Method for imparting environmental stress resistance to plants

By maintaining plants at 22°C to 28°C for 10 days to 12 weeks, the method enhances stress tolerance and gene expression, addressing inefficiencies in existing methods and improving hops' resilience to environmental stresses.

WO2026029086A1PCT designated stage Publication Date: 2026-02-05KIRIN HOLDINGS KK
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/026935
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-02-26
Filing Date
2025-07-30
Publication Date
2026-02-05

AI Technical Summary

Technical Problem

Existing methods for imparting heat stress tolerance to plants, such as breeding and genetic modification, are inefficient or costly, and there is a need for a more effective and practical method to enhance environmental stress tolerance in plants, particularly hops, which are affected by rising temperatures due to climate change.

Method used

A method involving maintaining plants, specifically hops, at a temperature range of 22°C to 28°C for a period of 10 days to 12 weeks, preferably in a liquid medium, to promote the expression of stress-responsive genes like HSFA2, HSP21, ZAT, AOX, DREB, and NCED, thereby enhancing tolerance to high temperature, oxidative, drought, and osmotic stresses.

Benefits of technology

This method effectively imparts environmental stress tolerance to plants, promoting gene expression and enhancing their ability to withstand high temperatures, oxidative stress, drought, and osmotic stress, while also promoting initial growth and reducing stress-related disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JP2025026935_05022026_PF_FP_ABST
    Figure JP2025026935_05022026_PF_FP_ABST
Patent Text Reader

Abstract

Provided is a method for imparting high-temperature stress resistance to plants. This method for producing a plant seedling to which environmental stress resistance is imparted includes a step for holding a plant body within a fixed temperature range for a fixed period of time, wherein the fixed temperature range is a temperature range of 22-28°C, and the fixed period is a period of 10 days to 12 weeks.
Need to check novelty before this filing date? Find Prior Art

Description

Method for imparting environmental stress tolerance to plants

[0001] The present invention relates to a technique for imparting environmental stress tolerance to plants.

[0002] Rising average temperatures are inevitable due to worsening climate change. For hops, which prefer cool climates, a negative correlation between late-summer temperatures and yield has been reported (Non-Patent Document 1). Furthermore, an evaluation combining weather forecast data with a hop yield and quality prediction model predicts that if temperatures rise by 1.4°C compared to the 1990s, yields will decrease by 20% and alpha acid content will decrease by 30% by 2050 (Non-Patent Document 2). Therefore, to ensure stable harvests of crops and other plant materials even in the face of worsening climate change, there is a need for the development of technologies that can confer heat stress tolerance to plants. Currently, there are three main agricultural techniques for enhancing heat stress tolerance in plants: 1) breeding of heat-tolerant varieties, 2) genetic modification, and 3) agricultural materials for improving heat tolerance. Technique 1 is one of the most reliable methods for stably and long-term conferring heat stress tolerance to plants. However, efficient breeding techniques have not yet been established for many crops, and the long time it takes to develop heat-tolerant varieties remains an issue. Research on 2) is being conducted mainly on model plants. It has been reported that when a genetically modified tomato plant was created that constitutively expresses Heat Shock Protein 21 (HSP21), it exhibited resistance to high temperature stress and oxidative stress (Patent Document 3). However, this method has the drawback of being unsuitable for general use, considering the effort required to create a genetically modified plant for each plant species and the difficulty of genetic modification in most plants. Sanguinarine has been reported as a compound that enhances the high temperature resistance of plants (Patent Document 1), but it is expensive, posing challenges for industrial application.

[0003] International Publication No. 2013 / 151041

[0004] Donner et al, Plant Soil and Environ, Volume 66 , Issue 1, Pages 41-46, 2020Mozny et al, Nat. Commun., Volume 14-6028, 2023Neta et al, The Plant Cell, Volume 17, Pages 1829-1838, 2005

[0005] The present invention addresses the problem of providing a method for imparting resistance to environmental stresses such as high temperature stress to plants.

[0006] The present inventors have conducted extensive research into methods for imparting environmental stress tolerance to plants, and as a result have found that environmental stress tolerance, such as high temperature stress tolerance, can be imparted to hops by treating them at a specific temperature for a specific period of time, thereby completing the present invention.

[0007] That is, the present invention is as follows: [1] A method for producing a plant seedling to which environmental stress tolerance has been imparted, comprising the step of maintaining a plant body within a certain temperature range for a certain period of time, wherein the certain temperature range is from 22°C to 28°C, and the certain period of time is from 10 days to 12 weeks. [2] The method of [1], wherein the step of maintaining a plant body within a certain temperature range for a certain period of time is carried out in a liquid. [3] The method of [1] or [2], wherein the plant body is a plant of the Cannabaceae family. [4] The method of [3], wherein the Cannabaceae plant is hops. [5] Any of the methods of [1] to [4], wherein the plant body is a tissue-cultured seedling. [6] Any of the methods of [1] to [5], wherein the environmental stress tolerance is one or more selected from the group consisting of high temperature stress tolerance, drought stress tolerance, oxidative stress tolerance, and osmotic stress tolerance. [7] A method for imparting environmental stress tolerance to a plant by maintaining the plant within a certain temperature range for a certain period of time, wherein the certain temperature range is between 22°C and 28°C, and the certain period of time is between 10 days and 12 weeks. [8] The method of [7], wherein the step of maintaining the plant within a certain temperature range for a certain period of time is carried out in a liquid. [9] The method of [7] or [8], wherein the plant is a plant of the Cannabaceae family.

[10] The method of [9], wherein the Cannabaceae plant is hops.

[11] Any of the methods of [7] to

[10] , wherein the plant is a tissue-cultured seedling.

[12] Any of the methods of [7] to

[11] , wherein the environmental stress tolerance is one or more selected from the group consisting of high temperature stress tolerance, drought stress tolerance, oxidative stress tolerance, and osmotic stress tolerance.

[13] A method for producing a plant in which expression of one or more genes selected from the group consisting of HSFA genes, HSP genes, ZAT genes, AOX genes, APX genes, DREB genes, and NCED genes is promoted, the method comprising a step of maintaining the plant within a certain temperature range for a certain period of time, wherein the certain temperature range is from 22°C to 28°C, and the certain period of time is from 10 days to 12 weeks.

[14] The method of

[13] , wherein the step of maintaining the plant within a certain temperature range for a certain period of time is carried out in a liquid.

[15] The method of

[13] or

[14] , wherein the plant is a plant of the Cannabaceae family.

[16] The method of

[15] , wherein the Cannabaceae plant is hops.

[17] Any of the methods

[13] to

[16] , wherein the plant is a tissue-cultured seedling.

[18] Any of the methods

[13] to

[17] , wherein the environmental stress tolerance is one or more selected from the group consisting of high temperature stress tolerance, drought stress tolerance, oxidative stress tolerance, and osmotic stress tolerance.

[19] A method for promoting expression of one or more genes selected from the group consisting of ZAT gene, HSP gene, HSFA gene, AOX gene, APX gene, DREB gene, and NCED gene in a plant, the method comprising the step of maintaining the plant within a certain temperature range for a certain period of time, wherein the certain temperature range is 22°C to 28°C, and the certain period of time is 10 days to 12 weeks.

[20] The method of

[19] , wherein the step of maintaining the plant within a certain temperature range for a certain period of time is carried out in liquid.

[21] The method of

[19] or

[20] , wherein the plant is a plant of the Cannabaceae family.

[22] The method of

[21] , wherein the Cannabaceae plant is hops.

[23] Any of the methods

[19] to

[22] , wherein the plant is a tissue-cultured seedling.

[24] Any of the methods

[19] to

[23] , wherein the environmental stress tolerance is one or more selected from the group consisting of high temperature stress tolerance, drought stress tolerance, oxidative stress tolerance, and osmotic stress tolerance.

[25] A method for producing a plant seedling whose initial growth after planting is promoted by maintaining a plant within a certain temperature range for a certain period of time, wherein the certain temperature range is 22°C to 28°C, and the certain period of time is 10 days to 12 weeks.

[26] The method of

[25] , wherein the step of maintaining the plant within a certain temperature range for a certain period of time is carried out in a liquid.

[27] The method of

[25] or

[26] , wherein the initial growth is an elongation of plant height.

[28] Any of the methods

[25] to

[27] , wherein the plant is a Cannabaceae plant.

[29] The method of

[28] , wherein the Cannabaceae plant is hops.

[30] The method according to any one of

[25] to

[29] , wherein the plant body is a tissue-cultured seedling.

[31] The method according to any one of

[25] to

[30] , wherein the environmental stress tolerance is one or more selected from the group consisting of high temperature stress tolerance, drought stress tolerance, oxidative stress tolerance, and osmotic stress tolerance.

[32] A method for promoting early growth after planting by maintaining a plant within a certain temperature range for a certain period of time, wherein the certain temperature range is between 22°C and 28°C, and the certain period of time is between 10 days and 12 weeks.

[33] The method of

[32] , wherein maintaining the plant within the certain temperature range for a certain period of time is carried out in liquid.

[34] The method of

[32] or

[33] , wherein the plant is a plant of the Cannabaceae family.

[35] The method of

[34] , wherein the Cannabaceae plant is hops.

[36] Any of the methods of

[25] to

[35] , wherein the plant is a tissue-cultured seedling.

[37] Any of the methods of

[25] to

[35] , wherein the environmental stress tolerance is one or more selected from the group consisting of high temperature stress tolerance, drought stress tolerance, oxidative stress tolerance, and osmotic stress tolerance. This specification incorporates the disclosure of Japanese Patent Application No. 2025-029422, from which the present application claims priority.

[0008] By applying the method of the present invention, it is possible to impart high temperature stress tolerance to plants. Furthermore, it is possible to impart environmental stress tolerance, such as oxidative stress tolerance and drought stress tolerance, and promote the expression of environmental stress tolerance genes. Furthermore, in addition to imparting environmental stress tolerance, it is also possible to promote initial growth after planting.

