Vector for preparing circular RNA and use thereof

Abstract

The present invention relates to the technical field of molecular biology; and specifically relates to a vector or nucleic acid for preparing a circular RNA and the use thereof, and a method for preparing a circular RNA. The vector or nucleic acid of the present invention comprises a 5'-end sequence of a ribozyme and a 3'-end sequence of the ribozyme. A target sequence intended for circularization is placed between the 5'-end sequence of the ribozyme and the 3'-end sequence of the ribozyme, such that the circularization of a precursor RNA can be achieved in vitro.

Description

A vector for preparing circular RNA and its application Technical Field

[0001] This invention relates to the field of molecular biology, specifically to a vector or nucleic acid for preparing circular RNA, its application, and a method for preparing circular RNA. Background Technology

[0002] Circular RNAs (RRNAs) are a class of closed circular RNA molecules lacking 5' and 3' free ends, exhibiting natural resistance to RNases. They were first discovered in plant pathogenic viroids in 1976. RRNAs are formed in vivo through trans-splicing, and for a long time, they were considered byproducts of gene production. With the development of high-throughput sequencing technology, numerous RRNAs have been discovered, and their diverse biological functions have been reported, such as acting as miRNA "sponges," interacting with proteins to regulate gene expression, and encoding proteins. The protein-coding ability of RRNAs is achieved in a cap-independent manner. In most cases, the internal ribosomal entry site (IRES) within the RRNA recruits the translation initiation complex, thus initiating protein translation. In a few cases, the recruitment of initiation elements is mediated by m6A base modification.

[0003] The primary technical challenge in the application of circular RNA is achieving precise and efficient circularization of RNA in vitro. Currently, commonly used strategies for in vitro synthesis of circular RNA include: T4 DNA ligase or T4 RNA ligase-mediated circularization strategies, and the permuted introns and exons (PIE) strategy. When using T4 DNA ligase or RNA ligase strategies, a splint sequence complementary to the linear ends is typically introduced to shorten the distance between the ends and create a gap, thus providing a precise ligation site. However, this method has low circularization efficiency, produces many byproducts, and performs poorly when ligating long fragments, therefore it is often used for the preparation of small circular RNA fragments. The classic PIE circularization strategy involves adding type I intron 5' and part of exon fragment E1, and intron 3' and exon fragment E2 to the 3' and 5' of the target RNA sequence, respectively. After in vitro transcription (IVT), the RNA is then ligated into a Mg²⁺ molecule. 2+ Under the influence of GTP, precursor RNA molecules self-splice into circular forms. Adding homologous arms and spacer sequences to both sides of the target RNA molecule effectively improves the circularization efficiency of the PIE strategy, enabling RNA circularization up to 5 kb. However, this strategy retains exogenous exon sequences in the circular RNA final product, which may increase its own immunogenicity. Summary of the Invention

[0004] To address the problems of existing technologies, the inventors of this application have discovered that artificial ribozymes with specific structures can be used to achieve precise circularization of precursor RNA in vitro. The process is simple, the circularization is highly efficient, and the in vivo expression level is high, making it suitable for the synthesis of circular RNA vaccines and drugs. Specifically:

[0005] In a first aspect, the present invention provides a vector or nucleic acid for preparing circular RNA, said vector or nucleic acid comprising a 5' end sequence and a 3' end sequence of a ribozyme.

[0006] The ribozyme is a ribozyme capable of catalyzing the formation of 5'-3' phosphodiester bonds. For example, the ribozyme performs a nucleophilic attack on the α-phosphodiester bond of 5'-triphosphate via a 3'-hydroxyl group, releasing a pyrophosphate and generating a new phosphodiester bond.

[0007] The ribozyme mentioned is a splicing ribozyme.

[0008] The ribozyme described is not a splicing ribozyme. It should be understood that the ribozyme can be a DNA ribozyme or an RNA ribozyme. When it is an RNA ribozyme, its 5' and 3' end sequences are constructed into a vector or nucleic acid, and uracil U needs to be converted into the corresponding thymine T in the DNA.

[0009] The ribozyme has 3-5 stem-loops.

[0010] The ribozyme is a ligation ribozyme that specifically catalyzes ligation.

[0011] The vector or nucleic acid contains a 5' end sequence of the ligase and a 3' end sequence of the ligase.

[0012] Preferably, the ligation ribozyme includes three stem-loop structures and a hinge region, wherein the three stem-loop structures are Stem A, Stem B and Stem C.

[0013] More preferably, Stem A includes a 5' end chain and a 3' end chain, the hinge region contains a double strand, and the structure of the ribozyme linker is as follows:

[0014] The 5' end chain of Stem A - Stem B - one chain of the hinge region - Stem C - the other chain of the hinge region - the 3' end chain of Stem A. Preferably, the first nucleotide of the 5' end chain of Stem A is the first nucleotide of the ribozyme linker, and the last nucleotide of the 3' end chain is the last nucleotide of the ribozyme linker.

[0015] In one specific embodiment of the present invention, the 3' end of the 5' end chain of Stem A is connected to the 5' end of Stem B, the 5' end of one chain in the hinge region is connected to the 3' end of Stem B, and the 3' end is connected to the 5' end of Stem C; the 5' end of another chain in the hinge region is connected to the 3' end of Stem C, and the 3' end is connected to the 5' end of the 3' end chain of Stem A.

[0016] In one specific embodiment of the present invention, the structure of the ligation ribozyme is as follows:

[0017] 5' end chain of Stem A - 5' end chain of Stem B - Stem B loop - 3' end chain of Stem B - a chain in the hinge region - 5' end chain of Stem C - Stem C loop - 3' end chain of Stem C - another chain in the hinge region - 3' end chain of Stem A.

[0018] Preferably, the loop sequences in Stem A, Stem B, and Stem C are each independently GNRA, where N is selected from any one of A, T, C, G, or U; and R is selected from G or A.

[0019] In one specific embodiment of the present invention, in the sequence GNRA of the loops in Stem A, Stem B, and Stem C, N is preferably A, and further, R is preferably A.

[0020] In one specific embodiment of the present invention, the sequence of the loops in the stem-loop structure is GAAA.

[0021] Preferably, the 3' end of Stem A comprises a Stem A ring, a stem connected to the 5' end of the Stem A ring, and a stem connected to the 3' end of the Stem A ring. The stem connected to the 5' end of the Stem A ring comprises a nucleotide sequence complementary to the bases of the 5' end of Stem A and a nucleotide sequence complementary to the bases of the stem connected to the 3' end of the Stem A ring.

[0022] The stem in Stem A contains a ligation site and a double strand with complementary base pairings, where the ligation site is located between the first nucleotide G and the last nucleotide of the ribozyme, and the last nucleotide is U or T.

[0023] Preferably, the first bit of the 5' end chain of the Stem A is G.

[0024] Preferably, the 5' end chain length of Stem A is 5-10 nucleotides, for example 5, 6, 7, 8, 9 or 10 nucleotides.

[0025] In one specific embodiment of the present invention, the nucleotide sequence of the 5' end chain of Stem A is as shown in GGACCTC (SEQ ID NO: 13) or GGACCUC (SEQ ID NO: 16);

[0026] Preferably, the first bit of the 3' end chain of Stem A is G and the seventh bit is A.

[0027] Preferably, the 3' end chain of Stem A is 20-30 nucleotides long, for example, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides.

[0028] In one specific embodiment of the present invention, the nucleotide sequence of the 3' end chain of Stem A is as shown in GAGGTTAGGTGCTCCGAAAGGAGCACT (SEQ ID NO: 12) or GAGGUUAGGUGCUCCGAAAGGAGCACU (SEQ ID NO: 17).

[0029] Preferably, the stem in Stem B is a double strand with complementary base pairing.

[0030] Preferably, the third position of the 3' end chain of the Stem B stem is C.

[0031] Preferably, the 3' end chain length of the Stem B stem is 3-7 nucleotides, for example 3, 4, 5, 6 or 7 nucleotides.

[0032] In one specific embodiment of the present invention, the nucleotide sequence of the 3' end chain of the Stem B stem is GCC.

[0033] Preferably, the 5' end chain length of the Stem B stem is 3-7 nucleotides, for example 3, 4, 5, 6 or 7 nucleotides.

[0034] In one specific embodiment of the present invention, the nucleotide sequence of the 5' end chain of the Stem B stem is GGC.

[0035] Preferably, the stem in Stem C is a double strand with complementary base pairing.

[0036] Preferably, the 5' end chain length of the Stem C stem is 1-5 nucleotides, for example 1, 2, 3, 4 or 5 nucleotides.

[0037] In one specific embodiment of the present invention, the nucleotide sequence of the 5' end chain of the Stem C stem is AGC.

[0038] Preferably, the 3' end chain length of the Stem C stem is 1-5 nucleotides, for example 1, 2, 3, 4 or 5 nucleotides.

