Compositions and methods for switched-on ADAR-edited RNA (SONAR) sensor

Abstract

Provided herein are nucleic acid molecules, compositions, and methods for expressing a payload (e.g., protein). The nucleic acid molecules can change form and become susceptible to ADAR editing when they hybridize with a target RNA, thereby expressing the payload in the presence of the target RNA.

Description

Atty Dkt No.: 65785-704601COMPOSITIONS AND METHODS FOR SWITCHED-ON ADAR-EDITED RNA (SONAR) SENSORCROSS-REFERENCE

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 680407, filed August 7, 2024, which application is incorporated herein by reference in its entirety.BACKGROUND

[0002] Adenosine deaminases acting on RNA (ADAR) are enzymes that bind to double-stranded RNA (dsRNA) and convert adenosine to inosine. Once incorporated into an mRNA, inosine functions similarly to guanosine during translation. Early-generation RNA-based therapeutics directly targeted RNA within cells, utilizing ADAR to make single base modifications of specific RNA sequences. However, RNA-based therapeutics that utilize ADAR can have the potential for use in a broader variety of diagnostic and therapeutic indications.SUMMARY

[0003] The disclosure describes an RNA sensor which changes configuration / form in response to binding of the RNA sensor to a target RNA, such that an editable moiety (e.g., an editable codon) becomes editable by ADAR editing upon the change in configuration / form of the RNA sensor. In some cases, formation of an editable stem-loop in the RNA sensor is conditional upon binding of a target RNA, greatly reducing baseline levels of ADAR editing: the editing ability can be “switched on” in response to target RNA binding. The conditional RNA sensor can comprise an auto-inhibitory sequence that permits at least two RNA structures to form: an editable structure comprising an editable stem-loop that forms in the presence of the target RNA and a non-editable structure that forms in the absence of the target RNA. In some embodiments, the editable stemloop formation of the conditional RNA sensor comprises a codon editable by ADAR. In some embodiments, the editable codon may be a stop codon, a start codon, or a near-start codon (e.g., AU A). The disclosure also describes conditional RNA sensor compositions, systems, methods and uses thereof.

[0004] In some aspects, provided herein is a engineered nucleic acid molecule, comprising: a) a first nucleic acid sequence comprising an editable moiety; and b) a second nucleic acid sequence capable of hybridizing to a target ribonucleic acid (RNA); and c) a third nucleic acid sequence capable of hybridizing to either the first nucleic acid sequence or the second nucleic acid sequence; wherein the engineered nucleic acid molecule is configured such that: i) when the second nucleicAtty Dkt No.: 65785-704601 acid sequence is not hybridized to the target RNA, the third nucleic acid sequence is hybridized to all or a portion of the first nucleic acid sequence or the second nucleic acid sequence, and the editable moiety is not susceptible to adenosine deaminase acting on RNA (ADAR) editing; and ii) when the second nucleic acid sequence hybridizes to the target RNA, the engineered nucleic acid molecule changes form such that the third nucleic acid sequence dehybridizes from all or a portion of the first nucleic acid sequences or the second nucleic acid sequences such that the editable moiety is susceptible to ADAR editing. In some embodiments, the first nucleic acid sequence is a stem-loop arm. In some embodiments, the second nucleic acid sequence is a target binding region. In some embodiments, the third nucleic acid sequence is a decoy sequence. In some embodiments, the decoy sequence comprises an additional moiety that renders said editable moiety not susceptible to editing by ADAR. In some embodiments, the engineered nucleic acid molecule further comprises the target RNA hybridized to the second nucleic acid sequence. In some embodiments, the editable moiety is an editable codon. In some embodiments, the second nucleotide sequence comprises two separate regions capable of hybridizing to the target RNA.

