Probiotic lacticaseibacillus paracasei strains for use in treating obesity
Newly identified lactic acid bacterial strains and their extracts are used to treat obesity and cardiovascular disease by inducing adipolysis, addressing the lack of clinical treatments for lipid metabolism-related conditions and achieving substantial metabolic improvements.
Patent Information
- Application Number
- PCT/EP2025/064732
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-08-06
- Filing Date
- 2025-05-27
- Publication Date
- 2026-02-12
AI Technical Summary
There is insufficient understanding of the therapeutic potential of probiotic microorganisms like lactic acid bacteria, and there are no clinically approved treatments for conditions related to lipid metabolism, such as obesity and cardiovascular disease.
The use of newly identified lactic acid bacterial strains, such as Lactobacillus paracasei M2.1 and Lactobacillus paracasei P4, or their extracts, to induce adipolysis and treat conditions related to lipid metabolism, including obesity and cardiovascular disease, through peroral administration.
The strains and extracts effectively reduce intracellular lipid deposition, enhance glucose uptake, and induce weight loss, leading to significant improvements in lipid metabolism-related conditions.
Smart Images

Figure EP2025064732_12022026_PF_FP_ABST
Abstract
Description
[0001] Attorney Reference No: 6666-P004-SAR-PCT
[0002] TITLE: PROBIOTIC LACTIC ACID BACTERIA AND LIPID METABOLISM
[0003] INTRODUCTION
[0004] [1] Probiotics have been recognised as “live microorganisms which when administered in adequate amounts confer a health benefit on the host”. In the last few years, the use of probiotics has received increasing attention as basic scientific research continues to accumulate on the properties, functionality and beneficial effects of probiotic bacteria. The search for more new probiotics is driven by the growing demand for probiotic functional food, beverages and dietary supplements due to rising levels of health consciousness and growing consumer awareness regarding gut health and the concept of preventive health care. Lactic acid bacteria such as Lactobacillus, are the most commonly used microorganisms as probiotics - “Generally Recognized As Safe” (GRAS). Acidity, presence of bile salts, and pancreatic enzymes in the gastrointestinal tract (GIT) are some of the major stresses that an orally taken probiotic experiences in the GIT.
[0005] [2] The appropriate probiotics live microorganism selection and their regular consumption has long been recognised to aid balance gut microbiota, enhance gut barrier function, stimulate the immune response, reduce inflammation caused by pathogens, improve digestion and optimise nutrient absorption. In addition to these well-documented local benefits, increasing attention is now being directed toward the systemic effects of metabolic products absorbed from probiotic microorganisms. These systemic benefits have been hypothesised to include for example reduction of inflammation, cardiovascular health, liver disease, autoimmunity and certain types of tumour.
[0006] [3] The effect has been primarily determined by the resorbed metabolic products released during probiotic microorganism life cycle, such as peptides, enzymes, vitamins, and others, collectively known as postbiotics. A contemporary trend in nutrigenomics is the direct intake of postbiotics, specifically targeted at certain physiological pathways, rather than probiotics. The advantages of this approach include greater stability of postbiotics during storage and transport compared to live microorganisms; significantly faster impact, easier and more precise dosing, and strictly specific targeting of a particular health issue, with their effectiveness not dependent on the potential for microbial colonization — a limiting factor for probiotics. Postbiotics are the preferred choice for people with compromised immune systems or those undergoing serious medical interventions due to the existing risk of bacteremia and other infectious complications.
[0007] [4] It should be noted that different strains, even closely related ones, produce different postbiotics and, therefore, modulate physiological processes in the microorganism in a strictly specific manner. Uncovering new sources and strains and deepening knowledge in the field of postbiotic mediators suggests a path for developing pharmacological strategies to create personalised dietary supplements that meet specific needs. Attorney Reference No: 6666-P004-SAR-PCT
[0008] [5] However, there is still insufficient understanding of the beneficial effects let alone a practical realisation of the therapeutic potential of probiotic microorganisms such as Lactic acid bacteria. Moreover, there are no clinically approved treatments which rely on probiotic microorganisms such as lactic acid bacteria which are widespread and relied on as standard.
[0009] [6] The invention therefore relies on the experiments described herein and offers new means and tools for addressing at least some of the above described shortcomings.
[0010] SUMMARY OF THE PRESENT INVENTION
[0011] [7] According to the WHO, unhealthy diet, raised blood lipids, overweight and obesity are some of the most important risk factors leading to bad health, cardiovascular disease and increased morbidity and mortality.
[0012] [8] In most general terms, it can be stated that the present invention relates to the field of probiotics, especially lactic acid bacterial strains such as newly identified lactic acid bacterial isolates or extracts therefrom for use as active ingredients suitable for compositions of administration. The present invention also relates to use of these active ingredients for treatment, preventive and / or general beneficial or prophylactic effect or influence of subjects suffering with or affected by a condition, disease or syndrome caused by or associated with lipid metabolism such as impaired lipid metabolism. The invention also relates to a method to identify probiotic bacterial strains that affect lipid metabolism. The active ingredients of the present invention have in particular been shown to have an adipolysis effect.
[0013] [9] Thus, the present invention relates to new uses and treatment methods that alleviate, abrogate, or otherwise reduce, prevent or stop any one or more condition, disease or syndrome by administering a probiotic microorganism, including variants thereof, an extract or supernatant therefrom.
[0014]
[0010] In particular, the present invention relates to new uses and treatment methods that alleviate, abrogate, or otherwise reduce, prevent or stop any one or more symptoms or conditions by administering lactic acid bacteria, including variants thereof, an extract or supernatant therefrom.
[0015]
[0011] Specifically, the invention relates to new uses of clinically safe probiotic lactic acid bacteria, an extract or supernatant therefrom, for the treatment of metabolic abnormalities in a subject. Furthermore, the invention relates to new uses of clinically safe lactic acid bacteria, including variants thereof, an extract or supernatant therefrom, for the treatment of cardiovascular disease, adipogenesis or obesity in a subject. More in particular the present relates to new uses of clinically safe lactic acid bacteria, including variants thereof, an extract or supernatant therefrom for treating subjects suffering with or affected by for example abnormal lipid metabolism. Attorney Reference No: 6666-P004-SAR-PCT
[0016]
[0012] The present invention provides lactic acid bacteria, including variants thereof, or extract therefrom, for use in the treatment of cardiovascular disease, adipogenesis or obesity in a subject. The present invention provides also provided lactic acid bacteria or extract therefrom, for use in the treatment of cardiovascular disease, adipogenesis or obesity in a subject by inducing adipolysis in the subject.
[0017]
[0013] The present invention further provides provides a therapeutically effective amount of lactic acid bacteria, including variants thereof, or extract therefrom, for use in the treatment of cardiovascular disease, adipogenesis or obesity in a subject by inducing adipolysis in the subject.
[0018]
[0014] In one aspect, there is provided a method of inducing adipolysis in a subject, the method comprising administering a therapeutically effective amount of lactic acid bacteria or extract therefrom.
[0019]
[0015] In one aspect, there is provided a therapeutically effective mount of lactic acid bacteria or extract therefrom, for use in inducing adipolysis in a subject.
[0020]
[0016] In some embodiments, there is provided a therapeutically effective amount of lactic acid bacteria or extract therefrom, for use in the treatment of cardiovascular disease, adipogenesis or obesity in a subject. In some embodiments, there is provided a therapeutically effective amount of lactic acid bacteria or extract therefrom, for use in the treatment of cardiovascular disease, adipogenesis or obesity in a subject by inducing adipolysis in the subject.
[0021]
[0017] In some embodiments, the subject is administered with a therapeutically effective amount of lactic acid bacteria or extract therefrom. In some embodiments, the therapeutically effective amount is achieved by a regimen of administration of the of lactic acid bacteria or extract therefrom. In some embodiments, the regimen of administration of the of lactic acid bacteria or extract therefrom, is carried out using methods known in the art. In some embodiments, the regimen comprises one or more types of administration of the of lactic acid bacteria or extract therefrom. In some embodiments, the regimen of administration of the of lactic acid bacteria or extract therefrom, is suitable for peroral administration.
[0022]
[0018] In some embodiments, the regimen of administration of the of lactic acid bacteria or extract therefrom, comprises one or more of peroral administration. In some embodiments, the regimen of administration of the of lactic acid bacteria or extract therefrom, comprises two or more of peroral administrations. In some embodiments, the therapeutically effective amount of lactic acid bacteria extract comprises cell-free supernatant. In some embodiments, the therapeutically effective amount of lactic acid bacteria comprises viable cells. In some embodiments, the therapeutically effective peroral administration comprises a dose of the lactic acid bacteria or extract therefrom.
[0023]
[0019] In some embodiments, the dose of the lactic acid bacteria or extract therefrom may conveniently be presented in a single dose or as divided doses administered at appropriate intervals, for Attorney Reference No: 6666-P004-SAR-PCT example as two, three, four or more sub-doses per day or per administration. In some embodiments, the dose of the lactic acid bacteria or extract therefrom, will typically be in the range of about 2 to about 2000 mg / ml per administration, dependent upon the route of administration.
[0024]
[0020] In some embodiments, the dose of the lactic acid bacteria or extract therefrom per administration will typically be in the range of about 0.1 to 2000 mg / kg of body weight, about 0.15 to 1750 mg / kg of body weight, about 0.2 to 1700 mg / kg of body weight, about 0.3 to 1500 mg / kg of body weight, about 0.5 to 1250 mg / kg of body weight, about 1 to 1000 mg / kg of body weight, about 2 to 900 mg / kg of body weight, about 3 to 800 mg / kg of body weight, about 4 to 700 mg / kg of body weight, about 5 to 600 mg / kg of body weight, about 10 to 500 mg / kg of body weight, administered as one, two, three, four or more doses or sub-doses per day or per administration.
[0025]
[0021] In some embodiments, the dose is 400 mg / kg of body weight administered as one, three, four or more doses or sub-doses per day or per administration. In some embodiments, the lactic acid bacteria or extract therefrom is adapted for peroral administration. In some embodiment, where the substance is adapted for peroral administration, a daily dose will typically be within the range of about 10 to 1500 pg / kg of body weight, about 20 to 1250 pg / kg of body weight, about 30 to 1000 pg / kg of body weight, about 500 to 750 pg / kg of body weight. In some embodiments, the peroral administration daily dose is 400 pg / kg of body weight.
[0026]
[0022] In some embodiments, the therapeutically effective peroral administration comprises a dose of the lactic acid bacteria or extract therefrom in the range of about 1 to 500 mg / ml, about 5 to 250 mg / ml, about 10 to 200 mg / ml, about 20 to 150 mg / ml, about 50 to 100 mg / ml per administration. In some embodiments, the therapeutically effective peroral administration comprises a daily dose of lactic acid bacteria or extract therefrom in the range of about 10 to 1500 mg, about 50 to 1250 mg, about 100 to 1000 mg, about 200 to 750 mg per administration. In some embodiments, the peroral administration daily dose of lactic acid bacteria or extract therefrom is 1000 mg per administration.
[0027]
[0023] In some embodiments, the lactic acid bacteria is selected from genus of Lactobacillus, Bifidobacteria and Streptococcus. In some embodiments, the lactic acid bacteria is selected from Lactobacillus paracasei, Lactobacillus delbrueckii, Lactobacillus acidophilus, Lactobacillus brevis, Lactobacillus buchneri, Lactobacillus casei, Lactobacillus curvatus, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus helveticus, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus sakei, or Lactobacillus salivarius or combinations thereof. In some embodiments, the lactic acid bacteria is selected from Lactobacillus paracasei M2.1 (accession No. 507616) or Lactobacillus paracasei P4 (accession No. 507615 / Attorney Reference No: 6666-P004-SAR-PCT
[0028]
[0024] In some embodiments, the regimen of administration of lactic acid bacteria or extract therefrom, leads to regression in white adipose tissue. In some embodiments, the regimen of peroral administration of lactic acid bacteria or extract therefrom reduces intracellular lipid deposition.
[0029]
[0025] In some embodiments, the accumulation of intracellular lipid deposition is reduced by at least 0.5%, at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more. In some embodiments, the lactic acid bacteria or extract therefrom reduces the size of white adipose cells. In some embodiments, the size of the adipose cells is reduced by at least 0.5%, at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more.