[0009] This figure shows the response of hops to high temperature stress after short-term acclimation at 37°C. This figure shows the appearance of hops cultivated under a high-temperature stress environment for 5 days. Leaf chlorosis under a high-temperature stress environment at 42°C was suppressed in the treated area (37°C, 4 hours) compared to the control area (Bar = 1 cm). This figure shows the response of hops to high temperature stress after short-term acclimation at 37°C. This figure shows the chlorophyll content per mg of leaves in hops cultivated under a high-temperature stress environment for 5 days. n = 15 (Test method: Student's t-test **P < 0.01; error bars indicate standard error). This figure shows the response of hops to high temperature stress after acclimation at 30°C for 4 hours in liquid culture. This figure shows the chlorophyll content per mg of leaves in hops cultivated under a high-temperature stress environment at 30°C for 4 weeks after acclimation at 30°C for 4 hours. The relative chlorophyll content compared to the control is shown. n = 9-10 (Test method: Student's t-test P = 0.873; error bars indicate standard error). Figure 3 shows the results of an investigation into acclimation conditions in liquid culture. After 6 weeks of growth at different temperatures, 20°C and 30°C, the plants grown at 30°C for 6 weeks (Figure 3B: acclimation group) showed leaf chlorosis and inhibited axillary bud outgrowth compared to the plants grown at 20°C for 6 weeks (Figure 3A: control group). Figure 3 shows the results of an investigation into acclimation conditions in liquid culture. This figure shows the chlorophyll content per mg of hop leaves after acclimation at 25°C for 4 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, and 12 weeks, followed by 4 weeks of high-temperature stress at 30°C (n = 9-11). This figure shows the effect of acclimation treatment at 25°C for 6 weeks using liquid culture, and shows the appearance of Saaz hops after treatment at 20°C for 6 weeks (Figure 5-1A: control group) or at 25°C for 6 weeks (Figure 5-1B: acclimation group), followed by 4 weeks of culture under a high-temperature stress environment at 30°C.These figures show the expression levels of the high-temperature stress-responsive genes HSFA2 and HSP21 in hops acclimated to 25°C for six weeks using liquid culture. Figure 5-2A shows the expression level of HSFA2 after six weeks of treatment at 20°C (control) or 25°C (treated), followed by exposure to high temperatures of 30°C for two hours. Figure 5-2B shows the expression level of HSP21 after six weeks of acclimation at 20°C (control) or 25°C (treated), followed by exposure to high temperatures of 30°C for four hours. Values ​​were calculated relative to the expression level in the control (20°C). n = 3 (Test method: Student's t test. *P < 0.05; error bars indicate standard error). In the figure, "SAZ" refers to Saaz hops, and "HEB" refers to Hersbrucker hops. The figure shows the plant height two weeks after planting of in vitro seedlings prepared by acclimation to 25°C for six weeks using liquid culture. Figure 6A shows the plant height of SAZ (Saaz hops), and Figure 6B shows the plant height of HEB (Helsbrucker hops). In the figure, 20°C represents the control area, and 25°C represents the treatment area. This figure shows the temperature two weeks after planting in an area that includes our company's test fields (Esashi, Oshu City, Iwate Prefecture). This figure was taken from the Japan Meteorological Agency website (https: / / www.data.jma.go.jp / obd / stats / etrn / view / daily_a1.php?prec_no=33&block_no=0236&year=2023&month=06&day=&view=p1). This figure shows the expression levels of environmental stress (high temperature stress, drought stress)-responsive genes two weeks after planting in the open field in cultured seedlings produced by acclimatization at 25°C for six weeks in liquid culture. The figures show the gene expression levels of HSP21 (Fig. 8-2A), HSFA2 (Fig. 8-2B), and DREB2A (Fig. 8-2C) two weeks after planting in the open field. The relative expression levels of the treated (25°C) plants compared with the control (20°C) plants were calculated. n = 5-6 (Test method: Student's t-test, **P < 0.01, *P < 0.05; error bars indicate standard error). "SAZ" stands for Saaz hops, and "HEB" stands for Hersbrucker hops.This figure shows the expression levels of environmental stress (oxidative stress)-responsive genes two weeks after field planting of cultured seedlings produced by acclimatization at 25°C for six weeks in liquid culture. The figures show the gene expression levels of ZAT10 (Fig. 8-2A), ZAT12 (Fig. 8-2B), AOX1a (Fig. 8-2C), and APX3 (Fig. 8-2D) two weeks after field planting. The relative expression levels of the treated (25°C) plants compared with the control (20°C) plants were calculated. n = 5–6 (Test method: Student's t-test, **P < 0.01, *P < 0.05; error bars indicate standard error). "SAZ" stands for Saaz hops, and "HEB" stands for Hersbrucker hops. This figure shows the response of hops to osmotic stress after acclimatization at 25°C for six weeks in liquid culture. The figure also shows the appearance of hops cultured under osmotic stress for 18 days. As shown in the figure, leaf yellowing was suppressed and fewer leaves died in treatment group B (acclimated) than in control group A (unacclimated) when a mannitol-containing medium was used. These results indicate that leaf yellowing and death under osmotic stress using a mannitol-containing solid medium were suppressed in treatment group B (25°C, 6 weeks) compared to control group A (Bar = 2 cm). This figure shows the response of hop plants to osmotic stress after 6 weeks of acclimation at 25°C in liquid culture. It also shows the chlorophyll content per milligram of leaves in hop plants cultured under osmotic stress for 18 days (n = 5 (Test method: Student's t-test *P < 0.05, error bars indicate standard deviation)). This figure shows the expression levels of the stress response-related genes HlDREB2A and HlNCED3 in hop plants after 6 weeks of acclimation at 25°C in liquid culture. Figure 10A shows the gene expression levels of HlDREB2A at 0 and 8 hours after osmotic stress exposure after acclimatization at 20°C for 6 weeks (control) or 25°C for 6 weeks (treated). Values ​​were calculated as relative expression levels, with the expression level at 0 hours of stress exposure in the control group (20°C for 6 weeks) set at 1 (n = 3 (Test method: Student's t-test *P < 0.05, error bars indicate standard deviation)).Figure 10B shows the gene expression levels of HlNCED3 at 0 and 8 hours after osmotic stress exposure after 6 weeks of acclimation at 20°C (control) or 6 weeks of acclimation at 25°C (treated). The values ​​are relative expression levels, with the expression level at 0 hours of stress exposure in the control (20°C, 6 weeks) set at 1 (n = 3; test method: Student's t-test *P < 0.05; error bars indicate standard deviation). This figure shows the response of hops to drought stress after 6 weeks of acclimation at 25°C in liquid culture. The irrigated (top) panel shows the appearance of hops that were irrigated throughout the growth period (without irrigation), while the unirrigated (bottom) panel shows the appearance of hops that were irrigated for 10 days, then resumed irrigation and grown for 7 days. As shown in the figure, leaf yellowing and dead leaves were suppressed in treated group B (acclimated) compared to control group A (unacclimated). These results indicate that leaf yellowing and withering under drought stress conditions were suppressed in treatment group B (25°C, 6 weeks) compared to control group A. Figure 1 shows the response of hops to drought stress after 6 weeks of acclimation at 25°C in liquid culture. Chlorophyll content per milligram of leaves from hops grown under drought stress conditions is shown (n = 10; test method: Student's t-test *P < 0.05; error bars indicate standard deviation). Figure 2 shows the response of hops to salt stress after 6 weeks of acclimation at 25°C in liquid culture. This figure shows the appearance of hops grown under salt stress conditions with tap water containing 0.2 M sodium chloride for 20 days. As shown in the figure, leaf yellowing and withering were suppressed in treatment group B (acclimated) compared to control group A (unacclimated). These results indicate that leaf yellowing and withering under salt stress conditions were suppressed in treatment group B (25°C, 6 weeks) compared to control group A. This figure shows the response of hops to salt stress after acclimatization treatment at 25°C for 6 weeks using liquid culture, and shows the chlorophyll content per mg of hop leaves grown under a salt stress environment (control: n = 10, treated: n = 20 (test method: Student's t-test *P < 0.05, error bars indicate standard deviation)).

[0010] The present invention is described in detail below. The present invention is a method for imparting environmental stress tolerance to a plant. Imparting environmental stress tolerance means suppressing the effects of environmental stress or imparting the ability to suppress the effects of environmental stress before the stress is applied, and includes reducing or eliminating the effects of environmental stress. In the method of the present invention, a plant is subjected to an acclimation treatment to environmental stress. Here, acclimation treatment refers to treating a plant seedling at a constant temperature for a constant period of time. The present invention is a method for imparting environmental stress tolerance to a plant, or a method for producing a plant imparted with environmental stress tolerance, preferably a method for producing a plant seedling imparted with environmental stress tolerance.

[0011] The method of the present invention can confer environmental stress tolerance to plants, reduce the effects of environmental stress that plants are normally exposed to, and promote plant growth, and therefore can also be referred to as a plant growth promotion method. Environmental stress that plants are normally exposed to includes mild environmental stress that does not cause chlorosis, poor growth, withering, etc. Here, in the present invention, "promotion" is used to mean both "enhancement," which increases the effect at a certain point in time, and "early expression," which accelerates the onset of the effect. Furthermore, "conferring environmental stress tolerance" also means enhancing or drawing out the environmental stress tolerance that plants originally possess.

[0012] The effects of environmental stress refer to unfavorable conditions for plants, such as bleaching, browning, and poor growth such as inhibition of axillary bud growth, and withering, which occur in plants due to environmental stress.

[0013] The present invention further relates to a method for promoting the production of an environmental stress responsive protein in a plant, and a method for producing a plant in which the production of the protein is promoted.The present invention still further relates to a method for promoting the expression of an environmental stress responsive gene in a plant, and a method for producing a plant in which the expression of the gene is promoted.Here, too, promotion is used to mean both enhanced production and enhanced expression, which result in a higher effect at a certain point in time, and early production and early expression, which result in a faster onset of effect.

[0014] 1. Environmental Stress According to the Agricultural Technology Dictionary published by the National Agriculture and Food Research Organization (http: / / lib.ruralnet.or.jp / nrpd / #koumoku=11040), environmental stress refers to abiotic stress such as high temperature, low temperature, and dryness, which are external factors that are unfavorable to plants. Examples of environmental stress include high temperature stress, low temperature stress, oxidative stress, strong light stress, drought stress, chemical stress, injury stress, osmotic stress, and salt stress.

[0015] Plants have the inherent ability to suppress declines in survival rate, growth, and yield in response to environmental stresses, and this ability is called environmental stress tolerance. Known examples of plant environmental stress tolerance include high temperature stress tolerance, drought stress tolerance, oxidative stress tolerance, osmotic stress tolerance, and salt stress tolerance.

[0016] Below, we will discuss examples of environmental stresses such as high temperature stress, drought stress, oxidative stress, osmotic stress, and salt stress, and the tolerance to these stresses.