[0005] In some aspects, provided herein is a engineered nucleic acid molecule, comprising, from 5’ to 3’ : i) a first nucleic acid sequence that is reverse complementary to a first region of a target RNA and capable of specifically binding the target RNA; ii) a second nucleic acid sequence comprising an editable codon capable of forming a stem-loop in the engineered nucleic acid molecule, wherein, when formed, the stem-loop comprises the editable codon and the editable codon is susceptible of being edited by an ADAR protein; iii) a third nucleic acid sequence that is reverse complementary to a second region of a target RNA and capable of specifically binding the target RNA; and iv) a fourth nucleic acid sequence that is reverse complementary or partially reverse complementary to a contiguous nucleotide sequence selected from: all or a portion of the first nucleic acid sequence; all or a portion of the second nucleic acid sequence; all or a portion of the third nucleic acid sequence; or a nucleotide sequence comprising all or a portion of the first nucleic acid sequence, all or a portion of the second nucleic acid sequence, and all or a portion of the third nucleic acid sequence. In some embodiments, the fourth nucleic acid sequence is a decoy sequence that, in an absence of the target RNA, hybridizes with all or a portion of the first nucleic acid sequence, to all or a portion of the second nucleic acid sequence, all or a portion of the third nucleic acid sequence, or a nucleotide sequence comprising all or a portion of the first nucleic acid sequence, all or a portion of the second nucleic acid sequence, and all or a portion of the third nucleic acid sequence, and, in a presence of the target RNA, dehybridizes from all or the portion of the first nucleic acid sequence, from all or the portion of the second nucleic acid sequence, from all or a portion of the third nucleic acid sequence or from the nucleotide sequence comprising all or the portion of the first nucleic acid sequence, all or the portion of the second nucleic acidAtty Dkt No.: 65785-704601 sequence, and all or a portion of the third nucleic acid sequence. In some embodiments, the first nucleic acid sequence is reverse complementary to a region of the target RNA that is 3’ to the region of the target RNA that the third nucleic acid sequence is reverse complementary to. In some embodiments, the third nucleic acid sequence is reverse complementary to a region of the target RNA that is 5’ to the region of the target RNA that the first nucleic acid sequence is reverse complementary to. In some embodiments, the second nucleic acid sequence comprises an upstream stem-loop arm and a downstream stem-loop arm. In some embodiments, in the absence of the target RNA, the editable codon cannot be edited by the ADAR protein, and wherein in the presence of the target RNA, the editable codon can be edited by the ADAR protein. In some embodiments, the editable codon is a stop codon, a start codon, or a near-start codon. In some embodiments, the engineered nucleic acid molecule further comprises a protein coding sequence that encodes an output protein. In some embodiments, the output protein is a diagnostic protein or a therapeutic protein. In some embodiments, the engineered nucleic acid molecule further comprises a cleavage sequence. In some embodiments, the cleavage sequence encodes a peptide that causes ribosome skipping. In some embodiments, the engineered nucleic acid molecule further comprises the first region of the target RNA hybridized to the first nucleic acid sequence and the second region of the target RNA hybridized to the third nucleic acid sequence. In some embodiments, the engineered nucleic acid molecule further comprises a 5 ’-untranslated region (UTR) or a 3’-UTR sequence.

[0006] In some aspects, provided herein is a composition comprising the engineered nucleic acid molecule described herein and a pharmaceutically acceptable carrier. In some aspects, provided herein is a composition comprising the engineered nucleic acid molecule provided herein and an ADAR enzyme. In some embodiments, the ADAR enzyme is endogenous. In some aspects, provided herein is a vector comprising or encoding the engineered nucleic acid molecule described herein. In some embodiments, the vector comprises a viral vector. In some embodiments, the vector comprises a non-viral vector. In some aspects, provided herein is a cell expressing the engineered nucleic acid molecule provided herein.

[0007] In some aspects, provided herein is a method, comprising: (a) providing an engineered nucleic acid molecule, comprising: i) a first nucleic acid sequence comprising an editable moiety; and ii) a second nucleic acid sequence capable of hybridizing to a target ribonucleic acid (RNA); and iii) a third nucleic acid sequence hybridized to all or a portion of the first nucleic acid sequence or the second nucleic acid sequence; wherein the editable moiety is not susceptible to adenosine deaminase acting on RNA (ADAR) editing; and (b) hybridizing the target RNA to the second nucleic acid sequence such that the third nucleic acid sequence dehybridizes from all or the portion of the first nucleic acid sequence or the second nucleic acid sequence, wherein the editable moietyAtty Dkt No.: 65785-704601 becomes susceptible to ADAR editing. In some embodiments, in (a), the first sequence is a stemloop arm. In some embodiments, in (a), the engineered nucleic acid molecule comprises a stemloop comprising the stem-loop arm. In some embodiments, in (a), the engineered nucleic acid molecule comprises a stem-loop that does not comprise the stem-loop arm. In some embodiments, the method further comprises, in (b), forming a stem-loop that comprises the first nucleic acid sequence in a stem region of the stem-loop. In some embodiments, in (a), the third nucleic acid sequence is hybridized to all or a portion of the first nucleic acid sequence. In some embodiments, in (a), the third nucleic acid molecule comprises an additional moiety that renders the editable moiety not susceptible to ADAR editing. In some embodiments, in (a), the third nucleic acid sequence is hybridized to all or a portion of the second nucleic acid sequence. In some embodiments, the method further comprises, after (b), subjecting the editable moiety to ADAR editing. In some embodiments, the editable moiety is an editable codon. In some embodiments, the engineered nucleic acid molecule comprises a protein coding sequence that encodes a protein. In some embodiments, (i) the editable moiety is a stop codon; (ii) after (b), the method further comprises editing the stop codon such that it is no longer a stop codon; and (iii) the method further comprises, after editing the stope codon, expressing the protein. In some embodiments, (i) the editable moiety is a start codon; and (ii) after (b), the method further comprises editing the start codon such that it is no longer a start codon; and (iii) as a result of the start codon no longer being a start codon, expression of the protein from the engineered nucleic acid molecule cannot occur.

