test strip has a second gold-labeled probe immobilized on the conjugate pad, the second gold-labeled probe containing the nucleotide sequence shown in SEQ ID NO.2.
[0009] The nitrocellulose membrane includes, from left to right, a detection line and a control line, wherein a detection probe is fixed on the detection line and a control probe is fixed on the control line; the detection probe contains the nucleotide sequence shown in SEQ ID NO.3; the control probe of the first gold-labeled test strip is a first control probe, which contains the nucleotide sequence shown in SEQ ID NO.4; the control probe of the second gold-labeled test strip is a second control probe, which contains the nucleotide sequence shown in SEQ ID NO.5.
[0010] Preferably, the colloidal gold test paper sensor further includes a sample processing solution, which includes a first sample processing solution and a second sample processing solution; wherein the first sample processing solution contains an upstream primer and a downstream primer, and the second sample processing solution contains an upstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.6, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.7.
[0011] Preferably, the detection probe and the quality control probe further include biotin and streptavidin.
[0012] Preferably, the result judgment criteria of the colloidal gold test paper sensor are as follows:
[0013] The first gold standard test strip shows color in both the test line and the control line, while the second gold standard test strip shows no color in the test line but color in the control line, indicating that the detection site of the sample is T / T.
[0014] The first gold standard test strip has no color development in the test line but a color development in the control line. The second gold standard test strip has color development in both the test line and the control line, indicating that the detection site of the sample is C / C.
[0015] Both the test line and control line of the first and second gold standard test strips show color development, indicating that the detection site of the sample is T / C.
[0016] This invention also provides a method for preparing the colloidal gold test paper sensor mediated by the gold chain length described in the above technical solution, comprising the following steps:
[0017] S1. Prepare gold-labeled probes, detection probes, and quality control probes;
[0018] S2. Prepare the sample pad;
[0019] S3. Spray the gold-labeled probe onto the conjugate pad, spray the first gold-labeled probe onto the first gold-labeled test strip, and spray the second gold-labeled probe onto the second gold-labeled test strip.
[0020] S4. Spraying detection probes onto the nitrocellulose membrane to form detection lines and spraying quality control probes to form quality control lines; wherein, the quality control lines of the first gold-labeled test strip are coated with the first quality control probe, and the quality control lines of the second gold-labeled test strip are coated with the second quality control probe.
[0021] S5. Adhere the sample pad, conjugate pad, nitrocellulose membrane and absorbent pad to the PVC base plate from left to right. One end of the test line on the nitrocellulose membrane is close to the conjugate pad, and the other end of the control line is close to the absorbent pad. There is a 1mm to 3mm overlap between each two parts of the sample pad, conjugate pad, nitrocellulose membrane and absorbent pad to obtain the assembled gold standard test strip.
[0022] S6. Cut the assembled gold label test strips into 2mm to 4mm widths and store them at room temperature to dry.
[0023] Preferably, the gold sputtering concentration of the gold-labeled probe in S3 is 4 μL / cm to 6 μL / cm.
[0024] Preferably, the binding pad in S3 needs to be soaked in buffer solution and dried before spraying the gold-labeled probe.
[0025] Preferably, the spray concentration of the detection probe in S4 is 0.5 μL / cm to 1.5 μL / cm; the spray concentration of the quality control probe in S4 is 0.5 μL / cm to 1.5 μL / cm.
[0026] Preferably, the distance between the detection line and the quality control line in S4 is 4mm to 6mm.
[0027] The present invention also provides an application of the gold chain length-mediated colloidal gold test strip sensor described above in a drug for detecting cytochrome P4501A1 gene mutations.
[0028] Beneficial Technical Effects: This invention provides a gold-labeled chain length-mediated colloidal gold test strip sensor, its preparation method, and its application. This invention designs two gold-labeled probes that are completely complementary to wild-type sites (T / T) and mutant sites (C / C), respectively. The chain length of the gold-labeled probes and the sodium chloride concentration are optimized, and two test strips are constructed based on the two gold-labeled probes. In practical operation, simply loading the sample onto the two test strips effectively distinguishes SNP sites and eliminates false positive results. Furthermore, the gold-labeled chain length-mediated colloidal gold test strip sensor of this invention has high accuracy and offers advantages such as speed, visualization, and low cost. Attached Figure Description
[0029] Figure 1 shows the structure of the colloidal gold nucleic acid test strip and its application in SNP detection;
[0030] Figure 2 shows the UV-Vis absorption spectra of colloidal gold and the gold-labeled probe AuNP-DNA probe;
[0031] Figure 3 shows the detection results of samples with different SNP sites on different test strips in 300mM (A), 200mM (B), 100mM (C) and 50mM (D) NaCl (20mM Tris-HCl, pH 8.2);
[0032] Figure 4 shows the effect of different concentrations of SNP site sequences on the detection results of 11G and 12A test strips;
[0033] Figure 5 shows the electrophoresis results of the first and second step PCR products at different concentrations; lanes 1-3 contain PCR products (67 bp) with 100 ng, 50 ng, and 10 ng gDNA as templates, respectively; lanes 1-6 contain single-stranded DNA (67 nt) obtained by second step PCR using the PCR products of lanes 1-3 as templates; lanes 7-9 contain single-stranded DNA (67 nt) with 500 nM, 200 nM, and 100 nM, respectively.