[0017] Oxidative stress resistance refers to the ability to withstand damage caused by reactive oxygen species, which are believed to be caused by excess harmful elements, nutrient deficiencies, and excess light energy due to photorespiration (Japanese Journal of Soil Science and Plant Nutrition, Vol. 90, No. 4 (2019), 273-278). Oxidative stress is generally defined as the difference between the oxidative damage potential of reactive oxygen species produced in the body and the potential of the body's antioxidant system. Oxidative stress can be caused by an increase in the production of reactive oxygen species or a decrease in the antioxidant system in plants exposed to the above environmental stresses. Oxidative stress can also be caused by an increase in the production of reactive oxygen species due to the above environmental stresses. Therefore, oxidative stress refers to a plant's exposure to an environment that is susceptible to the effects of reactive oxygen species for any length of time or any number of times. Plants exposed to oxidative stress can exhibit chlorosis, stunted growth, and wilting.

[0018] Heat stress tolerance refers to the ability to withstand high temperatures. When temperatures rise suddenly, plants produce heat shock proteins (HSPs). HSPs prevent heat-induced denaturation of intracellular proteins and restore denatured proteins to their original structure. Plants that produce HSPs can withstand high temperatures that would normally kill them. Therefore, heat stress refers to a plant being exposed to temperatures higher than the normal growth temperature range for any length of time and any number of times. Plants exposed to heat stress experience conditions such as inhibited photosynthesis, difficulty absorbing water, and an imbalance in plant hormones, resulting in physiological disorders such as bleaching, poor growth, and withering. The range of high temperatures that cause stress varies by plant species; for example, in the case of hops, temperatures above 30°C can be considered to be heat stressful.

[0019] Drought stress tolerance refers to the ability to withstand water deficiency. When water is scarce, plants protect themselves by shedding leaves to reduce leaf area, thickening the cuticle on the leaf surface, closing stomata to prevent transpiration, and promoting root elongation to expand the rhizosphere in deeper, moister soil. Water balance is also maintained by osmotic adjustment through the accumulation of compatible solutes such as sugars and amino acids in the cytoplasm. Hydrophilic LEA proteins are thought to retain moisture and prevent the crystallization of other proteins due to desiccation. Therefore, drought stress refers to a plant's exposure to water conditions below the water level required for normal growth, for any length of time and any number of times. Plants exposed to drought stress experience physiological disorders, including poor growth and wilting.

[0020] Osmotic stress tolerance refers to the ability to withstand changes in osmotic pressure in the soil or other growing environment. Osmotic stress is caused by a sudden change in the osmotic pressure around plant cells, and can occur when the osmotic pressure is higher or lower than normal. Osmotic stress can inhibit growth and, in the worst case, cause yellowing and death.

[0021] Salt stress tolerance refers to the ability to withstand increased concentrations of salts such as sodium chloride in the soil or other growing environments. Salt stress is stress caused by excessive increases in the salt concentration in the growing environment. Salt stress is observed in salt-accumulated soils in areas flooded or infiltrated by seawater or in arid regions, for example, and can cause leaf yellowing and plant death.

[0022] In this way, plants can cope with high temperature stress, oxidative stress, strong light stress, drought stress, chemical stress, injury stress, osmotic stress, and salt stress through their environmental stress tolerance, and can suppress declines in survival rate, growth, yield, etc. even in the presence of these stresses.

[0023] The method of the present invention imparts environmental stress tolerance to plants, thereby enabling the plants to acquire tolerance to environmental stresses such as high temperature stress, oxidative stress, strong light stress, drought stress, chemical stress, wound stress, osmotic stress, and salt stress. Various environmental changes, such as drought, strong light, high temperature, chemicals such as pesticides, wounding, infection, and various foreign substances, can produce large amounts of reactive oxygen species far exceeding the capacity of the reactive oxygen species scavenging mechanism. Even when plants are exposed to oxidative stress that exceeds the capacity of the reactive oxygen species scavenging mechanism due to stresses such as drought, strong light (exposure to light that is stronger or longer than the light conditions under which the plant normally grows), high temperature, chemicals such as pesticides, wounding, infection, and various foreign substances, if the stress can be suppressed, the effects of these stresses can be suppressed.

[0024] The method of the present invention can impart tolerance to one or more environmental stresses, particularly those selected from the group consisting of high temperature stress, drought stress, oxidative stress, and osmotic stress.

[0025] 2. Method for Imparting Environmental Stress Tolerance In the method of the present invention, environmental stress tolerance is imparted to a plant by maintaining it within a certain temperature range for a certain period of time. "Maintaining" a plant refers to maintaining the plant in a specific environment, particularly culturing it. "Maintaining" and "maintaining a plant at a certain temperature for a certain period of time" are also referred to as "treating a plant at a certain temperature for a certain period of time." Furthermore, in the present invention, "maintaining a plant at a certain temperature for a certain period of time" is also referred to as "acclimating the plant."

[0026] Here, the term "plant" refers to the organs, parts, and regions of a plant, including, for example, leaves, stems, roots (including adventitious roots), buds (including adventitious buds), petals, cotyledons, hypocotyls, anthers, embryos (including adventitious embryos), seeds, fruits, rhizomes, tuberous roots, tubers, bulbs, and parts thereof. In this context, the term "plant" typically does not include modified parts that branch and elongate even when separated from the plant (for example, hairy roots in hairy root culture). In other words, the term "plant" typically refers to a plant excluding hairy roots (or excluding only hairy roots).

[0027] In the present invention, at least a part of a plant is used. Here, "at least a part" includes the entire plant, as well as any one or a combination of the above-mentioned plant organs, parts, and regions, as well as parts of plant organs, parts, and regions.

[0028] Preferably, in the method of the present invention, a seedling is used as the plant. A nursery plant refers to a young plant that has sprouted from a seed and is often used for transplantation. Seedlings include seedlings, tissue culture seedlings, grafted seedlings, and cutting seedlings. A seedling refers to a young plant derived from a seed. On the other hand, tissue culture seedlings, grafted seedlings, and cutting seedlings are not necessarily derived from seeds. In the present invention, a tissue culture seedling is preferably used.

[0029] Maintenance in a specific environment can be carried out in the following environments or containers, with maintenance in an artificial climate chamber and a culture container being preferred. Environments used for maintenance: artificial climate chamber, greenhouse, plant factory, outdoor field. Containers used for maintenance: culture container, seedbed, pod. When maintaining the plant at a constant temperature for a certain period of time, it may be maintained in a liquid. The liquid is not limited as long as the plant can survive, and includes water and liquid culture media. Liquid culture media preferably contain media components used for plant culture. Culture media are artificially prepared liquids to provide the nutrients necessary for culturing microorganisms and plants, or liquids solidified with a gelling agent such as agar.

[0030] Furthermore, when plants are kept at a constant temperature for a certain period of time, they may be kept in a solid medium. However, it may be difficult to treat a large number of plants using a solid medium. Therefore, a method of keeping plants in a liquid is preferable, and a method of keeping plants in a liquid medium is even more preferable.

[0031] Here, the term "liquid medium" refers to a liquid containing nutrients such as carbon sources and nitrogen sources essential for plant growth, with the osmotic pressure and pH appropriately adjusted, for the purpose of favorable plant growth. The liquid medium may be a liquid basal medium known in plant tissue culture technology, a modified medium thereof, or a medium from which some of the components have been deleted. Examples of such known media include basal media such as White's medium (described in Introduction to Plant Cell Technology (Academic Society Publishing Center), pp. 20-36), MS medium (Murashige and Skoog's medium) (described in Introduction to Plant Cell Technology (Academic Society Publishing Center), pp. 20-36), Heller's medium (Heller R, Bot. Biol. Veg. Paris 14 1-223(1953)), SH medium (Schenk and Hildebrandt's medium), LS medium (Linsmaier and Skoog's medium) (described in Introduction to Plant Cell Technology (Academic Society Publishing Center), pp. 20-36), Gamborg's medium, B5 medium (described in Introduction to Plant Cell Technology (Academic Society Publishing Center), pp. 20-36), MB medium, and WP medium (Woody Plant: for woody plants), as well as media equivalent thereto.

[0032] The temperature range for holding the plant body is 22°C to 28°C, preferably 23°C to 28°C, more preferably 23°C to 27°C, even more preferably 24°C to 26°C, and particularly preferably 25°C. The temperature does not need to be the same all the time for a certain period of time, as long as it is adjusted to this temperature range for a certain period of time. Of course, the same temperature may be maintained for a certain period of time.

[0033] The temperature in an incubator, container, seedbed, or pod that holds the plant body may be adjusted to the above-mentioned temperature. When a liquid medium is used, the temperature of the liquid medium may also be adjusted to the above-mentioned temperature.

[0034] The period is from 1 week to 12 weeks, preferably from 10 days to 12 weeks, more preferably from 10 days to 10 weeks, and even more preferably from 2 weeks to 12 weeks. Alternatively, it is from 1 week to 11 weeks, preferably from 10 days to 11 weeks, and preferably from 2 weeks to 11 weeks. Alternatively, it is from 1 week to 6 weeks, preferably from 10 days to 6 weeks, and preferably from 2 weeks to 6 weeks.

[0035] When a plant is kept in a liquid for a certain period of time and a small seedling is used as the plant, most of the entire plant is initially submerged in the liquid. After that, if the plant is immersed in the liquid for several weeks or more, for example, 12 weeks, the plant grows and becomes larger, and only the underground parts such as the roots are submerged in the liquid. In the present invention, when a plant is kept in a liquid, this includes cases where the entire plant is submerged in the liquid and cases where only a part of the plant, such as the underground parts, is submerged in the liquid.

[0036] 3. Method for producing a plant imparted with environmental stress tolerance Environmental stress tolerance is imparted to a plant by the method of the present invention for imparting environmental stress tolerance. Thus, the present invention encompasses a method for producing a plant imparted with environmental stress tolerance. Typically, environmental stress tolerance is imparted to a seedling, such as a tissue-cultured seedling, by the method of the present invention, and the seedling is then planted and grown. Thus, the present invention also encompasses a method for producing a plant seedling imparted with environmental stress tolerance.

[0037] 4. Promotion of Environmental Stress Responsive Gene Expression The method of the present invention for imparting environmental stress tolerance promotes the expression of environmental stress responsive genes involved in environmental stress tolerance in plants, thereby making it possible to impart environmental stress tolerance to plants.

[0038] The present invention also encompasses a method for producing a plant in which the expression of environmental stress tolerance genes in the plant is enhanced.

[0039] In Arabidopsis, when the environmental stress is high temperature stress, the expression of high temperature stress responsive genes is promoted. Examples of high temperature stress responsive genes include HSFA, a transcription factor, preferably the HSFA2 gene, and HSP genes encoding heat shock proteins, preferably the HSP21 gene.