[0008] In some aspects, provided herein is a method, comprising: (a) providing an engineered nucleic acid molecule, comprising, from 5’ to 3’: i) a first nucleic acid sequence that is reverse complementary to a first region of a target RNA and capable of specifically binding the target RNA; ii) a second nucleic acid sequence comprising an editable codon capable of forming a stemloop in the engineered nucleic acid molecule, wherein, when formed, the stem-loop comprises the editable codon and the editable codon is susceptible of being edited by the ADAR protein; iii) a third nucleic acid sequence that is reverse complementary to a second region of a target RNA and capable of specifically binding the target RNA; and iv) a fourth nucleic acid sequence that is hybridized or partially hybridized to a contiguous nucleotide sequence selected from: all or a portion of the first nucleic acid sequence; all or a portion of the second nucleic acid sequence; all or a portion of the third nucleic acid sequence; or hybridized or partially hybridized to all or a portion of the first nucleic acid sequence, all or a portion of the second nucleic acid sequence, and all or a portion of the third nucleic acid sequence; and (b) hybridizing the first region of the target RNA to the first nucleic acid sequence and hybridizing the third nucleic acid sequence to the second region of the target RNA; such that, upon hybridizing the first region of the target RNA to the first nucleic acid sequence and hybridizing the third nucleic acid sequence to the second regionAtty Dkt No.: 65785-704601 of the target RNA, the fourth nucleic acid sequence or a portion thereof dehybridizes from: (1) all or a portion of the first nucleic acid sequence; (2) from all or a portion of the second nucleic acid sequence; (3) all or a portion of the third nucleic acid sequence; or (4) all or a portion of the first nucleic acid sequence, all or a portion of the second nucleic acid sequence, and all or a portion of the third nucleic acid sequence, wherein, after (b), the engineered nucleic acid molecule comprises the stem loop comprising the editable codon susceptible to editing by the ADAR protein. In some embodiments, (1) in (a), the fourth nucleic acid sequence is hybridized or partially hybridized to all or a portion of the first nucleic acid sequence; and (2) in (b), upon hybridizing the first region of the target RNA to the first nucleic acid sequence and hybridizing the third nucleic acid sequence to the second region of the target RNA, the fourth nucleic acid sequence or a portion thereof dehybridizes from all or a portion of the first nucleic acid sequence. In some embodiments, (1) in (a), the fourth nucleic acid sequence is hybridized or partially hybridized or partially hybridized to all or a portion of the third nucleic acid sequence; and (2) in (b), upon hybridizing the first region of the target RNA to the first nucleic acid sequence and hybridizing the third nucleic acid sequence to the second region of the target RNA, the fourth nucleic acid sequence or a portion thereof dehybridizes from all or a portion of the third nucleic acid sequence. In some embodiments, wherein: (1) in (a), the fourth nucleic acid sequence is hybridized or partially hybridized to all or a portion of the third nucleic acid sequence; and (2) in (b), upon hybridizing the first region of the target RNA to the first nucleic acid sequence and hybridizing the third nucleic acid sequence to the second region of the target RNA, the fourth nucleic acid sequence or a portion thereof dehybridizes from all or a portion of the third nucleic acid sequence. In some embodiments, (1) in (a), the fourth nucleic acid sequence is hybridized or partially hybridized to all or a portion of the first nucleic acid sequence, all or a portion of the second nucleic acid sequence, and all or a portion of the third nucleic acid sequence; and (2) in (b), upon hybridizing the first region of the target RNA to the first nucleic acid sequence and hybridizing the third nucleic acid sequence to the second region of the target RNA, the fourth nucleic acid sequence or a portion thereof dehybridizes from all or a portion of the first nucleic acid sequence, all or a portion of the second nucleic acid sequence, and all or a portion of the third nucleic acid sequence. In some embodiments, the method further comprises subjecting the editable codon of the stem loop to ADAR editing. In some embodiments, the engineered nucleic acid molecule comprises a protein coding sequence that encodes a protein. In some embodiments, (i) the editable codon is a stop codon; (ii) after (b), the method further comprises editing the stop codon such that it is no longer a stop codon; and (iii) the method further comprises, after (b), expressing the protein. In some embodiments, (i) the editable codon is a start codon; and (ii) after (b), the method further comprises editing the start codon such that it is no longer a start codon; and (iii) as a result of the start codon no longer beingAtty Dkt No.: 65785-704601 a start codon, expression of the protein from the engineered nucleic acid molecule cannot occur. In some embodiments, the method further comprises, prior to (b), administering the engineered nucleic acid molecule to a subject.