[0030]
[0026] In some embodiments, the lactic acid bacteria or extract therefrom reduces leads to an increase in brown adipose cells. In some embodiments, the increase in brown adipose cells is by at least 0.5%, by at least 1%, by at least 5%, by at least 10%, by at least 20%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 80%, by at least 90% or more.
[0031]
[0027] In some embodiments, the lactic acid bacteria or extract therefrom leads to at least 10% remission of adipose gain, at least 12% remission of adipose gain, at least 14% remission of adipose gain, at least 16% remission of adipose gain, at least 18% remission of adipose gain, at least 20% remission of adipose gain, at least 30% remission of adipose gain or more.
[0032]
[0028] In some embodiments, the lactic acid bacteria or extract therefrom leads to weight loss. In some embodiments, the lactic acid bacteria or extract therefrom leads to at least 0.5%, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10% or more enhancement in weight loss. In some embodiments, the lactic acid bacteria or extract therefrom leads to a statistically significant weight loss. In some embodiments, the lactic acid bacteria or extract therefrom, the lactic acid bacteria or extract therefrom leads to increase in glucose uptake.
[0033]
[0029] In an aspect of the present invention, there is provided lactic acid bacteria extract as described herein.
[0034]
[0030] In an aspect of the present invention, there is provided a composition comprising the lactic acid bacteria as described herein and / or the lactic acid bacteria extract as described herein. In some embodiments, there is provided an adipolysis composition comprising the lactic acid bacteria described herein and / or the lactic acid bacteria extract as described herein. In some embodiments, the at least one lactic acid bacteria as described herein is in a dosage regimen encapsulated from.
[0035]
[0031] In an aspect of the present invention there is provided a lactic acid bacteria, wherein the lactic bacterial strain is at least one selected from Lactobacillus paracasei isolate M2.1 (Accession No. 507616) Attorney Reference No: 6666-P004-SAR-PCT or Lactobacillus paracasei P4 (Accession No. 507615), wherein optionally the bacterial strain is associated with acceptable carrier or delivery vehicle and optionally adjuvant within a single composition or separate compositions comprising a mixture of distinct bacterial strains or combinations thereof.
[0036]
[0032] In an aspect of the present invention there is provided kit comprising lactic acid bacteria or extract therefrom, or a composition and a food product, in particular dairy product, and optionally a leaflet of instructions for administration to a host in need thereof.
[0037]
[0033] In an aspect of the present invention there is provided a method of identifying microorganisms that affect adipocyte metabolism, the method comprising the steps of: a. preparing microbial supernatant; b. exposing adipocytes to microbial supernatant; and c. testing for adipolysis.
[0038]
[0034] In some embodiments, the step of testing for adipolysis comprises determining concentration of glycerol and / or glucose in adipocyte supernatant.
[0039] BRIEF DESCRIPTION OF THE DRAWINGS
[0040]
[0035] FIG. 1. Graph showing assessment of cell viability in mature 3T3-L1 cell, treated with 10% cell-free supernatants from L. paracasei M2.1 or L. paracasei P4 strains, using MTT assay: FIG. 1 (a) microscopic images of the cell layer integrity after 24 hours of treatment (magnification 4x; Bars = 500pm); FIG. 1 (b) Relative cell viability effect (MTT assay) in percentages compared to MRS group.
[0041]
[0036] FIG. 2. Graph showing intracellular lipid accumulation. FIG. 2 (a) Effect of L. paracasei M2.1 or L. paracasei P4 strains LBS supernatants on the intracellular neutral lipid accumulation in mature 3T3-L1 cells. FIG. 2 (b) microscopic cell culture images, stained with Oil Red O (magnification 20x and 40x, bars: 100pm and 50pm magnification, respectively as shown in images).
[0042]
[0037] FIG. 3. Graphs showing glucose update / uptake and lipolysis. FIG. 3 (a) Assessment of glucose update / uptake after 24 hours of treatment of mature 3T3-L1 adipocytes with 10% supernatants from L. paracasei M2.1 or L. paracasei P4 strains. FIG. 3 (b) lipolysis rate after 24 hours of treatment of mature 3T3-L1 adipocytes with 10% supernatants from L. paracasei M2.1 or L. paracasei P4 strains.
[0043]
[0038] FIG. 4. Graphs showing effect of bacterial supernatant on in vitro gene expression. The effect of LBS supernatants obtained from L. paracasei M2. 1 or L. paracasei P4 strains, on the relative gene expression of: FIG. 4 (a) carnitine palmitoyltransferase la (Cptl); FIG. 4 (b) carnitine palmitoyltransferase 2 (Cpt2); FIG. 4 (c) acyl-Coenzyme A oxidase 1, palmitoyl (Acoxl); FIG. 4 (d) acetyl-CoA carboxylase (Acaca); FIG. 4 (e) fatty acid synthase (Fasn); FIG. 4 (f) perilipin 1 (Plinl); FIG. 4 (g) patatin-like Attorney Reference No: 6666-P004-SAR-PCT phospholipase domain containing 2 (Pnpla2); FIG. 4 (h) fatty acid-binding protein 4 (Fabp4); and FIG. 4 (i) adiponectin receptor 1 (Adipo).
[0044] DETAILED DESCRIPTION OF THE INVENTION
[0045]
[0039] Throughout this disclosure, various scientific publications, patents and published patent application or granted patents are referenced by an identifying citation or number. The disclosures of these publications, patents and published patent application or granted patents are hereby incorporated by reference into the present disclosure to more fully describe the state of the art and field to which this present disclosure and intention pertains.
[0046]
[0040] As used herein, certain terms may have the following defined meanings unless stated otherwise.
[0047]
[0041] As used in the specification and claims, the singular form “a,” “an” and “the” include singular and plural references unless the context clearly dictates otherwise. For example, the term “microorganism”, “probiotic microorganism”, “lactic acid bacteria”, “extract therefrom” or “supernatant therefreom”, includes a single or plurality of microorganisms, probiotic microorganism, lactic acid bacteria, or extracts from the microorganisms, from the probiotic microorganism or from the lactic acid bacteria such as newly identified lactic acid bacterial isolates. In some embodiments the microorganism is Lactobacillus paracasei M2.1 (accession No. 507616 In some embodiments the microorganism is Lactobacillus paracasei P4 (accession No. 507615 / In some embodiments the extract is from the microorganism Lactobacillus paracasei M2.1 (accession No. 507616 / In some embodiments the extract is from the microorganism Lactobacillus paracasei P4 (accession No. 507615 /
[0048]
[0042] The lactic acid bacterial strains such as newly identified lactic acid bacterial isolates or extracts therefrom can be referred herein as or represent an active ingredient of the present invention. The lactic acid bacterial strains such as newly identified lactic acid bacterial isolates or extracts therefrom as described herein can represent active ingredients of the present invention which are suitable of administration. The lactic acid bacterial strains such as newly identified lactic acid bacterial isolates or extracts therefrom can be referred herein as or represent active ingredients suitable for inclusion in compositions or combinations suitable for administration. The lactic acid bacterial strains such as newly identified lactic acid bacterial isolates or extracts therefrom can be referred herein as or represent active ingredients suitable for inclusion in compositions or combinations suitable for therapeutic uses or methods. The lactic acid bacterial strains such as newly identified lactic acid bacterial isolates or extracts therefrom can be referred herein as or represent active ingredients suitable for inclusion in compositions or combinations suitable for therapeutic treatment uses or methods. The lactic acid bacterial strains such as newly identified lactic acid bacterial isolates or extracts therefrom can be referred herein as or represent active ingredients suitable for inclusion in compositions or combinations suitable for in vitro such as tissue culture uses or analytical methods. Attorney Reference No: 6666-P004-SAR-PCT
[0049]
[0043] All numbers or numerals as used herein that indicate amounts, ratios of materials, physical properties of materials, and / or use are to be understood as modified or qualified by the term "about," except as otherwise explicitly indicated.
[0050]
[0044] As used herein, the term "about" includes the recited number or number and + / - 10% from the recited numeral or number. By way of non-limiting example, the term "about ten (10)" would encompass nine (9) to eleven (11) or 9-11.
[0051]
[0045] The term “adipolysis”, “lipolysis” and “lipidolysis” are used interchangeably and refer to breakdown, metabolism, digestion of fat molecules or sugar molecules or movement of fat molecules or sugar molecules in and / or out of cells such as fat cells or adipocytes. In some embodiments, as contemplated in the present invention, adipolysis can lead to reduction or shrinkage of cells such as fat cells or adipocytes. In some embodiments, as contemplated in the present invention, adipolysis can lead to the reduction of fat such as fatty acids or weight loss (fat molecules moving out of cells such as fat cells or adipocytes or increase in the breakdown or metabolism of fat molecules in cells such as fat cells or adipocytes). In some embodiments, as contemplated in the present invention, adipolysis can lead to reduction or shrinkage of fat cells and preferably fatty acids or lipid molecules such as for example LDL and HDL. In some embodiments, as contemplated in the present invention, adipolysis can lead to increase in cell uptake of sugar molecules such as glucose (sugar molecules, such as glucose, moving into cells such as fat cells or adipocytes also referred to as glucose uptake by cells such as fat cells or adipocytes).
[0052]
[0046] As used herein, the term “subject” means any animal, such as a vertebrate, preferably a mammal such as human, to whom will be or has been administered lactic acid bacteria, extract therefrom or compositions according to embodiments of the invention. Preferably, a subject is in need of, or has been the object of observation or experiment of, treatment or prevention of inflammation, cardiovascular abnormality, heart disease, liver disease, autoimmunity or abnormal lipid metabolism. Preferably, a subject is in need of, or has been the object of observation or experiment of, treatment or prevention of cardiovascular abnormality. Preferably, a subject is in need of, or has been the object of observation or experiment of, treatment or prevention of weight gain.
[0053]
[0047] As used herein the term “probiotic” refers to a bacterial strain such as lactic acid bacterial strain or isolate, including variants thereof, or extract therefrom or combination thereof, with the capability of exerting a beneficial effect on the subject to which they are administered or applied, preferably a beneficial effect on the health status. Probiotics are organisms, which when they are administered to a subject, especially but not exclusively as a food ingredient confer a health benefit to the host such as a subject. The beneficial effects may be achieved through interactions of the bacterial strain or combination thereof in the context of the invention, with the microbiota of the host to which they are administered or applied. Attorney Reference No: 6666-P004-SAR-PCT
[0054] Accordingly, the “probiotic” feature used as an adjective to qualify the bacterial strain, active ingredient, composition, and other food or compositions described herein, means that the same has the intended functionality encompassed by the “probiotic” definition.
