Probiotic compositions having bile acid deconjugation and dehydroxylation properties and methods thereof

Stable probiotic compositions of P. hiranonis bacteria, lyophilized and encapsulated to maintain viability, address the limitations of fecal transplantation by effectively restoring bile acid conversion and reducing dysbiosis in the gut.

WO2026029836A1PCT designated stage Publication Date: 2026-02-05TEXAS A&M UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/030109
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-29
Filing Date
2025-05-20
Publication Date
2026-02-05

AI Technical Summary

Technical Problem

Current methods for restoring P. hiranonis colonization in the gut, such as fecal microbiota transplantation, are unreliable and pose risks like pathogen transmission, and there are no stable probiotic compositions to consistently deliver P. hiranonis bacteria capable of converting primary bile acids to secondary bile acids.

Method used

Development of stable probiotic compositions comprising P. hiranonis bacteria, capable of converting primary bile acids to secondary bile acids, which are lyophilized and encapsulated to maintain viability under aerobic conditions, allowing effective gut colonization and dysbiosis reduction.

Benefits of technology

The probiotic compositions effectively restore bile acid conversion in the gastrointestinal tract, reducing dysbiosis and improving gut health without the drawbacks of fecal microbiota transplantation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000006_0001
    Figure IMGF000006_0001
  • Figure IMGF000007_0001
    Figure IMGF000007_0001
  • Figure IMGF000008_0001
    Figure IMGF000008_0001
Patent Text Reader

Abstract

Disclosed are methods and compositions for delivering at least one P. hiranonis bacterium to the gastrointestinal tract of an animal. The probiotic composition described herein comprise at least one P. hiranonis bacterium and a carrier and are capable of converting primary bile acids into secondary bile acids. Such probiotic compositions are stable and viable under aerobic conditions and reduce dysbiosis.
Need to check novelty before this filing date? Find Prior Art

Description

TITLE OF THE INVENTIONPROBIOTIC COMPOSITIONS HAVING BILE ACID DECONJUGATION AND DEHYDROXYLATION PROPERTIES AND METHODS THEREOFREFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of United States provisional application No. 63 / 676,523, filed July 29, 2024, herein incorporated by reference in its entirety.INCORPORATION OF SEQUENCE LISTING

[0001] The sequence listing that is contained in the file named “TAMC084WO_ST26.xml,” which is 377 kilobytes as measured in Microsoft Windows operating system and was created on April 29, 2025, is filed electronically herewith and incorporated herein by reference.FIELD OF THE INVENTION

[0002] The present invention relates generally to the field of gastrointestinal sciences. More specifically, the invention relates to compositions comprising P. hiranonis bacteria and methods for treating dysbiosis.BACKGROUND OF THE INVENTION

[0003] The gastrointestinal tract microbiome plays an important role in host health by stimulating the immune system, influencing gut structure, aiding in the defense against pathogens, and providing nutritional benefits to the host. In particular, bile acids (BA) and BA 7a-dehydroxylating bacteria appear to play major roles in host health. Furthermore, maintaining a correct balance between primary and secondary bile acids allows a beneficial microbiome to thrive in the gut. In animals, Peptacetobacter hiranonis (also known as Clostridium hiranonis) is an important anaerobic bacterial species in the gut. Some strains of P. hiranonis have the ability to deconjugate and dehydroxylate bile acids. When P. hiranonis colonization is lost, many species are unable to produce secondary bile acids, which leads to bile acid dysmetabolism and severe dysbiosis. In most cases, these dysbiosis patterns can only be corrected by restoring colonization of P. hiranonis to the gut.

[0004] There are currently no stable probiotic compositions comprising live P. hiranonis to reliably restore its colonization to the gut. The only available means to restore P. hiranonis colonization to the gut is by fecal microbiota transplantation (FMT). However, this method has inherent drawbacks and limitations. For example, FMT requires delivering an undefined product to a patient, requires extensive testing of donors, and risks include the transmission of enteric pathogens and / or multidrug resistant bacteria. Therefore, a continuing need exists in the art for the development of methods and compositions for restoring colonization of bacterial strains capable of converting primary bile acids (BAs) to secondary bile acids to the gut (e.g., P. hiranonis) as well as methods of preparing stable and viable compositions thereof.SUMMARY OF THE INVENTION

[0005] One aspect of the present invention provides a probiotic composition comprising at least one P. hiranonis bacterium and a carrier; wherein the P. hiranonis bacterium is capable of converting primary bile acids into secondary bile acids. In some embodiments, the P. hiranonis bacterium comprises bile acid deconjugation and 7- alpha-dehydroxylation activity. In further embodiments, the P. hiranonis bacterium comprises a bsh gene and a bai operon. In other embodiments, the probiotic composition restores bile acid conversion in the gastrointestinal tract of an animal when administered to the animal. In still other embodiments, the delivery of the probiotic composition to the gastrointestinal tract of the animal reduces dysbiosis in the animal. In some embodiments, the at least one P. hiranonis bacterium comprises a nucleotide sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs:l-173; or a combination of any thereof. In certain embodiments, the at least one P. hiranonis bacterium comprises P. hiranonis strain CH5, a representative sample of said strain having been deposited under NRRL Accession No. B-68416. In some embodiments, the probiotic composition is encapsulated. In specific embodiments, the composition comprises a concentration of the at least one P. hiranonis bacterium between about lxl07colony-forming units per capsule to about 8xl09colony-forming units per capsule.

[0006] In another aspect, the invention provides a method for delivering probiotic composition to the gastrointestinal tract of an animal comprising providing a composition comprising at least one P. hiranonis bacterium and a carrier in the diet of the animal; wherein the P. hiranonis bacterium is capable of converting primary bile acids into secondary bile acids. In some embodiments, the P. hiranonis bacterium comprises bile acid deconjugation and 7-alpha- dehydroxylation activity. In other embodiments, the at least one P. hiranonis bacteriumcomprises P. hiranonis strain CH5, a representative sample of said strain having been deposited under NRRL Accession No. B-68416. In other embodiments, the delivery of the probiotic bacteria to the gastrointestinal tract of the animal reduces dysbiosis in the animal. In specific embodiments, the animal is a dog, a cat, or a human. In further embodiments, the method for delivering probiotic composition to the gastrointestinal tract of an animal comprises providing lyophilized P. hiranonis bacterium; or providing an encapsulated probiotic composition. In certain embodiments, the at least one P. hiranonis bacterium is provided in the diet of the animal between about 1x107colony forming units per capsule to about 8xl09colony forming units (CFU) per capsule. In still other embodiments, the method comprises delivering the probiotic composition to an animal in dysbiosis. In certain embodiments, the dysbiosis is further characterized by chronic enteropathy. The probiotic composition may also be administered to the animal following antibiotic administration. In specific embodiments, the animal is in dysbiosis following antibiotic administration. In still further embodiments, the probiotic composition is delivered to an animal to re-establish a balanced bile acid conversion, thereby inhibiting C. difficile colonization.

[0007] In yet another aspect, the invention provides a method for lyophilizing P. hiranonis, the method comprising culturing P. hiranonis cells in a broth under anaerobic conditions, centrifuging the P. hiranonis culture, discarding the supernatant; reconstituting the P. hiranonis cells with a cryoprotectant, freezing the reconstituted P. hiranonis cells; and lyophilizing the frozen reconstituted P. hiranonis cells, wherein the P. hiranonis cells are viable under aerobic conditions. In some embodiments, the method further comprises distributing the lyophilized reconstituted P. hiranonis cells in a capsule. In other embodiments, the capsule comprises between about IxlO7colony forming units per capsule and about 8xl09colony forming unit per capsule. In still further embodiments, wherein the broth is Brain Heart Infusion Broth (BHI), culturing the P. hiranonis cells is carried out for between about 24h and about 72h, the cryoprotectant is skimmed milk powder, or the P. hiranonis cells are washed with phosphate buffer saline prior to reconstituting with a cryoprotectant.BRIEF DESCRIPTION OF THE DRAWINGS

[0008] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0009] FIG. 1. Shows canine- and feline-derived C. hiranonis also known as P. hiranonis) strains’ ability to deconjugate TCA and TCDCA to CA and CDCA followed by conversion to DCA and LCA. C. hiranonis strains color-coded in black (circles) are strains carrying the bsh gene, and in white (diamonds), C. hiranonis strains lacking the bsh gene.

[0010] FIG. 2. Shows canine- and feline-derived C. hiranonis strains’ ability to convert CA and CDCA into DCA and LCA, respectively.

[0011] FIG. 3. Shows the dysbiosis index and quantification, expressed in log DNA, of C. hiranonis (also known as P. hiranonis) over time for the first patient (a cat). The arrow denotes the time of cefovecin sodium (80mg / ml) antibiotic injection, and the vertical striped rectangles indicate the administration of the C. hiranonis probiotic composition.

[0012] FIG. 4. Shows the restoration of bile acid conversion following administration of the C. hiranonis probiotic composition in terms of the relative concentration of secondary bile acids in the first patient (a cat). The arrow denotes the time of the cefovecin sodium antibiotic injection; and the vertical shaded rectangle indicates the administration of the C. hiranonis probiotic composition.

[0013] FIG. 5. Shows the phylogenetic analysis of isolated canine and feline-derived P. hiranonis strains. The phylogenetic tree was built based on several genes randomly selected from P. hiranonis genomes. Strains appear to be grouped based on their bile acid deconjugation ability.

[0014] FIG. 6A, FIG. 6B, and FIG. 6C. Show the quantification, expressed in log DNA, of strict and facultative anaerobic bacteria following administration of the C. hiranonis probiotic composition in the first patient (a cat).

[0015] FIG. 7. Shows the Purina® Fecal Scoring Chart including a description of specimens and characteristics thereof.

[0016] FIG. 8. Shows representative fecal samples before and after C. hiranonis probiotic administration from the first patient (a cat).

[0017] FIG. 9. Shows the dysbiosis index and quantification, expressed in log DNA, of C. hiranonis over time for the second patient (a dog). The arrow denotes the time of the Clindamycin antibiotic treatment; and the vertical shaded rectangles indicate the administration of three doses of C. hiranonis probiotic composition.