[0009] In some aspects, provided herein is a method for expressing a protein in a target cell, the method comprising: combining the target cell with a sensor RNA comprising the following: (i) a first half-sensor sequence comprising a first sequence capable of hybridizing to a first region of a target RNA expressed in said target cell; (ii) a trigger sequence containing a stop codon; (iii) a stem-loop sequence, comprising an anti-trigger sequence capable of hybridizing to said trigger sequence containing said stop codon, and comprising a mismatch at said stop codon; a second half-sensor sequence comprising a second sequence capable of hybridizing to a second region of said target RNA; and an anti-anti-trigger sequence complementary to said ant-trigger sequence wherein said first half-sensor sequence and said second half-sensor sequence are configured such that: (a) in the absence of said target RNA, said anti-trigger sequence and said anti-anti trigger sequence are bound and said stop codon is not editable by ADAR; and (b) in the presence of said target RNA, said trigger sequence binds said anti-trigger sequence and said stop codon is editable by ADAR.

[0010] In some aspects, provided herein is a method for expressing a protein in a target cell, the method comprising: combining the target cell with a sensor RNA comprising the following: (i) a first half-sensor sequence comprising a first sequence capable of hybridizing to a first region of a target RNA expressed in said target cell; (ii) a stem-loop sequence, comprising a trigger sequence containing a stop codon; and a second half-sensor sequence comprising a second sequence capable of hybridizing to a second region of said target RNA; and a first anti -trigger sequence capable of hybridizing to said trigger sequence containing said stop codon, but not comprising a mismatch at said stop codon; and (iii) a second anti-trigger sequence between said first half-sensor sequence and said stem loop sequence, said second anti-trigger sequence being capable of hybridizing to said trigger sequence containing said stop codon but comprising a mismatch at said stop codon; wherein said first half-sensor sequence and said second half-sensor sequence are configured such that: (a) in the absence of said target RNA, said trigger sequence binds said first anti-trigger sequence and said stop codon is not editable by ADAR; and (b) in the presence of said target RNA, said trigger sequence binds said second-anti-trigger sequence and is editable by ADAR.INCORPORATION BY REFERENCE

[0011] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.Atty Dkt No.: 65785-704601BRIEF DESCRIPTION OF THE DRAWINGS

[0012] The novel features of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings of which:

[0013] FIG. 1 shows an example of the RNA sensor comprising an editable codon in the upstream part of the stem -loop (USTA) and the Decoy Sequence (the “DecSeq”) hybridizes to the Downstream Stem-Loop Arm (DSTA). In the absence of a target RNA, the DecSeq hybridizes with the DSTA and there is no editing of the editable codon because it is in a single-stranded region of RNA. In the presence of target RNA, the USTA hybridizes to the DSTA to form a stemloop with the DSTA, enabling editing of the editable codon by the ADAR protein.

[0014] FIG. 2 shows an example of the RNA sensor comprising an editable codon in the upstream part of the stem-loop (USTA), and the DecSeq hybridizes to the USTA. In the absence of a target RNA, the DecSeq hybridizes with the DSTA. In the presence of target RNA, the USTA hybridizes to the DSTA to form a stem-loop containing the editable codon, enabling editing by the ADAR protein. The RNA sensor also contains an optional editing inhibiting sequence in the DecSeq.