[0040] In other plant species, the expression of a homolog of an Arabidopsis HSFA gene, preferably the HSFA2 gene, and / or a homolog of an Arabidopsis HSP gene, preferably the HSP21 gene, is promoted. For each plant species, for example, when obtaining the nucleotide sequence of a homolog, a TBLASTN search can be performed using the amino acid sequence of the protein encoded by the Arabidopsis thaliana gene as a query, and the gene with the highest score can be selected as the homolog from among the genes listed as homolog candidates. For example, in hop, the expression of an H1HSFA gene, preferably the H1HSFA2 gene and / or an H1HSP gene, preferably the H1HSP21 gene, is promoted.

[0041] The proteins encoded by homologs of the Arabidopsis HSFA gene and HSFA2 gene in various plant species are collectively referred to as HSFA and HSFA2, respectively, and the proteins encoded by homologs of the Arabidopsis HSP gene and HSP21 gene in various plant species are collectively referred to as HSP and HSP21, respectively.

[0042] The expression of these high temperature stress responsive genes is increased by 1.1 times or more, preferably 1.2 times or more, more preferably 1.5 times or more, even more preferably 1.7 times or more, and even more preferably 2 times or more in plants to which environmental stress tolerance has been imparted by the method of the present invention for imparting environmental stress tolerance, compared to plants to which environmental stress tolerance has not been imparted.

[0043] In Arabidopsis, when the environmental stress is oxidative stress, the expression of oxidative stress-responsive genes is promoted. Examples of oxidative stress-responsive genes include the transcription factor ZAT, preferably ZAT10 or ZAT12. Further examples include the transcription factor AOX1, preferably AOX1a, or APX, preferably APX3.

[0044] In other plants, the expression of the Arabidopsis ZAT gene, preferably a homolog of the ZAT10 gene and / or a homolog of the Arabidopsis ZAT12 gene, is promoted. For each plant species, for example, to obtain the nucleotide sequence of a homolog, a TBLASTN search can be performed using the amino acid sequence of the protein encoded by the above Arabidopsis gene as a query, and the gene with the highest score can be selected as the homolog from among the genes listed as homolog candidates. For example, in hops, the expression of the H1ZAT gene, preferably the H1ZAT10 gene and / or the H1ZAT12 gene, is promoted. Alternatively, in hops, the expression of an AOX gene, preferably the AOX1a gene and / or the APX gene, preferably the APX3 gene, is promoted. Proteins encoded by homologs of the Arabidopsis ZAT gene, ZAT10 gene, and ZAT12 gene in various plant species are collectively referred to as ZAT, ZAT10, and ZAT12, respectively. Furthermore, the proteins encoded by homologs of the Arabidopsis AOX gene, AOX1a gene, APX gene, and APX3 gene in various plant species are collectively referred to as AOX, AOX1a, APX, and APX3, respectively.

[0045] The expression of these oxidative stress responsive genes is increased by 1.1 times or more, preferably 1.2 times or more, more preferably 1.5 times or more, even more preferably 1.7 times or more, and even more preferably 2 times or more in plants to which environmental stress tolerance has been imparted by the method of the present invention for imparting environmental stress tolerance, compared to plants to which environmental stress tolerance has not been imparted.

[0046] In Arabidopsis, when the environmental stress is drought stress, the expression of a drought stress responsive gene is promoted. Examples of the drought stress responsive gene include the transcription factor DREB, preferably DREB2A.

[0047] In other plants, the expression of homologs of the Arabidopsis thaliana DREB gene, preferably the DREB2A gene, is promoted. For example, when obtaining the nucleotide sequence of a homolog in each plant species, a TBLASTN search can be performed using the amino acid sequence of the protein encoded by the above-mentioned Arabidopsis thaliana gene as a query, and the gene with the highest score can be selected as the homolog from among the genes listed as homolog candidates. For example, in hops, the expression of the DREB2A gene is promoted. Proteins encoded by homologs of the Arabidopsis thaliana DREB gene and DREB2A gene in various plant species are collectively referred to as DREB and DREB2A, respectively.

[0048] The expression of these drought stress responsive genes is increased by 1.1 times or more, preferably 1.2 times or more, more preferably 1.5 times or more, even more preferably 1.7 times or more, and even more preferably 2 times or more in plants to which environmental stress tolerance has been imparted by the method of the present invention for imparting environmental stress tolerance, compared to plants to which environmental stress tolerance has not been imparted.

[0049] Furthermore, examples of drought stress responsive genes in Arabidopsis include NCED, preferably NCED3 (Nine-cis-epoxycarotenoid dioxygenase 3), which is a gene for synthesizing an enzyme that controls the synthesis of abscisic acid (ABA).

[0050] In other plants, the expression of a homolog of the Arabidopsis thaliana NCED gene, preferably the NCED3 gene, is promoted. For example, when obtaining the nucleotide sequence of a homolog in each plant species, a TBLASTN search can be performed using the amino acid sequence of the protein encoded by the above Arabidopsis thaliana gene as a query, and the gene with the highest score can be selected as the homolog from among the genes listed as homolog candidates. For example, in hops, the expression of the NCED3 gene is promoted. The proteins encoded by homologs of the Arabidopsis thaliana NCED gene and NCED3 gene in various plant species are collectively referred to as NCED and NCED3, respectively.

[0051] The expression of these drought stress responsive genes is increased by 1.1 times or more, preferably 1.2 times or more, more preferably 1.5 times or more, even more preferably 1.7 times or more, and even more preferably 2 times or more in plants to which environmental stress tolerance has been imparted by the method of the present invention for imparting environmental stress tolerance, compared to plants to which environmental stress tolerance has not been imparted.

[0052] Whether gene expression in a plant is promoted by the method of the present invention for imparting environmental stress tolerance is determined by extracting RNA from the plant, synthesizing cDNA using reverse transcriptase, and analyzing the expression level by real-time PCR. Here, promotion of gene expression by the method of the present invention for imparting environmental stress tolerance includes both promotion of expression before exposure of the plant to stress and promotion of expression upon exposure to stress.

[0053] The present invention encompasses methods for promoting the expression of genes involved in environmental stress tolerance, such as high temperature stress-responsive genes and oxidative stress-responsive genes. Specifically, the present invention encompasses methods for promoting ZAT expression, HSFA expression, and HSP expression. The composition of the composition is the same as that of the composition for imparting environmental stress tolerance to plants.

[0054] Conferring environmental stress tolerance to plants using the method of the present invention for conferring environmental stress tolerance can promote the expression of genes encoding ZAT, preferably genes encoding ZAT10 and ZAT12. Furthermore, conferring environmental stress tolerance to plants using the method of the present invention can promote the expression of genes encoding AOX, preferably genes encoding AOX1a, or genes encoding APX, preferably genes encoding APX3. As a result, by activating a group of genes that suppress the accumulation of reactive oxygen species within cells (Davletova et al., Plant Physiol. 2005 Oct; 139[2]: 847-856), tolerance to stresses caused by oxidation, drought, strong light, high temperature, chemicals such as pesticides, and injury can be conferred. Furthermore, conferring environmental stress tolerance to plants using the method of the present invention can promote the expression of genes encoding HSFA, preferably genes encoding HSFA2, and genes encoding HSPs, preferably genes encoding HSP21. As a result, tolerance to high temperature stress can be conferred. Furthermore, when environmental stress tolerance is imparted to a plant by the method of the present invention for imparting environmental stress tolerance, the expression of a gene encoding DREB, preferably a gene encoding DREB2A, can be promoted. Furthermore, when environmental stress tolerance is imparted to a plant by the method of the present invention for imparting environmental stress tolerance, the expression of a gene encoding NCED, preferably a gene encoding NCED3, can be promoted. As a result, tolerance to drought stress can be imparted.

[0055] That is, the environmental stress tolerance can be imparted by the method of the present invention for imparting environmental stress tolerance through the expression of the above-mentioned gene.

[0056] The genes whose expression is promoted by the present invention are genes that share, for example, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the gene of interest.

[0057] Furthermore, it is thought that the gene expression promoted by the present invention is due to the gene expression induction effect. Therefore, the present invention can also contribute to imparting environmental stress tolerance by suppressing the effects of environmental stress on the plant body by accelerating gene expression.

[0058] 5. Target Plants In the present invention, target plants include both angiosperms and gymnosperms, but are preferably angiosperms. Furthermore, angiosperms include both dicotyledonous and monocotyledonous plants. Examples of monocotyledonous plants include grasses such as rice, corn, barley, wheat, and sorghum; Araceae plants such as taro and konjac; Amaryllidaceae plants such as onion and leek; and Asparagaceae plants such as asparagus. Among these, grasses are preferred. Examples of dicotyledonous plants include Cannabaceae plants such as hemp, hops, Zelkova, and Enoki mushroom; Brassicaceae plants such as cabbage, Chinese cabbage, broccoli, radish, arugula, Komatsuna, Mizuna, mustard, and Arabidopsis; Solanaceae plants such as potato, tobacco, Nicotiana benthamiana, and tomato; Asteraceae plants such as lettuce and artichoke; Legumes such as alfalfa and soybean; Amaranthaceae plants such as spinach and sugar beet; Lamiaceae plants such as perilla and basil; Umbelliferae plants such as carrot and mitsuba; Cucurbitaceae plants such as melon, watermelon, cucumber, and pumpkin; and Malvaceae plants such as cotton. Among these, dicotyledonous plants and Cannabaceae plants are preferred.

[0059] 6. Method for Confirming the Impartation of Stress Tolerance Whether or not environmental stress tolerance has been imparted to a plant by the method of the present invention for imparting environmental stress tolerance can be confirmed by exposing a plant to which the method of the present invention for imparting environmental stress tolerance has been applied to environmental stress and then visually confirming the degree of leaf chlorosis, measuring the fresh weight of the above-ground parts of the plant excluding seeds and roots, or measuring the amount of chlorophyll in the plant.

[0060] When the environmental stress is high temperature stress, for example, plants treated with the method for imparting environmental stress tolerance of the present invention can be exposed to high temperatures, e.g., 30-50°C, for a period of one week or 10 days to several weeks. The degree of leaf chlorosis can then be confirmed by visual inspection, measuring the fresh weight of the aboveground parts of the plant excluding seeds and roots, or measuring the amount of chlorophyll in the plant. The temperature and duration of exposure to high temperatures can be determined appropriately depending on the plant species. The amount of chlorophyll is quantified using the method described in this example, which follows the method of Yamaguchi et al. (Nature Commun., 2021, Jun 9;12[1]:3480). If the degree of chlorosis, fresh weight, or chlorophyll content is smaller than that of untreated plants (unstressed plants) or plants not treated with the method for imparting environmental stress tolerance of the present invention, it can be determined that high temperature stress tolerance has been imparted.