[0055]
[0048] As used herein, the term “treatment” or “treating” refers to an amelioration, prophylaxis, or reversal of a disease, condition, syndrome or disorder, or of at least one discernible symptom thereof. It is also contemplated that the treatment, as described herein throughout and based on data, leads to one or more of clinical improvement, reduction in the severity of disease and reduction in weight in a patient. In some embodiments, “treatment” or “treating” refers to an amelioration, prophylaxis, or reversal of at least one measurable physical parameter related to the disease, condition, syndrome or disorder being treated, not necessarily discernible in or by the subject. In some embodiments, “treatment” or “treating” refers to inhibiting or slowing the progression of a disease or disorder, either physically, e.g., stabilisation of a discernible symptom, physiologically, e.g., stabilisation of a physical parameter, or both. In some embodiments, “treatment” leads to partial or complete remission of the disease or disorder. In some embodiments, “treatment” leads to reduction of intracellular lipid deposition. In some embodiments, “treatment” leads to regression in white adipose tissue. In some embodiments, “treatment” leads to reduces intracellular lipid deposition. In some embodiments, “treatment” leads to reduction in the size of white adipose cells. In some embodiments, “treatment” leads to increase in brown adipose cells. In some embodiments, “treatment” leads to clinical improvement in a subject suffering with overweight. In some embodiments, “treatment” leads to weight loss. In some embodiments, “treatment” leads to increase in glucose uptake such as cellular increase in glucose uptake. In some embodiments of the present invention, “treatment” leads to reduced intracellular lipid deposition. In some embodiments of the present invention, intracellular lipid deposition is reduced by at least 0.5%, at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more. In some embodiments of the present invention, the size of the adipose cells is reduced by at least 0.5%, at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more. In some embodiments of the present invention, the increase in brown adipose cells is by at least 0.5%, by at least 1%, by at least 5%, by at least 10%, by at least 20%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 80%, by at least 90% or more. In some embodiments, the present invention leads to at least 10% remission of adipose gain, at least 12% remission of adipose gain, at least 14% remission of adipose gain, at least 16% remission of adipose gain, at least 18% remission of adipose gain, at least 20% remission of adipose gain, at least 30% remission of adipose gain or more. In some embodiments, the present invention leads to at least 0.5%, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10% or more enhancement in weight loss. Attorney Reference No: 6666-P004-SAR-PCT
[0056]
[0049] Without wishing to be bound by theory, elevated blood levels of different markers such as biomarkers for example lipid metabolism markers, inflammatory markers, CBC markers and predictive markers have been associated with disease state prognosis and diagnosis, such as for example lipid metabolism markers, inflammation, cardiovascular disease (CVD) or abnormality, heart disease, liver disease, autoimmunity or tumour. As used herein the term “marker” refers to a predictive, prognostic or diagnostic marker such as a biomarker or indicator. Example markers include metabolic markers such as lipid metabolism markers for instance fatty acids such as LDL and HDL, protein-based biomarkers such as troponin and N-terminal pro-B-type natriuretic peptide (NT-proBNP), C reactive protein, weight loss, glucose and glycerol and others. In some embodiments of the present invention, markers are selected from the group consisting of metabolic markers such as lipid metabolism markers for instance fatty acids such as LDL and HDL, protein-based biomarkers such as troponin and N-terminal pro-B-type natriuretic peptide (NT-proBNP), C reactive protein, weight loss, glucose and glycerol and others. In some embodiments, the predictive marker is at least one selected from weight loss, glucose and glycerol. In some embodiments, the predictive marker is glucose. In some embodiments of the present invention, “treatment” leads to reduction of one or more predictive markers selected from the group consisting of C reactive protein; weight loss, glucose and glycerol. In some embodiments of the present invention, “treatment” leads to reduction of a predictive marker selected from C reactive protein; weight loss, glucose and glycerol. In some embodiments of the present invention, “treatment” leads to weight loss. In some embodiments of the present invention, “treatment” leads to statistically significant weight loss. In some embodiments the biomarker is a fatty acid. In some embodiments the biomarker is the fatty acid LDL. In some embodiments the biomarker is the fatty acid HDL. In some embodiments the biomarker is the fatty acid is LDL and HLD.
[0057]
[0050] The present invention relates to new uses and treatment methods that alleviate, abrogate, or otherwise reduce or cure any one or more symptoms caused by or associated with lipid metabolism, such as abnormal lipid metabolism, by administering or applying lactic acid bacteria or extract therefrom. In some embodiments of the present invention, administering or applying lactic acid bacteria or extract therefrom can alleviate, abrogate, or otherwise reduce or cure any one or more symptoms caused by or associated with lipid metabolism, such as abnormal lipid metabolism.
[0058]
[0051] While the emphasis of the present disclosure resides with subjects, those of skill in the art will readily recognise that the present invention is also equally applicable and effective to non-human subjects (i.e. vertebrate animals) such as, for example, livestock (e.g. cattle, horses and sheep), exotic animals (e.g. pandas, big cats such as tigers, lions and pumas, elephants, bats and similar animals) and also companion animals (such as dogs and cats), particularly where a disease or condition is associated with or caused by lipid metabolism such as abnormal lipid metabolism. Attorney Reference No: 6666-P004-SAR-PCT
[0059]
[0052] In one aspect of the present invention, there is provided a method of inducing adipolysis in a subject. In one aspect of the present invention, there is provided a method of inducing adipolysis in a subject, the method comprising administering a therapeutically effective amount of lactic acid bacteria or extract therefrom.
[0060]
[0053] In some embodiments of the present invention, there is provided a therapeutically effective mount of lactic acid bacteria or extract therefrom, for use in inducing adipolysis in a subject.
[0061]
[0054] In some embodiments of the present invention, there is provided a therapeutically effective amount of lactic acid bacteria or extract therefrom, for use in the treatment of cardiovascular disease, adipogenesis or obesity in a subject. In some embodiments, there is provided a therapeutically effective amount of lactic acid bacteria or extract therefrom, for use in the treatment of cardiovascular disease, adipogenesis or obesity in a subject by inducing adipolysis in the subject.
[0062]
[0055] The present inventors surprisingly discovered that administering or applying lactic acid bacteria or extract therefrom would treat a disease or condition caused by or associated with lipid metabolism, such as abnormal lipid metabolism. The present inventors also observed that administering or applying lactic acid bacteria or extract therefrom would lead to amelioration, prophylaxis, or reversal of a disease or disorder, or of at least one discernible symptom thereof, caused by or associated with lipid metabolism, such as abnormal lipid metabolism. In particular, the present inventors surprisingly and unexpectedly observed that administering or applying lactic acid bacteria or extract therefrom as described herein induced adipolysis in a subject.
[0063]
[0056] It would be known by those of skill in the art that probiotic microorganisms, such as lactic acid bacteria, involve genuses of bacteria: Lactobacillus, Bifidobacterium, Lactococcus, Bacillus, and Streptococcus. In each of these three genuses of bacteria, there are multiple known species and subspecies. It would also be appreciated by those of skill in the art there are also a plurality of unknowns and thus uncharacterised probiotic microorganisms. Examples of known lactic acid bacteria include Lactobacillus paracasei, Lactobacillus delbrueckii, Lactobacillus acidophilus, Lactobacillus brevis, Lactobacillus buchneri, Lactobacillus casei, Lactobacillus curvatus, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus helveticus, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus sakei, or Lactobacillus salivarius or combinations thereof. Other examples of known lactic acid bacteria include Bifidobacterium longus, Bifidobacterium lactis, Bifidobacterium bifidum and Bifidobacterium breve. Other examples of known lactic acid bacteria include Streptococcus thermophilus.
[0064]
[0057] The present invention is directed to a new lactic acid bacterial strain Lactobacillus paracasei isolate M2.1 (Accession No. 507616). The present invention is directed to a new lactic acid bacterial strain Lactobacillus paracasei isolate M2.1 (Accession No . 507616), including variants thereof. In one aspect, the Attorney Reference No: 6666-P004-SAR-PCT present invention provides a lactic acid bacterial strain as deposited with the National Bank for Industrial Microorganisms and Cell Cultures in Sofia, Bulgaria on DATE Lactobacillus paracasei isolate M2.1 (Accession No. 507616
[0065]
[0058] The present invention is directed to a new lactic acid bacterial strain Lactobacillus paracasei P4 (Accession No. 507615 The present invention is directed to a new lactic acid bacterial strain Lactobacillus paracasei P4 (Accession No. 507615 / including variants thereof. In one aspect, the present invention provides a lactic acid bacterial strain as deposited with the National Bank for Industrial Microorganisms and Cell Cultures in Sofia, Bulgaria on DATE Lactobacillus paracasei P4 (Accession No. 507615 /
[0066]
[0059] Different strains of Lactobacillus paracasei have different morphologies. By way of example, some are straight, some are curved, some a single cell, some are in pairs or lines of three. The cell morphology of Lactobacillus paracasei isolate M2.1 and Lactobacillus paracasei P4 is long with an average length of about 12 pm to about 20 pm. Lactobacillus paracasei isolate M2.1 and Lactobacillus paracasei P4 commonly occur in short chains of two or three straight rods that are attached together.
[0067]
[0060] The invention therefore relates to lactic acid bacterial strain or combination of bacterial strains, wherein the lactic bacterial strain or isolate or at least one bacterial strain or isolate is selected from the group consisting of: Lactobacillus paracasei isolate M2.1 and Lactobacillus paracasei isolate P4, whose genome has at least 95% or more Average Nucleotide Identity (ANI) with SEQ ID NO: 1 (Carnitine palmitoyltransferase la), SEQ ID NO: 2 (Carnitine palmitoyltransferase 2), SEQ ID NO: 3 (Acetyl-CoA carboxylase), SEQ ID NO: 4 (Fatty acid synthase), SEQ ID NO: 5 (Patatin-like phospholipase domain containing 2), SEQ ID NO: 6 (Perilipin 1), SEQ ID NO: 7 (Fatty acid-binding protein 4), SEQ ID NO: 8 (Acyl-Coenzyme A oxidase 1, palmitoyl), SEQ ID NO: 9 (Adiponectin), SEQ ID No: 10 ((3-actin ) and SEQ ID NO: 11 (Hypoxanthine guanine phosphoribosyl transferase) of Lactobacillus paracasei isolate M2.1 identified by Accession Number No. 1507616 deposited at the CABI Biosciences, UK Centre (IMI) Bakeham Lane, Enfield Green, Egham, Surrey TW20 9TY, England and Lactobacillus paracasei isolate P4 identified by Accession Number No. 507615 deposited at the CABI Biosciences, UK Centre (IMI) Bakeham Lane, Enfield Green, Egham, Surrey TW20 9TY, England whose genome has at least 95% or more Average Nucleotide Identity (ANI) with SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID No: 10 and SEQ ID NO: 11. The selected sequences for analysis such as different housekeeping genes and particular target genes are depicted in Table 1.
[0068]
[0061] The expressions “16S rRNA” and “ 16S rDNA” are used interchangeably herein.
[0069]
[0062] The expressions “14S rRNA” and “14S rDNA” are used interchangeably herein. Attorney Reference No: 6666-P004-SAR-PCT
[0070]
[0063] Average Nucleotide Identity (ANI) value can be readily determined by the skilled person using common knowledge and available tools, which are well detailed in the literature. The ANI between two genomes, especially prokaryotic genomes, is commonly known as a taxonomic method for classification that emerged in the era of genomics. Before that, DNA-DNA hybridization (DDH) was used for nearly 50 years as a standard for prokaryotic species circumscriptions at genomic level. Other methods are available as well, some of which are also detailed in the present application, including in the Experimental Section, such as 16S rRNA gene sequence similarity and other housekeeping and target genes. Present description also provides bibliographic references regarding implementation of the 16S rRNA gene sequence similarity method, in addition to the guidance provided herein, which can be used as guidelines by the skilled person.
[0071]
[0064] Software tools for carrying out the Average Nucleotide Identity (ANI) method and calculating an ANI value are also readily accessible to the skilled person: they can in particular be freely accessible over the internet. An example can be found at https: / / www.ezbiocloud.net / tools / ani. The literature provides details regarding available tools. In particular, identity percentages can conventionally be calculated through local, preferably global, sequence alignment algorithms and their available computerized implementations. In a most preferred embodiment, identity percentages are calculated over the entire length of the compared sequences, which may be the entire genomes of the compared strains. Global alignments, which attempt to align every residue in every sequence, are most useful when the sequences in the query set are similar and of roughly equal size. Computerized implementations of the algorithms used are generally associated with default parameters in the literature, which can be used for running said algorithm. The skilled person can readily adapt the same, taking into consideration its objective or the sequences comparison made.
[0072]
[0065] Whatever the algorithm used by the skilled person, it is however admitted that an ANI value of 95% is an appropriate cut-off value for distinguishing between two different species, i.e., for classifying the genome of the lactic acid bacterial strain or isolate whose classification is sought, within an existing species (as annotated in publicly available databases) or to define anew, unknown to date lactic acid bacterial species or isolate.
[0073]
[0066] As used in the present invention, a therapeutically effective amount of probiotic such as lactic acid bacteria or extract therefrom can be selected from the group consisting of Lactobacillus, Bifidobacterium, Lactococcus, Bacillus and Streptococcus . The therapeutically effective amount of lactic acid bacteria or extract therefrom can be selected from Lactobacillus paracasei, Lactobacillus delbrueckii, Lactobacillus acidophilus, Lactobacillus brevis, Lactobacillus buchneri, Lactobacillus casei, Lactobacillus curvatus, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus helveticus, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus sakei, Lactobacillus salivarius, Bifidobacterium longus, Bifidobacterium lactis, Bifidobacterium bifidum and Bifidobacterium breve, Streptococcus thermophilus, or Attorney Reference No: 6666-P004-SAR-PCT combinations thereof. In particular, the therapeutically effective amount of lactic acid bacteria or extract therefrom can be selected from Lactobacillus paracasei isolate M2.1 and Lactobacillus paracasei P4 or combinations thereof. In some embodiments, the therapeutically effective amount of probiotic such as lactic acid bacteria or extract therefrom comprises viable cells. In some embodiments, the therapeutically effective amount of lactic acid bacteria extract comprises cell -free supernatant.