[0018] FIG. 10. Shows the restoration of bile acid conversion following administration of the C. hiranonis probiotic composition in terms of relative concentration of secondary bile acids in the second patient (a dog). The arrow denotes the time of the Clindamycin antibiotic treatment; and the vertical shaded rectangle indicates three doses of C. hiranonis probiotic composition..

[0019] FIG. 11A, FIG. 11B, and FIG. 11C. Show the quantification, expressed in log DNA, of strict and facultative anaerobic bacteria following administration of the C. hiranonis probiotic composition in the second patient (a dog).

[0020] FIG. 12. Shows representative fecal samples before and after probiotic administration from the second patient (a dog).BRIEF DESCRIPTION OF THE SEQUENCESDETAILED DESCRIPTION

[0021] More than 100 trillion microbial cells inhabit the gastrointestinal tract (GIT), outnumbering the host cells approximately 10-fold. The GIT microbiota plays an important role in host health by stimulating the immune system, influencing gut structure, aiding in the defense against pathogens, and providing nutritional benefits to the host. A complex interplay exists between the host and intestinal microbes and their metabolic end-products. A balanced microbiome promotes host health; however, imbalances in the GIT may lead to deleterious effects. Such imbalances can be referred to as dysbiosis.

[0022] Intestinal dysbiosis, which is defined as compositional and functional alteration of the normal intestinal microbiome, has been associated with various diseases in animals including humans, dogs, and cats. In particular, the depletion of bacterial strains capable of converting primary bile acids (BAs) to secondary bile acids appears to be associated with Clostridioides difficile infections, severe dysbiosis, chronic enteropathies, and antimicrobial treatments.

[0023] P. hiranonis (also known as Clostridium hiranonis) is one bacterial species having the ability to convert primary bile acids to secondary bile acids. When colonization of P. hiranonis is lost, many animal species are unable to produce secondary bile acids, which leads to bile acid dysmetabolism and severe dysbiosis. This dysbiosis can be observed, e.g., in animals exhibiting chronic enteropathies; or in animals following administration of broadspectrum antibiotics. In some cases, these dysbiosis patterns can only be corrected by restoring the colonization of P. hiranonis to the gut.

[0024] Like many beneficial intestinal bacteria, P. hiranonis is a strict anaerobe. As such, uncontrolled exposure to oxygen causes cell viability to decrease rapidly making it challenging to handle without access to strict anaerobic conditions. There are currently no stable probiotic compositions of P. hiranonis to reliably restore colonization of P. hiranonis to the gut. Although fecal microbiota transplantation (FMT) has been attempted for this purpose, this method has inherent drawbacks and limitations including pathogen transfer and variable reproducibility due to donor variability. Additional side effects of FMT include transient discomfort, bloating, diarrhea, and transmission of harmful bacterial species. The inherent issues associated with FMT and the need to screen and test donor samples severely limit its broad use and adoption both clinically and commercially.

[0025] The present disclosure therefore represents a significant advance in the art in that it provides methods and compositions for reliably restoring colonization of P. hiranonis in thegut as well as methods of preparing stable and viable compositions thereof. In particular, the present disclosure describes stable and viable probiotic compositions comprising P. hiranonis that can consistently restore P. hiranonis colonization in the gut. Furthermore, the present disclosure also provides methods for preparing, lyophilizing, and / or encapsulating probiotic P. hiranonis compositions without a significant decrease in cell viability. The methods and compositions disclosed herein offer the opportunity to effectively treat patients to improve gut health, eliminate dysbiosis, and prolong their quality of life without the need for fecal microbiota transplantation.

[0026] Accordingly, provided herein are probiotic compositions comprising at least one P. hiranonis bacterium and a carrier; wherein the P. hiranonis bacterium is capable of converting primary bile acids into secondary bile acids, and wherein the P. hiranonis bacterium is stable and viable. For example, provided herein are probiotic compositions comprising at least one P. hiranonis bacterium comprising a bsh, a baiA2, a baiB, a baiCD, a baiE, a baiF, a baiG, a baiH, and a baiJ gene. In further embodiments, said gene may be described as having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a corresponding polynucleotide sequence disclosed herein. In specific embodiments, e.g., the at least one P. hiranonis bacterium comprises a bsh, a baiA2, a baiB, a baiCD, a baiE, a baiF, a baiG, a baiH, and a baiJ gene having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NOs:26, 27, 28, 29, 30, 31, 32, 33, and 34, respectively. Additionally, the methods described herein are useful in delivering said probiotic composition to the gastrointestinal tract of an animal. In other aspects, the present invention comprises novel methods of lyophilizing and encapsulating P. hiranonis, In some embodiments, the probiotic compositions comprising at least one P. hiranonis bacterium can be exposed to oxygen without loss of viability. As demonstrated herein, these probiotic compositions engraft in the gut of animals and successfully restore bile acid conversion in the gut.I. Probiotics

[0027] A “probiotic” as used herein refers to a microorganism that naturally inhabits the intestinal tracts of animals, including but not limited to dogs, cats, and humans, that is considered non-pathogenic, safe, and health beneficial. See, for example, Collado et al. , Lett.Appl. Microbiol. 45:454-460, 2007 and Fuller, J. Appl. Bacteriol. 66:365-378, 1989. Although the exact mechanisms by which probiotics provide health benefits in the intestine are still being elucidated, the beneficial effects of probiotics include intestinal microflora modulation, competitive exclusion of pathogens, and immune stimulation (Collado et al., J. Food Prot. 69:1675-1679, 2006; and Servin and Coconnier, Best Practice & Research Clinical Gastroenterology 17:741-754, 2003). Such probiotics, according to one aspect of the invention, may comprise bacteria from the genus Peptacetobacter. P. hiranonis, formerly known as Clostridium hiranonis, is a gram-positive, anaerobic, spore-forming bacteria, carrying the bile acid-inducible operon (bai). See Cai et al. , 2022 and Chen et al. , 2020. Probiotics of the present invention may comprise, in particular aspects, P. hiranonis strains capable of deconjugation and dehydroxylation of bile acids. Non-limiting examples include P. hiranonis bacteria comprising bile acid deconjugation and 7-alpha-dehydroxylation activity. The absence or elimination of P. hiranonis in the intestine is a major driver of severe dysbiosis, and animals with a high degree of dysbiosis are unlikely to have normal P. hiranonis abundance as reduced P. hiranonis abundance is correlated to chronic enteropathy as well as antibiotic use.

[0028] The use of many commercial probiotics has been generally concerned with their beneficial effects on the gastrointestinal tract. However, there still remains the important issue of how sufficient numbers of probiotic bacteria can realistically reach and bind to targeted sites. The viability of probiotics delivered orally to a host is affected by multiple factors. One such factor is a probiotic’s sensitivity to oxygen. In the case of strict anaerobic bacteria like P. hiranonis, developing methods to preserve viability when exposed to oxygen presents challenges for maintaining the efficacy of compositions containing the probiotic. The present disclosure provides, for the first time, methods for producing probiotic compositions of P. hiranonis that remain viable in the presence of oxygen. For example, in certain embodiments, a probiotic composition provided herein remains viable under aerobic conditions, e.g., in capsule form; is capable of engrafting into the gut of animals; and restores bile acid conversion in said animal. The effects by the methods provided herein, and the resulting stability and viability of the disclosed probiotic compositions allows for higher numbers of probiotic bacteria to reach the intestinal tract of the animal, thus resulting in greater colonization of P. hiranonis and restoration of bile acid conversion.IL Lyophilization and Encapsulation

[0029] Methods are provided for lyophilizing and encapsulating isolated probiotic microbes such that they are able to remain viable under aerobic conditions, and as they pass through the stomach and reach the intestinal tract of animals. Reference in this application to an “isolated” bacterium, strain, or an equivalent term or phrase, is intended to mean that the bacterium is one that is present alone or in combination with other compositions, but not within its natural environment. For example, a P. hiranonis strain would be “isolated” within the scope of this disclosure so long as it is found in a space in which it is not normally found in nature, i.e., in a probiotic composition such as a capsule. Tn certain embodiments, the isolated P. hiranonis strain can be lyophilized.

[0030] As described herein, the process of lyophilizing P. hiranonis cells may comprise culturing P. hiranonis cells in a broth under anaerobic conditions; centrifuging the P. hiranonis culture; discarding the supernatant; reconstituting the P. hiranonis cells with a cryoprotectant; freezing the reconstituted P. hiranonis cells; and lyophilizing the frozen reconstituted P. hiranonis cells, wherein the P. hiranonis cells are viable under aerobic conditions. Cryoprotectants of the present invention may include but are not limited to, skimmed milk powder, dextrose, trehalose, xylose, glycerol, lactose, glucose, inulin, cysteine, riboflavin, and sucrose.

[0031] Encapsulation is a barrier method, preventing ingredients from reacting prematurely with their environment or degrading during processing or storage, and can be applied to any scale manufacture. In some embodiments, the methods provided herein include distributing the lyophilized reconstituted P. hiranonis cells in a capsule. In other embodiments of the present invention, encapsulation prevents the probiotic bacteria from being killed during handling and storage as well as during the digestion process. In further embodiments, such capsule may comprises between about IxlO7colony-forming units per capsule and about 8xl09colonyforming units per capsule, between about 2xl07colony-forming units per capsule and about 8xl09colony-forming units per capsule, between about 3xl07colony-forming units per capsule and about 8xl09colony-forming units per capsule, between about 4xl07colony-forming units per capsule and about 5xl09colony-forming units per capsule, between about 6xl07colonyforming units per capsule and about 8xl09colony-forming units per capsule, between about 7xl07colony-forming units per capsule and about 8xl09colony-forming units per capsule, between about 8xl07colony-forming units per capsule and about 8xl09colony-forming units per capsule, between about 9xl07colony-forming units per capsule and about 8xl09colonyforming units per capsule, between about 2xl07colony-forming units per capsule and about 7xl09colony-forming units per capsule, between about 2xl07colony-forming units per capsuleand about 6xl09colony-forming units per capsule, between about 2xl07colony-forming units per capsule and about 5xl09colony-forming units per capsule, between about 2xl07colonyforming units per capsule and about 4xl09colony-forming units per capsule, between about 2xl07colony-forming units per capsule and about 3xl09colony-forming units per capsule, between about 2xl07colony -forming units per capsule and about 2xl09colony-forming units per capsule, between about 2xl07colony-forming units per capsule and about IxlO9colonyforming units per capsule, between about IxlO7colony-forming units per capsule and about 2xl07colony-forming units per capsule, or between about 5x106colony-forming units per capsule and about 3xl07colony-forming units per capsule.