[0015] FIG. 3 shows an example of the RNA sensor comprising an editable codon in the downstream part of the stem-loop (DSTA), and the DecSeq hybridizes to the DSTA. In the absence of a target RNA, the DecSeq hybridizes with the DSTA. In the presence of target RNA, the DSTA hybridizes to the USTA to form a stem-loop containing the editable codon, enabling editing by the ADAR protein. The RNA sensor also contains an optional editing inhibiting sequence in the DecSeq.

[0016] FIG. 4 shows an example of the RNA sensor comprising an editable codon in the DSTA and the DecSeq hybridizes to the USTA. In the absence of a target RNA, the DecSeq containing an editing inhibiting sequence hybridizes with the USTA. In the presence of target RNA, the DSTA hybridizes to the USTA to form a stem-loop containing the editable codon, enabling editing by the ADAR protein.

[0017] FIGs. 5A-5B show the conformational change of an RNA sensor. FIG. 5A shows the structure of the RNA sensor without the target RNA: a decoy sequence (DecSeq) prevents a Upstream Stem-Loop Arm (USTA) and a Downstream Stem-Loop Arm (DSTA) from hybridizing with each other to form a stem-loop. FIG. 5B shows the structure of the RNA sensor once bound to the target RNA: the USTA and the DSTA form a stem-loop. The target RNA is represented by the bottom strand in FIG. 5B, base 197 onwards. Bases 1-39: UTBR; 32-79: DecSeq target; 40- 106: USTA+DSTA; 45: target A; 107-142: DTBR; 143-190: DecSeq.Atty Dkt No.: 65785-704601

[0018] FIGs. 6A-6E demonstrate the ADAR editing rate (observed A>I editing) of RNA sensors as measured by the observed frequency of Guanine (G) at the positions of the target Adenosine (A) in the editable codon TAG. The RNA sensors were introduced to cells expressing the target RNA (e.g., target cells), and cells without the target RNA (e.g., non-target cells) were used as a control. An editing ratio of A to G conversion in target versus non-target cells was calculated in each experiment. The solid line with circles indicates the editing frequency in target cells for all A nucleotides within the analyzed region. The dashed line with diamonds indicates the editing frequency in non-target cells for the same nucleotide positions. The numbers indicate the observed target codon editing rate as assessed by next-generation sequencing. A schematic of the RNA sensor sequence used to generate the data has been included above the x-axis in each graph, below the editing rate data. The solid line is the upstream target binding region (UTBR), the dotted line is the stem-loop (comprised of the upstream and downstream stem-loop arms USTA and DSTA), the dashed line is the downstream target binding region (DTBR), the dash-dotted line is the decoy sequence (DecSeq) and the dash-dot-dotted line indicates the target of the decoy sequence (what it is reverse-complementary to). The single circle indicates the position of the target / editable A.

[0019] FIG. 6A shows the frequency of editing of RNA sensor 1 (52.2%) and an editing ratio of 5.4 (target to non-target cell). The DecSeq of RNA sensor 1 can hybridize to a portion of UTBR and a portion of the stem-loop formed by USTA and DSTA. FIG. 6B shows the frequency of editing of RNA sensor 2 (near 100%) and an editing ratio of 38.6 (target to non-target cell). The DecSeq of RNA sensor 2 can hybridize to a portion of UTBR. FIG. 6C shows the frequency of editing of RNA sensor 3 (31.4%) and an editing ratio of 33.6 (target to non-target cell). The DecSeq of RNA sensor 3 can hybridize to a portion of USTA and a portion of DSTA. FIG. 6D shows the frequency of editing of RNA sensor 4 (5.1%) and an editing ratio of 13.3 (target to non- target cell). The DecSeq of RNA sensor 4 can hybridize to a portion of DTBR. FIG. 6E shows the frequency of editing of RNA sensor 5 (36.2%) and an editing ratio of 12.5 (target to non-target cell). The DecSeq of RNA sensor 5 can hybridize to a portion of USTA.