[0039] In one specific embodiment of the present invention, the nucleotide sequence of the 3' end chain of the Stem C stem is GCT or GCU.

[0040] Preferably, the double strands in the hinge region can be double strands with complementary base pairings, or double strands containing partial complementary base pairings.

[0041] Preferably, the first position of one chain in the hinge region is G and the second position is T.

[0042] Preferably, the length of one chain in the hinge region is 5-10 nucleotides, for example, 5, 6, 7, 8, 9 or 10 nucleotides.

[0043] In one specific embodiment of the present invention, one chain of the hinge region is as shown in GTTCGACC (SEQ ID NO: 14) or GUUCGACC (SEQ ID NO: 18);

[0044] Preferably, the second position of the other chain in the hinge area is T, the third position is T, the fourth position is A, the fifth position is G, and the ninth position is G;

[0045] Preferably, the length of the other chain in the hinge region is 5-12 nucleotides, for example, 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides.

[0046] In one specific embodiment of the invention, the other chain of the hinge region is as shown in CTTAGACAG (SEQ ID NO: 15) or CUUAGACAG (SEQ ID NO: 19).

[0047] The ribozyme mentioned is not a type I intron.

[0048] The ribozyme mentioned is not a type II intron.

[0049] Preferably, the 5' end sequence and the 3' end sequence of the ribozyme are formed by breaking at the loop sequence of the ribozyme stem-loop structure. Optionally, after breaking, the 5' end sequence and / or the 3' end sequence of the ribozyme do not contain the loop sequence at the break point. Optionally, after breaking, the 5' end sequence and / or the 3' end sequence of the ribozyme contain the loop sequence at the break point.

[0050] In one specific embodiment of the invention, the Stem A loop connecting the ribozyme is broken.

[0051] The 5' end sequence includes the 5' end chain of Stem A, Stem B, the hinge region, Stem C, and the stem connected to the 5' end of the Stem A ring.

[0052] The 3' end sequence contains the stem connected to the 3' end of the Stem A ring.

[0053] Preferably, the nucleotide sequence linked to the 5' end of the Stem A loop is the 5' end sequence of the ligase, and the nucleotide sequence linked to the 3' end of the Stem A loop is the 3' end sequence of the ligase.

[0054] In one specific embodiment of the invention, the Stem B loop connecting the ribozyme is broken.

[0055] The 5' end sequence contains the 5' end strand of Stem A and the 5' end strand of Stem B.

[0056] The 3' end sequence includes the 3' end chain of Stem B stem, the hinge region, Stem C, and the 3' end chain of Stem A.

[0057] Preferably, the nucleotide sequence linked to the 5' end of the Stem B ring is the 5' end sequence of the ligase, and the nucleotide sequence linked to the 3' end of the Stem B ring is the 3' end sequence of the ligase.

[0058] In one specific embodiment of the invention, the Stem C loop connecting the ribozyme is broken.

[0059] The 5' end sequence includes the 5' end chain of Stem A, Stem B, a chain in the hinge region, and the 5' end chain of the stem of Stem C.

[0060] The 3' end sequence contains the 3' end chain of the Stem C stem - another chain of the hinge region - the 3' end chain of the Stem A.

[0061] Preferably, the nucleotide sequence linked to the 5' end of the Stem C ring is the 5' end sequence of the ligase, and the nucleotide sequence linked to the 3' end of the Stem C ring is the 3' end sequence of the ligase.

[0062] Preferably, the ribozyme catalyzes the 5' to 3' phosphodiester bond linkage at a specific site.

[0063] Preferably, the ligation ribozyme includes key sequences for maintaining conformation, forming hydrogen bond networks, forming phosphodiester bonds, reacting with divalent cations, and maintaining enzyme activity.

[0064] Preferably, the 27th position U or T of the 3' end chain of Stem A, the 4th position A of the other chain in the hinge region, and the 3rd position U or T of the other chain in the hinge region are used to form a hydrogen bond network to promote the formation of phosphodiester bonds.

[0065] Preferably, the third U or T of the other chain in the hinge region, the first G of the 5' end chain of Stem A, and the seventh A of the 3' end chain of Stem A are used to maintain the conformation, so that Stem A and Stem C are brought close to each other in the tertiary structure.

[0066] Preferably, the first position G of the 5' end chain of Stem A, the fourth position A of the other chain in the hinge region, and the fourth position G of the other chain in the hinge region are used to form a binding pocket with the divalent cation, thereby further enhancing the effect of the divalent cation.

[0067] Preferably, the GNRA at positions 4-7 of Stem B, the GNRA at positions 4-7 of Stem C, and the GNRA at positions 16-19 of the 3' end chain of Stem A are three tetranucleotide rings, which are the tops of Stem B, Stem C (stem ring), and Stem A (stem ring), respectively.

[0068] Preferably, the 3rd position C of the 3' end chain of Stem B, the 1st position G of one chain in the hinge region, the 2nd position T or U of one chain in the hinge region, the 2nd position T or U of the other chain in the hinge region, the 3rd position T or U of the other chain in the hinge region, the 4th position A of the other chain in the hinge region, the 9th position G of the other chain in the hinge region, and the 1st position G of the 3' end chain of Stem A are used to maintain the conformation of the ligation ribozyme and its enzyme activity.

[0069] Specifically, the ligation ribozyme comprises G at position 1, C at position 17, G at position 18, U or T at position 19, U or T at position 37, U or T at position 38, A at position 39, G at position 40, G at position 44, G at position 45, A at position 51, and U or T at position 71. Preferably, it also comprises G at position 11, N at position 12, R at position 13, A at position 14, G at position 29, N at position 30, R at position 31, A at position 32, G at position 60, N at position 61, R at position 62, and A at position 63. Wherein, N is selected from any one of A, T, C, G, or U, and R is selected from A or G.

[0070] The U or T at position 71, the A at position 39, and the U or T at position 38 are used to form a hydrogen bond network, promoting the formation of phosphodiester bonds.

[0071] The 38th position U or T, the 1st position G, and the 51st position A are used to maintain the conformation, bringing Stem A and Stem C into close contact with each other in the tertiary structure.

[0072] The G at position 1, the A at position 39, and the G at position 40 are used to form a binding pocket with the divalent cation, further enhancing the effect of the divalent cation.

[0073] The GNRAs at positions 11-14, 29-32, and 60-63 are three tetranucleotide rings, located at the top of stem ring Stem B, stem ring Stem C, and stem ring Stem A, respectively.

[0074] Position 17 (C), position 18 (G), position 19 (U or T), position 37 (U or T), position 38 (U or T), position 39 (A), position 44 (G), and position 45 (G) are used to maintain the conformation of the ligation ribozyme and its enzyme activity.

[0075] Preferably, the nucleotide sequence of the ligation ribozyme, when including the above-mentioned key sites, can have more than 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% homology, as long as it can maintain the same or similar function as the ligation ribozyme described in this application.

[0076] In one specific embodiment of the present invention, the ligation ribozyme is an L1 ligation ribozyme. The L1 ligation ribozyme is an artificial ribozyme isolated from randomly synthesized RNA libraries through in vitro screening. It possesses RNA ligase activity, and its minimal crystalline structure has been discovered (Robertson M P. and Scott W G., The structural basis of ribozyme-catalyzed RNA assembly, Science, 2007).

[0077] The ribozyme sequence comprises SEQ ID NO: 1 or SEQ ID NO: 28, or comprises a nucleotide sequence having 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 99.9% or more homology with SEQ ID NO: 1 or 28, or comprises a nucleic acid sequence having at least one, two or more, or at most five, four, three or two nucleotide substitutions, deletions or insertions on SEQ ID NO: 1 or 28.

[0078] Preferably, the 5' and 3' sequences of the ligation ribozyme are selected from any one of the following groups:

[0079] A) The nucleotide sequence of the 5' end is shown as GGACCTCGGCGAAAGCCGTTCGACCAGCGAAAGCTCTTAGACAGGAGGTTAGGTGCTCC (SEQ ID NO: 4) or GGACCUCGGCGAAAGCCGUUCGACCAGCGAAAGCUCUUAGACAGGAGGUUAGGUGCUCC (SEQ ID NO: 21); the nucleotide sequence of the 3' end is shown as GGAGCACT (SEQ ID NO: 7) or GGAGCACU (SEQ ID NO: 22);

[0080] B) The nucleotide sequence of the 5' end is shown as GGACCTCGGCGAAAGCCGTTCGACCAGC (SEQ ID NO: 3) or GGACCUCGGCGAAAGCCGUUCGACCAGC (SEQ ID NO: 23); the nucleotide sequence of the 3' end is shown as GCTTTAGACAGGAGGTTAGGTGCTCCGAAAGGAGCACT (SEQ ID NO: 6) or GCUCUUAGACAGGAGGUUAGGUGCUCCGAAAGGAGCACU (SEQ ID NO: 24).