[0032] The methods provided herein allow, for the first time, the production of probiotic compositions comprising viable P. hiranonis cells capable of engrafting in the gut of an animal. According to some embodiments, producing a probiotic composition comprising viable P. hiranonis cells comprises culturing P. hiranonis cells in a broth under anaerobic conditions; centrifuging the P. hiranonis culture; reconstituting the P. hiranonis cells with a cryoprotectant; freezing the reconstituted P. hiranonis cells; lyophilizing the frozen reconstituted P. hiranonis cells; and distributing the lyophilized reconstituted P. hiranonis cells in a capsule, wherein the P. hiranonis cells are viable under aerobic conditions. As such, the methods and compositions disclosed herein provide unique advantages over current fecal microbiota transplantation (FMT) methods used in the art. The probiotic compositions disclosed herein are significantly more stable than lyophilized feces kept at -20°C. For example, lyophilized feces kept -20°C for 1 month may have only about 20,000 CFU / g of feces of P. hiranonis, representing more than a 99% decrease as compared to the amount of P. hiranonis bacteria found in fresh feces (e.g., 8 billion CFU / g). In stark contrast, the probiotic compositions disclosed herein may comprise at least about I x lO6CFU per capsule, at least about 2 x 106CFU per capsule, at least about 3 x 106CFU per capsule, at least about 4 x 106CFU per capsule, at least about 5 x 106CFU per capsule, at least about 6 x 106CFU per capsule, at least about 7 x 106CFU per capsule, at least about 8 x 106CFU per capsule, at least about 9 x 106CFU per capsule, at least about 10 x 106CFU per capsule, at least about 11 x 106CFU per capsule, at least about 12 x 106CFU per capsule, at least about 13 x 106CFU per capsule, at least about 14 x 106CFU per capsule, at least about 15 x 106CFU per capsule, at least about 16 x 106CFU per capsule, at least about 17 x 106CFU per capsule, at least about 18 x 106CFU per capsule, at least about 19 x 106CFU per capsule, at least about 20 x 106CFU per capsule, at least about 21 x 106CFU per capsule, at least about 22 x 106CFU per capsule, at least about 23 x 106CFU per capsule, at least about 24 x 106CFU per capsule, at least about 25 x 106CFUper capsule, at least about 26 x 106CFU per capsule, at least about 27 x 106CFU per capsule, at least about 28 x 106CFU per capsule, at least about 29 x 106CFU per capsule, or at least about 30 x 106CFU per capsule.

[0033] The probiotic compositions disclosed herein may comprise a capsule size of 0, 00E, 0, 0E, 0, 1, 2, 3, 4, or 5, wherein the maximum capsule capacity is 822 mg, 600 mg, 540 mg, 408 mb, 288 mg, 216 mg, 162 mg, 120 mg, or 78 mg; and wherein the capsule length is 26.1 mm, 25.3 mm, 23.4 mm, 23.5 mm, 21.6 mm, 19.4 mm, 17.6 mm, 15.7 mm, 14.3 mm, or 11.1 mm, respectively. In specific embodiments, the encapsulated probiotic compositions may comprise a size 3 capsule weighing about 100 mg.III. Formulations and Compositions

[0034] The terms “formulation” and “composition” are used interchangeably herein to refer to a mixture of two or more chemical or biological substances (e.g., a mixture of a P. hiranonis and a carrier). Formulations and compositions are further provided comprising at least one P. hiranonis bacterium, wherein the P. hiranonis bacterium is capable of converting primary bile acids into secondary bile acids. A formulation or composition provided herein may further comprise a carrier. Common goals for formulating probiotics include enhancing shelf life, preserving viability of the product, and enhancing probiotic activity. Provided herein are methods for lyophilizing at least one P. hiranonis bacterium to extend the shelf life and maintain the bacterium’s viability in the presence of oxygen. Lyophilized products are often bulked out with additives, such as buffers, stabilizers, cryoprotectants, and volume additives. P. hiranonis can be encapsulated to make the final product safer and easier to use based on the present disclosure.

[0035] Many formulations or compositions comprising the P. hiranonis cells can be used to prolong the activity or shelf life of the products. Such formulations or compositions may include preservatives, stabilizers, surfactants, detergents, buffers, cofactors, ions, and other components to enhance the performance of the P. hiranonis bacterium.

[0036] Other embodiments of the formulations described herein may comprise one or more additional bacterial and yeast species, including but not limited to the following genera, Lactobacillus, Bifidobacterium, Saccharomyces, Streptococcus, Faecalibacterium, Fusobacterium, Bacteroides, and Enterococcus species conferring health benefits to the patient. Such formulations can contain additional bacterial species that are synergistic in modeof action with the P. hiranonis cells disclosed. In other embodiments, the probiotic composition may comprise a recombinant P. hiranonis bacterium.

[0037] The aforementioned compositions / formulations can comprise a carrier, e.g., a pharmaceutically acceptable carrier or polymeric carrier, whey protein, casein, skim milk powder, gelatin, dextrose, trehalose, xylose, glycerol, lactose, glucose, inulin, cysteine, riboflavin, and sucrose.

[0038] The term “dysbiosis index” (DI) as used herein can refer to a quantitative PCR-based assay used to assess the fecal microbiome in individual patients, i.e., dogs and cats (Sung et al. 2022 and AlShawaqfeh et al. 2017). It is currently the only analytically validated assay to assess the fecal microbiome and has been used in various published clinical studies. The DI quantifies the fecal abundance of seven bacterial taxa as well as the total bacterial abundance. These bacterial taxa are commonly altered in chronic enteropathies (CE) and after broadspectrum antibiotic use. The DI provides reference intervals for these bacterial groups and additionally calculates a single number that expresses the extent of intestinal dysbiosis (Table 1). The DI correlates negatively with species richness, i.e., a higher DI indicates lower microbial diversity (Table 2).Table 1. Reference intervals for several bacterial species included in the DI were identified in fecal samples from dogs and cats.Table 2. Interpretation of Dysbiosis Index in dogs and cats.

[0039] “Patient” as used herein includes an animal, e.g., a dog, a cat, or a human. In some embodiments, the patient is a dog or a cat. A “dog” may include, e.g., a Labrador Retriever, Golden Retriever, German Shepherd, Beagle, French Bulldog, Bulldog, Poodle, Yorkshire Terrier, Boxer, Rottweiler, Pembroke Welsh Corgi, Cavalier King Charles Spaniel, Dachshund, Dobermann, Shih Tzu, Australian Shepherd, Boston Terrier, German Shorthaired Pointer, Great Dane, Pomeranian, Bernese Mountain Dog, Siberian Husky, Miniature Schnauzer, a Border Collie, or a combination thereof (i.e., mixed breeds). A “cat” may include, e.g., Domestic Shorthair, American Shorthair, Domestic Longhair, Siamese, Maine Coon, Ragdoll, Russian Blue, Bengal, Bombay, Persian, or a combination thereof (i.e., mixed breeds).

[0040] As used herein, the term “control” e.g., a “control” dog or likewise a “control” cat) refers to an appropriate animal that is used for comparison to a patient. In some embodiments, a control animal lacks dysbiosis. In other embodiments, a control animal comprises dysbiosis, chronic enteropathies (CE), or has been administered broad-spectrum antibiotics.

[0041] As used herein, the term “polynucleotide” or “nucleic acid” generally refers to a polymer of nucleotide units and includes reference to a deoxyribonucleotide or ribonucleotidepolymer. Polynucleotides include both single- stranded and double-stranded nucleic acid molecules. One of ordinary skill in the art will appreciate that a wide variety of nucleic acidbased techniques are known and can be useful in obtaining the taxonomic identification of a given microorganism. These techniques can be used to identify cells by gene sequence or to identify cells that have particular genes or gene families. Common gene families useful for taxonomic studies include 16S rRNA gene family and the recombinase A (recA) gene family for procaryotic organisms, and the actin gene family for eukaryotic organisms. In specific embodiments, the bsh gene and / or sequences within the bai operon (e.g., baiB, baiCD, baiE, baiA2, baiF, baiG, baiH, and baiJ) may be useful for identifying P. hiranonis strains as described herein. These methods typically include amplifying and sequencing genes from the deoxyribonucleotide extracted from cells. The term “nucleic acid amplification” generally refers to techniques that increase the number of copies of a nucleic acid molecule in a sample or specimen. Techniques useful for nucleic acid amplification are well-known in the art. An example of nucleic acid amplification is the polymerase chain reaction (PCR), in which the deoxyribonucleotide extracted from a biological sample collected from a subject is contacted with a pair of oligonucleotide primers, under conditions that allow for the hybridization of the primers to nucleic acid template in the sample. The primers are extended under suitable conditions, dissociated from the template, and then re-annealed, extended, and dissociated to amplify the number of copies of the nucleic acid. Other examples of in vitro amplification techniques include strand displacement amplification; transcription-free isothermal amplification; repair chain reaction amplification; ligase chain reaction; gap filling ligase chain reaction amplification; coupled ligase detection and PCR; and RNA transcription-free amplification.

[0042] Methods for preparing and using nucleic acid primers are described, for example, in Sambrook et al. (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1989), Ausubel et al. (ed.) (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1998). Amplification primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Whitehead Institute for Biomedical Research, Cambridge, Mass.). One of ordinary skill in the art will appreciate that the specificity of a particular probe or primer increases with its length. Thus, for example, a primer comprising 25 consecutive nucleotides of an rRNA-encoding nucleotide or flanking region thereof will anneal to a target sequence with a higher specificity than a corresponding primer of only 15 nucleotides. Thus, in order to obtain greater specificity, probes and primerscan be selected that comprise at least 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides of a target nucleotide sequence such as the 16S rRNA.

[0043] Common techniques for the preparation of nucleic acids useful for nucleic acid applications (e.g., PCR) include phenol / chloroform extraction or the use of one of the many deoxyribonucleic acids (DNA) extraction kits that are available on the market. Another way that DNA can be amplified is by adding cells directly to the nucleic acid amplification reaction mix and relying on the denaturation step of the amplification to lyse the cells and release the DNA.