[0061] When the environmental stress is oxidative stress, for example, a plant to which the method of the present invention for imparting environmental stress tolerance has been applied can be treated with an oxidative stress inducer such as methyl viologen and left for several days, after which the degree of leaf chlorosis can be confirmed by visual inspection, by measuring the fresh weight of the above-ground parts of the plant excluding seeds and roots, or by measuring the amount of chlorophyll in the plant. The concentration of methyl viologen and the treatment time can be determined appropriately depending on the plant species. In this case, if the degree of chlorosis, fresh weight, or chlorophyll content is less than that of an untreated plant not treated with an oxidative stress inducer or a plant not treated with the method of the present invention for imparting environmental stress tolerance, it can be determined that oxidative stress tolerance has been imparted.

[0062] Furthermore, whether or not environmental stress tolerance has been conferred to a plant to which the method of the present invention for conferring environmental stress tolerance has been applied can also be confirmed by exposing the plant to which the method of the present invention for conferring environmental stress tolerance has been applied to environmental stress and then measuring the expression of environmental stress-responsive genes in the plant. Examples of environmental stress-responsive genes include the HSFA-encoding genes, HSP-encoding genes, ZAT-encoding genes, AOX-encoding genes, APX-encoding genes, DREB-encoding genes, and NCED-encoding genes described above in "4. Promotion of Environmental Stress-Responsive Gene Expression." If the expression of these genes is promoted, it can be determined that environmental stress tolerance has been conferred. Among these genes, if the expression of the HSFA-encoding gene and the HSP-encoding gene is particularly promoted, it can be determined that high temperature stress tolerance has been conferred. If the expression of the ZAT-encoding gene, the AOX-encoding gene, or the APX-encoding gene is promoted, it can be determined that oxidative stress tolerance has been conferred. If the expression of the DREB-encoding gene or the NCED-encoding gene is promoted, it can be determined that drought stress tolerance has been conferred.

[0063] 7. Method for Confirming Plant Growth Promotion Whether or not a growth-promoting effect has been imparted to a plant to which the method of the present invention for imparting environmental stress tolerance has been applied can be confirmed by, for example, measuring the fresh weight of the above-ground parts of the plant, excluding the seeds and roots, after the method has been applied. It can also be confirmed by measuring the number of leaves, plant height, leaf color, amount of chlorophyll, etc. It can be considered that a growth-promoting effect has been imparted to a plant when any of the measured values ​​is higher than that of a plant to which the method of the present invention for imparting environmental stress tolerance has not been applied.

[0064] 8. Promotion of Early Plant Growth The method of the present invention for imparting environmental stress tolerance can promote the early growth of plants. "Early plant growth" refers to the growth status of seedlings to which stress tolerance has been imparted after planting. Here, "planting" refers to transplanting a plant from an incubator, container, nursery bed, pod, or the like in which it was kept to impart environmental stress tolerance to its final cultivation site, typically in soil or medium outdoors or in a greenhouse. For example, "planting" refers to the growth status several days to several weeks, preferably 1 to 4 weeks, more preferably 1 to 3 weeks, and particularly preferably 2 weeks, after planting. The growth status of a plant can be determined, for example, by its height, which is the height of the above-ground part of the plant. The height from the ground surface can be measured and assessed based on the growth of the height. In other words, the degree of promotion of early growth can be determined by the degree of growth of the height.

[0065] In plants to which environmental stress tolerance has been imparted by the method of the present invention for imparting environmental stress tolerance, the plant height two weeks after planting is increased by 1.1 times or more, preferably 1.2 times or more, compared to plants to which environmental stress tolerance has not been imparted, and initial growth after planting is promoted.

[0066] The present invention will be specifically explained by the following examples, but the present invention is not limited to these examples.

[0067] Example 1: Enhancement of Heat Stress Tolerance through Acclimation Treatment Using Tissue-Cultured Seedlings 1. Purpose: Heat acclimation is a mechanism by which plants can tolerate subsequent heat stress after experiencing moderate heat stress in the past. It has been reported that Arabidopsis thaliana maintained its heat tolerance for three days in a high-temperature stress environment at 43.5°C after one hour of heat acclimation at 37°C (Yamaguchi et al., Nat. Commun., Volume 12-3480, 2021). However, the duration of tolerance retention after heat acclimation and field evaluation of tolerance are insufficient. Therefore, there is a need to establish a heat acclimation method that can efficiently enhance the duration of heat tolerance for industrial application. Furthermore, there have been no reports of high-temperature acclimation in hops, and it is unclear whether a high-temperature acclimation mechanism exists in hops and whether previously reported heat acclimation treatments are applicable.

[0068] Therefore, using hop tissue culture seedlings, we examined whether the previously reported high-temperature acclimation treatment (Yamaguchi et al., Nat. Commun., Volume 12-3480, 2021) also confers high-temperature stress tolerance in hops.

[0069] 2. Experimental Method (1) Experimental Materials Tissue culture seedlings of hops (variety: Saaz) were used as experimental materials. Hop seedlings were purchased from the Hana no Yakata Webshop (https: / / hananoyakata.shop-pro.jp / ).

[0070] (2) Growth Method and Acclimation Treatment (i) Growth Method: The growth medium used was a solid medium containing 1 / 2 (w / v) Murashige-Skoog medium salt mixture (Nacalai), 2% (w / v) glucose (FUJIFILM Wako), and 0.8% (w / v) agar (Ina Food Industry). (ii) Acclimation Treatment: Plantlets containing the terminal bud and first node were excised from tissue-cultured seedlings grown on the solid medium at 20°C for 2 months and used as experimental samples. Five plants per dish were subcultured. Control plants were grown for 96 hours in an incubator (TOMY) at 20°C. Treatment plants were similarly grown for 92 hours in an incubator at 20°C, followed by 4 hours in a dark incubator at 37°C.

[0071] (3) High-Temperature Stress Exposure and Evaluation (i) High-Temperature Stress Exposure: Both the control and treated plants were transferred to a 42°C incubator 96 hours after the start of incubation and grown for 5 days under high-temperature stress conditions. All incubators were set under a 16-hour light / 8-hour dark photoperiod. (ii) Evaluation: Leaf bleaching is generally observed in plants exposed to high-temperature stress. Therefore, in this experiment and other studies, the degree of bleaching was assessed by measuring the amount of chlorophyll, a green pigment, in the leaves. Two leaf blades from the first node of each plant were placed in a 1.5-mL tube (Eppendorf) containing 1 mL of N,N-dimethylformamide (FUJIFILM Wako) and incubated at 4°C in the dark for 1 day to extract chlorophyll. The absorbance of the extract was measured at 647 nm and 664 nm. The chlorophyll amounts calculated from the absorbance were designated a and b, respectively, and their sum, chlorophyll a + b, was calculated. To eliminate the influence of individual plant size, the value obtained by dividing a + b by the weight (mg) of the plant per well was used as the chlorophyll content per plant weight (hereinafter referred to as chlorophyll a + b amount). The chlorophyll content was determined according to the method of Yamaguchi et al. (Nature Commun, 2021, Jun 9;12(1):3480).

[0072] 3. Results The results are shown in Figures 1-1 and 1-2. Compared to the control group, the treated group showed reduced leaf bleaching under a high-temperature stress environment of 42°C (Figure 1-1). A comparison of the chlorophyll content in the leaves showed that it was significantly higher in the treated group (Figure 1-2).

[0073] 4. Conclusions It was suggested that acclimatization at 37°C for 4 hours may be able to confer high temperature stress tolerance to hops.

[0074] Example 2: Enhancement of high-temperature stress tolerance through short-term acclimation at 30°C using liquid culture 1. Purpose Example 1 suggested that acclimation using solid medium can confer high-temperature stress tolerance to hops. However, it can be difficult to treat a large number of plants using solid medium. Therefore, we investigated acclimation using liquid culture with the aim of more efficiently producing tissue-cultured seedlings with high-temperature stress tolerance.

[0075] 2. Experimental Method (1) Experimental Materials The same as in Example 1.

[0076] (2) Growth Method and Acclimation Treatment (i) Media: a) Solid Media: For plant growth, a solid medium containing 1 / 2 (w / v) Murashige and Skoog medium mixed salts (Nacalai), 2% (w / v) glucose (FUJIFILM Wako), and 0.8% (w / v) agar (Ina Food Industry) was used. b) Liquid Media: For liquid culture, a liquid medium containing 1 / 2 (w / v) Murashige and Skoog medium mixed salts (Nacalai) and 2% (w / v) glucose (FUJIFILM Wako) was used. (ii) Culture Conditions: The same as in Example 1. (iii) Acclimation Treatment: Tissue-cultured seedlings were grown on the solid medium for 1.5 to 2 months to reach a certain height, leaf number, and stem thickness. A single tissue-cultured seedling was placed in a 300-ml flask (IWAKI) containing 100 mL of the liquid medium. The flasks containing the tissue-cultured seedlings were transferred to a 20°C incubator (TOMY) for six weeks with shaking at 80 rpm for the control group. The treatment group was also cultured at 20°C for six weeks, and on the final day, they were acclimated to 30°C in the light for four hours. Subsequently, plantlets containing the apical bud and first node were excised from the tissue-cultured seedlings obtained from each flask in the control and treatment groups, and five plants per group were subcultured on solid medium and grown at 20°C for one week.

[0077] (3) Exposure to high temperature stress and evaluation (i) The control and treated plants exposed to high temperature stress were moved to a 30°C incubator (Nihon Medical Instruments Manufacturing Co., Ltd.) and grown for 4 weeks. The photoperiod of the incubator was set to 16 hours light and 8 hours dark. (ii) Evaluation The method for measuring chlorophyll content was the same as in Example 1.

[0078] 3. Results The results are shown in Figure 2. No difference was observed in the amount of chlorophyll in the leaves between the control and treated areas (Figure 2).

[0079] 4. Conclusions: It was suggested that a short-term acclimation treatment at 30°C during liquid culture may not confer high-temperature stress tolerance to hops.

[0080] Example 3: Enhancement of high-temperature stress tolerance through long-term acclimation at 30°C using liquid culture 1. Purpose Example 2 suggested that acclimation at 30°C for 4 hours using a liquid medium does not confer high-temperature tolerance to hops. Therefore, we investigated whether extending the acclimation period would confer high-temperature tolerance.

[0081] 2. Experimental Method (1) Experimental Materials Tissue-cultured seedlings of hops (variety: Hersbrucker) were used as experimental materials. Hop seedlings grown in our own experimental field (Oshu City, Iwate Prefecture) were used.