[0081] C) The nucleotide sequence of the 5' end is shown as GGACCTCGGC (SEQ ID NO: 2) or GGACCUCGGC (SEQ ID NO: 25); the nucleotide sequence of the 3' end is shown as GCCGTTCGACCAGCGAAAGCTCTTAGACAGGAGGTTAGGTGCTCCGAAAGGAGCACT (SEQ ID NO: 5) or GCCGUUCGACCAGCGAAAGCUCUUAGACAGGAGGUUAGGUGCUCCGAAAGGAGCACU (SEQ ID NO: 26).

[0082] Preferably, the vector or nucleic acid further comprises an IRES sequence.

[0083] Preferably, the IRES sequence is located between the 5' end and the 3' end of the ribozyme.

[0084] Preferably, the IRES sequence is derived from: Taura syndrome virus, triatomine virus, Theiler's encephalomyelitis virus, simian virus 40, red imported fire ant virus 1, rice constrictor aphid virus, reticuloendotheliosis virus, human poliovirus 1, Plautia stali enterovirus, Kashmir bee virus, human rhinovirus 2, glass leafhopper virus-1, human immunodeficiency virus type 1, glass leafhopper virus-1, Himetobi P virus, hepatitis C virus, hepatitis A virus, GB hepatitis virus, foot-and-mouth disease virus, human enterovirus 71, equine rhinitis virus, and Ectropis obliqua picorna-like virus. Virus), encephalomyocarditis virus, fruit tree C virus, human Coxsackievirus B3, cruciferous tobacco mosaic virus, cricket paralysis virus, bovine viral diarrhea virus 1, black bee queen cell virus, aphid lethal paralysis virus, avian encephalomyelitis virus, acute bee paralysis virus, hibiscus chlorotic ringspot virus, classical swine fever virus, human FGF2, human SFTPA1, human AML1 / RUNX1, fruit tree antennae and legs, human AQP4, human AT1R, human BAG-1, human BCL2, human BiP, human c-IAPl, human c-myc, human eIF4G, mouse NDST4L, human LEF1, mouse HIF1α, human n.myc, mouse Gtx, human p27kipl, human PDGF2 / c-sis, human p53, human Pim-1, mouse Rbm3, fruit reaper, canine scamper, fruit ubx, human UNR, mouse UtrA, human VEGF-A, human XIAP, fruit hairless, Saccharomyces cerevisiae TFIID, Saccharomyces cerevisiae YAP1, tobacco etch virus, turnip shrunken virus, EMCV-A, EMCV-B, EMCV-Bf, EMCV-Cf, EMCV pEC9, small disegmented RNA virus (Picoirnavirus), HCV QC64, human cosavirus (E / D), human cosavirus (F), human cosavirus (JMY), rhinovirus NAT001, HRV14, HRV89, HRVC-02, HRV-A21, Salivirus (A SH1), Salivirus (FHB), Salivirus (NG-J1), human paraenteric virus 1, Crohivirus B, Yc-3, Rosavirus M-7, Shanbavirus A, Pasivirus A, Pasivirus A 2, Echovirus E14, Human Paraenteritis Virus 5, Aichi Virus, Hepatitis A Virus HA16, Phopivirus, CVA10, Enterovirus C, Enterovirus D, Enterovirus J, Human Pegivirus 2, GBV-C GT110, GBV-C K1737, GBV-C Iowa, Pegivirus A 1220, Pasivirus A 3, Sapelovirus, Rosavirus B, Bakunsa Virus, Tremovirus A, Porcine Pasivirus 1, PLV-CHN, Pasivirus One or more of the following viruses are considered: A, Sicinivirus, Hepatitis Virus K, Hepatitis Virus A, BVDV1, Border Disease Virus, BVDV2, CSFV-PK15C, SF573 Bicistronic Virus, Parvovirus-like Virus, CRPV, Salivirus A BN5, Salivirus A BN2, Salivirus A O2394, Salivirus A GUT, Salivirus A CH, Salivirus A SZ1, Salivirus FHB, CVB3, CVB1, Echovirus 7, CVB5, EVA71, CVA3, CVA12, EV24, or eIF4G.

[0085] In one specific embodiment of the present invention, the IRES is derived from CVB3.

[0086] Preferably, the IRES comprises SEQ ID NO: 8 or comprises a nucleotide sequence having 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 99.9% or more homology with SEQ ID NO: 8.

[0087] In one specific embodiment of the present invention, the vector or nucleic acid comprises, from the 5' end to the 3' end, the 5' end sequence of the ribozyme, the IRES sequence, and the 3' end sequence of the ribozyme.

[0088] Preferably, the vector or nucleic acid contains the target sequence.

[0089] Preferably, the target sequence is located between the 5' end sequence and the 3' end sequence of the ribozyme.

[0090] Preferably, the vector or nucleic acid contains a spacer sequence, and more preferably contains a 5' spacer sequence and / or a 3' spacer sequence.

[0091] Preferably, the spacer sequence is located between the 5' end sequence and the 3' end sequence of the ribozyme.

[0092] In one specific embodiment of the present invention, the 5' spacer sequence is located upstream of the IRES sequence and the target sequence, and the 3' spacer sequence is located downstream of the IRES sequence and the target sequence.

[0093] In one specific embodiment of the present invention, the 5' spacer sequence is located downstream of the IRES sequence and the target sequence, and the 3' spacer sequence is located upstream of the IRES sequence and the target sequence.

[0094] Preferably, the 5' spacer sequence comprises SEQ ID NO: 9 or a nucleotide sequence comprising 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 99.9% or more homology with SEQ ID NO: 9.

[0095] Preferably, the 3' spacer sequence comprises SEQ ID NO: 10 or a nucleotide sequence comprising 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 99.9% or more homology with SEQ ID NO: 10.

[0096] In one specific embodiment of the present invention, the vector or nucleic acid comprises, from the 5' end to the 3' end, the following sequence: the 5' end sequence of the ribozyme, the spacer sequence, and the 3' end sequence of the ribozyme.

[0097] In one specific embodiment of the present invention, the vector or nucleic acid comprises, from the 5' end to the 3' end, the following sequence: the 5' end sequence of the ribozyme, the 5' spacer sequence, the 3' spacer sequence, and the 3' end sequence of the ribozyme.

[0098] Preferably, the vector or nucleic acid contains a spacer sequence and an IRES sequence.

[0099] In one specific embodiment of the present invention, the vector or nucleic acid comprises, from the 5' end to the 3' end, the following sequence: the 5' end sequence of the ribozyme, the 5' spacer sequence, the IRES sequence, the 3' spacer sequence, and the 3' end sequence of the ribozyme.

[0100] Preferably, the vector or nucleic acid may further contain homologous arm sequences, preferably 5' homologous arms and / or 3' homologous arms, wherein at least a portion of the 5' homologous arm and at least a portion of the 3' homologous arm are reverse complementary sequences.

[0101] Preferably, the at least a portion of the sequence comprises at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% of the sequence.

[0102] Preferably, the homologous arm includes SEQ ID NO: 29 or 30, or includes a nucleotide sequence having more than 80%, more than 85%, more than 90%, more than 95%, or more than 99% homology with SEQ ID NO: 29 or 30.

[0103] In one specific embodiment of the present invention, the 5' homology arm includes SEQ ID NO: 29 or includes a nucleotide sequence having 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more homology with SEQ ID NO: 29, and the 3' homology arm includes SEQ ID NO: 30 or includes a nucleotide sequence having 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more homology with SEQ ID NO: 30.

[0104] In one specific embodiment of the present invention, the 5' homology arm includes SEQ ID NO: 30 or includes a nucleotide sequence having 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more homology with SEQ ID NO: 30, and the 3' homology arm includes SEQ ID NO: 29 or includes a nucleotide sequence having 80% or more, 85% or more, 90% or more, 95% or more, or 99% or more homology with SEQ ID NO: 29.

[0105] In one specific embodiment of the present invention, the vector or nucleic acid comprises, from the 5' end to the 3' end, the following in sequence: a 5' homologous arm, a 5' end sequence of the ribozyme, a 5' spacer sequence, an IRES sequence, a 3' spacer sequence, a 3' end sequence of the ribozyme, and a 3' homologous arm.

[0106] Preferably, the target sequence can be DNA, RNA, or a spliced ​​sequence of DNA and RNA;

[0107] Preferably, the target sequence can be one or more.

[0108] It should be understood that when there are multiple target sequences: to form a single loop, multiple target sequences are ligated and placed between the 5' and 3' ends of the ribozyme. To form multiple loops, the formation of each loop requires a pair of 5' and 3' ends of the ribozyme. For example, the vector or nucleic acid may contain five target sequences, where two target sequences form separate loops, and the other three target sequences form one loop.