[0034] Figure 6 shows the UV-Vis absorption curves of single-stranded DNA at different concentrations; in the inset a: lane 1 is the product of the second step PCR (67bp); lanes 2 and 3 are the single-stranded DNA products recovered from gel DNA recovery and concentrated 2-fold and 1-fold, respectively; lanes 4-6 are 500nM, 200nM, and 100nM single-stranded DNA (67nt), respectively; inset b: linear curve of optical density at 260nm versus 20nM-500nM 67nt single-stranded DNA.
[0035] Figure 7 shows the comparison between sequencing results and test strip detection results; where TZ represents the test line and CZ represents the control line. Detailed Implementation
[0036] This invention provides a colloidal gold test strip sensor mediated by gold label chain length. The colloidal gold test strip sensor includes a first gold label test strip and a second gold label test strip. Both the first and second gold label test strips include a sample pad, a conjugate pad, a nitrocellulose membrane, and an absorbent pad, which are fixed to a PVC base plate from left to right.
[0037] The conjugate pad is immobilized with a gold-labeled probe, wherein the first gold-labeled test strip has a first gold-labeled probe immobilized on the conjugate pad, the first gold-labeled probe containing the nucleotide sequence shown in SEQ ID NO.1; the second gold-labeled test strip has a second gold-labeled probe immobilized on the conjugate pad, the second gold-labeled probe containing the nucleotide sequence shown in SEQ ID NO.2.
[0038] The nitrocellulose membrane includes, from left to right, a detection line and a control line, wherein a detection probe is fixed on the detection line and a control probe is fixed on the control line; the detection probe contains the nucleotide sequence shown in SEQ ID NO.3; the control probe of the first gold-labeled test strip is a first control probe, which contains the nucleotide sequence shown in SEQ ID NO.4; the control probe of the second gold-labeled test strip is a second control probe, which contains the nucleotide sequence shown in SEQ ID NO.5.
[0039] The structure of the colloidal gold test paper sensor mediated by the gold chain length of the present invention is shown in Figure 1A.
[0040] The detection site of the colloidal gold test strip sensor mediated by the gold chain length described in this invention is the 4889th base (rs1048943) of exon 7 of the cytochrome P4501A1 gene. If the A at this site is replaced by G, the encoded amino acid will change from IIe to Val, resulting in three types of genotyping: homozygous wild-type (IIe / IIe or A / A), homozygous mutant (Val / Val or G / G), and heterozygous mutant (IIe / Val or A / G). Mutations at this site are associated with the occurrence of various cancers, such as liver cancer, lung cancer, and breast cancer. Cytochrome P450 enzymes are typically involved in the metabolism of exogenous chemicals, such as drugs, carcinogens, and other environmental pollutants. The aryl hydrocarbon hydroxylase encoded by the mutated site can catalyze the reaction of polycyclic aromatic hydrocarbon environmental carcinogens (such as benzo[a]pyrene) into carcinogenic intermediates, while its detoxification ability for heterocyclic amines such as N-nitrosamines is reduced, leading to an increased incidence of cancer. Therefore, testing this gene locus can predict the risk of developing cancer, allowing at-risk individuals to prevent or delay the onset of cancer by improving external factors.
[0041] In this invention, the absorbent pad is preferably absorbent paper.
[0042] In this invention, the colloidal gold test paper sensor preferably further includes a sample processing solution, which includes a first sample processing solution and a second sample processing solution; wherein the first sample processing solution contains an upstream primer and a downstream primer, and the second sample processing solution contains an upstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.6, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.7.
[0043] In this invention, the sample processing solution further includes 2×Premix Taq. TM And sterile water; the sample processing solution is used for the preparation of the test sample, wherein the first sample processing solution is used for the first PCR to obtain the target double-stranded DNA; the second sample processing solution is used for the second PCR to obtain the target single-stranded DNA.
[0044] In this invention, the nucleotide sequences of SEQ ID NO.1 to SEQ ID NO.7 are as follows:
[0045] SEQ ID NO.1: GAGACCATTGCC;
[0046] SEQ ID NO.2: AGACCGTTGCC;
[0047] SEQ ID NO.3: GCTGGGAGGTCT;
[0048] SEQ ID NO.4: GGCAATGGTCTC;
[0049] SEQ ID NO.5: GGCAACGGTCTC;
[0050] SEQ ID NO.6: GCAGGATAGCCAGGAAGAG;
[0051] SEQ ID NO.7: GGCAAGCGGAAGTGTATC.
[0052] In this invention, the detection probe and the quality control probe further include biotin and streptavidin (SA); wherein, the detection probe and the quality control probe are first reacted with biotin to form a biotinylated detection probe (Biotin-DNA probe T) and a biotinylated quality control probe (Biotin-DNA probe C), respectively, and then reacted with streptavidin to form the detection probe complex SA-biotin-DNA-T and the quality control probe complex SA-biotin-DNA-C, respectively.