[0074]
[0067] As used herein the term “regimen” refers to a plan or a set of rules of different possible routs or modes of administration, preferably to achieve a therapeutically effective amount of probiotic such as lactic acid bacteria or extract therefrom in a subject. Preferably the regimen comprises lactic acid bacteria or extract therefrom selected from the group consisting of Lactobacillus, Bifidobacterium, Lactococcus, Bacillus and Streptococcus. Preferably the regimen comprises lactic acid bacteria or extract selected from the group consisting of Lactobacillus paracasei, Lactobacillus delbrueckii, Lactobacillus acidophilus, Lactobacillus brevis, Lactobacillus buchneri, Lactobacillus casei, Lactobacillus curvatus, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus helveticus, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus sakei, Lactobacillus salivarius, Bifidobacterium longus, Bifidobacterium lactis, Bifidobacterium bifidum and Bifidobacterium breve, Streptococcus thermophilus or combinations thereof as administered in a subject. Preferably the regimen comprises lactic acid bacteria or extract therefrom selected from Lactobacillus paracasei isolate M2.1 and Lactobacillus paracasei P4 or combinations thereof, administered in a subject.
[0075]
[0068] As used herein the term “extract”, “supernatant” or “lysate” are used interchangeably and refer to a mixture of biomolecules, metabolites, hormones, microbial antigens or peptides derived or obtained from different live or viable, non-live or non-viable, inactivated, disrupted or disintegrated microbes such as probiotic or lactic acid bacteria. Biomolecules, metabolites, microbial antigens or peptides are obtained by either chemical or mechanical lysis of microorganisms and their extract collected from culturing microbial strains. In some embodiment, the microorganism extract employed in the present method is obtained from at least one microorganism. The microorganism extract can be derived from lactic acid bacteria. The extract can be derived from lactic acid bacteria or extract therefrom selected from Lactobacillus paracasei, Lactobacillus delbrueckii, Lactobacillus acidophilus, Lactobacillus brevis, Lactobacillus buchneri, Lactobacillus casei, Lactobacillus curvatus, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus helveticus, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus sakei, Lactobacillus salivarius, Bifidobacterium longus, Bifidobacterium lactis, Bifidobacterium bifidum and Bifidobacterium breve, Streptococcus thermophilus. In some embodiments, the extract is derived from Lactobacillus paracasei, Lactobacillus delbrueckii, Lactobacillus acidophilus, Lactobacillus brevis, Lactobacillus buchneri, Lactobacillus casei, Lactobacillus curvatus, Lactobacillus Attorney Reference No: 6666-P004-SAR-PCT delbrueckii, Lactobacillus fermentum, Lactobacillus helveticus, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus sakei, Lactobacillus salivarius, Bifidobacterium longus, Bifidobacterium lactis, Bifidobacterium bifidum and Bifidobacterium breve, Streptococcus thermophilus. The extract can be derived from Lactobacillus paracasei isolate M2.1. The extract can be derived from Lactobacillus paracasei P4. In some embodiments, the extract is derived from Lactobacillus paracasei isolate M2.1. In some embodiment, the extract is derived from Lactobacillus paracasei P4. In some embodiments, the extract comprises cell- free supernatant. In some embodiments, the extract comprises viable cells. In some embodiments, the extract comprises non-viable cells.
[0076]
[0069] Although the inventors do not wish to be bound by theory, it is believed that the present invention may benefit from the quorum sensing capabilities of the microorganisms such as lactic acid bacteria.
[0077]
[0070] It would be known to those of skill in the art that different regimens may be employed in the context of the present invention.
[0078]
[0071] As used herein the term “administration” should be understood to encompass for example peroral, intravenous, parenteral, inhalation, pulmonary, rectal, nasal, topical (e.g., transdermal and intraocular), intravesical, intrathecal, enteral, pulmonary, intralymphatic, intracavital, vaginal, transurethral, intradermal, aural, intramammary, buccal, orthotopic, intratracheal, intralesional, percutaneous, endoscopical, transmucosal, sublingual, intestinal administration and combinations thereof.
[0079]
[0072] Peroral Administration: The lactic acid bacteria or extract therefrom of the invention can be formulated to take the form of tablets or capsules prepared by conventional means with one or more pharmaceutically acceptable carriers (e.g., excipients such as binding agents, fillers, lubricants and disintegrants).
[0080]
[0073] Parenteral Administration: The lactic acid bacteria or extract therefrom of the present invention can be formulated for parenteral administration by injection (e.g., by bolus injection or continuous infusion). Formulations for injection can be presented in unit dosage form in ampoules or in multi -dose containers with an optional preservative added. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass, plastic or the like. The formulation can take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and can contain agents such as suspending, stabilizing and / or dispersing agents. For example, a parenteral preparation can be a sterile injectable solution or suspension in a nontoxic parenterally acceptable diluent or solvent (e.g., as substance in 1,3 -butanediol solution). Some of the acceptable vehicles and solvents that can be employed include for example water, Ringer’s solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. Attorney Reference No: 6666-P004-SAR-PCT
[0081]
[0074] Controlled-Release Administration: Controlled-release (or sustained- release) preparations can be formulated to extend the activity of a substance and reduce dosage frequency. Controlled-release preparations can also be used to affect the time of onset of action or other characteristics, such as blood levels of the lactic acid bacteria or extract therefrom, and consequently affect the occurrence of any side effects.
[0082]
[0075] Controlled-release preparations can be designed to initially release an amount of the lactic acid bacteria or extract therefrom that produces the desired therapeutic effect, and gradually and continually release other amounts of the substance to maintain the level of therapeutic effect over an extended period of time. In order to maintain a near-constant levels in the body, the lactic acid bacteria or extract therefrom can be released from the dosage form at a rate that will replace the amount of substance being metabolised and / or excreted from the body. The controlled-release of a substance can be stimulated by various inducers, e.g., change in pH, change in temperature, enzymes, water, and / or other physiological conditions or molecules.
[0083]
[0076] Controlled-release systems can include, for example, an infusion pump which can be used to administer the substance in a manner similar to that used for delivering insulin or chemotherapy to the body generally, or to specific organs or tissues such as adipose tissues. Typically, using such a system, the substance is administered in combination with a biodegradable, biocompatible polymeric implant that releases the substance over a controlled period of time at a selected site. Example polymeric materials include polyanhydrides, polyorthoesters, polyglycolic acid, polylactic acid, polyethylene vinyl acetate, and copolymers and combinations thereof. In addition, a controlled release system can be placed in proximity of a therapeutic target such as adipose tissue, thus requiring only a fraction of a systemic dosage.
[0084]
[0077] In some embodiments, the regimen of administration of the lactic acid bacteria or extract therefrom is suitable for peroral administration.
[0085]
[0078] In some embodiments, the regimen of administration of the lactic acid bacteria or extract therefrom, comprises one or more of peroral administration.
[0086]
[0079] It will be appreciated by those skilled in the art that the amount or dose of the lactic acid bacteria or extract therefrom, as contemplated in the present invention, will vary with the nature or severity of the disease, syndrome or condition being treated; the type of the disease, syndrome or condition; the stage of the disease, syndrome or condition; the age of the subject; the weight and the overall condition of the subject, and will be ultimately at the discretion of the subject or wherever applicable at the recommendation of the attendant physician for example where the subject is on existing pharmaceutical therapy. The amount or dose of the lactic acid bacteria or extract therefrom, is preferably pharmaceutically relevant for the intended use and desired outcome such as amelioration, prophylaxis, or reversal of a disease or disorder, or of at least one discernible symptom thereof caused by or associated with lipid metabolism such as abnormal lipid Attorney Reference No: 6666-P004-SAR-PCT metabolism. The amount or dose of the lactic acid bacteria or extract therefrom, is preferably pharmaceutically relevant for the intended use and desired outcome such as amelioration, prophylaxis, or reversal of a disease or disorder, or of at least one discernible symptom thereof caused by or associated with lipid metabolism such as abnormal lipid metabolism.
[0087]
[0080] In some embodiments, the dose of the lactic acid bacteria or extract therefrom may conveniently be presented in a single dose or as divided doses administered at appropriate intervals, for example as two, three, four or more sub-doses per day or per administration.
[0088]
[0081] In an aspect of the present invention there is provided a use of a lactic acid bacteria or extract therefrom for preparing an adipolysis medicament for the therapeutic treatment of a subject affected by or suffering with a disease or disorder, caused by or associated with lipid metabolism such as abnormal lipid metabolism.
[0089]
[0082] In some embodiments, the dose of the lactic acid bacteria or extract therefrom, will typically be in the range of about 2 to about 2000 mg / ml per administration, dependent upon the route of administration.
[0090]
[0083] In some embodiments, the dose of the lactic acid bacteria or extract therefrom per administration will typically be in the range of about 0.1 to 2000 mg / kg of body weight, about 0.15 to 1750 mg / kg of body weight, about 0.2 to 1700 mg / kg of body weight, about 0.3 to 1500 mg / kg of body weight, about 0.5 to 1250 mg / kg of body weight, about 1 to 1000 mg / kg of body weight, about 2 to 900 mg / kg of body weight, about 3 to 800 mg / kg of body weight, about 4 to 700 mg / kg of body weight, about 5 to 600 mg / kg of body weight, about 10 to 500 mg / kg of body weight, administered as one, two, three, four or more doses or sub-doses per day or per administration.
[0091]
[0084] In some embodiments, the dose is 400 mg / kg of body weight administered as one, three, four or more doses or sub-doses per day or per administration.
[0092]
[0085] In some embodiments, the lactic acid bacteria or extract therefrom is adapted for peroral administration. In some embodiment, where the substance is adapted for peroral administration, a daily dose will typically be within the range of about 10 to 1500 pg / kg of body weight, about 20 to 1250 pg / kg of body weight, about 30 to 1000 pg / kg of body weight, about 500 to 750 pg / kg of body weight. In some embodiments, the peroral administration daily dose is 400 pg / kg of body weight.
[0093]
[0086] In some embodiments, the therapeutically effective peroral administration comprises a dose of the lactic acid bacteria or extract therefrom in the range of about 1 to 500 mg / ml, about 5 to 250 mg / ml, about 10 to 200 mg / ml, about 20 to 150 mg / ml, about 50 to 100 mg / ml per administration. In some embodiments, the therapeutically effective peroral administration comprises a daily dose of lactic acid Attorney Reference No: 6666-P004-SAR-PCT bacteria or extract therefrom in the range of about 10 to 1500 mg, about 50 to 1250 mg, about 100 to 1000 mg, about 200 to 750 mg per administration. In some embodiments, the peroral administration daily dose of lactic acid bacteria or extract therefrom is 1000 mg per administration.
[0094]
[0087] In some embodiments, the lactic acid bacteria as contemplated in the present invention incorporates viable cells. In some embodiments, the lactic acid bacteria as contemplated in the present invention incorporate between about 1O2-5X1O10viable cells / ml, preferably between about 102-5xl09viable cells / ml, preferably between about 102-5xl08viable cells / ml, , preferably between about 102-5xl07viable cells / ml, preferably between about 102-5xl06viable cells / ml, preferably between about 102-5xl05viable cells / ml.
[0095]
[0088] The skilled person would know that viability of microbial cells can be assessed or estimated using colony-forming units per millilitre (CFU / mL) in case of a liquid being tested or grams (CFU / g) if a solid material is tested.