[0109] To enable translation, IRES may be included before the target sequence, preferably before or between the target sequences in each pre-formed loop.

[0110] The vector or nucleic acid may contain a pair of 5' end sequences and a pair of 3' end sequences of a ribozyme, or it may contain multiple pairs of 5' end sequences and 3' end sequences of a ribozyme. That is, the vector or nucleic acid may form at least one loop, preferably 1, 2, 3, 4, 5, 6, 7, 8, 9 or more loops.

[0111] In one specific embodiment of the present invention, the vector or nucleic acid comprises, from the 5' end to the 3' end, the 5' end sequence of the ribozyme, the target sequence, and the 3' end sequence of the ribozyme.

[0112] In one specific embodiment of the present invention, the vector or nucleic acid comprises, from the 5' end to the 3' end, the 5' end sequence of the ribozyme, the IRES sequence, the target sequence, and the 3' end sequence of the ribozyme.

[0113] In one specific embodiment of the present invention, the vector or nucleic acid comprises, from the 5' end to the 3' end, the following sequence in sequence: the 5' end sequence of the ribozyme, the 5' spacer sequence, the target sequence, the 3' spacer sequence, and the 3' end sequence of the ribozyme.

[0114] In one specific embodiment of the present invention, the vector or nucleic acid comprises, from the 5' end to the 3' end, the following sequence in sequence: the 5' end sequence of the ribozyme, the 5' spacer sequence, the IRES sequence, the target sequence, the 3' spacer sequence, and the 3' end sequence of the ribozyme; or, the 5' end sequence of the ribozyme, the 5' spacer sequence, the target sequence, the IRES sequence, the 3' spacer sequence, and the 3' end sequence of the ribozyme; or, the 5' end sequence of the ribozyme, the 3' spacer sequence, the target sequence, the IRES sequence, the 5' spacer sequence, and the 3' end sequence of the ribozyme; or, the 5' end sequence of the ribozyme, the 3' spacer sequence, the IRES sequence, the target sequence, the 5' spacer sequence, and the 3' end sequence of the ribozyme.

[0115] Preferably, the protein encoded by the target sequence comprises one or more of the following: antibody (preferably a full-length antibody, scFv antibody, VHH antibody, antibody heavy chain, antibody light chain, antibody heavy chain variable region, or antibody light chain variable region), chimeric antigen receptor (CAR), T cell receptor (TCR, preferably comprising TCR α chain, TCR β chain, TCR γ chain, or TCR δ chain), synthetic T cell receptor antigen receptor (STAR, preferably comprising STAR α chain, STAR β chain, STAR γ chain, STAR δ chain), cytokine, chemokine, transcription factor, immunogen, or adjuvant; or, the target sequence comprises the sequence required for gene editing or a reporter gene.

[0116] Preferably, the cytokines include one or more of IL-2, IL-4, IL-6, IL-7, IL-10, IL-11, IL-12, IL-13, TGF-β, IL-1RA, or IL-15;

[0117] Preferably, the transcription factor includes one or more of FOXP3, STAT5B, HELIOS, Tbet, GATA3, RORgt, or CD25;

[0118] Preferably, the chemokine includes one or more of CC chemokine, CXC chemokine, XC chemokine or CX3C chemokine; more preferably, it includes one or more of CCL 1-28, CXCL 1-17, XCL 1-2 or CX3CL1.

[0119] Preferably, the reporter gene includes a fluorescent protein reporter gene (e.g., one or more of GFP, eGFP, RFP or BFP), a luciferase reporter gene, a human growth hormone (hGH) reporter gene, a secretory alkaline phosphatase (SEAP) reporter gene, a chloramphenicol acetyltransferase (CAT) reporter gene, or a β-galactosidase reporter gene.

[0120] Preferably, the gene editing sequence includes the sequence required by the CRISPR system, the sequence required for tissue-specific knockout, or interfering RNA.

[0121] Preferably, the immunogen includes viral proteins, bacterial proteins, or parasitic proteins.

[0122] The viral proteins include, but are not limited to, spike protein, N protein, RBD, etc. of coronaviruses (such as SARS-CoV-2, SARS, or MERS); hemagglutinin, neuraminidase, etc. of influenza viruses; surface antigen (HBsAg) of hepatitis B virus; L1 capsid protein of HPV; Fusion protein of respiratory syncytial virus (RSV); Env protein of HIV, etc.

[0123] The bacterial proteins include, but are not limited to, diphtheria toxoid, tetanus toxoid, pertussis toxoid, and pneumococcal surface proteins.

[0124] The parasitic proteins include, but are not limited to, circospore proteins (CSP), MSP1, and AMA1 from Plasmodium.

[0125] Preferably, the carrier skeleton of the carrier includes a prokaryotic carrier skeleton or a eukaryotic carrier skeleton.

[0126] In one specific embodiment of the present invention, the vector backbone of the vector includes any one of the following: pUC series plasmids (e.g., pUC57), pVAX series plasmids (e.g., pVAX1), pcDNA series plasmids (e.g., pcDNA3.1), pBud series plasmids (e.g., pBudCE4.1), or pCEP series plasmids (e.g., pCEP4).

[0127] Preferably, the vector or nucleic acid may also contain other elements, such as promoters, terminators, ribosome binding sites, 5'UTR, 3'UTR, polyA, polyC, polyAC spacers, YTHFD binding regions, eIF4G aptamers, etc. The promoter is preferably a constitutive promoter or an inducible promoter (e.g., the T7 promoter).

[0128] Preferably, the upstream of the target sequence includes SEQ ID NO: 31, and the downstream of the target gene includes 32.

[0129] In one specific embodiment of the present invention, the vector or nucleic acid includes SEQ ID NO: 11, 20.

[0130] A second aspect of the present invention provides the application of the vector or nucleic acid described in the first aspect above in the preparation of circular RNA.

[0131] A third aspect of the present invention provides a method for preparing circular RNA, the method comprising using the vector or nucleic acid described in the first aspect above; or the method comprising inserting a target sequence into the circular structure of a ribozyme and then transcribing it in vitro.

[0132] Preferably, the method includes linearizing the vector or nucleic acid described in the first aspect above (e.g., by enzyme digestion) and then transcribing it (preferably in vitro transcription).

[0133] Preferably, the transcription includes a reaction at 30°C-40°C (e.g., 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C or 40°C) for 3-5 hours (e.g., 3, 4 or 5 hours). The reaction is preferably carried out in a water bath.

[0134] Preferably, the method further includes digesting the DNA template in the system, for example by a DNase (preferably an endonuclease or exonuclease, such as DNase I).

[0135] Preferably, the method further includes eliminating the secondary structure of the RNA precursor, preferably by incubating at high temperature followed by cooling, for example by incubating at any value in the range of 65°C-75°C (e.g., 65°C, 66°C, 67°C, 68°C, 69°C, 70°C, 71°C, 72°C, 73°C, 74°C, or 75°C) for 3-10 minutes (e.g., 3, 4, 5, 6, 7, 8, 9, or 10 minutes) and then placing it on ice. For example, incubation in a metal bath.

[0136] Preferably, the method further includes adding a divalent cation;

[0137] Preferably, the divalent cation includes Ca. 2+ Mg 2+ Ba 2+ Zn 2+ Cu 2+ Fe 2+ or Hg 2+ One or more of them.

[0138] In one specific embodiment of the present invention, the divalent cation is Mg. 2+ .

[0139] Preferably, the final concentration of the added divalent cation is any value in the range of 5-100 mM (e.g., 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 15 mM, 20 mM, 25 mM, 30 mM, 35 mM, 40 mM, 45 mM, 50 mM, 55 mM, 60 mM, 65 mM, 70 mM, 75 mM, 80 mM, 85 mM, 90 mM, 95 mM or 100 mM).

[0140] Preferably, a divalent cation is added and incubated at any value in the range of 0°C to 60°C (e.g., 0°C, 5°C, 10°C, 15°C, 20°C, 25°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 45°C, 50°C, 55°C, or 60°C), preferably for at least 10 minutes, such as 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 minutes or longer.

[0141] Preferably, the method further includes purification or enrichment, wherein the purification or enrichment comprises linear RNA in a digestion system, preferably using an RNase (e.g., an endonuclease or an exonuclease).

[0142] Preferably, the reaction temperature for purifying or enriching RNase is any value between 30°C and 40°C (e.g., 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, or 40°C).

[0143] Preferably, the reaction time for purifying or enriching the RNase is at least 10 minutes, for example, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100 minutes or longer.

[0144] In one specific embodiment of the present invention, the method includes linearizing the vector or nucleic acid described in the first aspect (e.g., by enzyme digestion), transcribing it, and then adding a divalent cation (preferably Mg). 2+ Incubation.