[0053] In the present invention, the result determination standard of the colloidal gold test strip sensor is as follows: both the test line and the quality control line of the first gold-labeled test strip are colored; the test line of the second gold-labeled test strip is not colored and the quality control line is colored, indicating that the test site of the test sample is T / T; the test line of the first gold-labeled test strip is not colored and the quality control line is colored, and both the test line and the quality control line of the second gold-labeled test strip are colored, indicating that the test site of the test sample is C / C; both the test line and the quality control line of the first gold-labeled test strip and the second gold-labeled test strip are colored, indicating that the test site of the test sample is T / C. The detection steps of the colloidal gold test strip sensor mediated by the gold-labeled chain length in the present invention are shown in Figure 1B. If the DNA strand modified on the colloidal gold is too short, it will affect its binding to the target single-stranded DNA, resulting in both the wild SNP fragment and the mutant SNP fragment being unable to bind to the gold-labeled probe (T>Tm), causing the T lines of the test strip to not be colored; while if the DNA probe strand is too long, both the wild SNP fragment and the mutant SNP fragment can bind to the gold-labeled probe (T<Tm), resulting in false positive results. The present invention designs two gold-labeled probes, which are completely complementary to the wild-type site (T / T) and the mutant site (C / C) respectively, optimizes the gold-labeled probe chain length and the sodium chloride concentration, and constructs two test strips based on the two gold-labeled probes respectively. In actual operation, only by applying the sample on the two test strips respectively, the SNP sites can be effectively distinguished and the generation of false positive results can be eliminated.
[0054] The present invention also provides a preparation method for the colloidal gold test strip sensor mediated by the gold-labeled chain length as described in the above technical solution, including the following steps:
[0055] S1. Prepare the gold-labeled probe, the detection probe and the quality control probe;
[0056] S2. Prepare the sample pad;
[0057] S3. Spray and draw the gold-labeled probe on the conjugate pad respectively, spray and draw the first gold-labeled probe on the first gold-labeled test strip, and spray and draw the second gold-labeled probe on the second gold-labeled test strip;
[0058] S4. Spray and draw the detection probe on the nitrocellulose membrane to form a test line, and spray and draw the quality control probe to form a quality control line; among them, the quality control line of the first gold-labeled test strip is sprayed with the first quality control probe, and the quality control line of the second gold-labeled test strip is sprayed with the second quality control probe;
[0059] S5. Adhere the sample pad, the conjugate pad, the nitrocellulose membrane and the absorbent pad to the PVC bottom plate in sequence from left to right, with the end of the test line on the nitrocellulose membrane close to the conjugate pad and the end of the quality control line close to the absorbent pad. There is an overlap of 1 mm to 3 mm between every two parts of the sample pad, the conjugate pad, the nitrocellulose membrane and the absorbent pad, to obtain the assembled gold-labeled test strip;
[0060] S6. Cut the assembled gold-labeled test strip into a width of 2 mm to 4 mm and store it in dry at room temperature.
[0061] This invention first prepares a gold-labeled probe, a detection probe, and a quality control probe.
[0062] In this invention, the preferred method for preparing the gold-labeled probe is as follows:
[0063] ① Preparation of colloidal gold: Add trisodium citrate solution to heated aqueous chloroauric acid (HAuCl4), continue stirring and reflux. The solution color gradually changes from colorless and black to dark red. Continue heating, cool to room temperature, filter to remove large particles, and set aside.
[0064] ② Preparation of gold-labeled probes: Tris(2-carboxyethyl)phosphine (TCEP) was added to a solution of thiol-modified DNA (nucleotide sequence SEQ ID NO.1 or SEQ ID NO.2). The final concentration was adjusted to eliminate disulfide bonds between primers. The treated thiol-modified DNA probe was added to colloidal gold for reaction. Buffer and SDS were added, and the mixture was shaken at room temperature. Sodium chloride was added, and the mixture was aged at room temperature. After centrifugation, the supernatant was discarded, and the red precipitate was resuspended in resuspension buffer. This process was repeated three times. Finally, the gold-labeled probes (first gold-labeled probe AuNP-DNA probe A or second gold-labeled probe AuNP-DNA probe G) were obtained by resuspending the probes in buffer and stored for later use. In this invention, the final concentration of sodium chloride is preferably 200 mM. The sodium chloride concentration also has a significant impact on detection. A suitable sodium chloride concentration can promote hybridization between the gold-labeled DNA and the target single strand and increase the Tm temperature. Too high a concentration can easily lead to false positives, while too low a concentration will result in an undetectable signal. Therefore, the elimination of false positive results is crucial in visual detection. Using the sodium chloride concentration of this invention, false positive results can be effectively eliminated, thereby achieving accurate visual detection of SNP sites.
[0065] In this invention, the preparation method of the detection probe and the quality control probe preferably includes the following steps:
[0066] ①Preparation of Biotin-DNA probe T and Biotin-DNA probe C;
[0067] ② Mix Biotin-DNA probe T and Biotin-DNA probe C with streptavidin respectively, and react at room temperature for a period of time to form SA-biotin-DNA-T and SA-biotin-DNA-C.
[0068] The present invention further prepared the sample pad.
[0069] In this invention, the preparation method of the sample pad preferably includes the following steps: immersing the sample pad in a buffer solution, drying it, and then storing it. The buffer solution is preferably 0.5% Triton X-100, 1% BSA, 2% glucose, 2% PEG-4000, 10mM PB buffer, pH = 7.4.
[0070] In this invention, a gold-labeled probe is sprayed onto the conjugate pad, a first gold-labeled probe is sprayed onto the first gold-labeled test strip, and a second gold-labeled probe is sprayed onto the second gold-labeled test strip.