[0044] As used herein “amplified” or “amplification” is meant the construction of multiple copies of a nucleic acid sequence or multiple copies complementary to the nucleic acid sequence using at least one of the nucleic acid sequences as a template. Amplification systems include the polymerase chain reaction (PCR) system, ligase chain reaction (LCR) system, nucleic acid sequence-based amplification (NASBA, Cangene, Mississauga, Ontario), Q-Beta Replicase systems, transcription-based amplification system (TAS), and strand displacement amplification (SDA). See, e. g., Diagnostic Molecular Microbiology. Principles and Applications, D. H. Persing et al., Ed., American Society for Microbiology, Washington, D. C. (1993). The product of amplification is termed an amplicon.

[0045] The product of nucleic acid amplification reactions may be further characterized by one or more of the standard techniques that are well-known in the art, including electrophoresis, restriction endonuclease cleavage patterns, oligonucleotide hybridization or ligation, and / or nucleic acid sequencing. When in hybridization techniques are used for cell identification purposes, a variety of probe labeling methods can be useful, including fluorescent labeling, radioactive labeling and non-radioactive labeling. When nucleic acid sequencing techniques are used, homology search for the nucleotide sequence of the amplified nucleic acid molecules can be conducted using various databases of known sequences, including but not limited to DDBJ / GenBank / EMBL databases.

[0046] The terms “hybridization” or “anneal” refer to the process by which single strands of nucleic acid sequences form double-helical segments through hydrogen bonding between complementary nucleotides. Hybridization between nucleic acids is discussed in detail in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).

[0047] A “primer” is a DNA molecule that is designed for use in annealing or hybridization methods that involve an amplification reaction. An amplification reaction is an in vitro reaction that amplifies template nucleic acid to produce an amplicon. As used herein, an “amplicon” is a DNA molecule that has been synthesized using amplification techniques. Amplicons of the invention have a polynucleotide sequence comprising a DNA sequence complementary to any one of SEQ ID NOs: 1-173, or fragments thereof. A pair of primers may be used with template DNA, such as a sample of cDNA, in an amplification reaction, such as polymerase chain reaction (PCR), to produce an amplicon, where the amplicon produced would have a DNA sequence corresponding to the sequence of the template DNA located between the two sites where the primers hybridized to the template. A primer is typically designed to hybridize with a complementary target DNA strand to form a hybrid between the primer and the target DNA strand. The presence of a primer is a point of recognition by a polymerase to begin extension of the primer using as a template the target DNA strand. Primer pairs refer to use of two primers binding opposite strands of a double stranded nucleotide segment for the purpose of amplifying the nucleotide segment between them. Primer pairs of the present invention may in certain embodiments also be defined as comprising a first and second DNA molecule, wherein each are of sufficient length to function as DNA primers when used together in an amplification reaction with DNA (e.g., cDNA) comprising a sequence corresponding to, e.g., bsh, baiCD, and P. hiranonis’ 16S ribosomal RNA to produce an amplicon diagnostic for a P. hiranonis strain disclosed herein.

[0048] The term “probe” refers to a single-stranded oligonucleotide sequence that will recognize and form a hydrogen-bonded duplex with a complementary sequence in a target nucleic acid sequence analyte or its cDNA derivative. Probes useful in relation to the present invention include not only deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) but also polyamides and other probe materials that bind specifically to a target DNA sequence and the detection of such binding can be useful in detecting the presence or absence of the target polynucleotide sequence. A probe may be attached to a conventional detectable label or reporter molecule, such as a radioactive isotope, ligand, chemiluminescent agent, or enzyme.

[0049] Methods for designing and using primers and probes are well-known in the art. Polynucleotide molecules comprising the full length of or fragments of SEQ ID NOs: 1-173 are useful as primers and probes for detecting the polynucleotides associated with glomerulardisease described herein and can readily be designed by one of skill in the art using the sequences provided herein.

[0050] As used herein, two nucleic acid molecules are capable of specifically hybridizing to one another if the two molecules are capable of forming an anti-parallel, double- stranded nucleic acid structure. A nucleic acid molecule is the “complement” of another nucleic acid molecule if they exhibit complete complementarity. As used herein, two molecules exhibit “complete complementarity” if when aligned every nucleotide of the first molecule is complementary to every nucleotide of the second molecule. Two molecules are “minimally complementary” if they can hybridize with one another with sufficient stability to permit them to remain annealed to one another under at least conventional “low-stringency” conditions. Similarly, the molecules are “complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional “high- stringency” conditions. Departures from complete complementarity are therefore permissible, as long as such departures do not completely preclude the capacity of the molecules to form a double-stranded structure.

[0051] Appropriate stringency conditions that promote DNA hybridization, for example, 6.0 x sodium chloride / sodium citrate (SSC) at about 45°C, followed by a wash of 2.0 x SSC at 50°C, are known to those skilled in the art or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. For example, the salt concentration in the wash step can be selected from a low stringency of about 2.0 x SSC at 50°C to a high stringency of about 0.2 x SSC at 50°C. In addition, the temperature in the wash step can be increased from low stringency conditions at room temperature, about 22°C, to high stringency conditions at about 65°C. Both temperature and salt may be varied, or either the temperature or the salt concentration may be held constant while the other variable is changed.

[0052] Detection (<?.g., of an amplification product, of a hybridization complex, of a polynucleotide) can be accomplished using detectable labels that may be attached or associated with a hybridization probe or antibody. The term “label” is intended to encompass the use of direct labels as well as indirect labels. Detectable labels include enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of detection methodologies include, but are not limited to, Southern analysis, PCR amplification for detection of a polynucleotide, Northern blots, RNase protection, primer-extension, RT-PCR amplification for detecting RNA transcripts, Sangersequencing, Next Generation sequencing technologies (e.g. , Illumina®, PacBio®, Ion Torrent™, etc.) enzymatic assays for detecting enzyme or ribozyme activity of polypeptides and polynucleotides, and protein gel electrophoresis, Western blots, immunoprecipitation, and enzyme-linked immunoassays to detect polypeptides. Other techniques such as in situ hybridization, enzyme staining, and immunostaining also can be used to detect the presence or expression of polypeptides and / or polynucleotides.

[0053] As used herein, the term “sequence identity” refers to the extent to which two optimally aligned polynucleotide sequences or two optimally aligned polypeptide sequences are identical. An optimal sequence alignment is created by manually aligning two sequences, e.g., a reference sequence and another sequence, to maximize the number of nucleotide matches in the sequence alignment with appropriate internal nucleotide insertions, deletions, or gaps. As used herein, the term “reference sequence” may refer to a sequence disclosed herein.

[0054] As used herein, the term “percent sequence identity” or “percent identity” or “% identity” is the identity fraction times 100. The “identity fraction” for a sequence optimally aligned with a reference sequence is the number of nucleotide matches in the optimal alignment, divided by the total number of nucleotides in the reference sequence, e.g., the total number of nucleotides in the full length of the entire reference sequence. Thus, one embodiment of the invention is a polynucleotide molecule comprising a sequence that when optimally aligned to a reference sequence provided herein, has at least about 85 percent identity, at least about 90 percent identity, at least about 95 percent identity, at least about 96 percent identity, at least about 97 percent identity, at least about 98 percent identity, or at least about 99 percent identity to the reference sequence. In particular embodiments such sequences may be defined as any one of SEQ ID NOs: 1 -173, or fragments thereof. For example, in some embodiments, a probiotic composition comprising at least one P. hiranonis bacterium and a carrier, wherein the at least one P. hiranonis bacterium comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a sequence selected from SEQ ID NOs:l-173 is provided.

[0055] In addition to the analysis of nucleic acids, microorganisms such as P. hiranonis can be characterized and identified based on the presence (or absence) of specific proteins directly. Such analysis can be based on the activity of the specified protein, e.g., through an enzyme assay or by the response of a co-cultured organisms, or by the mere presence of the specifiedprotein (which can for instance be determined using immunologic methods, such as in situ immunofluorescent antibody staining).

[0056] Biochemical profiling of bacteria is commonly used to identify and describe different bacterial species. The API® test combines various tests to assess the utilization of carbohydrates, amino acids, and other energy sources for the identification of different bacteria groups, such as anaerobic bacteria (API®20A and API®32A) and Enterobacteriaceae (API®20E). Limited information about the biochemical profiling of P. hiranonis is available in the literature, in which only a human-derived strain has been described. The API®20A test combines twenty different biochemical tests aimed at identifying anaerobic species, commonly used for identifying Clostridioides difficile. The API®32A test accounts for 32 different biochemical tests and its advantage over the API®20A is the additional biochemical tests and a shorter turnover time, with a four-hour test compared to the twenty-four hours required by the API®20A test. As further detailed in the illustrative examples provided herein, see, e.g., Examples 2-4, isolated P. hiranonis strains of the present invention can be identified and characterized by the results obtained from such biochemical profiling, including the API®20A and API®32A tests. A schematic overview of the procedure as well as the methodology applied for biochemical profiling of P. hiranonis strains using the API® 20A test and API® 32A test can be found in the respective instruction manuals for such tests, along with guidelines for interpretation of biochemical results obtained therefrom. See API® 20 A and API® 32A Instruction Manuals (bioMerieux); herein incorporated by reference in their entirety. Such biochemical assays can be used with the methods described herein to screen and / or identify specifically only the microorganisms of interest.

[0057] As described in more detail in the Examples section of the present disclosure, Applicants have discovered several beneficial novel microorganisms, for example, effective P. hiranonis strains capable of converting primary bile acids into secondary bile acids. Particularly, these novel microorganisms are effective for reduction of dysbiosis severity in a patient. In some embodiments, these were identified from fecal samples from clinically healthy dogs and cats. DNA extraction from P. hiranonis strains was performed as described by Dashti et al. (Dashti et al. 2009), and confirmation of P. hiranonis was conducted following the protocol described by AlShawaqfeh et al. (AlShawaqfeh et al. 2017). Selection of isolated microorganisms was based on the ability of the microorganisms to perform the deconjugationof the glycine- and taurine-conjugated bile acids; and the conversion of primary to secondary fecal unconjugated bile acids using the 7a-dehydroxylation pathway.