[0020] FIG. 7 demonstrates the improvement in editing ratio from adding a Decoy Sequence (DecSeq) to an RNA sensor. The graph compares an RNA sensor with a stem-loop but without a DecSeq to one that includes the same stem-loop and a DecSeq. The diamonds indicate RNA sensors without a DecSeq, while the circles represent RNA sensors that include a DecSeq. Sensors were evaluated in a pooled manner using lentiviral vectors to achieve one integration per cell of a sensor construct. RNA from the cells expressing the sensors was then extracted and sequenced. The rate of TAG (unedited) versus TGG (edited) reads was calculated using next-generation sequencing. The editing ratio depicted here is the ratio of editing rates in target cells comprising a target RNA (HeLa-hLUM) over non-target cells that do not comprise a target RNA (HeLa).Atty Dkt No.: 65785-704601DETAILED DESCRIPTION

[0021] Recognized herein is an unmet need for improving early-generation RNA sensors and RNA therapeutics that use adenosine deaminases acting on RNA (ADAR) to make single-base modifications of specific RNA sequences. Previously described RNA sensors using ADAR editing have desirable properties but may exhibit high baseline signaling. This refers to the expression of the output or payload (e.g., a protein) even when the target, input, or trigger RNA (e.g., mRNA in a cell) is not present. This occurs because the editing substrate of these RNA sensors (e.g., a stem-loop comprising the editable codon) is continuously present and can spontaneously bind to ADAR, resulting in ADAR editing even in the absence of the target RNA.

[0022] The present disclosure provides a solution to these technical problems. The disclosure describes an RNA sensor that changes configuration / form in response to binding to a target RNA, such that an editable moiety (e.g., an editable codon) becomes editable by ADAR upon the change in configuration / form. The formation of an editable stem-loop in the RNA sensor described herein is conditional upon binding to a target RNA, greatly reducing baseline levels of ADAR editing. In some cases, the RNA sensor described herein can further comprise an inhibitory sequence, which allows the RNA sensor to form at least two structures / configurations: 1) an editable configuration comprising an editable stem-loop in the presence of the target RNA and 2) a non- editable configuration in the absence of the target RNA. In some embodiments, the editable stemloop comprises a codon editable by ADAR. The editable codon can be a stop codon, a start codon, or a near-start codon (e.g., AU A). In some aspects, the present disclosure provides compositions, kits, methods, and systems for the RNA sensor described herein.Definitions

[0023] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art. Singleton, et al., Dictionary of Microbiology and Molecular Biology, 2d ed., John Wiley and Sons, New York (1994), and Hale & Markham, The Harper Collins Dictionary of Biology, Harper Perennial, N.Y. (1991) provide one of skill with the general meaning of many of the terms used herein.

[0024] The terminology used herein is for the purpose of describing particular embodiments and is not intended to be limiting. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms "including", "includes", "having", "has", "with", or variants thereof as used herein mean "comprising."

[0025] Unless otherwise specified, all ranges disclosed herein also encompass all possible subranges and combinations of sub-ranges thereof.Atty Dkt No.: 65785-704601

[0026] Unless otherwise specified, the words "comprising", "comprise", "comprises", "having", "have", "has", "including", "includes", "include", "containing", "contains" and "contain" are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0027] Reference to "some embodiments", "an embodiment", "one embodiment", or "other embodiments" means that a particular feature or characteristic described in connection with the embodiments is included in at least one or more embodiments, but not necessarily all embodiments, of the present disclosure.

[0028] The term "about" or "approximately" in relation to a numerical means, a range of values that fall within 10% greater than or less than the value. For example, about x means x ± (10% * x).

[0029] The term "substantially" as used herein may refer to a value approaching 100% of a given value. In some embodiments, the term may refer to an amount that may be at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.9%, or at least 99.99% of a total amount. In some embodiments, the term may refer to an amount that may be about 100% of a total amount.

[0030] The terms "protein" and "polypeptide" can be used interchangeably to refer to a polymer of two or more amino acids joined by covalent bonds (e.g., an amide bond) that can adopt a three- dimensional conformation. In some embodiments, a protein or polypeptide comprises at least 10 amino acids, 15 amino acids, 20 amino acids, 30 amino acids or 50 amino acids joined by covalent bonds (e.g., amide bonds). In some embodiments, a protein comprises at least two amide bonds. In some embodiments, a protein comprises multiple amide bonds. In some embodiments, a protein may be a full-length protein (e.g., a fully processed protein having certain biological function). In some embodiments, a protein may be a variant or a fragment of a full-length protein. A variant of a protein or enzyme can comprise a polypeptide having an amino acid sequence that is about 60% identical, about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 96% identical, about 97% identical, about 98% identical, about 99% identical, about 99.5% identical, or about 99.9% identical to the amino acid sequence of a reference protein.