[0096]
[0089] If the lactic acid bacteria as contemplated in the present invention contains viable cells, the concentration of the viable cells can readily be estimated via colony-forming units per milliliter (CFU / mL or growth medium). In some embodiments, the concentration of the viable cells is from 0.5 million to 1 billion CFU / mL, 0.5 million to 500 million CFU / mL, 0.5 million to 400 million CFU / mL, 0.5 million to 300 million CFU / mL, 0.5 million to 200 million CFU / mL, 0.5 million to 150 million CFU / mL, 0.5 million to 125 million CFU / mL, 0.5 million to 100 million CFU / mL, 0.5 million to 75 million CFU / mL, 0.5 million to 50 million CFU / mL, 0.5 million to 10 million CFU / mL, 0.5 million to 5 million CFU / mL, 0.5 million to 1 million CFU / mL, 1 million to 1 billion CFU / mL, 1 million to 500 million CFU / mL, 1 million to 400 million CFU / mL, 1 million to 300 million CFU / mL, 1 million to 200 million CFU / mL, 1 million to 150 million CFU / mL, 1 million to 125 million CFU / mL, 1 million to 100 million CFU / mL, 1 million to 75 million CFU / mL, 1 million to 50 million CFU / mL, 1 million to 10 million CFU / mL, 1 million to 5 million CFU / mL, 5 million to 1 billion CFU / mL, 5 million to 500 million CFU / mL, 5 million to 400 million CFU / mL, 5 million to 300 million CFU / mL, 5 million to 200 million CFU / mL, 5 million to 150 million CFU / mL, 5 million to 125 million CFU / mL, 5 million to 100 million CFU / mL, 5 million to 75 million CFU / mL, 5 million to 50 million CFU / mL, 5 million to 10 million CFU / mL, 10 million to 1 billion CFU / mL, 10 million to 500 million CFU / mL, 10 million to 400 million CFU / mL, 10 million to 300 million CFU / mL, 10 million to 200 million CFU / mL, 10 million to 150 million CFU / mL, 10 million to 125 million CFU / mL, 10 million to 100 million CFU / mL, 10 million to 75 million CFU / mL, 10 million to 50 million CFU / mL, 50 million to 1 billion CFU / mL, 50 million to 500 million CFU / mL, 50 million to 400 million CFU / mL, 50 million to 300 million CFU / mL, 50 million to 200 million CFU / mL, 50 million to 150 million CFU / mL, 50 million to 125 million CFU / mL, 50 million to 100 million CFU / mL, 50 million to 75 million CFU / mL, 100 Attorney Reference No: 6666-P004-SAR-PCT million to 1 billion CFU / mL, 100 million to 500 million CFU / mL, 100 million to 400 million CFU / mL, 100 million to 300 million CFU / mL, 100 million to 200 million CFU / mL, 100 million to 150 million CFU / mL, 100 million to 125 million CFU / mL, 125 million to 1 billion CFU / mL, 125 million to 500 million CFU / mL, 125 million to 400 million CFU / mL, 125 million to 300 million CFU / mL, 125 million to 200 million CFU / mL, 125 million to 150 million CFU / mL, 150 million to 1 billion CFU / mL, 150 million to 500 million CFU / mL, 150 million to 400 million CFU / mL, 150 million to 300 million CFU / mL, 150 million to 200 million CFU / mL, 200 million to 1 billion CFU / mL, 200 million to 500 million CFU / mL, 200 million to 400 million CFU / mL, 200 million to 300 million CFU / mL, 300 million to 1 billion CFU / mL, 300 million to 500 million CFU / mL, 300 million to 400 million CFU / mL, 400 million to 1 billion CFU / mL, 400 million to 500 million CFU / mL, or 500 million to 1 billion CFU / mL or more such as 10 billion CFU / ml.
[0097]
[0090] The present inventors found that the lactic acid bacteria or extract therefrom as contemplated in the present invention may be conveniently administered to a subject by the peroral route, particularly in the form of a tablet or capsule (e.g. a tablet). In some embodiments, the particular dosage regimes contemplated in the invention are particularly suited to oral administration in the form of a tablet or capsule that is formulated such that the release of the lactic acid bacteria or extract therefrom as used in the invention from said tablet or capsule after peroral administration is modified. The term “modified” or "modified release" as used herein in relation to the substance according to the invention or a used in any other context means release, which is not immediate release and is taken to encompass controlled release, sustained release, prolonged release, timed release, retarded release, extended release and delayed release. In some embodiments, the modified release substance is lactic acid bacteria or extract therefrom. In some embodiments, the modified release substance is Lactobacillus paracasei M2.1 (accession No. 507616) or extract therefrom. In some embodiments, the modified release substance is Lactobacillus paracasei P4 (accession No. 507615 or extract therefrom) or extract therefrom. In some embodiments, the modified release substance is a combination of Lactobacillus paracasei M2.1 (accession No. 507616) and Lactobacillus paracasei P4 (accession No. 507615), or extracts therefrom.
[0098]
[0091] For the avoidance of doubt, the skilled person will understand that references to certain maximum amounts and concentrations in plasma may also require a minimum of a therapeutically effective amount in the plasma.
[0099]
[0092] The skilled person will understand that references to certain maximum (i.e. where values are indicated as being “below”) and minimum (i.e. where values are indicated as being “at least”) amount and / or concentrations in plasma may be combined to form ranges (i.e. wherein the amount in plasma is in a range that is from the minimum value to the maximum value). Attorney Reference No: 6666-P004-SAR-PCT
[0100]
[0093] As used herein, the term “significant” when referring to for example reducing, enhancing, remission, amelioration, prophylaxis, or reversal, that is statistically significant, not due to chance alone, which has a p-value of 0.05 or less. In particular, the term “significant” can have a p-value of less than 0.05, 0.04, 0.03, 0.01, 0.005, 0.001, etc., when referring to for example reducing, enhancing, remission, amelioration, prophylaxis, weight loss, size of white adipose cells, intracellular lipid deposition, increase in brown adipose cells or glucose uptake, regression, or reversal of disease, disorder or symptom caused by or associated with lipid metabolism such as abnormal lipid metabolism for example when compared with the level or biomarker determinations in one or more non-treated patients or when compared with the level or biomarker determinations in the same patient observed at a different time point such as an earlier time point (e. g. comparison with a "base line" level or placebo). Those of skill in the relevant art would be familiar with different statistical calculation approaches, examples include, t-test, z-test, sample test, O’Brien- Fleming method for normally distributed data etc. Reference here is also made to the Figures as described and incorporated in the present invention.
[0101] Disease or condition state and biomarkers
[0102]
[0094] Without wishing to be bound by theory, elevated blood levels of different markers such as biomarkers for example lipid metabolism markers, inflammatory markers, CBC markers and predictive markers have been associated with disease state prognosis and diagnosis, such as for example lipid metabolism markers, inflammation, cardiovascular disease (CVD) or cardiovascular abnormality, heart disease, liver disease, autoimmunity or tumour. As used herein the term “marker” refers to a predictive, prognostic or diagnostic marker such as a biomarker or indicator. Example markers include metabolic markers such as lipid metabolism markers for instance fatty acids such as LDL and HDL, protein-based biomarkers such as troponin and N-terminal pro-B-type natriuretic peptide (NT-proBNP), C reactive protein, weight loss, glucose and glycerol and others. In some embodiments of the present invention, markers are selected from the group consisting of metabolic markers such as lipid metabolism markers for instance fatty acids such as LDL and HDL, protein-based biomarkers such as troponin and N-terminal pro-B-type natriuretic peptide (NT-proBNP), C reactive protein, weight loss, glucose and glycerol and others.
[0103]
[0095] In some embodiments, the predictive marker is selected from LDL and HDL. In some embodiments, the predictive marker is LDL. In some embodiments, the predictive marker is HDL. In some embodiments, the predictive marker is selected from glucose and glycerol. In some embodiments, the predictive marker is glucose. Conversely, it has been recognised in the art that reduction in the levels of these markers can be linked to improvement of disease state or absence of disease or disorder such as a caused by or associated with inflammation, cardiovascular abnormality, heart disease, liver disease, autoimmunity or abnormal lipid metabolism. Attorney Reference No: 6666-P004-SAR-PCT
[0104] Combination treatment
[0105]
[0096] The probiotic lactic acid bacteria or extract therefrom as contemplated in the present invention selected from Lactobacillus, Bifidobacteria and Streptococcus or selected from Lactobacillus paracasei, Lactobacillus delbrueckii, Lactobacillus acidophilus, Lactobacillus brevis, Lactobacillus buchneri, Lactobacillus casei, Lactobacillus curvatus, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus helveticus, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus sakei, or Lactobacillus salivarius or combinations thereof or selected from Lactobacillus paracasei M2.1 (accession No. 507616) or Lactobacillus paracasei P4 (accession No. 507615 / including variants thereof, or extracts therefrom, can be administered in the present methods, uses or compositions in combination with (e.g. in a combined formulation with) other therapeutic agents for example agents that are useful as, for example, insulin, anti-inflammatory agents, NSAID, beta-blockers, calcium channel blockers, anticoagulants, angiotensin-converting enzyme inhibitors (ACEIs), diuretics, digoxin, statins, Lipitor, Diovan, metformin and others.
[0106]
[0097] In some embodiments, the Lactobacillus paracasei, Lactobacillus delbrueckii, Lactobacillus acidophilus, Lactobacillus brevis, Lactobacillus buchneri, Lactobacillus casei, Lactobacillus curvatus, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus helveticus, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus sakei, or Lactobacillus salivarius or combinations thereof or Lactobacillus paracasei M2.1 (accession No. 507616) or Lactobacillus paracasei P4 (accession No. 507615) or extracts therefrom, is used in combination with insulin. In some embodiments, Lactobacillus paracasei M2.1 (accession No. 507616) or Lactobacillus paracasei P4 (accession No. 507615) or extract therefrom, is used in combination with insulin. In some embodiments, Lactobacillus paracasei M2.1 (accession No. 507616) or Lactobacillus paracasei P4 (accession No. 507615) or extract therefrom, is used in combination with metformin.
[0107]
[0098] Unless otherwise stated or apparent from the context (e.g. when discussed with reference to a specific formulation or administration regimen), references to the dose of the Lactobacillus paracasei, Lactobacillus delbrueckii, Lactobacillus acidophilus, Lactobacillus brevis, Lactobacillus buchneri, Lactobacillus casei, Lactobacillus curvatus, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus helveticus, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus sakei, or Lactobacillus salivarius or combinations thereof or Lactobacillus paracasei M2.1 (accession No. 507616) or Lactobacillus paracasei P4 (accession No. 507615) or extracts therefrom, according to the invention will be understood to refer to the dose of the chosen lactic acid bacteria or extract therefrom.
[0108]
[0099] In an aspect of the present invention, there is provided a composition comprising the lactic acid bacteria as described herein and / or the lactic acid bacteria extract as described herein. In some embodiments, Attorney Reference No: 6666-P004-SAR-PCT there is provided an adipolysis composition comprising the lactic acid bacteria described herein and / or the lactic acid bacteria extract as described herein. In some embodiments, the at least one lactic acid bacteria as described herein is in a dosage regimen encapsulated from.
[0109]
[0100] As used herein the term “encapsulated” refers to the probiotic bacteria such as the lactic acid bacteria or extract therefrom, which have undergone an encapsulation process such as a process by which bacterial cells or extracts therefore, such as live cells or extracts therefrom, are packaged within an outer shell material to offer protection against unfavourable environmental conditions and wherever required or deemed necessary as contemplated in the present invention, allowing for their controlled release under appropriate conditions in environment such as intestinal conditions or intestinal environment. Several methods are known in the art for encapsulation of probiotics such as lactic acid bacteria according to the present invention, such as with non-limiting examples only, spray drying, extrusion, emulsion or phase separation, freeze drying, ionotropic gelation and others. Probiotic encapsulation technology usually allows for immobilisation and stabilisation of probiotics such as lactic acid bacteria according to the present invention, within semipermeable and / or biocompatible materials. Here the skilled person would be familiar with for example, Prado et al., 2020. Therefore, suitable carrier or delivery vehicle as described herein by way of non-limiting examples, encompass those suitable carrier or delivery vehicle which allow for encapsulation of bacterial strains or extracts therefrom of the present invention without adversely affecting their function.
[0110]
[0101] In an aspect of the present invention there is provided a lactic acid bacteria, wherein the lactic bacterial strain is at least one selected from Lactobacillus paracasei isolate M2.1 (Accession No. 507616) or Lactobacillus paracasei P4 (Accession No. 507615 / wherein optionally the bacterial strain is associated with acceptable carrier or delivery vehicle and optionally adjuvant within a single composition or separate compositions comprising a mixture of distinct bacterial strains or combinations thereof.
[0111]
[0102] The present invention is also concerned with a kit comprising or consisting essentially of, or consisting of the lactic acid bacterial of the present invention, according to any embodiment recited herein, and at least one food product, in particular a dairy food product, and if appropriate a leaflet for administration instructions with a view of achieving the effect described herein. Thus, in an aspect of the present invention there is provided kit comprising lactic acid bacteria or extract therefrom, or a composition and a food product, in particular dairy product, and optionally a leaflet of instructions for administration to a host in need thereof.