[0071] In this invention, the binding pad needs to be soaked in a buffer solution and dried before spraying the gold-labeled probe. The buffer solution is preferably a buffer solution for soaking the sample pad.
[0072] In this invention, the gold sputtering concentration of the gold-labeled probe is preferably 4 μL / cm to 6 μL / cm, and more preferably 5 μL / cm.
[0073] This invention involves spraying detection probes onto a nitrocellulose membrane to form detection lines and spraying quality control probes to form quality control lines; wherein, the quality control lines of the first gold-labeled test strip are coated with the first quality control probe, and the quality control lines of the second gold-labeled test strip are coated with the second quality control probe.
[0074] In this invention, the spray concentration of the detection probe is preferably 0.5 μL / cm to 1.5 μL / cm, more preferably 1.0 μL / cm; the spray concentration of the quality control probe is preferably 0.5 μL / cm to 1.5 μL / cm, more preferably 1.0 μL / cm; and the distance between the detection line and the quality control line is preferably 4 mm to 6 mm, more preferably 5 mm.
[0075] In this invention, the sample pad, conjugate pad, nitrocellulose membrane, and absorbent pad are sequentially adhered to a PVC base plate from left to right. One end of the detection line on the nitrocellulose membrane is close to the conjugate pad, and the other end of the control line is close to the absorbent pad. There is a 1mm to 3mm overlap between each two parts of the sample pad, conjugate pad, nitrocellulose membrane, and absorbent pad, resulting in an assembled gold-labeled test strip.
[0076] In this invention, the sample pad, conjugate pad, nitrocellulose membrane, and absorbent pad preferably overlap by 2 mm between each pair of components. By limiting the distance between each pair of components, this invention ensures smooth sample chromatography during the detection process.
[0077] Finally, the assembled gold-labeled test strips are cut into widths of 2mm to 4mm and stored at room temperature after drying.
[0078] In this invention, the width of the gold-labeled test strip is preferably 3 mm, and the gold-labeled test strip is preferably cut using a microcomputer-controlled automatic cutting machine.
[0079] The present invention also provides an application of the gold chain length-mediated colloidal gold test strip sensor described above in a drug for detecting cytochrome P4501A1 gene mutations.
[0080] This invention does not impose any particular limitation on the dosage form of the drug; any medically acceptable dosage form using a gold-labeled chain length-mediated colloidal gold test paper sensor is acceptable. This invention does not impose any particular limitation on the preparation method of the drug; any preparation method appropriate to the dosage form is acceptable. This invention does not impose any particular limitation on the form in which the gold-labeled chain length-mediated colloidal gold test paper sensor exists in the drug; any conventional form in the drug is acceptable.
[0081] To better understand the present invention, the following embodiments further illustrate the content of the present invention, but the content of the present invention is not limited to the following embodiments. Unless otherwise specified, the materials, reagents, etc., used in the embodiments and experimental examples of the present invention can be obtained commercially; unless otherwise specified, the methods used in the embodiments and experimental examples of the present invention are conventional methods.
[0082] Instruments, materials and reagents
[0083] (1) Instruments:
[0084] [Revised according to Detailed Rule 26, 07.08.2024] The microcomputer automatic chopping machine, HM3030 XYZ three-dimensional film-spraying gold instrument, and gold-spraying tools were all purchased from Shanghai Jinbiao Biotechnology Co., Ltd.; T100 TM PCR instrument (Bio-Rad Laboratories, USA), PowerPac™ Basic electrophoresis system (Bio-Rad Laboratories, USA), gel imaging system (UVP, USA), UV-2550 ultraviolet spectrophotometer (Shimadzu, Japan), HT7700 transmission electron microscope (Hitachi, Japan), 5424 centrifuge (Eppendorf, Germany), DHG-90304 electric thermostatic drying oven (Wuhan Yiheng Sujing Scientific Instruments Co., Ltd., China), DF-101S thermal collector-type thermostatic magnetic stirrer (Gongyi Yuhua Instrument Co., Ltd., China), TG16-Ⅱ benchtop high-speed centrifuge (Changsha Pingfan Instruments Co., Ltd., China), EOS600D digital camera (Canon, Taiwan, China), and ultrapure water system (Millipore-Q, USA).
[0085] (2) Materials and reagents:
[0086] Chloroauric acid (HAuCl4·4H2O), trisodium citrate, sodium chloride, trisodium phosphate, Tween 20, sucrose, polyethylene glycol octylphenyl ether (Triton X-100), sodium dodecyl sulfate (SDS), PEG-4000, disodium hydrogen phosphate (Na2HPO4·12H2O), sodium dihydrogen phosphate (NaH2PO4·2H2O), tris(hydroxymethyl)aminomethane (Tris), and hydrochloric acid were all purchased from Sinopharm Chemical Reagent Co., Ltd.; tris(2-carboxyethyl)phosphine (TCEP) was purchased from Aladdin; streptavidin (SA, 1 mg) was purchased from BBI; all reagents were of analytical grade. TM (TaKaRa Taq TM Version 2.0 was purchased from Baori Biotechnology (Beijing) Co., Ltd. The water used in the experiment was ultrapure water (18.2 MΩ / cm); the resuspension buffer at pH 7.4 was prepared with Na3PO4 (20 mM), BSA (5%), Tween 20 (0.25%), and sucrose (10%); the blood genomic DNA extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.; the gel DNA recovery kit was purchased from Chengdu Fujie Biotechnology Co., Ltd.; SX42 absorbent paper (300×200 mm), CB06 glass fiber paper (300×200 mm), and SMNF31-25 PVC base plate (300×60 mm) were purchased from Shanghai Jinbiao Biotechnology Co., Ltd.; CN140 nitrocellulose membrane (300×25 mm) was purchased from Sartorius GmbH, Germany. All nucleic acid sequences were synthesized at Shanghai Sangon Biotech Co., Ltd. (modified nucleic acids) and Wuhan Qingke Innovation Biotechnology Co., Ltd. (ordinary nucleic acids).