[0145] In one specific embodiment of the present invention, the method includes linearizing the vector or nucleic acid described in the first aspect above (e.g., by enzyme digestion), transcribing it, digesting the DNA template after the transcription reaction is completed, and then adding a divalent cation (preferably Mg). 2+ Incubation.

[0146] In one specific embodiment of the present invention, the method includes linearizing the vector or nucleic acid described in the first aspect (e.g., by enzyme digestion), transcribing it, digesting the DNA template and eliminating the secondary structure of the RNA precursor after the transcription reaction, and then adding a divalent cation (preferably Mg). 2+ Incubation.

[0147] In one specific embodiment of the present invention, the method includes linearizing the vector or nucleic acid described in the first aspect (e.g., by enzyme digestion), transcribing it, digesting the DNA template and eliminating the secondary structure of the RNA precursor after the transcription reaction, and then adding a divalent cation (preferably Mg). 2+After incubation, the RNA is purified or enriched (including digestion of linear RNA).

[0148] In a fourth aspect, the present invention provides a composition or kit for preparing circular RNA.

[0149] Preferably, the composition or kit comprises the 5' end sequence and the 3' end sequence of the ribozyme.

[0150] Preferably, the composition or kit further comprises one or more of an IRES sequence, a spacer sequence, or a homologous arm.

[0151] Preferably, the composition or kit further includes reagents required for in vitro transcription.

[0152] Preferably, the composition or kit further comprises a divalent cation.

[0153] Preferably, the definitions of the 5' end sequence, 3' end sequence, IRES sequence, spacer sequence, and homologous arm of the ribozyme are the same as in the first aspect of the invention. The definitions of the divalent cation are the same as in the third aspect of the invention.

[0154] A fifth aspect of the present invention provides a circular RNA obtained by any of the vectors or nucleic acids described above, or by any of the methods described above.

[0155] In one specific embodiment of the present invention, the circular RNA contains only the target sequence.

[0156] In one specific embodiment of the present invention, the circular RNA comprises the 5' end sequence of the ribozyme, the target sequence, and the 3' end sequence of the ribozyme connected in sequence.

[0157] In one specific embodiment of the present invention, the circular RNA comprises the 5' end sequence of the ribozyme, the IRES sequence, the target sequence, and the 3' end sequence of the ribozyme connected in sequence.

[0158] In one specific embodiment of the present invention, the circular RNA comprises the 5' end sequence of the ribozyme, the 5' spacer sequence, the target sequence, the 3' spacer sequence, and the 3' end sequence of the ribozyme connected in sequence.

[0159] In one specific embodiment of the present invention, the circular RNA comprises the 5' end sequence of the ribozyme, the 5' spacer sequence, the IRES sequence, the target sequence, the 3' spacer sequence, and the 3' end sequence of the ribozyme connected in sequence.

[0160] In one specific embodiment of the present invention, the circular RNA comprises the 5' end sequence of the ribozyme, the 5' spacer sequence, the target sequence, the IRES sequence, the 3' spacer sequence, and the 3' end sequence of the ribozyme connected in sequence.

[0161] In one specific embodiment of the present invention, the circular RNA comprises the 5' end sequence of the ribozyme, the 3' spacer sequence, the target sequence, the IRES sequence, the 5' spacer sequence, and the 3' end sequence of the ribozyme connected in sequence.

[0162] In one specific embodiment of the present invention, the circular RNA comprises the 5' end sequence of the ribozyme, the 3' spacer sequence, the IRES sequence, the target sequence, the 5' spacer sequence, and the 3' end sequence of the ribozyme connected in sequence.

[0163] A sixth aspect of the present invention provides a cell.

[0164] Preferably, the cells contain one or both of the above-described vectors or nucleic acids or any of the above-described circular RNAs.

[0165] Preferably, the cells can be any type of cell, such as tumor cells (e.g., human lung cancer cell line A549, human breast cancer cell line MCF-7, human cervical cancer cell line HeLa), human embryonic kidney cell line (293 cells), human embryonic lung cells (HEL), rat hepatocytes, immune cells, etc.

[0166] A seventh aspect of the present invention provides the use of any of the above-described vectors or nucleic acids or any of the above-described circular RNAs in the preparation of products for treating and / or preventing diseases.

[0167] Preferably, the product includes a drug or a vaccine.

[0168] Preferably, the disease includes one or more of the following: tumor, autoimmune disease, or inflammation.

[0169] Preferably, the tumors include, but are not limited to, lymphomas (e.g., Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B-cell lymphoma, T-cell lymphoma, and Waldenström macroglobulinemia), B-cell tumors, T-cell tumors, bone marrow / monocyte tumors, lung cancer, leukemias (e.g., acute lymphoblastic leukemia, acute myeloid leukemia, myeloid leukemia, chronic lymphocytic leukemia, myeloma, plasma cell leukemia, or chronic myeloid leukemia). One or more of the following diseases: ovarian cancer, nasopharyngeal carcinoma, breast cancer, endometrial cancer, colon cancer, rectal cancer, gastric cancer, bladder cancer, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver cancer, bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome, or sarcoma (e.g., one or more of osteosarcoma, Ewing sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, or rhabdomyosarcoma);

[0170] Preferably, the immune-related diseases include, but are not limited to, allergies, asthma, myocarditis, nephritis, hepatitis, systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, primary thrombocytopenic purpura, autoimmune hemolytic anemia, ulcerative colitis, autoimmune liver disease, diabetes, pain or neurological disorders, etc.

[0171] Preferably, the inflammation includes both acute and chronic inflammation. Specifically, it includes, but is not limited to, one or more of the following: degenerative inflammation, exudative inflammation (serous inflammation, fibrinous inflammation, purulent inflammation, hemorrhagic inflammation, necrotizing inflammation, catarrhal inflammation, etc.), proliferative inflammation, or specific inflammation (tuberculosis, syphilis, leprosy, lymphogranuloma, etc.).

[0172] In an eighth aspect, the present invention provides a medicament comprising any of the above-described carriers or nucleic acids or any of the above-described circular RNAs or the above-described cells.

[0173] Preferably, the drug further comprises pharmaceutically acceptable excipients.

[0174] Preferably, the pharmaceutically acceptable excipients include, but are not limited to, one or more of the following: diluents, absorbents, wetting agents, binders, disintegrants, lubricants, solvents, pH adjusters, buffers, antioxidants, metal ion chelators, antibacterial agents, or isotonic adjusters.

[0175] Preferably, the drug can be formulated as any one of the following: syrup, elixir, suspension, powder, granules, tablet, capsule, pill, lozenge, rectal suppository, rectal enema, injection, ointment, lotion, aqueous solution, cream, gel, or emulsion (e.g., water-in-oil or oil-in-water emulsions). All dosage forms of the drug can be prepared according to conventional pharmaceutical manufacturing methods.

[0176] Preferably, the pharmaceutical formulation is a unit dose formulation. The amount of the active pharmaceutical ingredient in the unit dose formulation can be varied or adjusted from 0.001 mg to 1000 mg, depending on the specific application and efficacy of the active pharmaceutical ingredient.

[0177] Preferably, the route of administration of the drug includes, but is not limited to, gastrointestinal administration (e.g., oral administration, enteral administration, or catheter administration) or non-gastrointestinal administration (e.g., intravenous infusion, intramuscular injection, intradermal injection, subcutaneous injection, local administration, intraperitoneal administration, or intrathecal administration, etc.).

[0178] Depending on the specific implementation requirements, the drug may be used simultaneously with other therapeutic agents.

[0179] In a ninth aspect, the present invention provides a vaccine comprising any of the vectors or nucleic acids described above, or any of the circular RNAs described above, or the cells described above.

[0180] Preferably, the vaccine further comprises immunologically acceptable excipients.

[0181] Preferably, the immunologically acceptable excipients include adjuvants, diluents, solubilizers, lubricants, suspending agents, transfection promoters, excipients, fillers, binders, absorption enhancers and / or synergists, etc.

[0182] Preferably, the adjuvant includes, but is not limited to, surfactants such as immunostimulatory complexes, Freund's complete adjuvant (FCA) or Freund's incomplete adjuvant (FIA), CpG, aluminum salt adjuvants (aluminum hydroxide or aluminum phosphate), LPS analogs (e.g., monophosphate A), cell wall peptides, benzoquinone analogs, squalene, hyaluronic acid, lipids, liposomes, calcium ions, viral proteins, cations, polycations (e.g., poly-L-glutamic acid (LGS)) or nanoparticles, GM-CSF, IL-17, IFNg, IL-15, IL-21, anti-PD1 / 2, lactoferrin, protamine sulfate, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, INF-α, INF-γ, Lymphotoxin-α, hGH, MCP-1, MIP-1a, MIP-1p, IL-8, and RANT. ES, L-selectin, P-selectin, E-selectin, CD34, GlyCAM-1, MadCAM-1, LFA-1, VLA-1, Mac-1, p150.95, PECAM, ICAM-1, ICAM-2, ICAM-3, CD2, LFA-3, M-CSF, CD40, CD40L, vascular endothelial growth factor, fibroblast growth factor, nerve growth factor, Apo-1, p55, WSL-1, DR3, TRAMP, Apo-3, AIR, LARD, NGRF, DR4, DR5, KILLER, TRAIL-R2, TRICK2, DR6, caspase ICE, Fos, c-jun, Sp-1, Ap-1, Ap-2, p38, p65Rel, MyD88, IRAK, TRAF6, IkB, inactive NIK, SAP K, SAP-1, JNK, NFkB, Bax, TRAIL, TRAILrec, TRAILrecDRC5, TRAIL-R3, TRAIL-R4, RANK, RANK LIGAND, Ox40, Ox40LIGAND, NKG2D, MICA, MICB, NKG2A, NKG2B, NKG2C, NKG2E, NKG2F, TAP1, TAP2, and their functional fragments.