[0112]
[0103] In one embodiment of the present invention, the lactic acid bacteria bacterial can be found in a food-based product. In one embodiment of the present invention, the lactic acid bacteria bacterial can be administered in association with a food-based product. Attorney Reference No: 6666-P004-SAR-PCT
[0113]
[0104] Carrier or delivery vehicle as mentioned herein can be adapted accordingly, following the conventional practice in the field. When in a food product or administered in association with a food product, bacterial strain may further be encapsulated. In some embodiments of the present invention, the food product is a dairy based product. The invention also relates to a method of manufacturing a composition, formulation, food product (such as a dairy product), or kit containing the lactic acid bacteria described herein, according to any embodiment herein disclosed. In some embodiments, the dairy may be an animal milk or dairy milk. In some embodiments the animal milk or dairy milk can be derived from a cow, a sheep, a goat, a camel, a reindeer, a water buffalo, a yak, a horse, a donkey etc.. In some embodiments, the dairy is a non-animal milk or non-dairy milk. In some embodiments the non-animal milk or non-dairy milk can be derived from almonds, soya, rice, cashew, coconut, oats, flax, hemp etc.. In some embodiments the product is substantially free of animal or dairy products or by-products.
[0114]
[0105] In some embodiment, the lactic acid comprising product according to the present invention can incorporate inert, inorganic or organic excipients. In some embodiments, to prepare pills, tablets, coated tablets and hard gelatin capsules, e.g., lactose, com starch or derivatives thereof, talc, stearic acid or its salts, etc. can be used. Excipients for soft gelatin capsules and suppositories are, e.g., fats, waxes, semi-solid and liquid polyols, natural or hardened oils etc. Suitable excipients for the production of solutions and syrups are, e.g., water, alcohol, sucrose, invert sugar, glucose, polyols etc.
[0115]
[0106] In an aspect of the present invention there is provided a method of identifying microorganisms that affect adipocyte metabolism, the method comprising the steps of: a. preparing microbial supernatant; b. exposing adipocytes to microbial supernatant; and c. testing for adipolysis.
[0116]
[0107] In some embodiments, the step of testing for adipolysis comprises determining concentration of glycerol and / or glucose in adipocyte supernatant. In some embodiments, the step of testing for adipolysis comprises determining concentration of triglycerides. In some embodiments, the step of testing for adipolysis comprises determining concentration of free fatty acids. As contemplated herein adipolysis or lipolysis can be tested by using adipose tissue or cell culture. In some embodiments the adipocyte can be selected from 3T3-L1 or differentiated 3T3-L1 cells.
[0117] Quorum sensing
[0118]
[0108] Without wishing to be bound by theory, quorum sensing is generally considered to represent a response to fluctuations in cell-population density. Quorum sensing microorganisms for instance lactic acid bacteria produce and release chemical signal molecules generally called autoinducers that increase in Attorney Reference No: 6666-P004-SAR-PCT concentration as a function of cell density. The detection of a minimal threshold stimulatory concentration of an autoinducer leads to an alteration in gene expression. Microorganism such as Gram -positive and Gramnegative lactic acid bacteria such as Lactobacillus paracasei, Lactobacillus delbrueckii, Lactobacillus acidophilus, Lactobacillus brevis, Lactobacillus buchneri, Lactobacillus casei, Lactobacillus curvatus, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus helveticus, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus sakei, or Lactobacillus salivarius or combinations thereof or Lactobacillus paracasei A / 2. / accession No. 507616) or Lactobacillus paracasei P4 (accession No. 507615) or extracts therefrom, is used in combination with insulin. In some embodiments, Lactobacillus paracasei M2.1 (accession No. 507616) or Lactobacillus paracasei P4 (accession No. 507615) or extract therefrom, is used in combination with insulin. In some embodiments, Lactobacillus paracasei M2.1 (accession No. 507616) or Lactobacillus paracasei P4 (accession No. 507615), use quorum sensing communication circuits to regulate a diverse array of physiological and physicochemical metabolic activities and processes. These metabolic activities and processes include for example virulence, competence, conjugation, antibiotic production, motility, metabolite utilisation, acid production, lipidolysis metabolite production and biofdm formation.
[0119]
[0109] In general and certainly without wishing to be bound by theory, in bacteria such as lactic acid bacterial of the present invention use acylated homoserine lactones as autoinducers while Gram-positive bacteria use for example processed oligo-peptides to communicate. Recent advances in the field indicate that cell-cell communication via autoinducers occurs both within and between different bacteria such as lactic acid bacterial of the present invention.
[0120]
[0110] It is believed that when the microbial cultures of the present invention are propagated according to the method of the present invention, the propagated microorganisms, particularly bacteria such as lactic acid bacterial of the present invention can be monitored aiming to maintain certain physico-chemical parameters at a desired level, the metabolic processes of the microorganisms can be controlled in such a manner so as to effectively control the microorganisms to release or even maximise the release of defined levels of favourable or even the desirable microbial metabolites which enhance lipid metabolism such as lipid break down or lipidolysis.
[0121] Reports and Data Transmission
[0122]
[0111] In some embodiments, the methods, uses, lactic acid bacterial strains, extract and compositions disclosed herein further comprise generating one or more reports. In some embodiments, the methods disclosed herein further comprise storing one or more reports. In some embodiments, the methods disclosed herein further comprise transmitting one or more reports. In some embodiments, the report includes information on the adipolysis capability of a microorganism. In some embodiments, the report provides Attorney Reference No: 6666-P004-SAR-PCT recommendations on a therapeutic regimen of the lactic acid bacteria, variants or extracts therefrom or compositions described herein to induce or lead to for instance adipolysis. In some embodiments, the report provides recommendations on the dosage of a lactic acid bacteria, variants or extracts therefrom or compositions described herein to induce or lead to for instance adipolysis.
[0123]
[0112] In order that the invention may be readily understood and put into practical effect, particular embodiments will now be described by way of the following non-limiting examples.
[0124] MATERIALS, METHODS AND EXPERIMENTAL EXAMPLES
[0125]
[0113] Molecular Identifiecation of new lactic acid bactria, Materials, Methods and Chemicals Reagents
[0126]
[0114] Molecular identification and characterisation of new bacterial strains:
[0127]
[0115] DNA from the reference strains Lactobacillus helveticus DSM 20075; L. plantarum DSM 20174; L. casei DSM 20011; L. delbrueckii ssp. bulgaricus DSM 20081 and L. delbrueckii ssp. lactis DSM 20072 was used as a template for PCR amplification using universal primers corresponding to the 5 ’-end fDl (5’-AGAGTTTGATCCTGGCTCAG-3’) and 3’-end rDl (5’-TAAGGAGGTGATCCAGGC-3’) of the 16S rRNA gene (Weisburg et al., 1991).
[0128]
[0116] The PCR product from 16S rDNA amplification was digested with endonucleases EcoRI and Haelll (NZYTech, Portugal). The restriction fragments were separated electrophoretically in 2% agarose gel (Cleaver Scientific Ltd, Hungary) and visualized by staining with fluorescent nucleic acid dye GelRed® (Biotium, USA). Restriction patterns identical to the references led to the lack of identification of the corresponding species. After that the species-specific PCR with particular primer sets was performed as follows: L. paracasei LMG13087 (5' -CCCACTGCTGCCTCCCGTAGGAGT-3' and 5'- CACCGAGATTCAACATGG-3 ) (Roy et al., 2000) and L. rhamnosus LMG6400 (5'- CAGACTGAAAGTCTGACGG-3 and 5 -GCGATGCGAATTTCTATTATT-3 ) (Walter et al., 2000).
[0129]
[0117] Materials, Methods and Chemicals Reagents:
[0130]
[0118] We conducted different studies in which we routinely employed supernatants or extracts from newly isolated Lactocaseibacillus paracasei strains M2.1 and P4, as well as 3T3-L1 mouse embryonic fibroblasts (ATCC® CRL-3242™) from the American Type Culture Collection (ATCC, Washington, DC, USA). The reagents used in the current investigation were Dulbecco's Modified Eagle's Medium (DMEM) with high glucose content (4500 mg / 1), fetal bovine serum (FBS), L-glutamine, antibiotic solution (Penicillin G, Streptomycin, Amphotericin B), indomethacin, dexamethasone, phosphate-buffered saline (PBS), 100% isopropanol, sodium chloride (HCL), Oil Red O powder, 3 -(4,5 -dimethyl -2 -thiazolyl)-2, 5 -diphenyl -2H- tetrazolium bromide (MTT) powder, trypsin solution, dimethyl sulfoxide (DMSO), Adipolysis assay kit Attorney Reference No: 6666-P004-SAR-PCT
[0131] MAK313 - all suitable for cell cultures and purchased from Sigma- Aldrich, Chemie, GmbH (Merk KGaA, Darmstadt, Germany). Insulin (cell application, San Diego, CA, USA) and 3 -isobutyl- 1 -methylxanthine IB MX (Cayman Chemical, Ann Arbor, ML, USA) were also used. Investigated microorganisms were precultured in de Man, Rogosa, and Sharpe (MRS) broth, supplied by Oxoid, UK. Glucose GOD-PAD reagent was purchased from Biolabo SAS (Maizy, France). The plates and pipettes used were sterile and single-use, produced by Coming Incorporated, Costar, USA. For gene expression analyses, we used the RNeasy Mini Lipid Tissue Kit (QIAGEN Sciences, Inc; Germantown, MD, USA), the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Waltam, MA, USA), and the KAPA SYBR® fast qPCR Master Mix kit (QIAGEN Sciences, Inc; Germantown, MD, USA).
[0132]
[0119] Preparation of Microbial Supernatants:
[0133]
[0120] Autochthonous Lacticaseibacillus paracasei strains M2.1 and P4 were isolated from Formica rufa anthills in Sinite Kamani National Park, Bulgaria, identified and cultivated in MRS at 37°C for 24 hours, as previously described by Grigorova et al., 2023. Supernatants from both microorganisms, M2. 1 and P4, were filtered through a 20 pm filter after centrifugation at 9000 rpm for ten minutes. The obtained supernatants were adjusted to pH 7 with 0.1 N NaOH and then ex tempore included in the freshly prepared adipocyte maintenance culture media (AMM) at a 10% v / v concentration.
[0134]
[0121] Cultivation and Adipogenesis of 3T3-L1 Cells:
[0135]
[0122] 3T3-L1 preadipocytes were propagated in basal media (BM) consisting of DMEM, 10% (v / v) FBS, and 1% antibiotic solution in T75 flasks. They were then seeded in 12- and 24-well plates at 104cells / mL concentrations and cultured at 37°C in a humidified atmosphere of 95% air and 5% CO2. Upon reaching 100% confluence, the cells underwent a 24-hour growth arrest followed by adipogenic differentiation. They were cultured for 48 hours in adipogenic induction media (AIM) containing DMEM, 10% (v / v) FBS, 2% L-glutamine, 0.1 mM IB MX, 0.05 mM indomethacin, 1 pM dexamethasone, 10 pg / mL insulin, and 1% antibiotic solution. In order to achieve full maturation by day 8, the cells were maintained in adipocyte maintenance media (AMM) composed of DMEM, 10% (v / v) FBS, 2% L-glutamine, 10 pg / mL insulin, and 1% antibiotic solution.
[0136]
[0123] On day 9, the mature adipocytes in the current study were divided into two experimental groups and one control group. The experimental groups, M2. 1 and P4, were treated for 24 hours with 10% v / v LPS M2.1 or LPS P4 supernatant in AMM. Since the microorganisms were pre-cultured in MRS broth, 10% (v / v) MRS was included in the AMM of the control group (MRS) for the same duration.
[0137]
[0124] Three parallel replicates were conducted concurrently for each group, consisting of six probes per group (n=6): Replicate 1 involved performing an MTT assay on 24-well plates; Replicate 2 included oil Attorney Reference No: 6666-P004-SAR-PCT
[0138] Red O staining on 12-well plates; and Replicate 3 was designed for assessing glucose and glycerol concentration in cell supernatants and for isolating mRNA from the same 3T3-L1 adipocytes for RT-PCR gene expression analysis (12-well plates).