[0082] (2) Growth method and acclimation treatment (i) Growth method: Liquid culture was performed, and the growth method was the same as in Example 2. (ii) Acclimation treatment: Tissue-cultured seedlings grown on the above solid medium for 1.5 to 2 months were used as experimental samples. 100 mL of the above liquid medium was dispensed into 300 mL flasks (IWAKI) for the treatment and control groups, and one tissue-cultured seedling was placed in each flask. The control group was transferred to an incubator (TOMY) at 20°C and cultured with shaking for 6 weeks. The shaking speed was 80 rpm. The treatment group was also cultured at 30°C for 6 weeks as an acclimation treatment. The photoperiod setting for the incubator was the same as in Example 2.

[0083] 3. Results The results are shown in Figure 3. Neither the treated (Figure 3B) nor the control (Figure 3A) plants were exposed to high temperature stress, and only the appearance of the samples after acclimation was evaluated. Plants acclimated to 30°C for 6 weeks showed browning throughout the plant body, and no axillary bud growth was observed.

[0084] 4. Conclusions: It was suggested that acclimatization to 30°C for 6 weeks in hops may result in growth inhibition due to the acclimatization treatment.

[0085] Example 4: Enhancement of high-temperature stress tolerance through acclimation treatment at 25°C using liquid culture 1. Purpose Example 3 suggested that acclimation treatment at 30°C for 6 weeks using a liquid culture medium inhibits hop growth. Therefore, we investigated the acclimation period at 25°C to confer high-temperature tolerance.

[0086] 2. Experimental Method (1) Experimental Materials The same as in Example 1.

[0087] (2) Growth Method and Acclimatization Treatment (i) Growth Method: The growth method was the same as in Example 2. (ii) Acclimatization Treatment: Tissue-cultured seedlings grown on the above-mentioned agar medium for 1.5 to 2 months were used as experimental samples. One tissue-cultured seedling was placed in each of 300-ml flasks (IWAKI) containing 100 mL of the above-mentioned liquid medium for the treatment and control groups. The control group was transferred to an incubator (TOMY) at 20°C and cultured with shaking for 6 weeks. The treatment group was acclimated at 25°C for 4 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, and 12 weeks. The photoperiod settings for the incubator were the same as in Example 2.

[0088] (3) Exposure to high temperature stress and evaluation (i) The high temperature stress-exposed area and the control area were exposed to high temperature stress (30°C for 4 weeks) and then subjected to evaluation. The photoperiod setting of the incubator was the same as in Example 2. (ii) Evaluation The method for measuring chlorophyll content was the same as in Example 1.

[0089] 3. Results The results are shown in Figure 4. When a short-term acclimation treatment at 25°C for 4 hours was performed during the 6-week liquid culture period, no difference in leaf chlorophyll content was observed compared to the control group. However, individuals that had been acclimated to 25°C for 2 to 6 weeks tended to have higher leaf chlorophyll content compared to the control group. Furthermore, the leaf chlorophyll content of individuals that had been acclimated to high temperatures for 12 weeks tended to decrease compared to individuals that had been acclimated for 2 to 6 weeks.

[0090] 4. Conclusions: When acclimatizing hops during liquid culture, it was suggested that acclimatization at 25°C for more than one week may be effective.

[0091] Example 5: Enhanced Expression of High-Temperature Stress-Responsive Genes by Long-Term Acclimation at 25°C in Liquid Culture 1. Objective: Example 4 suggests that acclimation at 25°C for one week or longer in liquid culture may suppress leaf chlorosis under high-temperature stress. Therefore, we investigated the expression of high-temperature stress-responsive genes to confirm the acquisition of high-temperature tolerance during acclimation using multiple indicators. Heat Shock Protein 21 (HSP21) has been reported as a gene whose expression is enhanced in Arabidopsis seedlings two days after high-temperature acclimation compared to controls (Sedaghatmehr et al., Nat. Commun., Volume 7-12439, 2016). Furthermore, it has been reported that in Arabidopsis, a Heat Shock Transcription Factor A2 (HSFA2) deletion mutant does not show accumulation of HSP21 transcripts, and that it lacks the ability to confer high temperature tolerance upon acclimation (Charng et al., Plant Physiol, Volume 143, Pages 251-262, 2007). Therefore, we investigated the expression of these two genes to determine whether tolerance was conferred after acclimation.

[0092] 2. Experimental Method (1) Experimental Materials Tissue culture seedlings of hops (varieties: Saaz and Hersbrucker) were used as experimental materials. Hop seedlings were purchased from the Hana no Yakata Webshop (https: / / hananoyakata.shop-pro.jp / ).

[0093] (2) Growth method and acclimation treatment (i) Growth method The growth method was the same as in Example 2. (ii) Acclimation treatment The acclimation method was the same as in Example 4. The acclimation period for the control group was 20°C for 6 weeks, and for the treatment group was 25°C for 6 weeks.

[0094] (3) The hops in the high-temperature stress-exposed and control groups were exposed to high-temperature stress (30°C for 0 hours, 2 hours (HSFA2), and 4 hours (HSP21)) and subjected to gene expression analysis. The photoperiod settings in the incubator were the same as in Example 2.

[0095] (4) Gene Expression Analysis (i) Search for Homologs of Arabidopsis Heat Stress-Responsive Genes in Hop To design target gene primers required for gene expression analysis by real-time PCR, we searched for homologs of Arabidopsis heat stress-responsive genes in hop. The amino acid sequences of Arabidopsis HSFA2 (AGI code: AT2G26150) and HSP21 (AGI code: AT4G27670) were obtained from TAIR (https: / / www.arabidopsis.org / ), and the nucleotide sequences of the homologs were obtained using HopBase (https: / / hopbase.cgrb.oregonstate.edu / ). We also obtained the nucleotide sequence of the Arabidopsis EF1α (AGI code: AT1G18070) homolog as a reference gene. The hop homologs were named HlHSFA2, HlHSP21, and HlEF1α.

[0096] (ii) Analysis of expression levels of high-temperature-responsive genes by real-time PCR Plants for the test were prepared using the same method as in Example 2. Control plants were cultured at 20°C for 6 weeks, and acclimation plants were cultured at 25°C for 6 weeks. Both control and treatment plants were subcultured on agar medium and grown at 20°C for 1 week, then incubated at 30°C for a certain period of time as a high-temperature stress treatment. After growth, plant samples were frozen in liquid nitrogen, and RNA was extracted using the RNeasy Plant Mini Kit (Thermo Fischer Scientific).

[0097] cDNA, which was required as a template for real-time PCR, was synthesized from the obtained RNA. 1000 ng of total RNA from each sample was used. For Saaz hops, the Verso cDNA Synthesis Kit (Thermo Fischer Scientific) was used, and for Helsbrucker hops, the PrimeScript cDNA Synthesis Kit was used. TMcDNA was synthesized using RT Master Mix (Perfect Real Time) (TaKaRa). The synthesized cDNA was diluted 5-fold with sterile distilled water and subjected to real-time PCR. For real-time PCR, the target genes were HSFA2 and HlHSP21, and the reference gene was HlEF1α. PCR reaction mixtures were prepared with TB Green Ex Taq II (TaKaRa). For the Saaz hops, a LightCycler® 480 System (Roche) was used, and for the Helsbrucker hops, a Thermal Cycler Dice® Real Time System IV (TaKaRa) was used. The PCR amplification cycles were 50. The primers used were as follows: HlHSFA2 Fw: TCGCGAACAAAGGGTTTCAG (SEQ ID NO: 1) Rv: ACCGGATTTTGCAGAATCGG (SEQ ID NO: 2), HlHSP21 Fw: ATGAGGCAAATGCTGGACAC (SEQ ID NO: 3) Rv: ACCGGAGCTTGATTTCGTTC (SEQ ID NO: 4), HlEF1α Fw: TTTTGCTGTCAGGGACATGC (SEQ ID NO: 5) Rv: TTGGCAGCGGATTTGGTAAC (SEQ ID NO: 6).

[0098] Thereafter, the relative expression level of the target gene in the control group was calculated by the ΔΔCt method using the Ct value obtained from real-time PCR.

[0099] 3. Results The results are shown in Figures 5-1 and 5-2. In hop plants, plants acclimated to 25°C for 6 weeks showed a tendency to exhibit greater plant height and significantly larger leaves under high-temperature stress conditions at 30°C compared to controls (Figure 5-1). Furthermore, in both Saaz and Hersbrucker cultivars, HSFA2 expression levels increased approximately 10.4-fold and 2.2-fold, respectively, in the acclimated plants compared to controls (Figure 5-2A). Similarly, HSP21 expression levels increased approximately 4.3-fold and 2.5-fold, respectively, compared to controls (Figure 5-2B). In Arabidopsis, HSFA2 is known to be a transcription factor upstream of HSP21. In hops, the expression of HSFA2 was enhanced after 2 hours of high-temperature stress incubation, and HSP21 expression was enhanced after 4 hours of high-temperature stress incubation. These data suggest that hop plants share a similar mechanism to Arabidopsis.

[0100] 4. Conclusions: Our results suggest that hop enhances its tolerance to high temperature stress through increased expression of the high temperature stress response genes HSFA2 and HSP21.

[0101] Example 6: Examination of outdoor growth using tissue-cultured seedlings that had been acclimated to 25°C for a long period during the cultivation process 1. Objective Based on Examples 4 and 5, we discovered an acclimation method that can impart high-temperature stress tolerance to hops under laboratory conditions. Therefore, we examined the outdoor growth of tissue-cultured seedlings prepared using the above method.

[0102] 2. Experimental Method (1) Experimental Materials The same as in Example 5.

[0103] (2) Growth Method and Acclimatization Treatment (i) Growth Method The growth method and liquid culture method were the same as in Example 2. (ii) Acclimatization Treatment Method The acclimation treatment method was the same as in Example 5.

[0104] (3) Preparation of tissue-cultured seedlings: Hops cultured and acclimatized in the liquid culture described above for 6 weeks were cut and dried according to the method of Hirakawa and Tanno (Plants, 2022, Apr 13;11(8):1066), then rooted and temporarily planted in a potting soil containing Metro-Mix 350 (Sun Gro Horticulture), vermiculite, and Akadama in a 3:1:1 ratio to prepare tissue-cultured seedlings. Five to seven weeks after temporary planting, the tissue-cultured seedlings were used for testing.

[0105] (4) Plant height survey method: Field growth surveys were conducted in our own test fields. Tissue culture seedlings were planted 35 cm apart in rows equipped with cultivation shelves and guide strings. Two weeks after planting, the plant height from the ground surface was measured and evaluated using a 10 m tape measure.

[0106] 3. Results The results are shown in Figure 6. For both Saaz (Figure 6A) and Hersbrucker (Figure 6B) varieties, plants that underwent 6 weeks of acclimation at 30°C had significantly higher plant height two weeks after planting compared to the control. The planting date was June 1, 2023, and the temperatures for two weeks after planting in the area including the company's test field are shown in Figure 7.