[0183] In a tenth aspect, the present invention provides a method for treating and / or preventing a disease. Preferably, the method comprises using one or more of the above-described vectors or nucleic acids, any of the above-described circular RNAs, the above-described cells, the above-described drugs, or the above-described vaccines.

[0184] Preferably, the method comprises administering to an individual in need an effective amount of one or more of the above-described vector or nucleic acid, any of the above-described circular RNA, the above-described cells, the above-described drugs, or the above-described vaccines.

[0185] The "ribozyme" described in this invention is catalytically active RNA, chemically known as ribonucleic acid. The ribozyme includes, but is not limited to, naturally discovered ribozymes or artificially synthesized ribozymes. Based on the type of catalytic reaction, it can be classified into cleavage-type ribozymes, splicing-type ribozymes, or ribozymes with only ligation function. The cleavage-type ribozymes include, but are not limited to, RNase P, hammerhead ribozymes, hairpin ribozymes, or hepatitis D virus ribozymes (HDV ribozymes). The splicing-type ribozymes include, but are not limited to, type I introns and type II introns.

[0186] The term "homology" as used in this invention refers to the ability of those skilled in the art to adjust the sequence according to actual work needs when using protein or nucleotide sequences, so that the sequence used has (including but not limited to) 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39% homology compared to sequences obtained by existing technologies. %, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% of the sameness.

[0187] The term "and / or" as used in this invention encompasses all combinations of items connected by the term, and should be considered as if each combination had been individually listed herein. For example, "A and / or B" includes "A", "A and B", and "B". As another example, "A, B and / or C" includes "A", "B", "C", "A and B", "A and C", "B and C", and "A and B and C".

[0188] The use of "comprising" or "including" in this invention is an open-ended description, encompassing the specified ingredients or steps described, as well as other specified ingredients or steps that do not materially affect them.

[0189] The “effective amount” as used in this invention refers to the amount or dose of the product of this invention that provides the desired prevention or treatment after being administered to an individual or organ in one or more doses.

[0190] The term "prevention" as used in this invention refers to all actions taken before or after the onset of a disease to avoid the occurrence of symptoms or delay the progression of specific symptoms by applying the products of this invention.

[0191] The “treatment” described in this invention refers to slowing down, interrupting, preventing, controlling, stopping, reducing or reversing the progression or severity of a sign, symptom, disorder, condition or disease after the disease has begun to develop, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, conditions or disorders.

[0192] The term "pharmaceutically acceptable" or "immunologically acceptable" as used in this invention refers to the biological activity and properties of the active substance in the applied product that neither significantly stimulates the organism nor inhibits it. Attached Figure Description

[0193] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings, wherein:

[0194] Figure 1: Secondary structure diagram of the L1 ligase when the 5' end sequence is ligated to the 3' end sequence of the L1 ligase and functions as a ligase.

[0195] Figure 2: Electrophoresis of the circularized products and enriched products of the L1 ligation ribozyme method for preparing green fluorescent protein (eGFP) circular RNA. Leftmost lane: RNA marker; Lane 1: Product after IVT and circularization reaction, which is the circularized product of eGFP circular RNA, containing linear precursors, circular RNA and other byproducts; Lane 2: Enriched product of eGFP circular RNA after RNase R enrichment and purification, containing only circular RNA.

[0196] Figure 3: Sequencing map of circular RNA ligation interface.

[0197] Figure 4: Cell fluorescence detection 24 hours after transfection with eGFP circular RNA prepared by the L1 ligation ribozyme method. Left panel: Negative control; Right panel: Transfection with eGFP circular RNA prepared in Example 1.

[0198] Figure 5: Fluorescence detection results of cells 12 hours after transfection with the prepared luciferase (Fluc) circular RNA, where NC represents the blank control group. Detailed Implementation

[0199] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0200] Figure 1 shows the secondary structure of the L1 ligase used in the examples when its 5' end sequence is ligated to its 3' end sequence and it functions as a ligase.

[0201] Example 1: Construction of green fluorescent protein (eGFP) circular RNA

[0202] The eGFP nucleic acid sequence was retrieved and downloaded from the NCBI database. The complete green fluorescent protein DNA sequence was constructed into the pUC57 vector to prepare a precursor plasmid. The nucleotide sequence of the precursor plasmid is shown in SEQ ID NO: 11 (which includes the T7 promoter sequence (SEQ ID NO: 27)). After linearization and restriction enzyme digestion, the precursor plasmid was purified to obtain the transcription template. The in vitro transcription (IVT) reaction solution was prepared, and the reaction system is shown in Table 1, or the amounts of each component were increased proportionally. The reaction conditions were a 37°C water bath for 4 hours.

[0203] Table 1

[0204] After the IVT reaction, DNase I is added to eliminate the DNA transcription template. The product after template elimination is then placed in a metal bath and incubated at 70°C for 5 minutes, immediately followed by placement on ice. This step inactivates DNase I and disrupts the secondary structure of the precursor RNA. An additional 5–60 mM MgSO4 is added to the product from the previous step. 2+ Mg is usually added. 2+ The final concentration is 40 mM. For example, in this embodiment, 1.74 μL of Mg with an initial concentration of 500 mM is added to a 20 μL IVT reaction system. 2+ After mixing by pipetting and aspiration, incubate at 37°C for 30 minutes or longer to perform the cyclization reaction of precursor RNA to obtain the cyclized product. Further purify the RNA in the above reaction product; in most cases, these RNAs include precursor RNA and circular RNA. RNase R is used to enrich the cyclized product. RNase R, derived from *E. coli*, is a magnesium-dependent 3'-5' ribonuclease that can digest almost all linear RNA but is not readily digestible of circular RNA. The RNase R reaction system is shown in Table 2, or the components in the system can be increased proportionally. The reaction conditions for the above system are 37°C for 15-30 minutes.

[0205] Table 2

[0206] The cyclized product was purified by RNase R to obtain an enriched product, the concentration of which was determined by spectrophotometer and stored at -80℃.

[0207] In most cases, the cyclized product and the final enriched product are examined by agarose gel electrophoresis. A 1% (w / v) agarose gel is prepared, and 1-2 μg of the cyclized product and enriched product are subjected to gel electrophoresis for identification. As shown in Figure 2, after RNase R digestion, the product bands are single, indicating that linear RNA has been removed from the product, leaving high-purity circular RNA molecules.

[0208] After reverse transcription and PCR, the circularized RNA ligation interface was sequenced using Sanger sequencing, as shown in Figure 3. The sequencing at the circular interface was correct, and the fragment was successfully ligated at both ends without any base insertion. This confirms the feasibility of the circularization strategy based on the L1 ligase.

[0209] Example 2: Validation of Green Fluorescent Protein (eGFP) Circular RNA Expression

[0210] Validation of eGFP circular RNA protein expression prepared in Example 1. Lipofectamine was used. TM 293T cells were transfected with 3000 transfection reagent (Invitrogen), and the expression of eGFP circular RNA was detected by fluorescence microscopy after transfection.

[0211] One day before transfection, healthy 293T cells were injected with 1×10⁻⁶ cells. 6 The cells were evenly seeded into six-well cell culture plates and cultured overnight. Before transfection, the culture medium in the six-well cell culture plates was discarded, and the cells were washed twice with sterile PBS. The PBS was discarded, and serum-reduced OPTI-MEM medium was added for later use. 3.75 μL of transfection reagent and 2.5 μg of eGFP circular RNA were diluted separately with 125 μL of OPTI-MEM medium. The diluted eGFP circular RNA was added to the diluted transfection reagent and gently mixed, and allowed to stand for 15 minutes. The eGFP circular RNA-transfection reagent complex was evenly added to the prepared 293T cells and cultured at 37°C in a 5% CO2 incubator for 24 hours. After culture, the six-well cell culture plates were imaged under an inverted fluorescence microscope. As shown in Figure 4, a clear green fluorescence signal was observed in the cells 24 hours after transfection with eGFP circular RNA, proving that the eGFP circular RNA prepared in Example 1 can translate into functional green fluorescent protein.