[0058] P. hiranonis is an anaerobic, spore-forming, and Gram-positive bacterium (Chen et al. 2020; Kitahara et al. 2001). P. hiranonis occupies a pivotal role in the conversion of primary to secondary fecal unconjugated bile acids. This conversion involves a multi-step biochemical pathway encoded by the bai operon. One of skill in the art will readily appreciate that P. hiranonis microorganisms can be taxonomically identified by any of the taxonomic techniques described herein, or a combination thereof. Most common techniques include comparative sequence analyses using 16S rRNA sequences as well as qPCR and whole genome sequencing techniques; and those described in Examples 2 of the present disclosure.III. Deposit of Biological Material

[0059] Purified cultures of microbial strain P. hiranonis CH5, capable of converting primary bile acids into secondary bile acids was deposited with the Agricultural Research Service Culture Collection located at 1815 N. University Street, Peoria, Ill. 61604, USA (NRRL) in accordance with the Budapest Treaty for the purpose of patent procedure and the regulations thereunder (Budapest Treaty). The strain is deposited under NRRL Accession No. B-68416. The date of the deposit is July 24, 2024. The deposit has been accepted under the Budapest Treaty.

[0060] The microbial strains have been deposited under conditions that ensure that access to the culture will be available during the pendency of this patent application to one determined by the Commissioner of Patents and Trademarks to be entitled thereto under 37 C.F.R. § 1.14 and 35 U.S.C. § 122. The deposits represent substantially pure cultures of the deposited strains. The deposits are available as required by foreign patent laws in countries wherein counterparts of the subject application or its progeny are filed. However, it should be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action. Preferred microorganisms of the present invention have all of the identifying characteristics of the deposited strains and, in particular, the identifying characteristics of being capable of converting primary bile acids into secondary bile acids as described herein, and as being capable of restoring bile acid conversion in the gastrointestinal tract of an animal when administered to the animal as described herein. In particular, the preferred microorganisms of the present invention refer to microorganismshaving the characteristics of the deposited microorganisms as described above, the deposited microorganisms, and mutants thereof.EXAMPLES

[0061] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples, which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments, which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.Example 1Determining Dysbiosis Index (DI)

[0062] The dysbiosis index (DI) is a quantitative PCR-based assay that can be used to assess the feline (Sung et al. 2022) or canine (AlShawaqfeh et al. 2017) fecal microbiome in individual patients. It is currently the only analytically validated assay to assess the fecal microbiome and has been used in various published clinical studies. The DI quantifies the fecal abundance of seven bacterial taxa as well as the total bacterial abundance. These bacterial taxa are commonly altered in chronic enteropathies (CE) and after broad-spectrum antibiotic use. The DI provides reference intervals for these bacterial groups and additionally calculates a single number that expresses the extent of intestinal dysbiosis (Table 1; above). The DI correlates negatively with species richness, i.e., a higher DI indicates lower microbial diversity (Table 2; above).DNA extraction and qPCR

[0063] Total fecal DNA was extracted using the QIAamp PowerFecal Pro DNA Kit (QIAGEN) and an automatic extraction system (Thermo KingFisher Flex Magnetic Particle Purification 96 PCR Isolation System), according to the manufacturers’ instructions. The qPCR assays were performed as previously reported (AlShawaqfeh et al. 2017; Blake et al. 2020). Briefly, the DNA concentration of the extract was measured by a spectrophotometer (NanoDrop 1000; Thermo Scientific) and normalized to 5 ng / pl. A mixture of 2 pl normalizedDNA extract (5 ng / |il), 5 pl SsoFast EvaGreen supermix (Bio-Rad Laboratories), 0.4 pl forward primer (400 nM), 0.4 pl reverse primer (400 nM) and 2.2 pl DNA-free water was used for qPCR assays using a Bio-Rad Cl 000 Touch Thermal Cycler (Bio-Rad Laboratories). The protocol for the thermal cycler was as follows: initial denaturation at 98°C for 2 mins; 35 cycles with denaturation at 98°C for 3 s; and annealing for 3 s. All samples were analyzed in duplicate and the average of the two results was used for further analysis. The Bio- Rad CFX Maestro 1.1 software (Bio-Rad Laboratories) was applied to analyze the qPCR results. The 10 targeted bacterial groups, the primer sets, and their specific annealing temperatures were listed by Sung et al. and AlShawaqfeh et al.Standard curves for quantification of log DNA

[0064] To assess the specificity of the PCR primers the PCR amplicons from each assay were separated by agarose gel electrophoresis. The PCR product was extracted from the gel using the QIAquick Gel Extraction Kit (QIAGEN) and ligated to pCR 4-TOPO vector (Invitrogen) and transformed into competent DH5aTM-TlR Escherichia coli using TOPO TA Cloning Kit (ThermoFisher). Purification of the plasmid DNA was performed by using the QIAprep Spin Miniprep Kit (QIAGEN). Twenty clones were picked for each bacterial target. The conventional PCR assay was repeated to ensure the plasmid DNA contained the targeted bacterial sequence. The inserted DNA sequence was verified by Sanger Sequencing at Eton Bioscience (San Diego, CA).

[0065] Ten-fold serial dilution of the plasmid DNA was performed to establish a standard curve for each bacterial target. Each calibration curve was established based on 5-7 concentrations of the standard. The qPCR results were expressed as the log amount of DNA for each bacterial group / 10 ng isolated total DNA. The melting curve was analyzed after 35 cycles at a temperature ranging from 60°C to 90°C with an increase of 0.5 for 5 s. The abundance of each bacterial group in the 80 healthy cats was used to establish the RI using the freeware Microsoft Excel add-on Reference Value Advisor v2. 1. (Geffre et al. 2011). Finally, the reference intervals for each bacterial group for dogs were defined by Blake et al. 2020.Dysbiosis Index Development

[0066] The dysbiosis index was developed separately for dogs and cats. For calculation of the DI, the cycle threshold (Ct) values obtained for each bacterial group were used. To overcome variability between samples, the Ct values of each bacterial group were normalized by dividing them by the Ct values for total bacteria. The DI was established by the nearest centroidclassifier algorithm. First, all samples were divided into a training set and a testing set. These samples were previously collected in a prospective fashion to study the fecal microbiota in healthy cats and dogs and those presenting chronic enteropathies (CE) - a detailed history regarding previous medication administration ( / .<?., antibiotics) was available for each of these. The normalized qPCR results from the training set of each animal were used as input in the classification model. Different combinations of bacterial groups involved in the classification model were tested. The classification model was then used to define the centroid of both the healthy and CE groups and to classify the test sample by calculating the Euclidean distances from the test sample to the centroids of both groups. The DI was calculated based on the difference between these two distances. If the distance from the test sample to the centroid of the healthy group was less than that of the CE group, the test sample was classified as healthy, with a DI <0. If the test sample was equidistant from both centroids, the DI was 0. If the distance from the test sample to the centroid of the healthy group was greater than that of the CE group, the test sample was consistent with dysbiosis, with a DI >0. The independent testing dataset was used to assess the diagnostic performance of the DI. For additional validation and to evaluate potential confounders of geographic differences, sampling time, and antibiotic history, animals from all locations were randomized into additional training and testing and the diagnostic performance was assessed.Example 2Comprehensive genome analysis of canine- and feline-derived Peptacetobacter hiranonis strains

[0067] Fecal samples were collected from clinically healthy dogs (n=l 1) and cats (n=l 1). The ten- fold (from 10'1to 10s) dilution was plated on Brucella blood agar plates in anaerobiosis at 37°C (Anaerobe Systems, CA), and colonies morphologically similar to P. hiranonis were selected for further isolation, DNA extraction, and identification by quantitative PCR (qPCR) (AlShawaqfeh et al. 2017).

[0068] DNA extraction from P. hiranonis strains was performed as described by Dashti et al. (Dashti et al. 2009), and confirmation of P. hiranonis’ 16S ribosomal RNA and P. hiranonis’ baiCD gene by qPCR was conducted following the protocol described by AlShawaqfeh et al. (2017) and Lopes et al. (2024), respectively. For P. hiranonis’ bsh gene, primers are described as follows: 5'-AGTCGTGGGATGGGAGGTAT-3' (forward primer) and 5'- TCTGCTGCTCAACAGATCCT -3' (reverse primer).

[0069] Canine (n=l 1) and feline-derived (n= 11) P. hiranonis strains were cultured in Brain Heart Infusion (BHI) broth in anaerobiosis at 37°C for 48 hours for the DNA extraction. Bacteria cells were resuspended in 160 uL Pl buffer (Qiagen) and high molecular weight DNA was extracted using MagAttract HMW DNA Kit (Qiagen). The DNA was eluted in 100 uL AE buffer (Qiagen). DNA concentrations were determined using the Qubit® dsDNA HS Assay Kit (Life Technologies). Samples presenting low DNA concentration were amplified by the whole genome amplification process by using REPLI-g Midi kit (Qiagen). The linear-amplified DNA sample was cleaned using DNEasy PowerClean Pro Cleanup Kit (Qiagen) and concentration was evaluated using the Qubit® dsDNA HS Assay Kit (Life Technologies). To determine the size of the DNA, samples were run into E-Gel SizeSelect 2% Agarose Gel (Invitrogen) along with a 1 Kb ladder. The samples were sheared using the Covaris G-tube (Covaris Inc.). The average size of the sheared DNA samples was determined using Agilent 2100 Bioanalyzer (Agilent Technologies). 1500 ng of the sheared and purified DNA was used as input for the library preparation using SMRTbell Express Template Prep Kit 2.0 (Pacific Biosciences).

[0070] During library preparation, the samples underwent DNA damage and end repair as well as barcode adapter ligation. To remove the un-ligated DNA fragments from the libraries, nuclease treatment was performed. The SMRT libraries were size selected (>6Kb) using 0.75% Agarose gel in Blue Pippin (Sage Science). Following the size selection, the concentration of the final libraries was measured using the Qubit® dsDNA HS Assay Kit (ThermoFisher Scientific), and the average library size was determined using the Agilent 2100 Bioanalyzer (Agilent Technologies). The libraries were then sequenced using the 30-hour movie time on the PacBio Sequel II (Pacific Biosciences).