[0031] As used herein, the term “exogenous” refers to a nucleic acid or protein not normally or naturally found in or produced by a given bacterium, organism, or cell in nature. As used herein, the term “endogenous” refers to a nucleic acid or protein that is normally found in or produced by a given bacterium, organism, or cell in nature.

[0032] As used herein, the term "polypeptide domain", "protein domain", or "domain" when used in the context of a protein or polypeptide, refers to a polypeptide chain that has one or more biological functions. In some embodiments, a protein comprises multiple protein domains. In some embodiments, a protein comprises multiple protein domains that are naturally occurring. InAtty Dkt No.: 65785-704601 some embodiments, a protein comprises multiple protein domains from different naturally occurring proteins. A protein that comprises amino acid sequences from different origins or naturally occurring proteins may be referred to as a fusion, or a chimeric protein.

[0033] The term "function" and its grammatical equivalents as used herein may refer to a capability of operating, having, or serving an intended purpose. Functional may comprise any percent from baseline to 100% of an intended purpose. For example, functional may comprise or comprise about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or up to 100% of an intended purpose. In some embodiments, the term functional may mean over 100% of normal function, for example, about 125%, about 150%, about 175%, about200%, about250%, about 300%, about 400%, about 500%, about 600%, about 700% or up to 1000% of an intended purpose.

[0034] As used herein, a "functional fragment" or "functional portion", refers to any portion of a reference protein (e.g., a wild-type protein) that encompasses less than the entire amino acid sequence of the reference protein while retaining one or more of the functions, e.g., catalytic or binding functions. When the reference protein is a fusion of multiple functional domains, a functional fragment thereof may retain one or more of the functions of at least one of the functional domains.

[0035] A "functional variant" or "functional mutant", as used herein, refers to any variant or mutant of a reference protein (e.g., a wild-type protein) that encompasses one or more alterations to the amino acid sequence of the reference protein while retaining one or more of the functions, e.g., catalytic or binding functions. In some embodiments, the one or more alterations to the amino acid sequence comprises amino acid substitutions, insertions or deletions, or any combination thereof. In some embodiments, the one or more alterations to the amino acid sequence comprises amino acid substitutions.

[0036] The term "isolated" means free or removed to varying degrees from components which normally accompany it as found in the natural state or environment. For example, a polypeptide naturally present in a living animal is not isolated, and the same polypeptide partially or completely separated from the coexisting materials of its natural state is isolated.

[0037] The terms "homologous," "homology," or "percent homology" as used herein refer to the degree of sequence identity between an amino acid and a corresponding reference amino acid sequence or a polynucleotide sequence and a corresponding reference polynucleotide sequence. "Homology" can refer to polymeric sequences, e.g., polypeptide or nucleic acid sequences that are similar. Homology can mean, for example, nucleic acid sequences with at least: 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, atAtty Dkt No.: 65785-704601 least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity. In other embodiments, a "homologous sequence" of nucleic acid sequences may exhibit 93%, 95% or 98% sequence identity to the reference nucleic acid sequence. For example, a "region of homology to an mRNA sequence" can be a region of an RNA that has a similar sequence to a given region in an mRNA. Similarly, a region of homology can be a portion of a RNA molecule that is sufficient in length and sequence identity to the reverse complement of a nucleotide sequence in an mRNA region to promote binding of the RNA molecule to the mRNA region. For example, the region of homology can comprise at least 5, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 200, at least 300, at least 400 or more bases in length such that the region of homology has sufficient homology to the reverse complement of the mRNA to undergo binding with the corresponding mRNA region.

[0038] When a percentage of sequence homology or identity is specified, in the context of two nucleic acid sequences or two polypeptide sequences, the percentage of homology or identity generally refers to the alignment of two or more sequences across a portion of their length when compared and aligned for maximum correspondence. When a position in the compared sequence can be occupied by the same base or amino acid, then the molecules can be homologous at that position. Unless stated otherwise, sequence homology or identity is assessed over the specified length of the nucleic acid, polypeptide or a portion thereof. In some embodiments, the homology or identity is assessed over a functional portion or specified portion of the length. To evaluate the sequence identity or homology of nucleic acid binding partners, analysis can be performed to first determine the reverse complement of one of the nucleic acid binding partners prior to determining their sequence identity or homology.