[0212] Example 3: Construction and expression verification of luciferase (Fluc) circular RNA

[0213] The preparation method of the luciferase circular RNA is the same as in Example 1. The nucleotide sequence of the precursor plasmid designed for luciferase is shown in SEQ ID No: 20.

[0214] The prepared luciferase circular RNA was also prepared using lipofectamine. TM 293T cells were transfected with 3000 transfection reagent, and the fluorescence signal intensity after transfection was detected using luciferase detection reagent to verify the expression properties of luciferase circular RNA.

[0215] One day before transfection, healthy 293T cells were injected with 2×10⁻⁶ cells. 4 The cells were evenly seeded into 96-well cell culture plates and cultured overnight. Before transfection, the culture medium in the 96-well cell culture plates was discarded and replaced with 100 μL of serum-diluted OPTI-MEM medium. The amounts of transfection reagent and circular RNA in each well of the 96-well cell culture plate were as follows: 0.15 μL of transfection reagent and 100 ng of luciferase circular RNA were diluted separately with 5 μL of OPTI-MEM medium. The diluted luciferase circular RNA was added to the diluted transfection reagent and gently mixed, then incubated for 15 minutes. The luciferase circular RNA-transfection reagent complex was then evenly added to the prepared 293T cells and cultured at 37°C in a 5% CO2 incubator for 12 hours.

[0216] Before detecting luciferase, the Britelite Plus (Revvity) luciferase assay reagent was removed from the -80℃ freezer and allowed to equilibrate to room temperature. 100 μL of the luciferase assay reagent was added to each well of a 96-well 293T cell culture plate to be tested, and the mixture was gently pipetted and aspirated, then allowed to stand for 1-2 minutes. 100 μL of the supernatant was added to each white-background 96-well assay plate, and the plate was quickly placed in a microplate reader to detect the luciferase intensity. The reading wavelength was 576 nm, and the read length was 1000 ms. The results are shown in Figure 5. Compared to the blank cell group, cells transfected with luciferase circular RNA were able to express luciferase.

[0217] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0218] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

Claims

1. A vector or nucleic acid for preparing circular RNA, characterized in that, The vector or nucleic acid contains the 5' end sequence of the ribozyme and the 3' end sequence of the ribozyme; Preferably, the ribozyme is a ribozyme capable of catalyzing the formation of 5'-3' phosphodiester bonds.

2. The vector or nucleic acid according to claim 1, characterized in that, The ribozyme is a ligation ribozyme that specifically catalyzes ligation; Preferably, the ligation ribozyme comprises three stem-loop structures and a hinge region, wherein the three stem-loop structures are Stem A, Stem B, and Stem C, Stem A comprises a 5' end chain and a 3' end chain, and the hinge region comprises a double strand. The structure of the ligation ribozyme is as follows: The 5' end chain of Stem A - Stem B - one chain in the hinge region - Stem C - another chain in the hinge region - the 3' end chain of Stem A.

3. The vector or nucleic acid according to claim 2, characterized in that, The 3' end of the 5' end chain of Stem A is connected to the 5' end of Stem B. The 5' end of one chain in the hinge area is connected to the 3' end of Stem B, and the 3' end is connected to the 5' end of Stem C. The 5' end of another chain in the hinge area is connected to the 3' end of Stem C, and the 3' end is connected to the 5' end of the 3' end chain of Stem A.

4. The vector or nucleic acid according to claim 2 or 3, characterized in that, In Stem B and Stem C, the stem is a double strand with complementary base pairing. In Stem A, the stem contains a ligation site and a double strand with complementary base pairing. The ligation site is located between the first nucleotide G and the last nucleotide of the ribozyme, and the last nucleotide is U or T.

5. The vector or nucleic acid according to any one of claims 2-4, characterized in that, The structure of the ligation ribozyme is as follows: 5' end chain of Stem A - 5' end chain of Stem B - Stem B loop - 3' end chain of Stem B - a chain in the hinge region - 5' end chain of Stem C - Stem C loop - 3' end chain of Stem C - another chain in the hinge region - 3' end chain of Stem A.

6. The vector or nucleic acid according to any one of claims 2-5, characterized in that, The loop sequences in Stem A, Stem B, and Stem C are each independently GNRA, where N is selected from any one of A, T, C, G, or U; and R is selected from G or A. Preferably, the sequence of the rings in the stem-ring structure is GAAA.

7. The vector or nucleic acid according to claim 1, characterized in that, The ribozyme is not a type I intron or / or a type II intron.

8. The vector or nucleic acid according to any one of claims 1-7, characterized in that, The 5' end sequence and the 3' end sequence of the ribozyme are formed by breaking at the loop sequence of the stem-loop structure of the ribozyme.

9. The vector or nucleic acid according to claim 8, characterized in that, The nucleotide sequence linked to the Stem A loop of the ribozyme is broken. Preferably, the nucleotide sequence linked to the 5' end of the Stem A loop is the 5' end sequence of the ribozyme, and the nucleotide sequence linked to the 3' end of the Stem A loop is the 3' end sequence of the ribozyme.

10. The vector or nucleic acid according to claim 8, characterized in that, The nucleotide sequence linked to the Stem B loop of the ribozyme is broken. Preferably, the nucleotide sequence linked to the 5' end of the Stem B loop is the 5' end sequence of the ribozyme, and the nucleotide sequence linked to the 3' end of the Stem B loop is the 3' end sequence of the ribozyme.

11. The vector or nucleic acid according to claim 8, characterized in that, The nucleotide sequence is broken at the Stem C loop of the ribozyme. Preferably, the nucleotide sequence linked to the 5' end of the Stem C loop is the 5' end sequence of the ribozyme, and the nucleotide sequence linked to the 3' end of the Stem C loop is the 3' end sequence of the ribozyme.

12. The vector or nucleic acid according to any one of claims 1-11, characterized in that, The ribozyme sequence comprises SEQ ID NO: 1 or SEQ ID NO: 28, or comprises a nucleic acid sequence having more than 90% homology with the nucleic acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 28, or comprises a nucleic acid sequence having at least one, two or more, or at most five, four, three or two nucleotide substitutions, deletions or insertions on SEQ ID NO: 1 or 28.

13. The vector or nucleic acid according to any one of claims 1-12, characterized in that, The ribozyme is an L1-ligated ribozyme, and the 5' and 3' sequences of the L1-ligated ribozyme are selected from any one of the following groups: A) The nucleotide sequence of the 5' end is shown as GGACCTCGGCGAAAGCCGTTCGACCAGCGAAAGCTCTTAGACAGGAGGTTAGGTGCTCC (SEQ ID NO: 4) or GGACCUCGGCGAAAGCCGUUCGACCAGCGAAAGCUCUUAGACAGGAGGUUAGGUGCUCC (SEQ ID NO: 21); the nucleotide sequence of the 3' end is shown as GGAGCACT (SEQ ID NO: 7) or GGAGCACU (SEQ ID NO: 22); B) The nucleotide sequence of the 5' end is shown as GGACCTCGGCGAAAGCCGTTCGACCAGC (SEQ ID NO: 3) or GGACCUCGGCGAAAGCCGUUCGACCAGC (SEQ ID NO: 23); the nucleotide sequence of the 3' end is shown as GCTTTAGACAGGAGGTTAGGTGCTCCGAAAGGAGCACT (SEQ ID NO: 6) or GCUCUUAGACAGGAGGUUAGGUGCUCCGAAAGGAGCACU (SEQ ID NO: 24). C) The nucleotide sequence of the 5' end is shown as GGACCTCGGC (SEQ ID NO: 2) or GGACCUCGGC (SEQ ID NO: 25); the nucleotide sequence of the 3' end is shown as GCCGTTCGACCAGCGAAAGCTCTTAGACAGGAGGTTAGGTGCTCCGAAAGGAGCACT (SEQ ID NO: 5) or GCCGUUCGACCAGCGAAAGCUCUUAGACAGGAGGUUAGGUGCUCCGAAAGGAGCACU (SEQ ID NO: 26).