[0071] Assembled contigs were used for the comprehensive genome analysis on BV-BRC platform (Davis et al. 2020). RAST tool kit (RASTtk) was used to annotate genomic features in bacteria (Aziz etal. 2008; Brettin etal. 2015), which includes BLASTN (Ye, McGinnis, and Madden 2006) to identify repeat regions within the genome. After repeat regions are identified, coding sequences (CDS) are defined Prodigal and Glimmer (Hyatt et al. 2010; Delcher et al. 2007). Antimicrobial resistance is projected for a select group of genera based on an Adaboost machine-learning (Davis, Boisvert, et al. 2016), followed by an initial protein annotation using BLAT (Kent 2002) and BLASTP (Johnson et al. 2008) to identify CDSs that have homology to proteins in specialty databases. Possible virulence factors are identified by blasting againsta database containing proteins collected from the Virulence Factor Database (Liu et al. 2019), Violins (Xiang et al. 2007), and a curated database by the BV-BRC (Mao et al. 2015). Genes with homology to those identified as being involved in antimicrobial resistance are BLATed against proteins from the Comprehensive Antibiotic Resistance Database (CARD) (Alcock et al. 2020), the National Database of Antibiotic-Resistant Organisms (NCBI 2024), the Antibiotic Resistance Database (ARDB) (Liu and Pop 2009) and a curated database by BV- BRC (Antonopoulos et al. 2019). Genes with homology to transporters are identified by searching against proteins from the Transporter Classification Database (TCDB) (Saier Jr et al. 2016), and those similar to genes that have been identified as potential drug targets by comparison to proteins from DrugBank (Wishart et al. 2018) and the Therapeutic Target Database (TTD) (X. Chen, Ji, and Chen 2002). Protein families (Davis, Gerdes, et al. 2016) are assigned, and then hypotheticals are identified. All proteins are then mapped to subsystems (Overbeek et al. 2014; Overbeek et al. 2005). PubMLST (www.pubmlst.org) is used to assign sequence types, and then PhiSpy (Akhter, Aziz, and Edwards 2012) is used to find prophages in bacterial genomes. Generated data includes a genome quality assessment, AMR genes and phenotype predictions, specialty genes, subsystem overview, identification of the closest genome sequences, a phylogenetic tree, and a list of features that distinguish the genome from its nearest species.

[0072] Assembled contigs were used for the comprehensive genome analysis on the BV-BRC platform (Davis et al. 2020). RAST tool kit (RASTtk) was used to annotate genomic features in bacteria (Aziz et al. 2008; Brettin et al. 2015). The Codon Tree pipeline generates bacterial phylogenetic trees through the BV-BRC platform. To build the phylogenetic tree, the amino acid and nucleotide sequences from a defined number of the BV-BRC global Protein Families (PGFams) were used (Davis, Gerdes, et al. 2016), which are picked randomly to build an alignment, and then a tree based on the differences within those selected bacterial genomes. Protein sequences are aligned using MUSCLE (Edgar 2004), and the nucleotide coding gene sequences are aligned using the Codon align function of BioPython (Cock et al. 2009). The concatenated alignment of all proteins and nucleotides was written to a PHYL1P formatted file, and then a partition file for RaxML(Stamatakis 2014) was generated, describing the alignment. Support values are generated using 100 rounds of the “Rapid” bootstrapping option of RaxML (Stamatakis, Hoover, and Rougemont 2008).

[0073] Based on the phylogenetic analysis of P. hiranonis isolated from fecal samples of dogs and cats, it is possible to observe that canine-derived strains form a clade separate from the feline-derived strains. The phylogenetic tree was built based on several genes randomly selected from P. hiranonis genomes. Interestingly, strains appear to be grouped based on their bile acid deconjugation ability. P. hiranonis CH2, a strain lacking the BSH activity culture from a dog, is grouped with the feline-derived strains. In addition, two strains cultured from fecal samples of cats, CH5 and CH23, which carry the bsh gene, are grouped with canine- derived P. hiranonis strains (Table 3 and FIG. 5).

[0074] DI provides a reliable tool to evaluate the dysbiosis in a patient. DI is not affected by age, body weight, and / or gender. Unlike sequencing methods, e.g., 16S rRNA gene and Shotgun sequencing, which are commonly applied to assess the intestinal microbiome, DI is the only analytically validated reproducible test to assess the fecal microbiome of dogs and cats. DI provides a measurement of the severity of intestinal dysbiosis through the quantification of anaerobic (Faecalibacterium, Turicibacter, Blautia, Fusobacterium, Bifidobacterium, Bacteroides, and P. hiranonis) and aerobic (E. coli and Streptococcus) bacterial species. Additionally, DI allows the quantification of bacterial abundances, while sequencing methods allow only the relative abundance quantification. DI provides an overview of the general condition of the intestinal microbiome, detecting dysbiosis in dogs and cats presenting a reduction of Faecalibacterium, Turicibacter, Blautia, Fusobacterium, Bifidobacterium, Bacteroides, and P. hiranonis and an increased abundance of Streptococcus and E. coli.Example 3Biochemical characterization of canine- and feline-derived Peptacetobacter hiranonis strains using API®

[0075] Biochemical profiling of bacteria is commonly used to identify and describe different bacterial species. The API® test combines various tests to assess the utilization of carbohydrates, amino acids, and other energy sources for the identification of different bacteria groups, such as anaerobic bacteria (API®20A and API®32A) and Enterobacteriaceae (API®20E). Limited information about the biochemical profiling of P. hiranonis is available in the literature, in which only a human-derived strain was described. The API®20A test combines twenty different biochemical tests aimed at identifying anaerobic species, commonly used for identifying Clostridioides difficile, for example (Summanen and lousimies-Somer 1988;Gresser et al. 1984). The API®32A test accounts for 32 different biochemical tests and its advantage over the API®20A is the additional biochemical tests and a shorter turnover time, with a four-hour test compared to the twenty-four hours required by the API®20A test.

[0076] Fecal samples were collected from clinically healthy dogs (n=l 1) and cats (n=l 1). The ten- fold (from 10-1 to 10-8) dilution was plated on Brucella blood agar plates in anaerobiosis at 37°C (Anaerobe Systems, CA), and colonies morphologically similar to P. hiranonis were selected for further isolation, DNA extraction, and identification by quantitative PCR (qPCR) (AlShawaqfeh et al. 2017).

[0077] DNA extraction from P. hiranonis strains was performed as described by Dashti et al. (Dashti et al. 2009), and confirmation of P. hiranonis was conducted following the protocol described by AlShawaqfeh et al. 2017.

[0078] Canine (n=l 1) and feline-derived (n=l l) P. hiranonis strains were cultured in Brain Heart Infusion (BHI) broth in anaerobiosis at 37°C for 48 hours for the bile acid conversion assay. For the API® assay, P. hiranonis strains were cultured in Brucella blood agar plates in anaerobiosis at 37°C (Anaerobe Systems, CA) for 24 hours. A McFarland standard of 3 and 4 was used to prepare the inoculum for API® 20 A and API® 32A, respectively; and tests were performed following the manufacturer’s instructions. In summary, bacterial cells were harvested from Brucella blood agar plates and suspended in a suspension medium (bioMerieux). The API® strips, containing dehydrated substrates for the biochemical tests, were inoculated with the prepared bacterial suspension. The API® 20A test was incubated in anaerobiosis at 37°C for 24 hours, while the API® 32A test was incubated in aerobiosis at 37°C for 4 hours, following the manufacturer’s instructions. After incubation, results were observed by color changes in the API strips, and characterization of P. hiranonis biochemical profile was recorded.Table 3. Canine- and feline-derived P. hiranonis strains.

[0079] Using API® 20A to characterize P. hiranonis strains, positive reactions were observed on the acidification of broth through the utilization of glucose, saccharose, and mannose. Negative reactions were observed on utilization of lactose, maltose, salicin, xylose, arabinose, gelatinase, glycerol, cellobiose, esculin, melibiose, raffinose, rhamnose, trehalose; and production of indole, urease, catalase, and hydrogen sulfide (H2S). Variable results on utilization of mannitol and sorbitol were observed (Table 4).Table 4. Biochemical profiling of canine- (n=l 1) and feline-derived (n=l 1) P. hiranonis strains using API® 20A assayNote: POS: positive reaction. WR: weak positive reaction. NEG: negative reaction.

[0080] Using API® 32A to characterize P. hiranonis strains, positive reactions were observed in the production of N-Acetyl-Bglucosaminidase. Negative reactions were observed in the production of urease, a-galactosidase, B-galactosidase, B-galactosidase 6 phosphatase, a- glucosidase, B-glucosidase, a-arabinosidase, B-glucuronidase, mannose, raffinose, a- fucosidase, phenylalanine arylamidase, tyrosine arylamidase, glycine arylamidase, histidine arylamidase, glutamyl-glutamic acid arylamidase, and serine arylamidase. Variable results in the production of glutamic acid decarboxylase, leucine arylamidase, pyroglutamic acid arylamidase, arginine arylamidase, alanine arylamidase, alkaline phosphatase, leucyl-glycine arylamidase, arginine dihydrolase, indole, and proline arylamidase, and reduction of nitrates were observed (Table 5).Table 5. Biochemical profiling of canine- (n=l 1) and feline-derived (n=l 1) P. hiranonis strains using API® 32A assayNote: POS: positive reaction. WR: weak positive reaction. NEG: negative reaction.

[0081] These results demonstrate that P. hiranonis strains comprise biochemical phenotypes that may be used to characterize strains of the present invention. Furthermore, it provides an improved characterization of P. hiranonis strains cultured from fecal samples of dogs and cats, since limited data is available regarding biochemical profiling of this species. The carbohydrate and amino acid utilization by P. hiranonis strains allows for a better understanding of their metabolic capabilities and insights into the potential ecological niche occupied by P. hiranonis in the intestinal microbiome of dogs and cats. Finally, it provides the characterization of representative strains with detailed information on the biochemical phenotypes.Example 4Canine- and feline-derived Peptacetobacter hiranonis strains’ ability to convert primary into secondary bile acids

[0082] Cholic acid (CA) and chenodeoxycholic acid (CDCA) are generated in the liver through the catabolism of cholesterol. Subsequently, they are conjugated to the amino acids glycine and taurine by the enzyme amino acid N-acyltransferase. In dogs and cats, most bile acids are conjugated to taurine. Once conjugated, the bile acids are actively secreted from the liver, passing through the canicular membrane into the gall bladder, and ultimately into the intestinal lumen. Alongside dietary lipids and lipid- soluble nutrients, the bile acids form micellar structures that facilitate absorption by the enterocytes. This process is essential for the proper digestion and absorption of nutrients, reinforcing the maintenance of overall gastrointestinalhealth. Approximately 95% of the bile acids undergo reabsorption via the portal vein in a process referred to as enterohepatic circulation.