[0107] 4. Conclusions: The results suggest that acclimatization at 25°C for 6 weeks may promote early growth after planting outdoors in hops.

[0108] Example 7: Enhanced Expression of Environmental Stress Response Genes in the Field Using Tissue-Cultured Seedlings Acclimatized at 25°C for a Long Period During Cultivation 1. Purpose: In the field, multiple environmental stresses (heat, drought, salinity, and waterlogging) exist, and these simultaneously affect plants. For example, it has been reported that simultaneous exposure to drought and high temperature stress in rice results in a greater reduction in yield than exposure to either drought or high temperature stress alone (Lawas et al., Field Crops Research, Volume 299, Issue 1, Pages 66-77, 2018). Therefore, to efficiently enhance heat stress tolerance in plants in the field, it is important to simultaneously promote tolerance to other environmental stresses.

[0109] High temperature stress, especially in the field, is known to act simultaneously with drought and oxidative stress (Mizoi et al., Biochim. Biophys. Acta, Volume 1819-86, 2011). Therefore, we investigated whether high temperature acclimation treatment could enhance drought and oxidative stress response genes in addition to high temperature stress response genes.

[0110] 2. Experimental Method (1) Experimental Materials The same as in Example 6.

[0111] (2) Growth method and acclimatization treatment (i) Growth method The growth method and liquid culture method were the same as in Example 2. (ii) Acclimation treatment method The same as in Example 5.

[0112] (3) Method for producing tissue culture seedlings: The same as in Example 6.

[0113] (4) Sampling Method: The planting location and planting method after acclimatization were the same as in Example 6. Hop seedlings two weeks after planting were used as experimental materials. 1 ml of RNAlater (registered trademark, Thermo Fisher Scientific) was dispensed into a 2 ml Eppendorf tube, and two leaf blades from the second node from the apex were excised and immersed in the solution.

[0114] (5) Search for homologs of Arabidopsis environmental stress-responsive genes in hop. To design target gene primers required for gene expression analysis by real-time PCR, we searched for homologs of Arabidopsis heat-, oxidative-, and drought-stress-responsive genes in hop. Specifically, we obtained the amino acid sequences of Arabidopsis oxidative stress-responsive genes ZAT10 (AGI code: AT1G27730), ZAT12 (AGI code: AT5G59820), AOX1a (AGI code: AT3G22370), and APX3 (AGI code: AT4G35000) and the drought-stress-responsive gene DREB2A (AGI code: AT5G05410) from TAIR (https: / / www.arabidopsis.org / ). We then obtained the nucleotide sequences of the homologs using HopBase (https: / / hopbase.cgrb.oregonstate.edu / ). The hop homologous genes were named HlZAT10, HlZAT12, HlAOX1a, HlAPX3, and HlDREB2A. The high temperature stress responsive genes (HlHSFA2, HlHSP21) and their reference genes were those searched for in Example 5.

[0115] (6) Analysis of Expression Levels of Stress-Response Genes by Real-Time PCR The expression levels of the above stress-response genes were analyzed. The PCR conditions were the same as in Example 5. The same primers as in Example 5 were used for gene expression analysis of HlHSFA2 and HlHSP21, and the following primers were used for the expression investigation of other genes. HlZAT10 Fw: CAATTCTCCAACCACGGCTAAC (SEQ ID NO: 7) Rv: ATGGCTCGTGGAATTGGAGAG (SEQ ID NO: 8), HlZAT12 Fw: CCTGGACATGGCTAATTGCTTG (SEQ ID NO: 9) Rv: AAGTCTTGCAAGCGAACACG (SEQ ID NO: 10), HlAOX1a Fw: CAGCAGCGCAGTTTATTTGG (SEQ ID NO: 11) Rv: TGATGCTCACCGTTTTCAGC (SEQ ID NO: 12), HlAPX3 Fw: TGCTGGTGTTGTTGCTGTTG (SEQ ID NO: 13) Rv: CTTGAGTGGCATTTGGAAGACG (SEQ ID NO: 14), HlDREB2A Fw: ATGAAGCTGCAAGGGCTATG (SEQ ID NO: 15) Rv: TGCACCATTGTTCCTGCAAC (SEQ ID NO: 16).

[0116] Thereafter, the relative expression level of the target gene in the control group was calculated by the ΔΔCt method using the Ct value obtained from real-time PCR.

[0117] 3. Results The results are shown in Figures 8-1 and 8-2. For both Saaz and Hersbrucker varieties, tissue cultured hop seedlings that had been acclimated for 6 weeks (treated groups) showed increased expression of the high temperature stress response genes HSFA2 and HSP21 compared to the control group (Figure 8-1).

[0118] In addition, increased expression of the oxidative stress response genes ZAT10, ZAT12, AOX1a, and APX3 (Fig. 8-2) and the drought stress response gene DREB2A (Fig. 8-1) was observed in Helsbruecker. In Saaz, increased expression of the oxidative stress response genes ZAT10 and ZAT12 and the drought stress response gene DREB2A was also observed (Figs. 8-1 and 8-2).

[0119] 4. Conclusions: In hops, acclimation to 25°C for 6 weeks promoted high temperature stress tolerance through increased expression of the high temperature stress response genes HSFA2 and HSP21. Furthermore, acclimation also increased expression of not only high temperature stress response genes but also oxidative stress response genes and drought stress response genes. These results suggest that acclimation may also confer tolerance to multiple environmental stresses acting in the field.

[0120] Example 8: Enhancement of osmotic stress tolerance through acclimatization treatment at 25°C for 6 weeks using liquid culture 1. Purpose Hops face challenges in terms of declining yield and quality due to rising temperatures and heat waves (high temperature stress) caused by global warming, as well as reduced rainfall and drought. Therefore, we investigated whether acclimatization treatment of hops also confers osmotic stress tolerance.

[0121] 2. Experimental Method (1) Experimental Materials Tissue culture seedlings of hops (variety: Saaz) were used as experimental materials. Hop seedlings were purchased from the Hana no Yakata Webshop (https: / / hananoyakata.shop-pro.jp / ).

[0122] (2) Growth Method and Acclimation Treatment (i) Culture Conditions: Plants were grown on solid medium containing 1 / 2 (w / v) Murashige and Skoog medium mixed salts (Nacalai), 2% (w / v) glucose (FUJIFILM Wako), and 0.8% (w / v) agar (FUJIFILM Wako). The incubator photoperiod was set to 16 hours light and 8 hours dark. (ii) Acclimation Treatment: Tissue-cultured seedlings were grown under the above culture conditions for 1.5–2 months to reach a certain height, leaf number, and stem thickness. A single tissue-cultured seedling was placed in a 300-ml flask (IWAKI) containing 100 mL of liquid medium containing 1 / 2 (w / v) Murashige and Skoog medium mixed salts (Nacalai) and 2% (w / v) glucose (FUJIFILM Wako). The flasks containing the tissue culture seedlings were transferred to a 20°C incubator (Sanki Seiki) for six weeks of shaking culture in the control group. The shaking speed was 80 rpm. The treatment group was also cultured in a similar manner at 25°C for six weeks. After that, plant bodies including the apical bud and first node were excised from the tissue culture seedlings obtained in each of the control and treatment flasks, and five plants per group were subcultured on solid medium and grown at 20°C for one week.

[0123] (3) Osmotic Stress Exposure and Evaluation (i) Osmotic Stress Exposure: Osmotic stress was simulated by adding the osmotic regulator mannitol to the medium to inhibit root water absorption. The concentration conditions were based on the osmotic stress test conducted by Tajaragh et al. (Horticulture, 2022 Nov;8(12):1117). Plants grown in (2) above were transferred to solid medium containing mannitol for 18 days under osmotic stress conditions, as control and treatment groups. For plant growth, solid medium containing 1 / 2 (w / v) Murashige and Skoog medium salt mixture (Nacalai), 2% (w / v) glucose (FUJIFILM Wako), and 0.8% (w / v) agar (FUJIFILM Wako) was supplemented with 0, 0.1, 0.2, or 0.4 MD(-) mannitol (FUJIFILM Wako) at final concentrations of 0, 0.4, 0.2, or 0.4. (ii) Evaluation. Osmotic stress can inhibit growth and, in the worst case, cause yellowing and death. In this study, the extent of yellowing and death was assessed by measuring the amount of the green pigment chlorophyll in the leaves. Two leaf blades from the first node of each plant were placed in a 2 mL tube (Eppendorf) containing 1 mL of N,N-dimethylformamide (FUJIFILM Wako) and incubated at 4°C in the dark for one day to extract chlorophyll. The absorbance of the extract was measured at 647 nm and 664 nm. The chlorophyll amounts determined from the absorbance were designated a and b, respectively, and their sum, chlorophyll a + b, was calculated. To eliminate the influence of plant size, a + b was divided by the weight (mg) of the plant per well to determine the chlorophyll content per plant weight. The chlorophyll content was quantified according to the method of Yamaguchi et al. (Nature Commun., 2021 Jun 9;12(1):3480).

[0124] 3. Results: Compared to the control group, the yellowing and withering of leaves under osmotic stress in the solid medium supplemented with D(-) mannitol was suppressed in the treated group (Fig. 9-1). When the chlorophyll content of the leaves was compared, the values ​​in the treated group were higher than those in the control group in the mannitol-supplemented medium, and significant differences were observed in the 0.2M and 0.4M mannitol-supplemented medium compared to the control group (Fig. 9-2).

[0125] 4. Conclusions Our results suggest that 6-week acclimation at 25°C may be able to confer osmotic stress tolerance to hops.

[0126] Example 9: Promotion of Related Gene Expression by Six-Week Acclimation at 25°C Using Liquid Culture 1. Purpose Example 1 demonstrated that six-week acclimation at 25°C using liquid culture suppressed leaf yellowing and withering under osmotic stress. It has been reported that Arabidopsis and rice have overlapping upstream pathways for high-temperature and drought stress responses, and that dehydration-responsive element-binding protein 2A (DREB2A) in particular is activated in response to combined high-temperature and drought stress, demonstrating tolerance (Nakashima et al., Plant Physiol., 2009 Jan;149(1):88-95). In Arabidopsis, nine-cis-epoxycarotenoid dioxygenase 3 (NCED3) has been reported as a gene encoding an enzyme that primarily controls the synthesis of abscisic acid (ABA), a plant hormone that responds to drought stress (Iuchi et al., Plant physiol., 2001 Dec;27(4):325-333). Therefore, to confirm the acquisition of osmotic tolerance during the acclimation treatment using multiple indicators, we investigated the expression of these two genes to determine whether tolerance was acquired after acclimation.