[0139]
[0125] Cell Viability Assay - Figure 1 :
[0140]
[0126] The cell viability of 3T3-L1 upon 24-hour treatment with 10% supernatants was determined using the MTT assay. This colorimetric method exploits the reduction of MTT by NAD(P)H-dependent cellular oxidoreductase enzymes, producing an insoluble, purple formazan product, as detailed by Yang et al., 2007 and further elaborated by Kim et al., 2010. In this procedure, cells were incubated with MTT solution (5 mg / mL) at 37°C for 80 minutes. Following incubation, the formazan product was solubilized using an isopropanol solution containing 0.04 N HC1. Absorbance was measured at 570 nm (a reference wavelength - of 630 nm) using a Synergy LX Multi-Mode Microplate Reader (BioTek Instruments, Inc.), and the results were expressed as a percentage of the control (NC), in line with the approach described by Park et al., 2003.
[0141]
[0127] Oil Red O Staining and Intracellular Lipid Accumulation Assessment - Figure 2:
[0142]
[0128] At the end of the experiment, differentiated adipocytes were fixed with 10% formalin, dried with 60% isopropanol, and then colored with Oil Red O for 30 min. To quantify neutral lipid accumulation, the stain was then extracted from the lipid droplets with 100% isopropanol, and the dye absorbance was measured at 490 nm (Y ang et al., 2011).
[0143]
[0129] Glycerol concentration masurement and lipolysis rate estimation:
[0144]
[0130] To evaluate lipolysis in mature adipocytes treated with 10% LBS supernatants, we quantified the glycerol released into the supernatants. This analysis used the adipolysis assay kit specifically designed for cell culture supernatants. Each sample was measured twice to ensure accuracy. The readings were taken using the Synergy TM Lee Multi-Mode Microplate Reader from BioTek Instruments, Inc., Santa Clara, CA, USA. The device was set to a primary wavelength of 570 nm with a reference correction at 630 nm. Glycerol concentrations were then calculated based on a pre-established concentration curve, following the protocol provided by the manufacturer, and expressed relative to the MRS group as a percent.
[0145]
[0131] The determination of glycerol concentration is a well-established method for assessing adipocyte lipolysis. Glycerol is a direct byproduct of the hydrolysis of triglycerides, reflecting the breakdown activity within the adipose tissue.
[0146]
[0132] Glucose concentration in cell supernatants Figure 3: Attorney Reference No: 6666-P004-SAR-PCT
[0147]
[0133] After the mature adipocytes were exposed for 24 hours to LBS M2.1, LBS P4, or a 10% solution of MRS broth, we assessed the glucose levels in cell supernatants. This measurement was performed using the Mindrey BS-120 automatic biochemical analyzer manufactured in Guangzhou, China. For the glucose assay, we used the Glucose GOD-PAD reagent. The procedure was carried out according to the manufacturers' guidelines. To determine the glucose level taken from the treated cells in each group, we subtracted each value (experimental glucose concentration (EG)) from the corresponding amount established in the freshly prepared media just before application (initial glucose concentration (IG)) based on the equation provided by Diaz et al. .
[0148] Glucose uptake UG (mg / L) = IG - EG
[0149]
[0134] Finally, the data was presented as a percentage of the control group (MRS).
[0150]
[0135] Real-time PCR:
[0151]
[0136] The RNeasy Mini Lipid Tissue Kit was used for total mRNA isolation from pre-lysed mature adipocytes. The quality and quantity of the obtained mRNA were evaluated spectrophotometrically, ensuring that only high-quality mRNA (with absorbance ratios of approximately 2 at 260 / 280 nm) was used for subsequent analyses. Reverse transcription of equal amounts of mRNA from each sample was performed using the RevertAid First Strand cDNA Synthesis Kit. RT-qPCR was conducted using the KAPA SYBR Green Master Mix, employing self-designed primers as previously described by Grigorova et al. (2023). The RT-PCR data were analyzed using the modified delta-delta Ct method, which incorporates normalization based on multiple housekeeping genes. Six housekeeping genes were analyzed: Hypoxanthine Phosphoribosyltransferase (HPRT), 18S ribosomal RNA (18S), Beta-actin (ACTB), Ribosomal Protein L19 (RPL19, also known as 36B4), Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH), and Hydroxymethylbilane Synthase (HMBS). The identification of the least variable gene or combination of genes was performed by the web-based software RefFinder (Xie et al., 2012). In the final analysis, a combination of HPRT and ACTB was utilized. The sequences of the employed housekeeping and target genes are presented in Table 1. Attorney Reference No: 6666-P004-SAR-PCT
[0152] Table 1
[0153] PCR
[0154] Abbreviation Product
[0155] Full Name Forward Primer Reverse Primer
[0156] Size
[0157] (bp)
[0158] Carnitine
[0159] Cptl palmitoyltransferase AAGAACATCGTGAGTGGCGT GACCTTGACCATAGCCATCCA 165
[0160] NM 013495.2 la
[0161] Carnitine
[0162] Cpt2 palmitoyltransferase CATCGTACCCACCATGCACT CTCCTTCCCAATGCCGTTCT 169
[0163] NM 009949.2
[0164] 2
[0165] Acaca Acetyl-CoA
[0166] TGCTCATGTTCCTTGCCCAA TGCCACCACCATATTTGAGATT 247
[0167] NM 133360.3 carboxylase
[0168] Fasn
[0169] Fatty acid synthase CTGAAGCCGAACACCTCTGT GGGAATGTTACACCTTGCTCCT 218
[0170] NM 007988.3
[0171] Patatin-like
[0172] Pnpla2 phospholipase
[0173] CCTTCACCATCCGCTTGTTG CCCAGTGAGAGGTTGTTTCG 250
[0174] NM 001163689.1 domain containing
[0175] 2
[0176] Plinl
[0177] Perilipin 1 ACCCTCCAGAAAAGATCGCC CTTCCCAGAGCCAGATCAGC 229
[0178] NM 001113471.1
[0179] Fabp4 Fatty acid-binding
[0180] AACTGGGCGTGGAATTCGAT CCACCAGCTTGTCACCATCT 150
[0181] NM 024406.4 protein 4
[0182] Acoxl Acyl-Coenzyme A
[0183] ACAGAGATGGGTCATGGAACT ATGTAACCCGTAGCACTCCC 195
[0184] NM 015729.4 oxidase 1, palmitoyl
[0185] Adipo
[0186] Adiponectin TCCCGTATGATGTGCTTCCT AGCACAAAACCAAGCAGATGT 157
[0187] NM 028320.4
[0188] Actb
[0189] P-actin CCTCTATGCCAACACAGTGC GTACTCCTGCTTGCTGATCC 211
[0190] NM 007393.5
[0191] Hypoxanthine
[0192] Hprt guanine
[0193] ACAGGCCAGACTTTGTTGGA ACTTGCGCTCATCTTAGGCT 150
[0194] NM 013556.2 phosphoribosyl transferase Attorney Reference No: 6666-P004-SAR-PCT
[0195]
[0137] Statistical Analyses
[0196]
[0138] We utilized Statisticaversion 10 (StatSoft Inc., 2011, Tulsa, OK, USA) to analyze the obtained data. Initially, descriptive statistics were conducted to calculate the mean and standard error of the mean, which are represented in the figures with values and error bars. Then, the statistical significance of differences between each experimental group and the control (MRS) was assessed using the non-parametric Mann-Whitney U test. The symbol "asterisk" shows the degree of significance in the figures as follows: * for p < 0.05, ** for p < 0.01, and *** for p < 0.001.
[0197] EXAMPLES
[0198]
[0139] EXAMPLE 1
[0199]
[0140] Results from MTT cell viability assay
[0200]
[0141] On Day 8 following adipogenic induction, mature 3T3-L1 cells were treated with 10% cell- free supernatants from L. paracasei M2.1 and P4 for 24 hours. Subsequently, an MTT assay was performed to assess any cytotoxic effects of the applied supernatant concentration. Figure 1(a) shows microscopic images of the cell layer integrity after 24 hours of treatment. As illustrated in Figure 1, no cell -damaging impacts were observed. In fact, cell viability was notably increased by 18% in the samples treated with M2. 1 supernatant compared to the control (MRS) (p<0.001) Figure 1(b). Figure 1(a) shows microscopic images of the cell layer integrity after 24 hours of treatment. Figure 1. Assessment of cell viability in mature 3T3- L1 cell, treated with 10% cell-free supernatants from L. paracasei M2.1 or P4 strains, using MTT assay: Figure 1 (a) microscopic images of the cell layer integrity after 24 hours of treatment (magnification 4x; Bars = 500pm); and Figure 1 (b) Relative cell viability effect (MTT assay) in percentages compared to MRS group.
[0201]
[0142] Abbreviations: MRS - mature adipocytes treated with 10% (v / v) MRS broth (control); M2.1 and P4 - experimental groups of mature adipocytes exposed to 10% (v / v) M2.1 or P4 LBS cell-free supernatants. Statistical differences between each experimental group (M2.1 or P4) and MRS were evaluated using the Mann-Whitney U test, with significance levels indicated in the Figures by *, **, and *** for p- values of <0.05, <0.01, and <0.001, respectively.
[0202]
[0143] EXAMPLE 2
[0203]
[0144] Intracellular lipid accumulation
[0204]
[0145] Neutral lipid deposition in already differentiated 3T3-L1 adipocytes exposed to 10% cell supernatants from LBS M2.1 or P4 was observed microscopically (Fig. 2a) and then quantified spectrophotometrically following isopropanol extraction (Fig. 2b). Data showed a 19% increase in the Attorney Reference No: 6666-P004-SAR-PCT intracellular lipid accumulation in adipocytes treated with M2.1 supernatants compared to supplemented with MRS (p<0.01), with no change observed in P4 group. Figure 2. Assessment of intracellular lipid accumulation: Figure 2. (a) Effect of M2.1 and P4 LBS supernatants on the intracellular neutral lipid accumulation in mature 3T3-L1 cells. Figure 2. (b) microscopic images, stained with Oil Red O (magnification 20x and 40x, bars: 100 and 50pm, respectively).
[0205]
[0146] Abbreviations: MRS - mature adipocytes treated with 10% (v / v) MRS broth (control); M2.1 and P4 - experimental groups of mature adipocytes exposed to 10% (v / v) M2.1 or P4 LBS cell-free supernatants. Statistical differences between each experimental group (M2.1 or P4) and MRS were evaluated using the Mann-Whitney U test, with significance levels indicated in the Figures by *, **, and *** for p- values of <0.05, <0.01, and <0.001, respectively.
[0206]
[0147] EXAMPLE 3
[0207]
[0148] Glucose uptake and lipolysis rate
[0208]
[0149] Figure 3. Is a graph showing glucose update / uptake and lipolysis. Figure 3. (a) Assessment of glucose update / uptake after 24 hours of treatment of mature 3T3-L1 adipocytes with 10% supernatants from L. paracasei M2.1 or L. paracasei P4 strains. Schemes follow the same formatting; and Figure 3. (b) lipolysis rate after 24 hours of treatment of mature 3T3-L1 adipocytes with 10% supernatants from L. paracasei M2.1 or L. paracasei P4 strains.
[0209]
[0150] At the end of the experiment, the glucose concentration and glycerol release in the cell supernatants from all groups were measured. Based on these results, the glucose uptake and lipolysis rate in adipocytes were evaluated (Figure 3). A significant increase of over 30% in glucose uptake by the treated cells compared to the MRS group was demonstrated (p<0.001). Concurrently, a 28% reduction in the lipolysis rate in the M2.1 group (p<0.001) and no significant change in lipolysis in the P4 group was observed.
[0210]
[0151] Abbreviations: MRS - mature adipocytes treated with 10% (v / v) MRS broth (control); M2.1 and P4 - experimental groups of mature adipocytes exposed to 10% (v / v) M2.1 or P4 LBS cell-free supernatants. Statistical differences between each experimental group (M2.1 or P4) and MRS were evaluated using the Mann-Whitney U test, with significance levels indicated in the Figures by *, **, and *** for p- values of <0.05, <0.01, and <0.001, respectively.