[0083] In the distal portion of the gastrointestinal tract, the microbiota plays a crucial role in two essential metabolic functions related to conjugated and unconjugated bile acids that escape reabsorption: the deconjugation of the glycine- and taurine-conjugated bile acids; and the conversion of primary to secondary fecal unconjugated bile acids. P. hiranonis and other species deconjugate glycine- and taurine-conjugated bile acids through the bile salt hydrolase activity - protein encoded by the choloylglycine hydrolase or bsh gene. However, only a few bacterial species have been identified as responsible for converting primary fecal unconjugated bile acids ( / .<?., CA and CDCA) into secondary fecal unconjugated bile acids, deoxycholic acid (DCA), and lithocholic acid (LCA) through the 7a-dehydroxylation pathway.

[0084] P. hiranonis is an anaerobic, spore-forming, and Gram-positive bacterium. P. hiranonis occupies a pivotal role in the conversion of primary to secondary fecal unconjugated bile acids through the 7 -dehydroxylation pathway. This conversion involves a multi-step biochemical pathway encoded by the bai operon. In brief, the primary fecal unconjugated bile acids enter the cell through a transporter encoded by the baiG gene. Subsequently, it is conjugated to coenzyme A (CoA) by a CoA-ligase encoded by the baiB gene. The fecal unconjugated bile acid, bound to the coenzyme A, undergoes oxidation by a dehydrogenase encoded by the baiA gene. Lastly, the baiH and baiCD encode the enzymes responsible for the dehydroxylation of those molecules.

[0085] The present example demonstrates the ability of certain isolated strains of P. hiranonis to convert primary fecal unconjugated bile acids (i.e., CA and CDCA) into secondary fecal unconjugated bile acids, deoxycholic acid (DCA), and lithocholic acid (LCA) through the 7a- dehydroxylation pathway.

[0086] Fecal samples were collected from clinically healthy dogs (n=l 1) and cats (n=l 1). The ten- fold (from 10'1to 10'8) dilution was plated on Brucella blood agar plates in anaerobiosis at 37°C (Anaerobe Systems, CA), and colonies morphologically similar to P. hiranonis were selected for further isolation, DNA extraction, and identification by quantitative PCR (qPCR).

[0087] DNA extraction from P. hiranonis strains was performed as described by Dashti et al. (2009), and confirmation of P. hiranonis’ 16S ribosomal RNA gene and P. hiranonis’ baiCD gene by qPCR was conducted following the protocol described by AlShawaqfeh et al. (2017)and Lopes el al. (2024), respectively. For the bsh gene, primers are described as follows: 5'- AGTCGTGGGATGGGAGGTAT-3' (forward), and 5'-TCTGCTGCTCAACAGATCCT -3' (reverse) (Table 6).

[0088] Canine (n=l l) and feline-derived (n=l l) P. hiranonis strains were cultured in Brain Heart Infusion (BHI) broth in anaerobiosis at 37°C for 48 hours for the bile acid conversion assay. For the bile acid conversion assay, 250 pl of P. hiranonis culture and 50 pl of cholic acid (10 mM) or chenodeoxycholic acid (10 mM) were added to 4.7 ml of BHI broth and incubated in anaerobiosis at 37°C for 24 hours.

[0089] For bile acid extraction from P. hiranonis culture, 100 pl was aliquoted into 2 ml tubes and removed from the anaerobic chamber for the extraction. A total amount of 300 pl methanol was added to the tubes containing 100 pl of the culture. The tubes were subjected to a shaking protocol using a bead beater and then centrifuged (16,000 g for 10 min at 4°C). After centrifugation, 200 pl were transferred to a new tube for an additional centrifugation step (10,000 g for 10 min at 4°C). Finally, 150 pl of the extracted material was used for bile acid quantification using liquid chromatography with tandem mass spectrometry (LC-MS / MS), after the addition of an internal standard for quality control and quantification.

[0090] Samples were placed in an autosampler (Agilent Infinity II Multisampler) for injection in the system. An automated online solid phase extraction system was coupled directly to the liquid chromatography-mass spectrometry instrument. The liquid chromatography system included an SPE column (Agilent Infinity Lab Poroshell 120 EC-C18 4.6 x 5 mm, 4 pm), analytical column (Agilent Infinity Lab Poroshell 120 EC-C18 2.1 x 100 mm, 2.7 pm), and 1260 and 1290 binary pumps (Agilent). The total run time for a sample injection was approximately 21 minutes. Data was collected on an Agilent 6470B triple quadrupole with Jet Stream ESI source in dynamic multiple reaction monitoring (dMRM) mode with positive / negative mode switching. Bile acids were quantitated using 15-point standard curves and internal standards d4-glycocholic acid and d4-glycolithocholic acid. Four other deuterated bile acids were used as retention time calibrators (d4-cholic acid, d4-lithocholic acid, d4- taurocholic acid, and d4-taurolithocholic acid).Table 6. Canine- and feline-derived P. hiranonis strains carrying the P. hiranonis’ bsh gene and bai operon were detected by qPCR and whole genome sequencing (WGS).P: present. A: absent

[0091] The assays described herein indicate that the isolated strains may vary in the expression of bile salt hydrolase activity. Furthermore, not all P. hiranonis strains comprise a complete bai operon and / or a bsh gene. If a strain carries both the bsh gene and a functional bai operon, when supplied with TCA or TCDCA, those bile acids would be expected to be deconjugated, and subsequently converted into secondary BA. Therefore, the variability observed is a sum of both bile salt hydrolase and 7-alpha dehydroxylation activities. P. hiranonis strains in which the bsh gene was not identified by WGS or qPCR did not deconjugate TCA and TCDCA into CA and CDCA. However, those strains that do not carry the bsh gene were able to convert when provided with media containing unconjugated bile acids (CA and CDCA) if they carried a functional bai operon (FIG. 1) (Table 7).

[0092] These assays also indicate that P. hiranonis strains vary in expressions of the bai operon when provided with unconjugated CA and CDCA, resulting in different bile acid conversion efficiency. Canine- and feline-derived P. hiranonis strains without the bai operon, confirmed by WGS and qPCR, did not produce DCA and LCA but rather used different pathways to produce other less-known subtypes of bile acids (FIG. 2).

[0093] These results demonstrate the variability in bile acid conversion ability among different P. hiranonis strains. Highlighting a unique ability found in some P. hiranonis strains to deconjugate taurine- and glycine-conjugated bile acids and convert primary into secondary bile acids. The ability convert primary into secondary bile acids in vitro is reflected by the in vivo bile acid conversion observed in patient 1 and 2. P. hiranonis strains containing both deconjugation and conversion activity and presenting the ability to colonize the gut of dogs and cats embody an ecological advantage compared to other P. hiranonis where deconjugation of conjugated bile acids was not observed and the in vivo ability of colonization was not assessed. P. hiranonis strains capable of converting primary bile acids, i.e., CA and CDCA, into secondary bile acids, i.e., DCA, LCA, and UDCA represent a beneficial role in the gut microbiome, e.g., these compounds are described as inhibiting the outgrow of C. difficile.Table 7. Summary of secondary bile acids obtained from P. hiranonis strains after incubation in anaerobiosis at 37°C for 24 hours with primary bile acids (CA and CDCA). This summary includes several secondary bile acid compounds, but is not limited.DCA: deoxycholic acid. LCA: lithocholic acid. HDCA: Hyodeoxycholic acid. UDCA: Ursodeoxycholic acid.GDCA: Glycodeoxycholic acidExample 5Protocol for Manufacturing Probiotic Compositions Comprising Lyophilized Peptacetobacter hiranonis

[0094] The following example describes the manufacture of probiotic compositions comprising lyophilized P. hiranonis strains that can be manufactured outside of an anaerobic chamber without significant loss in bacterial viability. Since this species is extremely sensitive to oxygen exposure, additional measures are necessary to keep P. hiranonis strains alive.

[0095] Exemplary media and buffers for manufacturing the probiotic compositions disclosed herein include Sterile Brain Heart Infusion Broth, Sterile PBS, and reconstituted skimmed milk powder (solution final concentration: 20%).

[0096] P. hiranonis was cultured in BHI broth in 4 tubes of 5 ml for 48 hours (starting culture) under anaerobic conditions. After 24 hours, 10 pl of P. hiranonis culture was inoculated into a Brucella Blood Agar plate to assess the purity of the P. hiranonis culture. 5 ml of P. hiranonis culture was transferred to a bottle containing 300 ml BHI. P. hiranonis was then cultured in 300 ml of BHI for 48 hours. The P. hiranonis culture was then distributed into 50 ml tubes for centrifugation and concentration of P. hiranonis cells.

[0097] The following steps may be performed outside of the anaerobic chamber. The 50 ml tubes containing the 48 hours P. hiranonis culture in BHI were carefully centrifuged, e.g., at 1800 x g for 20 min. The supernatant was then carefully discarded. Pellets containing P. hiranonis culture were carefully combined into two 50 ml tubes. 40 ml of PBS was added to the P. hiranonis pellet. The P. hiranonis cells and PBS were vortexed. The P. hiranonis cells and PBS were centrifuged again, and the supernatant was discarded. 10 ml of a cryoprotectant was then added to the pellet containing washed P. hiranonis, e.g., reconstituted 20% skimmed milk powder. The P. hiranonis cells and reconstituted cryoprotectant (skimmed milk powder) were mixed and vortexed. The solution was then frozen on an inclined surface at -80°C for 1hour. The solution containing P. hiranonis cells and reconstitute skimmed milk powder was lyophilized for at least 24 hours to ensure that the solution containing P. hiranonis cells and reconstitute skimmed milk powder is completely lyophilized. In this regard, lyophilization is directly affected by the surface area of the product to be lyophilized, therefore ensure surface to volume ratio is as high as possible.