[0087] Example 1: Preparation of a colloidal gold test paper sensor mediated by gold chain length
[0088] (1) Preparation of colloidal gold: 100 mL of 0.01% (w / v) HAuCl4 aqueous solution was injected into a round-bottom flask equipped with a reflux condenser and heated to boiling. Then, 2 mL of 1% (w / v) trisodium citrate solution was added to the flask. The mixture was heated under reflux with vigorous stirring. The solution color gradually changed from colorless and black to dark red. The mixture was heated for another 10 min. After cooling to room temperature, the mixture was filtered through a 0.22 μm nylon membrane to remove large particles and stored in a refrigerator at 4 °C for later use.
[0089] (2) Preparation of gold-labeled probes: First, TCEP was added to the thiol-modified DNA solution (1OD) to make the final concentration 10mM to eliminate the disulfide bonds between primers. The treated thiol-modified DNA probes were added to 14mL of colloidal gold and reacted for 16h. PB buffer and SDS were added to make the final concentrations 9mM and 0.1% (w / v) respectively. The mixture was shaken at room temperature for 30min. Sodium chloride was added in 6 portions to make the final concentration 0.2M. The mixture was aged at room temperature for 1 day. It was centrifuged at 7300g for 15min at 4℃. The supernatant was discarded to remove the unmodified DNA. The red precipitate was resuspended in 1mL of resuspension buffer (5wt% bovine serum albumin, 10wt% sucrose, 10mM phosphate buffer). The process of discarding the supernatant, centrifugation and resuspension was repeated three times. Finally, the mixture was resuspended in 700μL of buffer to obtain various gold-labeled DNA probes (first gold-labeled probe and second gold-labeled probe). The probes were stored at 4℃ for later use.
[0090] (3) Treatment of sample pads and conjugate pads: The sample pads and conjugate pads were immersed in buffer (0.5% w / v Triton X-100, 1% w / v BSA, 2% w / v glucose, 2% w / v PEG-4000, 10mM PB buffer, pH=7.4), dried at 37℃ for 1h, and then dried at room temperature for storage.
[0091] (4) Gold spraying on the conjugate pad: Various gold-labeled probes AuNP-DNA probe A or AuNP-DNA probe G were sprayed onto the conjugate pad using a gold spraying instrument. The gold spraying concentration was 5 μL / cm. The pad was dried at 37℃ for 1 h and stored at 4℃.
[0092] (5) Preparation of detection probe and quality control probe: 100 μM of biotinylated detection probe T (Biotin-DNA probe T) and quality control probe C (Biotin-DNA probe C) were mixed with streptavidin at a concentration of 1 mg / mL at a ratio of 1:1 (v / v) and reacted at room temperature for 2 h to form SA-biotin-DNA-T and SA-biotin-DNA-C. SA-biotin-DNA-C was divided into the first quality control probe Biotin A-DNA probe C and the second quality control probe Biotin G-DNA probe C.
[0093] (6) Nitrocellulose membrane scrubbing: Use a scrubbing gold sprayer to scrub onto the nitrocellulose membrane at a rate of 1 μL / cm to form the detection line T line and the control line C line. The C line of the first gold-labeled test strip is the Biotin A-DNA probe C, and the C line of the second gold-labeled test strip is the Biotin G-DNA probe C. The distance between the T line and the C line is 5 mm. Dry at room temperature for 1 hour before use.
[0094] (7) Assembly: The gold-labeled test strip consists of a sample pad, a conjugate pad, a nitrocellulose membrane, and an absorbent pad, arranged from left to right in the direction of chromatography. Finally, the sample pad, the gold-labeled conjugate pad, the NC membrane, and the absorbent pad are sequentially adhered to the PVC base plate, with a 2mm overlap between the two parts to ensure smooth sample chromatography during the detection process. The test strip is cut to a width of 3.0mm using a microcomputer-controlled automatic cutter. After preparation, it is dried at room temperature and stored for later use.
[0095] (8) Sample processing solution: ① First sample processing solution: containing upstream and downstream primers, 2×Premix Taq TM Sterilized water;
[0096] ② Second sample processing solution: contains upstream primer, 2×Premix Taq TM Sterilized water.
[0097] Example 1: Characterization of Colloidal Gold
[0098] As a key component of test strips, the quality of colloidal gold nucleic acid probes in their preparation is crucial. Therefore, the prepared colloidal gold and colloidal gold nucleic acid probes were characterized by UV-Vis spectroscopy and agarose gel electrophoresis.