[0211]
[0152] EXAMPLE 4
[0212]
[0153] Relative Gene Expression Attorney Reference No: 6666-P004-SAR-PCT
[0213]
[0154] Figure 4. Effect of LBS supernatants obtained from L. paracasei M2.1 or L. paracasei P4 strains, on the relative gene expression of: (a) carnitine palmitoyltransferase la (Cptl); (b) carnitine palmitoyltransferase 2 (Cpt2); (c) acyl-Coenzyme A oxidase 1, palmitoyl (Acoxl); (d) acetyl-CoA carboxylase (Acaca); (e) fatty acid synthase (Fasn); (f) perilipin 1 (Plinl); (g) patatin-like phospholipase domain containing 2 (Pnpla2); (h) fatty acid-binding protein 4 (Fabp4); and (i) adiponectin receptor 1 (Adipo).
[0214]
[0155] The expression of genes related to mitochondrial and peroxisomal beta-oxidation in adipocytes was analyzed, as illustrated in Figures 4a-c. A statistically significant upregulation, exceeding 10%, was observed exclusively in the acyl -coenzyme A oxidase 1, palmitoyl (Acoxl) gene in both treated adipocytes compared to the control group (p<0.05). Perilipin 1 (Plinl) and fatty acid-binding protein 4 (Fabp4) were also significantly upregulated in the M2.1 (p < 0.05) and P4 (p < 0.001) compared to the MRS group. Interestingly, the patatin-like phospholipase domain containing 2 (Pnpla2) and adiponectin (Adipo) showed significantly higher expression only in the P4 group (p < 0.01 and p < 0.05, respectively).
[0215]
[0156] Abbreviations: MRS - mature adipocytes treated with 10% (v / v) MRS broth (control); M2.1 and P4 - experimental groups of mature adipocytes exposed to 10% (v / v) M2.1 or P4 LBS cell-free supernatants. RT-qPCR data was analyzed via the modified AACt method, normalized to the GeoMean value of HPRT and beta-actin. Statistical differences between each experimental group (M2.1 or P4) and MRS were evaluated using the Mann-Whitney U test, with significance levels indicated in the figures by *, **, and *** for p-values of <0.05, <0.01, and <0.001, respectively.
[0216]
[0157] The disclosure illustratively described herein can suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms “comprising”, “including,” containing”, etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognised that various modifications are possible within the scope of the disclosure claimed. It will also be appreciated that the method(s), use(s), compositions(s), combinations(s) and / or administrations(s) may be subject to numerous rearrangements, modifications and substitutions without departing from the scope of the present disclosure as set forth and defined by the following claims. Attorney Reference No: 6666-P004-SAR-PCT
[0217] REFERENCES:
[0218] Prado et al., Encapsulation of live marine bacteria for use in aquaculture facilities and process evaluation using response surface methodology . Applied Microbiology and Biotechnology 2020, 104, 1993-2006. Grigorova, N.; Ivanova, Z.; Vachkova, E.; Petrova, V.; Beev, G. Antidiabetic and Hypolipidemic Properties of Newly Isolated Wild Lacticaseibacillus paracasei Strains in Mature Adipocytes. Appl. Set. 2023, 13, 6489.
[0219] Yang, Z.; Tu, Y.; Xia, H.; Jie, G.; Chen, X.; He, P. Suppression of Free-Radicals and Protection against H2O2-Induced Oxidative Damage in HPF-1 Cell by Oxidized Phenolic Compounds Present in Black Tea. Food Chem. 2007, 105, 1349-1356
[0220] Kim, H.; Lim, J. J.; Shin, H.Y.; Suh, H.J.; Choi, H.S. Lactobacillus Plantarum K8-Based Paraprobiotics Suppress Lipid Accumulation during Adipogenesis by the Regulation of JAK / STAT and AMPK Signaling Pathways. J. Funct. Foods 2021, 87, 104824.
[0221] Park, Y.J.; Liang, J.F.; Ko, K.S.; Kim, S.W.; Yang, V.C. Low Molecular Weight Protamine as an Efficient and Nontoxic Gene Carrier: In Vitro Study. J. Gene Med. 2003, 5, 700-711.
[0222] Yang, Z.; Tu, Y .; Xia, H.; Jie, G.; Chen, X.; He, P. Suppression of Free-Radicals and Protection against H2O2-Induced Oxidative Damage in HPF-1 Cell by Oxidized Phenolic Compounds Present in Black Tea. Food Chem. 2007, 105, 1349-1356.
[0223] Rivera Diaz, P.A.; Gomez Camargo, D.E.; Ondo-Mendez, A.; Gomez-Alegria, C.J. A Colorimetric Bioassay for Quantitation of Both Basal and Insulin-Induced Glucose Consumption in 3T3-L1 Adipose Cells. Heliyon 2020, 6, e03422.
[0224] Xie, F.; Xiao, P.; Chen, D.; Xu, L.; Zhang, B. miRDeepFinder: A miRNA Analysis Tool for Deep Sequencing of Plant Small RNAs. Plant Mol. Biol. 2012, 80, 75-84.
[0225] Weisburg, W. G., S. M. Bams, D. A. Pelletier, D. J. Lane (1991). 16S ribosomal DNA amplification for phylogenetic study. Bacteriol. 173: 697-703.
[0226] Roy, D.; Ward, P.; Vincent, D.; Mondou, F. Molecular Identification of Potentially Probiotic Lactobacilli. Curr. Microbiol. 2000, 40, 40-46.
[0227] Walter, J.; Tannock, G.W.; Tilsala-Timisjarvi, A.; Rodtong, S.; Loach, D.M.; Munro, K.; Alatossava, T. Detection and Identification of Gastrointestinal Lactobacillus Species by Using Denaturing Gradient Gel Electrophoresis and Species-Specific PCR Primers. Appl. Environ. Microbiol. 2000, 66, 297-303.] 6666-P004-SAR-PCT
[0228] 1 / 2
[0229] PCT
[0230] (Original in Electronic Form)
[0231] (This sheet is not part of and does not count as a sheet of the international application) 6666-P004-SAR-PCT
[0232] 2 / 2
[0233] PCT
[0234] (Original in Electronic Form)
[0235] (This sheet is not part of and does not count as a sheet of the international application)
[0236] FOR RECEIVING OFFICE USE ONLY
[0237] FOR INTERNATIONAL BUREAU USE ONLY
[0238] 0-5 This form was rec international Bure
[0239] 0-5-1 Authorized officer
Claims
Attorney Reference No: 6666-P004-SAR-PCTWHAT IS CLAIMED IS:
1. A method of inducing adipolysis in a subject, the method comprising administering a therapeutically effective amount of lactic acid bacteria or extract therefrom.
2. A method according to claim 1, wherein the therapeutically effective amount is achieved by a regimen of administration of the lactic acid bacteria or extract therefrom.
3. A method according to any one of claims 1 or 2, wherein the regimen comprises peroral administration of the lactic acid bacteria or extract therefrom.
4. A method according to any one of claims 2 or 3, wherein the regimen comprises one or more peroral administration of the lactic acid bacteria or extract therefrom.
5. A method according to any one of claims 2 to 4, the regimen comprises two or more peroral administrations of the lactic acid bacteria or extract therefrom.
6. A method according to any one of the preceding claims, wherein the therapeutically effective amount of lactic acid bacteria extract comprises cell -free supernatant.
7. A method according to any one of claims 1 to 5, wherein the therapeutically effective amount of lactic acid bacteria comprises viable cells.
8. A method according to any one of claims 3 to 7, wherein the therapeutically effective peroral administration comprises a dose of the lactic acid bacteria or extract therefrom in the range of about 1 to 500 mg / ml, about 5 to 250 mg / ml, about 10 to 200 mg / ml, about 20 to 150 mg / ml, about 50 to 100 mg / ml per administration.
9. A method according to any one of claims 3 to 7, wherein the therapeutically effective peroral administration comprises a daily dose of lactic acid bacteria or extract therefrom in the range of about 10 to 1500 mg, about 50 to 1250 mg, about 100 to 1000 mg, about 200 to 750 mg.
10. A method according to claim 9, wherein the peroral administration daily dose of lactic acid bacteria or extract therefrom is 1000 mg.
11. A method according to any one of the preceding claims, wherein the lactic acid bacteria is selected from Lactobacillus, Bifidobacteria, Bacillus and Streptococcus.
12. A method according to claim 11, wherein the lactic acid bacteria is selected from Lactobacillus paracasei, Lactobacillus delbrueckii, Lactobacillus acidophilus, Lactobacillus brevis, Lactobacillus buchneri, Lactobacillus casei, Lactobacillus curvatus, Lactobacillus delbrueckii,34Attorney Reference No: 6666-P004-SAR-PCTLactobacillus fermentum, Lactobacillus helveticus, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus sakei, or Lactobacillus salivarius or combinations thereof.
13. A method according to claim 12, wherein the lactic acid bacteria is selected from Lactobacillus paracasei M2.1 (accession No. 507616 / or Lactobacillus paracasei P4 (accession No. 507615 / 14. A method according to any one of claims 1 to 13, wherein the method comprises a regimen of administration of lactic acid bacteria or extract therefrom, which leads to regression in white adipose tissue.
15. A method according to claim 14, wherein the method comprises a regimen of peroral administration of lactic acid bacteria or extract therefrom, which reduces intracellular lipid deposition.
16. A method according to claim 15, wherein the accumulation of intracellular lipid deposition is reduced by at least 0.5%, at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more.
17. A method according to any one of claims 1 to 13, wherein the method reduces the size of white adipose cells.
18. A method according to claim 17, wherein the size of the adipose cells is reduced by at least 0.5%, at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more.
19. A method according to any one of claims 1 to 13, wherein the method leads to increase in brown adipose cells.
20. A method according to claim 19, wherein the increase in brown adipose cells is by at least 0.5%, by at least 1%, by at least 5%, by at least 10%, by at least 20%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 80%, by at least 90% or more.
21. A method according to any one of claims 1 to 13, wherein the method leads to at least 10% remission of adipose gain, at least 12% remission of adipose gain, at least 14% remission of adipose gain, at least 16% remission of adipose gain, at least 18% remission of adipose gain, at least 20% remission of adipose gain, at least 30% remission of adipose gain or more.
22. A method according to any one of claims 1 to 21, wherein the method leads to weight loss.
23. A method according to claim 22, wherein the method leads to at least 0.5%, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10% or more enhancement in weight loss.35Attorney Reference No: 6666-P004-SAR-PCT24. A method according to any one of claims 1 to 25, wherein the method leads to a statistically significant weight loss.
25. A method according to any one of claims 1 to 13, wherein the lactic acid bacteria or extract therefrom leads to increase in glucose uptake.
26. A lactic acid bacteria extract, according to any one of claims 1 to 13.
27. An adipolysis composition comprising at least one lactic acid bacteria according to anyone of claims 1 to 13 and / or the lactic acid bacteria extract according to claim 26.
28. An adipolysis composition according to claim 27, wherein the at least one lactic acid bacteria is as defined in claim 13, in a dosage regimen encapsulated from.
29. A lactic acid bacteria, wherein the lactic bacteria is at least one selected from Lactobacillus paracasei isolate M2.1 (Accession No. 507616 / or Lactobacillus paracasei P4 (Accession No. 507615 / wherein optionally the bacterial strain is associated with acceptable carrier or delivery vehicle and optionally adjuvant within a single composition or separate compositions comprising a mixture of distinct bacterial strains or combinations thereof.
30. A kit comprising a bacterial strain according to any one of claims 1 to 13, or an adipolysis composition and a food product, in particular dairy product, and optionally a leaflet of instructions for administration to a host in need thereof.
31. A method of identifying microorganisms that affect adipocyte metabolism, the method comprising the steps of: a. preparing microbial supernatant; b. exposing adipocytes to microbial supernatant; and c. testing for adipolysis.
32. A method according to claim 31, wherein the microorganism is lactic bacterial strain selected from Lactobacillus paracasei isolate M2.1 (Accession No. 507616 or Lactobacillus paracasei P4 (Accession No. 50761533. A method according to any one of claims 31 or 32, wherein the step of testing for adipolysis comprises determining concentration of glycerol and / or glucose in adipocyte supernatant.
Citation Information
Patent Citations
A probiotic composition with weight loss function, its preparation method and application
CN109924506B
Reducing body fat probiotic strain, composition thereof, and use thereof
US20200306324A1
Lactobacillus paracasei and weight control
WO2009138448A1