[0098] Encapsulation of the lyophilized powder may be carried out using a pill machine as described herein or using similar techniques known in the art. In this example, a single pill fits approximately 100 mg of product containing P. hiranonis cells and cryoprotectant (skimmed milk powder) when using pills size 3 in the pill machine. The product containing P. hiranonis cells and skimmed milk powder inside of the pills is distributed in the pill, ensuring that the pills are full. For example, 10 ml of reconstituted skimmed milk powder added to P. hiranonis cells was found to typically yield approximately 15 pills containing 100 million P. hiranonis CFU / pill, as 10 ml of reconstituted skimmed milk powder contains two grams of skimmed milk powder and a single pill fits approximately 100 mg. If dilution of the lyophilized product is performed in a ratio of 1 :3 or 1:4, this protocol can yield approximately 50 to 100 pills.

[0099] Quantification of P. hiranonis was also performed. Quantification of one single pill can be defined through serial dilution of a pill and further plating into Brucella Blood Agar (<?.g., use 10sto 10'8for quantification) to estimate the dilution factor based on the quantification for the lyophilized P. hiranonis product. For example, to quantify the lyophilized P. hiranonis product, 900 pl of PBS was added to the content of a pill (approximately 100 mg); and a serial dilution was made using 1 ml (900 pl of PBS). The 10sto 10’8dilution from serial was plated for quantification into Brucella Blood Agar. It was found that 300 ml of culture will usually generate 100 million CFU / pill. For dilution of lyophilized P. hiranonis product, the skimmed milk powder in a ratio of 1:3 or 1:4 was used. Skimmed milk powder in a ratio defined by the concentration of the desired pill was added. For 10 million CFU / pill with skimmed milk powder a ratio of 1 :4 was used. For 20 million CFU / pill with skimmed milk powder a ratio of 1 :3 was used. Adjustments may be required based on the initial concentration of the pill. This correlation is not necessarily linear. As described herein, the pills containing lyophilized P. hiranonis can be manufactured outside of the anaerobic chamber without significant loss of viability.

[0100] These methods demonstrate the preservation of P. hiranonis viability in capsule formulations after exposure to oxygen. The methodology described combines intrinsic physicaland chemical characteristics of skimmed milk powder (e.g., protein stabilization relying on casein (the major protein present in milk)), osmotic protection relying on lactose and mineral components of milk, and reducing the formation of ice crystals responsible for bacterial cell membrane damage and bacterial cell lysis. In addition to the physical and chemical properties previously mentioned, the use of skimmed milk powder enhances the product's palatability for animals. Furthermore, the concentration of P. hiranonis through centrifugation enables the manufacture of highly concentrated pills, allowing for smaller pill sizes and reduced frequency of probiotic administration in dogs and cats.Example 6Administration of Probiotic Compositions to an Animal Following Antibiotic Treatment

[0101] Probiotic compositions as described herein were administered to patients to reduce and / or eliminate dysbiosis. The first patient (a cat) had been treated with cefovecin sodium antibiotic (long-acting injectable cephalosporin) in January 2023, and developed dysbiosis with loss of P. hiranonis. The patient remained dysbiotic for 8 months (FIG. 3). After a single dose of a probiotic composition comprising P. hiranonis strain CH5, colonization was restored, and DI normalized. Moreover, engraftment was persistent and the patient remained normal with respect to DI to date after receiving the probiotic composition. No side effects were observed (FIGS. 7-9).

[0102] Additionally, it was specifically confirmed that the P. hiranonis strain CH5 had successfully engrafted. In brief, it was found that the patient previously carried a bsh negative strain of P. hiranonis (before administration of the probiotic composition). Analysis of fecal samples 2 weeks post-probiotic confirmed the presence of P. hiranonis strain CH5 (bsh positive), therefore showing engraftment. Moreover, bile acid conversion was restored after probiotic administration (FIG. 4). Further investigation also revealed that other strict as well as facultative anaerobic bacteria were maintained within their reference intervals following administration of the P. hiranonis probiotic composition (FIG. 6A-C).

[0103] Fecal scores were also preserved following probiotic administration (FIG. 8). In brief, the fecal scores of all the fecal samples collected were defined based on the Purina® Fecal Scoring Chart (available on Purina Fecal Scoring Chart). The fecal scoring system acknowledges that changes in fecal consistency may reflect changes in the colon and other gastrointestinal-related problems. In general, a fecal score of 2 is considered normal and it iscommonly reported in healthy animals. Representative specimens and their corresponding scores are shown in FIG. 7.

[0104] Probiotic compositions as described herein were also administered to patients to reduce and / or eliminate dysbiosis following treatment with clindamycin. In particular, the second patient (a dog) had received treatment with clindamycin following a dental abscess, and remained dysbiotic with loss of P. hiranonis for two months (FIG. 9). The patient received 3 doses of a probiotic composition comprising P. hiranonis strain CH5. It was found BA conversion was restored after probiotic administration (FIG. 10). Moreover, no side effects were observed, and a small improvement in fecal scores i.e., “no longer leaving residue when feces were picked up”) was observed. Consistent with the results observed in the first patient, other strict as well as facultative anaerobic bacteria were maintained within their reference intervals following administration (FIG. 11A-C); and fecal scores were either preserved or improved following probiotic administration (FIG. 12).

[0105] These results thus demonstrate that administration of the probiotic compositions described herein, which comprise stable and viable P. hiranonis cells under aerobic conditions capable of converting primary bile acids into secondary bile acids, can reduce or eliminate dysbiosis, colonize the patients’ gut, restore bile acid conversion, and preserve or improve fecal scores. Furthermore, these beneficial effects can be achieved without the negative side effects and limitations associated with FMT.Example 7Administration of Probiotic Compositions to an Animal Following Antibiotic Treatment

[0106] Further experiments analogous to those described in Examples 1 -5 will be carried out in animals diagnosed with chronic enteropathies and dysbiosis. For example, dogs with evidence of CE and / or dysbiosis will be administered probiotic compositions described herein, which comprise stable and viable P. hiranonis cells. Samples will be collected from patients to determine the log DNA of P. hiranonis as well as the dysbiosis index at enrollment, preprobiotic administration, and post-probiotic administration.

[0107] It is anticipated that administration of the probiotic compositions described herein to patients experiencing chronic enteropathies and dysbiosis will yield a reduction or eliminationof dysbiosis, result in colonization of the patients’ gut, restore bile acid conversion, and / or preserve or improve fecal scores as seed in patients following antibiotic treatments.

[0108] All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit, and scope of the invention. All such variations and modifications apparent to those skilled in the art are deemed to be within the spirit, scope, and concept of the invention as defined by the appended claims.

Claims

CLAIMS1. A probiotic composition comprising at least one P. hiranonis bacterium and a carrier; wherein the P. hiranonis bacterium is capable of converting primary bile acids into secondary bile acids.

2. The probiotic composition of claim 1, wherein the P. hiranonis bacterium comprises bile acid deconjugation and 7-alpha-dehydroxylation activity.

3. The probiotic composition of claim 2, comprising a bsh gene and a bai operon.

4. The probiotic composition of claim 1, wherein the probiotic composition restores bile acid conversion in the gastrointestinal tract of an animal when administered to the animal.

5. The probiotic composition of claim 1 , wherein the delivery of the probiotic composition to the gastrointestinal tract of the animal reduces dysbiosis in the animal.

6. The probiotic composition of claim 1, wherein the at least one P. hiranonis bacterium comprises a nucleotide sequence having at least 95% sequence identity to a sequence selected from SEQ ID NOs: 1-173.

7. The probiotic composition of claim 1, wherein the at least one P. hiranonis bacterium comprises P. hiranonis strain CH5, a representative sample of said strain having been deposited under NRRL Accession No. B-68416.

8. The probiotic composition of claim 1, wherein the probiotic composition is encapsulated.

9. The probiotic composition of claim 8, wherein the composition comprises a concentration of the at least one P. hiranonis bacterium between about lxl07colony-forming units per capsule to about 8xl09colony-forming units per capsule.

10. A method for delivering probiotic composition to the gastrointestinal tract of an animal comprising providing a composition comprising at least one P. hiranonis bacterium and a carrier in the diet of the animal; wherein the P. hiranonis bacterium is capable of converting primary bile acids into secondary bile acids.

11. The method of claim 10, wherein the P. hiranonis bacterium comprises bile acid deconjugation and 7-alpha-dehydroxylation activity.

12. The method of claim 10, wherein the at least one P. hiranonis bacterium comprises P. hiranonis strain CH5, a representative sample of said strain having been deposited under NRRL Accession No. B-68416.

13. The method of claim 10, wherein the delivery of the probiotic bacteria to the gastrointestinal tract of the animal reduces dysbiosis in the animal.

14. The method of claim 10, wherein the animal is a dog, a cat, or a human.

15. The method of claim 10, wherein the composition comprises lyophilized P. hiranonis bacterium.

16. The method of claim 10, wherein the probiotic composition is encapsulated.

17. The method of claim 16, wherein the at least one P. hiranonis bacterium are provided in the diet of the animal between about IxlO7colony-forming units per capsule to about 8xl09colony-forming units per capsule.

18. The method of claim 10, comprising delivering the probiotic composition to an animal in dysbiosis.

19. The method of claim 18, wherein dysbiosis is characterized by chronic enteropathy.

20. The method of claim 10, wherein the probiotic composition is administered to the animal following antibiotic administration.

21. The method of claim 20, wherein the animal is in dysbiosis following antibiotic administration.

22. The method of claim 10, comprising delivering the probiotic composition to an animal to treat a C. difficile infection.

23. A method for lyophilizing P. hiranonis, the method comprising:(a) culturing P. hiranonis cells in a broth under anaerobic conditions;(b) centrifuging the P. hiranonis culture;(c) discarding the supernatant;(d)reconstituting the P. hiranonis cells with a cryoprotectant;(e) freezing the reconstituted P. hiranonis cells; and(f) lyophilizing the frozen reconstituted P. hiranonis cells; wherein the P. hiranonis cells are viable under aerobic conditions.

24. The method of claim 23, further comprising distributing the lyophilized reconstituted P. hiranonis cells in a capsule.

25. The method of claim 24, wherein the capsule comprises between about IxlO7colonyforming units per capsule and about 8xl09colony -forming units per capsule.

26. The method of claim 23, wherein: the broth is Brain Heart Infusion Broth (BHI); culturing the P. hiranonis cells is carried out for between about 24h and about 72h; the cryoprotectant is skimmed milk powder; or the P. hiranonis cells are washed with phosphate buffer saline prior to reconstituting with a cryoprotectant.