[0099] The detection results are shown in Figure 2. As shown in Figure 2, the prepared colloidal gold absorption peak is at 519 nm, and the calculated concentration of the colloidal gold is approximately 0.8 nM. After nucleic acid modification, the maximum absorption peak of the gold-labeled probe AuNP-DNA probe showed a red shift (523.5 nm), which may be due to the increased hydration radius of the colloidal gold and the aggregation of gold particles after thiol DNA modification. Simultaneously, the absorption peak intensity of the gold-labeled probe decreased, which may be due to losses during the purification process. The agarose gel electrophoresis results in the right inset of Figure 2 show that the colloidal gold aggregated in the sample wells (lane 1) because it could not tolerate the electrophoresis buffer, while the gold-labeled probe showed clear bands (lane 2), indicating that DNA had been modified onto the surface of the colloidal gold, thus enabling it to tolerate the electrophoresis buffer.
[0100] Experimental Example 2: Optimization of Gold-labeled Probe Chain Length and Sodium Chloride Concentration
[0101] (1) Optimization of gold-labeled probe chain length: Gold-labeled DNA probes with lengths of 12–9 nt that are completely complementary to the SNP site C / C were prepared (nucleotide sequences are shown in Table 1), and test strips were prepared using them, named 12G–9G test strips; at the same time, gold-labeled DNA probes with lengths of 12–9 nt that are completely complementary to the SNP site T / T were also synthesized, and test strips were prepared using them, named 12A–9A test strips. Meanwhile, three synthesized single-stranded DNAs (T67, C67, T / C67) with a length of 67 nt containing the SNP site were used as target single strands for test strip optimization experiments.
[0102] Table 1. Nucleotide sequences of gold-labeled DNA probes with lengths of 12–9 nt.
[0103] (2) Optimization of sodium chloride concentration:
[0104] Figure 3 shows the results of loading DNA from different SNP mutation sites onto different test strips at different sodium chloride concentrations (300mM, 200mM, 100mM, and 50mM). As can be seen from Figure 3, when the sodium chloride concentration is 300mM (20mM Tris-HCl, pH 8.2), the T line of the 12G test strip shows a clear signal (Figure 3A), failing to effectively distinguish the three SNP mutation sites. For the 11G test strip, colorimetric signals were also observed after loading samples from all three SNP sites. This may be because the G / T mismatch is a weak mismatch; the gold-labeled DNA probe can bind to the target single strand even if it is not perfectly complementary, causing false positive results on both test strips and failing to effectively distinguish SNPs. For the 10G and 9G test strips, the T line signal intensity was very low after sample loading, also failing to distinguish SNP sites. Meanwhile, this invention investigated the ability of test strip A to distinguish SNP sites. The results showed that all four test strips (12A to 9A) could effectively distinguish SNP sites. When C67 containing C / C type SNP sites was loaded, the T line of the test strip showed extremely weak signal and no visible color due to the mismatch. However, when T / C67 and T67 containing T / C type and T / T type SNP sites respectively were loaded, the T lines showed strong signals. This may be because the A / C mismatch is a strong mismatch, preventing the gold-labeled DNA from binding to the target single strand. However, since test strip G showed false positives or excessively low signal intensity at a sodium chloride concentration of 300 mM, the test strip could not effectively distinguish the three types of SNP sites at this concentration.
[0105] When the sodium chloride concentration is 200 mM, the 11G and 12A test strips can effectively distinguish the three SNP sites. When samples are loaded at C67 and T / C67, the T line of the 11G test strip is colored, while the T line at T67 is not colored (Figure 3B). When samples are loaded at T67 and T / C67, the T line of the 12A test strip is colored, while the T line at C67 is not colored. These two test strips can effectively eliminate false positive results. For the 12G test strip, the T lines of all three SNP sites are colored, resulting in false positive results (Figure 3B). The T line signals of the 10G, 9G, and 9A test strips are all weak and cannot distinguish SNPs. While the 11A and 10A test strips can distinguish SNP sites, their T line signals are weak, failing to achieve optimal detection results.
[0106] When the sodium chloride concentration was 100mM and 50mM, the T-line signal of all test strips was very weak when detecting samples from the three SNP sites (Figures 3C and 3D), and the detection purpose could not be achieved. This may be because a suitable sodium chloride concentration can promote DNA binding and increase the Tm temperature. Too low a sodium chloride concentration will prevent DNA from hybridizing, thus affecting the detection.
[0107] Therefore, when the sodium chloride concentration is 200mM, the 11G and 12A test strips can eliminate false positive results and achieve visual detection of SNPs.
[0108] Experimental Example 3: Effect of different concentrations of SNP sites on detection
[0109] Hybridization of ssDNA is a balancing process; excessive ssDNA increases non-specific binding, causing AuNPs to accumulate on the detection line and leading to false positive results. The concentration of the single-stranded DNA to be detected also affects the results; therefore, single-stranded DNA concentrations of 50 nM, 100 nM, 200 nM, 300 nM, 400 nM, and 500 nM were used for detection.
[0110] Figure 4 shows the effect of different concentrations of SNP site sequences on the detection results of 11G and 12A test strips. As can be seen from Figure 4, when the ssDNA (T67, C67, and T / C67) concentration is 500 nM, the 11G and 12A bands cannot clearly distinguish SNPs; when the SNP site is T / T, the 11G band also shows color, leading to false positive results; when the ssDNA concentration is between 400 nM and 100 nM, only C-base SNP sites (C / C and T / C) and T-base SNP sites (T / T and T / C) are visible in the 11G and 12A bands, respectively; however, when the concentration is 50 nM, the detection signal on both bands is low, making it unsuitable for practical applications.