14. The vector or nucleic acid according to any one of claims 1-13, characterized in that, The vector or nucleic acid also contains an IRES sequence. Preferably, the IRES sequence is derived from: Taura syndrome virus, triatomine virus, Theiler's encephalomyelitis virus, simian virus 40, red imported fire ant virus 1, rice constrictor aphid virus, reticuloendotheliosis virus, human poliovirus 1, Plautia stali enterovirus, Kashmir bee virus, human rhinovirus 2, glass leafhopper virus-1, human immunodeficiency virus type 1, glass leafhopper virus-1, Himetobi P virus, hepatitis C virus, hepatitis A virus, GB hepatitis virus, foot-and-mouth disease virus, human enterovirus 71, equine rhinitis virus, and Ectropis obliqua picorna-like virus. Virus), encephalomyocarditis virus, fruit tree C virus, human Coxsackievirus B3, cruciferous tobacco mosaic virus, cricket paralysis virus, bovine viral diarrhea virus 1, black bee queen cell virus, aphid lethal paralysis virus, avian encephalomyelitis virus, acute bee paralysis virus, hibiscus chlorotic ringspot virus, classical swine fever virus, human FGF2, human SFTPA1, human AML1 / RUNX1, fruit tree antennae and legs, human AQP4, human AT1R, human BAG-1, human BCL2, human BiP, human c-IAPl, human c-myc, human eIF4G, mouse NDST4L, human LEF1, mouse HIF1α, human n.myc, mouse Gtx, human p27kipl, human PDGF2 / c-sis, human p53, human Pim-1, mouse Rbm3, fruit reaper, canine scamper, fruit ubx, human UNR, mouse UtrA, human VEGF-A, human XIAP, fruit hairless, Saccharomyces cerevisiae TFIID, Saccharomyces cerevisiae YAP1, tobacco etch virus, turnip shrunken virus, EMCV-A, EMCV-B, EMCV-Bf, EMCV-Cf, EMCV pEC9, small disegmented RNA virus (Picoirnavirus), HCV QC64, human cosavirus (E / D), human cosavirus (F), human cosavirus (JMY), rhinovirus NAT001, HRV14, HRV89, HRVC-02, HRV-A21, Salivirus (A SH1), Salivirus (FHB), Salivirus (NG-J1), human paraenteric virus 1, Crohivirus B, Yc-3, Rosavirus M-7, Shanbavirus A, Pasivirus A, Pasivirus A 2, Echovirus E14, Human Paraenteritis Virus 5, Aichi Virus, Hepatitis A Virus HA16, Phopivirus, CVA10, Enterovirus C, Enterovirus D, Enterovirus J, Human Pegivirus 2, GBV-C GT110, GBV-C K1737, GBV-C Iowa, Pegivirus A 1220, Pasivirus A 3, Sapelovirus, Rosavirus B, Bakunsa Virus, Tremovirus A, Porcine Pasivirus 1, PLV-CHN, Pasivirus One or more of the following: A, Sicinivirus, Hepatitis Virus K, Hepatitis Virus A, BVDV1, Border Disease Virus, BVDV2, CSFV-PK15C, SF573 Bicistronic Virus, Minimally Infectious Virus-like Virus, CRPV, Salivirus A BN5, Salivirus A BN2, Salivirus A 02394, Salivirus A GUT, Salivirus A CH, Salivirus A SZ1, Salivirus FHB, CVB3, CVB1, Echovirus 7, CVB5, EVA71, CVA3, CVA12, EV24, or eIF4G. Preferably, the IRES is derived from CVB3; Preferably, the IRES comprises SEQ ID NO: 8 or comprises a nucleotide sequence having more than 90% homology with SEQ ID NO: 8; Preferably, the vector or nucleic acid comprises, from the 5' end to the 3' end, the 5' end sequence of the ribozyme, the IRES sequence, and the 3' end sequence of the ribozyme.

15. The vector or nucleic acid according to any one of claims 1-14, characterized in that, The vector or nucleic acid further comprises a spacer sequence, preferably a 5' spacer sequence and / or a 3' spacer sequence. Preferably, the 5' spacer sequence comprises SEQ ID NO: 9 or comprises a nucleotide sequence having more than 90% homology with SEQ ID NO: 9; Preferably, the 3' spacer sequence comprises SEQ ID NO: 10 or comprises a nucleotide sequence having more than 90% homology with SEQ ID NO: 10; Preferably, the vector or nucleic acid comprises, from the 5' end to the 3' end, the following sequence: the 5' end sequence of the ribozyme, the 5' spacer sequence, the IRES sequence, the 3' spacer sequence, and the 3' end sequence of the ribozyme.

16. The vector or nucleic acid according to any one of claims 1-15, characterized in that, The vector or nucleic acid contains a target sequence, which is located between the 5' end sequence and the 3' end sequence of the ribozyme. Preferably, the target sequence can be DNA, RNA, or a spliced ​​sequence of DNA and RNA; Preferably, the target sequence can be one or more.

17. The vector or nucleic acid according to any one of claims 1-16, characterized in that, The vector or nucleic acid comprises, from the 5' end to the 3' end, the following: The 5' end sequence of the ribozyme, the 5' spacer sequence, the IRES sequence, the target sequence, the 3' spacer sequence, and the 3' end sequence of the ribozyme; or, The 5' end sequence of the ribozyme, the 5' spacer sequence, the target sequence, the IRES sequence, the 3' spacer sequence, and the 3' end sequence of the ribozyme; or, The 5' end sequence, 3' spacer sequence, target sequence, IRES sequence, 5' spacer sequence, and 3' end sequence of the ribozyme; or, The 5' end sequence, 3' spacer sequence, IRES sequence, target sequence, 5' spacer sequence, and 3' end sequence of the ribozyme.

18. The vector or nucleic acid according to claim 16 or 17, characterized in that, The protein encoded by the target sequence comprises one or more of the following: antibody (preferably a full-length antibody, scFv antibody, VHH antibody, antibody heavy chain, antibody light chain, antibody heavy chain variable region, or antibody light chain variable region), chimeric antigen receptor (CAR), T cell receptor (TCR, preferably comprising TCR α chain, TCR β chain, TCR γ chain, or TCR δ chain), synthetic T cell receptor antigen receptor (STAR, preferably comprising STAR α chain, STAR β chain, STAR γ chain, STAR δ chain), cytokine, chemokine, transcription factor, immunogen, or adjuvant; or, the target sequence comprises the sequence required for gene editing or a reporter gene.

19. The vector or nucleic acid according to claim 18, characterized in that, The cytokines mentioned include one or more of IL-2, IL-4, IL-6, IL-7, IL-10, IL-11, IL-12, IL-13, TGF-β, IL-1RA, or IL-15; Preferably, the transcription factor includes one or more of FOXP3, STAT5B, HELIOS, Tbet, GATA3, RORgt, or CD25; Preferably, the chemokine includes one or more of CC chemokine, CXC chemokine, XC chemokine or CX3C chemokine; more preferably, it includes one or more of CCL 1-28, CXCL 1-17, XCL 1-2 or CX3CL1. Preferably, the reporter gene includes a fluorescent protein reporter gene (e.g., one or more of GFP, eGFP, RFP or BFP), a luciferase reporter gene, a human growth hormone (hGH) reporter gene, a secretory alkaline phosphatase (SEAP) reporter gene, a chloramphenicol acetyltransferase (CAT) reporter gene, or a β-galactosidase reporter gene. Preferably, the gene editing sequence includes the sequence required by the CRISPR system, the sequence required for tissue-specific knockout, or interfering RNA; Preferably, the immunogen includes viral proteins, bacterial proteins, or parasitic proteins.

20. The vector or nucleic acid according to any one of claims 1-19, characterized in that, The carrier skeleton of the carrier includes a prokaryotic carrier skeleton or a eukaryotic carrier skeleton.

21. A method for preparing circular RNA, characterized in that, The method involves inserting the target sequence into the loop structure of a ribozyme and then transcribing it in vitro.

22. A method for preparing circular RNA, characterized in that, The method includes using the vector or nucleic acid as described in any one of claims 1-20; Preferably, the method includes transcribing the vector or nucleic acid according to any one of claims 1-20 after linearization; Preferably, the transcription is in vitro transcription.

23. The method according to claim 21 or 22, characterized in that, The method further includes the addition of divalent cations; Preferably, the divalent cation includes Ca. 2+ Mg 2+ Ba 2+ Zn 2+ Cu 2+ Fe 2+ or Hg 2+ One or more of the following; more preferably Mg 2+ .

24. A circular RNA obtained by the vector or nucleic acid of any one of claims 1-20 or by the method of any one of claims 21-23.

25. A cell characterized in that, The cells contain the vector or nucleic acid as described in any one of claims 1-20 or the circularized RNA as described in claim 24.

26. The use of a vector or nucleic acid according to any one of claims 1-20 or a circular RNA according to claim 24 in the preparation of products for treating and / or preventing diseases; Preferably, the product includes a drug or a vaccine; Preferably, the disease includes one or more of the following: tumor, autoimmune disease, or inflammation.

27. A drug, characterized in that, The drug comprises the vector or nucleic acid according to any one of claims 1-20 or the circular RNA according to claim 24; Preferably, the drug further comprises pharmaceutically acceptable excipients.

28. A vaccine, characterized in that, The vaccine comprises the vector or nucleic acid as described in any one of claims 1-20 or the circular RNA as described in claim 24; Preferably, the vaccine further comprises immunologically acceptable excipients.

Images