[0127] 2. Experimental Method (1) Experimental Materials: The same as in Example 8.

[0128] (2) Growth method and high temperature acclimation treatment (i) Culture conditions: Same as in Example 8. (ii) Acclimation treatment: Same as in Example 8.

[0129] (3) Exposure to Osmotic Stress As in Example 8, a solid medium containing 0.4M D(-) mannitol was used to apply osmotic stress (0 hours, 8 hours) to the acclimation treatment group and the control group, and gene expression was investigated.

[0130] (4) Gene Expression Analysis (i) Search for Arabidopsis Stress Response-Related Gene Homologs in Hop. To design target gene primers required for real-time PCR gene expression analysis, we searched for hop homologs of Arabidopsis stress response-related genes. Arabidopsis DREB2A (AGI code: AT5G05410) and NCED3 (AGI code: AT3G14440) were obtained from TAIR (https: / / www.arabidopsis.org / ), and the nucleotide sequences of the homologs were obtained using HopBase (https: / / hopbase.cgrb.oregonstate.edu / ). Additionally, the nucleotide sequence of the Arabidopsis EF1α (AGI code: AT1G18070) homolog was also obtained as a reference gene. The hop homologs were named HlDREB2A, HlNCED3, and HlEF1α. (ii) Analysis of expression levels of high-temperature-responsive genes by real-time PCR. Plant samples exposed to osmotic stress were frozen in liquid nitrogen, and RNA was extracted using the RNeasy Plant Mini Kit (Thermo Fischer Scientific). cDNA, required as a template for real-time PCR, was synthesized from the obtained RNA. 1000 ng of total RNA from each sample was used to synthesize cDNA using PrimeScript™ RT Master Mix (Perfect Real Time) (TaKaRa). The synthesized cDNA was diluted 5-fold with sterile distilled water and subjected to real-time PCR. For real-time PCR, the target genes were HlDREB2A and HlNCED3, and the reference gene was HlEF1α. The PCR reaction mixture was prepared with TB Green Ex Taq II (TaKaRa). PCR was performed using the Thermal Cycler Dice™ Real Time System IV (TaKaRa), with 50 amplification cycles. The primers used were as follows:HlDREB2A Fw: AAGTGGGTTGCTGAAATCCG (SEQ ID NO: 17) Rv: AGAAAGTACCGAGCCAAAGC (SEQ ID NO: 18) HlNCED3 Fw: TGCATTGACGGTGTTTACGC (SEQ ID NO: 19) Rv: TTGAACGGCGTGAACCATTC (SEQ ID NO: 20) HlEF1α Fw: TTTTGCTGTCAGGGACATGC (SEQ ID NO: 21) Rv: TTGGCAGCGGATTTGGTAAC (SEQ ID NO: 22).

[0131] Thereafter, the relative expression level of the target gene in the control group was calculated by the ΔΔCt method using the Ct value obtained from real-time PCR.

[0132] 3. Results: After 8 hours of exposure to osmotic stress, the expression level of HlDREB2A in the acclimation treatment increased approximately 3.1-fold compared to the control (Fig. 10A). Similarly, the expression level of HlNCED3 increased approximately 3.8-fold compared to the control (Fig. 10B).

[0133] 4. Conclusions: Our results suggest that hop plants enhance osmotic stress tolerance through increased expression of the stress response-related genes HlDREB2A and HlNCED3.

[0134] Example 10: Enhancing Drought Stress Tolerance of Tissue-Cultured Seedlings by Acclimatization at 25°C for 6 Weeks 1. Purpose Based on Examples 1 and 2, we discovered an acclimation method that can impart osmotic stress tolerance to hops under laboratory conditions. Therefore, we examined the growth of tissue-cultured seedlings prepared using the following method under drought stress.

[0135] 2. Experimental Method (1) Experimental Materials: The same as in Example 8.

[0136] (2) Growth method and acclimatization treatment (i) Culture conditions: The same as in Example 8. (ii) Acclimation treatment method: The same as in Example 8.

[0137] (3) Preparation of tissue-cultured seedlings: Hops cultured and acclimatized in the liquid culture described above for 6 weeks were cut and dried according to the method of Hirakawa and Tanno (Plants, 2022 Apr;11(8):1066), then rooted and temporarily planted in a potting soil containing Metro-Mix 350 (Sun Gro Horticulture), vermiculite, and Akadama in a 3:1:1 ratio to prepare tissue-cultured seedlings. One week after temporary planting, the tissue-cultured seedlings were used for testing.

[0138] (4) Exposure to Drought Stress and Evaluation (i) Exposure to Drought Stress Drought stress was administered according to the method of Qin et al. (Plant J., 2007 Mar;50(1):54-69). Irrigation of tissue culture seedlings in the control and treatment groups was stopped for 10 days, then irrigation was resumed for 7 days, and growth was evaluated and chlorophyll content was measured. 150-200 ml of tap water was applied daily from the bottom. (ii) Evaluation As in Example 8, the degree of yellowing and withering was evaluated by measuring the amount of chlorophyll, a green pigment, in the leaves.

[0139] 3. Results: Compared to the control group, the treatment group, which underwent acclimatization at 25°C for six weeks, suppressed leaf yellowing and death under drought stress (Figure 11-1). A comparison of the chlorophyll content in the leaves showed that it was significantly higher in the treatment group (Figure 11-2).

[0140] 4. Conclusions: It was suggested that acclimatization at 25°C for 6 weeks may confer drought stress tolerance to hop tissue-cultured seedlings.

[0141] Example 11: Enhancement of salt stress tolerance using tissue-cultured seedlings by acclimatization at 25°C for 6 weeks 1. Purpose Salt stress is observed in saline-accumulated soils in areas where seawater is flooded or seeped, or in arid regions. Therefore, we examined the growth of tissue-cultured seedlings prepared using the above method under salt stress.

[0142] 2. Experimental Method (1) Experimental Materials: The same as in Example 8.

[0143] (2) Growth method and acclimatization treatment (i) Culture conditions: The same as in Example 8. (ii) Acclimation treatment method: The same as in Example 8.

[0144] (3) Preparation method of tissue culture seedlings: The same as in Example 10.

[0145] (4) Exposure to Salt Stress and Evaluation (i) Exposure to Salt Stress Salt stress was achieved by irrigating the cell seedlings in the control and treatment groups with 150-200 ml of tap water containing 0.2 M sodium chloride from the bottom for 20 days according to Saito et al. (Journal of the Japan Society of Green Crafts, 2015;41(1):21-26). (ii) Evaluation As in Example 8, the amount of chlorophyll, a green pigment, in the leaves was measured to evaluate the degree of yellowing and withering.

[0146] 3. Results: Compared to the control group, the treatment group, which underwent acclimatization at 25°C for six weeks, suppressed leaf yellowing and withering under salt stress (Figure 12-1). A comparison of the chlorophyll content in the leaves showed that it was significantly higher in the treatment group (Figure 12-2).

[0147] 4. Conclusions: The results suggest that acclimatization at 25°C for 6 weeks may confer salt stress tolerance to tissue-cultured hop seedlings.

[0148] By maintaining the plant body at a constant temperature for a certain period of time, it is possible to impart environmental stress resistance to the plant, thereby increasing the yield of the plant even in harsh environments where environmental stress is present.

[0149] SEQ ID NOS: 1-22 Primers All publications, patents and patent applications cited herein are hereby incorporated by reference in their entirety.

Claims

1. A method for producing a plant seedling that has been endowed with environmental stress tolerance, comprising the step of maintaining a plant body within a certain temperature range for a certain period of time, wherein the certain temperature range is between 22°C and 28°C, and the certain period of time is between 10 days and 12 weeks.

2. The method according to claim 1, wherein the step of maintaining the plant body within a certain temperature range for a certain period of time is carried out in a liquid.

3. The method according to claim 1, wherein the plant is a Cannabaceae plant.

4. The method according to claim 3, wherein the Cannabaceae plant is hops.

5. The method according to claim 1, wherein the plant body is a tissue culture seedling.

6. The method according to claim 1, wherein the environmental stress tolerance is one or more selected from the group consisting of high temperature stress tolerance, drought stress tolerance, oxidative stress tolerance and osmotic stress tolerance.

7. A method for imparting environmental stress resistance to a plant body by maintaining the plant body within a certain temperature range for a certain period of time, wherein the certain temperature range is between 22°C and 28°C, and the certain period is between 10 days and 12 weeks.

8. The method according to claim 7, wherein the step of maintaining the plant body within a certain temperature range for a certain period of time is carried out in a liquid.

9. A method for producing a plant body in which expression of one or more genes selected from the group consisting of HSFA genes, HSP genes, ZAT genes, AOX genes, APX genes, DREB genes and NCED genes is promoted, the method comprising a step of maintaining the plant body within a certain temperature range for a certain period of time, wherein the certain temperature range is a temperature of 22°C or higher and 28°C or lower, and the certain period of time is a period of 10 days or higher and 12 weeks or lower.

10. The method according to claim 9, wherein the step of maintaining the plant body within a certain temperature range for a certain period of time is carried out in a liquid.

11. A method for promoting the expression of one or more genes selected from the group consisting of ZAT genes, HSP genes, HSFA genes, AOX genes, APX genes, DREB genes, and NCED genes in a plant body, the method comprising the step of maintaining the plant body within a certain temperature range for a certain period of time, wherein the certain temperature range is a temperature range of 22°C or higher and 28°C or lower, and the certain period is a period of 10 days or higher and 12 weeks or lower.

12. The method according to claim 11, wherein the step of maintaining the plant body within a certain temperature range for a certain period of time is carried out in a liquid.

13. A method for producing plant seedlings in which initial growth after planting is promoted by maintaining the plant body within a certain temperature range for a certain period of time, wherein the certain temperature range is a temperature of 22°C or higher and 28°C or lower, and the certain period is a period of 10 days or higher and 12 weeks or lower.

14. The method according to claim 13, wherein the step of maintaining the plant body within a certain temperature range for a certain period of time is carried out in a liquid.

15. The method according to claim 13, wherein the degree of promotion of initial growth is judged by the degree of plant height increase.

16. A method for promoting early growth after planting by maintaining a plant body within a certain temperature range for a certain period of time, wherein the certain temperature range is between 22°C and 28°C, and the certain period is between 10 days and 12 weeks.

17. The method according to claim 16, wherein the plant body is maintained within a certain temperature range for a certain period of time in a liquid.

Citation Information

Patent Citations

  • Method of controlling flowering of plants in next generation and seeds and seedlings with controlled flowering time

    JP2016182094A

  • Method for producing stress tolerant plant

    JP2018166480A

  • Composition for imparting stress resistance to plants

    WO2024080353A1