[0111] Experiment 4: Investigation of PCR Results at Different Sample Concentrations
[0112] We selected 100ng, 50ng, and 10ng gDNA, which are commonly used in sample extraction, as PCR templates, and kept the rest of the procedures unchanged.
[0113] The results are shown in Figure 5. As can be seen from Figure 5, the product concentrations obtained in the first step of PCR were not significantly different at these three concentrations (lanes 1-3). The second step PCR, using the product from the first step PCR as a template, also yielded a 67 nt target band (lanes 4-6). Comparison with the electrophoresis results of standard single-stranded DNA (67 nt) at 500 nM, 200 nM, and 100 nM (lanes 7-9) revealed that the single-stranded DNA concentration obtained in the second step PCR was between that of 200 nM and 500 nM. This demonstrates that both PCR steps using different concentrations of genomic DNA as templates can effectively amplify the target DNA.
[0114] Step 2 of Experiment Example 4: Recovery of PCR Products
[0115] The experiment revealed that if the single-stranded DNA products (containing three SNP sites) obtained from the two-step PCR were directly loaded onto 11G and 12A test strips, obvious bands appeared in the T line, indicating false positive results and inability to distinguish SNP sites. Therefore, the target DNA single strand (67nt) obtained from the second-step PCR (Figure 6, inset a, lane 1) was subjected to agarose gel DNA recovery, yielding products concentrated 2-fold (lane 2) and 1-fold (lane 3), respectively. By comparing the bands of standard concentration single-stranded DNA electrophoresis (lanes 4-6), it can be seen that the concentrations of the 2-fold and 1-fold concentrated products are between 100nM and 500nM. UV-Vis absorption spectroscopy showed (Figure 6, inset b) that the concentrations of the 2-fold and 1-fold concentrated products were 269nM and 132.3nM, respectively (Figure 6), with the former being suitable for the detection of SNP mutation sites (Figure 4).
[0116] Test Example 5 Sample Detection
[0117] Sample information: 21 human blood samples (Source: Wuhan Commercial Workers Hospital).
[0118] Genomic DNA (gDNA) is extracted from the sample using a kit and used as a template for PCR reaction.
[0119] (1) Obtaining the target double-stranded DNA:
[0120] 50 μL PCR reaction system (first sample processing solution): 25 μL 2×Premix Taq TM The system consisted of 2 μL each of upstream and downstream primers, 2 μL of gDNA, and 19 μL of sterile water.
[0121] PCR reaction conditions: 94℃ pre-denaturation for 5 min; 94℃ for 30 s, 51.9℃ for 15 s, 72℃ for 12 s, 30 cycles; 72℃ for 10 min.
[0122] (2) Obtaining the target single-stranded DNA:
[0123] 50 μL PCR reaction system (second sample processing solution): 25 μL 2×Premix Taq TM , 2.5 μL upstream primer, 2.5 μL PCR product obtained in (1) above, 20 μL sterile water to make up the system;
[0124] PCR reaction conditions: 94℃ pre-denaturation for 1 min; 94℃ for 30 s, 51.9℃ for 15 s, 72℃ for 10 s, 30 cycles; 72℃ for 10 min.
[0125] (3) Test strip detection:
[0126] The PCR products obtained in (2) were subjected to agarose gel electrophoresis and recovered using an agarose gel DNA recovery kit. The recovered DNA was then added to the sample pad of the test strip for chromatography detection. After 10 minutes, clear bands were visible on the test strip, and the intensity was analyzed using ImageJ grayscale analysis. Among the samples, there were 14 T / T site samples, 2 C / C site samples, and 5 T / C site samples.
[0127] (4) Result verification:
[0128] The type of SNP mutation site was confirmed by sequencing. First, a PCR reaction was performed on the gDNA, and the system included 25 μL of 2×Premix Taq. TM The system was supplemented with 2 μL each of upstream primer FP-L (SEQ ID NO.8) and downstream primer RP-L (SEQ ID NO.9), 2 μL gDNA, and 19 μL sterile water.
[0129] The nucleotide sequences of SEQ ID NO.8 to SEQ ID NO.9 are shown below:
[0130] SEQ ID NO.8: CTGCATTTGGAAGTGCTC;
[0131] SEQ ID NO.9: CTACCTGAACGGTTTCTCAC;
[0132] PCR reaction conditions: 94℃ pre-denaturation for 5 min; 94℃ for 30 s, 58.8℃ for 15 s, 72℃ for 20 s, 30 cycles; 72℃ for 10 min. PCR products were used for sequencing to obtain SNP mutation site types.
[0133] Figure 7 shows the comparison between the sequencing results and the test strip results. As can be seen from Figure 7, the sequencing results for the three types (T / T, T / C, C / C) of SNP samples are completely consistent with the test strip results.
[0134] In summary, this invention eliminates false positive results by optimizing the gold-labeled probe chain length and sodium chloride concentration, which is of great significance for the visual detection of SNPs. The method of this invention can also be extended to the detection of any other SNP site; it can effectively and quickly visualize and distinguish SNP sites using only two test strips, thus playing an important role in the initial screening of SNP-related diseases.
[0135] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A gold label chain length mediated colloidal gold test strip sensor, characterized in that, The colloidal gold test paper sensor comprises a first gold label test paper strip and a second gold label test paper strip; the first gold label test paper strip and the second gold label test paper strip each comprise a sample pad, a conjugate pad, a nitrocellulose membrane and a water absorption pad fixed on a PVC base plate in sequence from left to right; The conjugate pad is fixed with a gold label probe, wherein the conjugate pad of the first gold label test paper strip is fixed with a first gold label probe, and the first gold label probe comprises a nucleotide sequence as shown in SEQ ID NO. 1; the conjugate pad of the second gold label test paper strip is fixed with a second gold label probe, and the second gold label probe comprises a nucleotide sequence as shown in SEQ ID NO. 2; The nitrocellulose membrane comprises a detection line and a quality control line in sequence from left to right, wherein the detection line is fixed with a detection probe, and the quality control line is fixed with a quality control probe; the detection probe comprises a nucleotide sequence as shown in SEQ ID NO. 3; the quality control probe of the first gold label test paper strip is a first quality control probe, and the first quality control probe comprises a nucleotide sequence as shown in SEQ ID NO. 4; the quality control probe of the second gold label test paper strip is a second quality control probe, and the second quality control probe comprises a nucleotide sequence as shown in SEQ ID NO.
5.
2. The colloidal gold test paper sensor according to claim 1, wherein, The colloidal gold test paper sensor further comprises a sample processing liquid, and the sample processing liquid comprises a first sample processing liquid and a second sample processing liquid; wherein the first sample processing liquid comprises an upstream primer and a downstream primer, and the second sample processing liquid comprises an upstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 6, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.
7.
3. The colloidal gold test paper sensor according to claim 1, wherein the gold label is a gold nanoparticle. The detection probe and the quality control probe further comprise biotin and streptavidin.
4. The colloidal gold test paper sensor according to any one of claims 1 to 3, wherein the gold label is a gold nanoparticle. The result judgment standard of the colloidal gold test paper sensor is as follows: The detection line and the quality control line of the first gold label test paper strip are colored, the detection line of the second gold label test paper strip is not colored, and the quality control line is colored, which represents that the detection site of the detection sample is T / T; The detection line of the first gold label test paper strip is not colored, and the quality control line is colored, and the detection line and the quality control line of the second gold label test paper strip are colored, which represents that the detection site of the detection sample is C / C; The detection line and the quality control line of the first gold label test paper strip and the second gold label test paper strip are colored, which represents that the detection site of the detection sample is T / C.
5. A method for preparing the gold-labeled chain length mediated colloidal gold test paper sensor according to any one of claims 1 to 4, characterized in that, The method comprises the following steps: S1, preparing a gold label probe, a detection probe and a quality control probe; S2, preparing a sample pad; S3, spraying and drawing the gold label probe on the conjugate pad, spraying and drawing the first gold label probe on the first gold label test paper strip, and spraying and drawing the second gold label probe on the second gold label test paper strip; S4, spraying and drawing the detection probe on the nitrocellulose membrane to form a detection line, and spraying and drawing the quality control probe to form a quality control line; wherein the quality control line of the first gold label test paper strip is sprayed with the first quality control probe, and the quality control line of the second gold label test paper strip is sprayed with the second quality control probe; S5, the sample pad, the binding pad, the nitrocellulose membrane and the water absorption pad are sequentially adhered on the PVC base plate from left to right, one end of the detection line on the nitrocellulose membrane is close to the binding pad, one end of the quality control line is close to the water absorption pad, there is 1mm-3mm overlap between every two parts of the sample pad, the binding pad, the nitrocellulose membrane and the water absorption pad, and a gold standard test strip is obtained; S6, the gold standard test strip is cut into 2mm-4mm width, and is dried and stored at room temperature.
6. The method for preparing the colloidal gold test paper sensor mediated by the gold chain length according to claim 5, characterized in that, The gold standard probe in S3 has a spraying concentration of 4μL / cm-6μL / cm.
7. The method for preparing the colloidal gold test paper sensor mediated by the gold chain length according to claim 5, characterized in that, The binding pad in S3 needs to be soaked and treated with buffer before spraying the gold standard probe and dried.
8. The method for preparing the colloidal gold test paper sensor mediated by the gold chain length according to claim 5, characterized in that, The spraying concentration of the detection probe in S4 is 0.5μL / cm-1.5μL / cm; the spraying concentration of the quality control probe in S4 is 0.5μL / cm-1.5μL / cm.
9. The method for preparing the colloidal gold test paper sensor mediated by the gold chain length according to claim 5, characterized in that, The distance between the detection line and the quality control line in S4 is 4mm-6mm.
10. The application of the gold standard chain length mediated colloidal gold test paper sensor in any one of claims 1-4 in the detection of cytochrome P4501A1 gene mutation.
Citation Information
Patent Citations
Nano-sensors for nucleic acid detection and discrimination
CN108700535A
Universal aptamer colloidal gold lateral chromatography test paper for detecting small molecular substances
CN113406329A
Preparation and application of DNA nanostructure capture probe lateral flow chromatography test strip
CN116027020A