[0039] Alignment of sequences for assessment of sequence homology can be conducted by an algorithm, such as the Basic Local Alignment Search Tool (BLAST) algorithm, which is described in Altschul et al, J. Mol. Biol. 215:403- 410, 1990. A publicly available, internet interface, for performing BLAST analyses is accessible through the National Center for Biotechnology Information. Additional algorithms include those published in: Smith & Waterman, "Comparison of Biosequences", Adv. Appl. Math. 2:482, 1981; Needleman & Wunsch, "A general method applicable to the search for similarities in the amino acid sequence of two proteins" J. Mol. Biol. 48:443, 1970; Pearson & Lipman "Improved tools for biological sequence comparison", Proc.Atty Dkt No.: 65785-704601Natl. Acad. Sci. USA 85:2444, 1988; or by automated implementation of these or similar algorithms. Global alignment programs may also be used to align similar sequences of roughly equal size. Examples of global alignment programs include NEEDLE (available at www.ebi.ac.uk / Tools / psa / emboss_needle / ) which is part of the EMBOSS package (Rice Pet al., Trends Genet., 2000; 16: 276-277), and the GGSEARCH program https: / / fasta.bioch.virginia.edu / fasta_www2 / , which is part of the PASTA package (Pearson Wand Lipman D, 1988, Proc. Natl. Acad. Sci. USA, 85: 2444-2448). Both of these programs are based on the Needleman-Wunsch algorithm which is used to find the optimum alignment (including gaps) of two sequences along their entire length. A detailed discussion of sequence analysis can also be found in Unit 19.3 of Ausubel et al ("Current Protocols in Molecular Biology" John Wiley & Sons Inc, 1994-1998, Chapter 15, 1998). Unless otherwise specified, alignment between a query sequence and a reference sequence is performed with Needleman- Wunsch alignment with Gap Costs set to Existence: 11 Extension: 1 where percent identity is calculated by dividing the number of identities by the length of the alignment, as further described in Altschul et al. ("Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402, 1997) and Altschul et al, ("Protein database searches using compositionally adjusted substitution matrices", FEBS J. 272:5101-5109, 2005).

[0040] The term "polynucleotide" or "nucleic acid molecule" can be any polymeric form of nucleotides, including DNA, RNA, or RNA-DNA chimeric molecules. In some embodiments, a polynucleotide comprises mRNA or cDNA. In some embodiments, a polynucleotide is doublestranded, e.g., a double-stranded DNA in a gene. In some embodiments, a polynucleotide is singlestranded or substantially single-stranded, e.g., single-stranded RNA, IncRNA, or an mRNA. In some embodiments, a polynucleotide comprises modified nucleotides.

[0041] As used herein, the terms "modified" or "modification" as applied to polynucleotides refers to chemical modification with respect to the A, C, G, T and U nucleotides, and is indicated as mA, mC, mG, mT, and mT. In some embodiments, modifications may be on the nucleoside base and / or sugar portion of the nucleosides that comprise the polynucleotide. In some embodiments, the modification may be on the internucleoside linkage (e.g., phosphate backbone). In some embodiments, multiple modifications are included in the modified nucleic acid molecule. In some embodiments, a single modification is included in the modified nucleic acid molecule.

[0042] The term "complement", "complementary", or "complementarity" as used herein, refers to the ability of two polynucleotide molecules to base pair with each other. Examples of complementarity can include an adenine on one polynucleotide molecule base pairing to a thymine or an uracil on a second polynucleotide molecule and a cytosine on one polynucleotide molecule base pairing to guanine on a second polynucleotide molecule. In addition, a guanine on oneAtty Dkt No.: 65785-704601 polynucleotide molecule will form a “wobble base pair” to an uracil on a second polynucleotide. Two polynucleotide molecules are complementary to each other when a first polynucleotide molecule comprising a first nucleotide sequence can base pair with a second polynucleotide molecule comprising a second nucleotide sequence. For instance, the two RNA molecules 5'- AUGC-3' and 5'-GCAU-3' are complementary, and the complement of the RNA molecule 5'- AUGC-3' is 5'-GCAU-3'. A percentage of complementarity can indicate the percentage of nucleotides in a polynucleotide molecule which can base pair with a second polynucleotide molecule (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary, respectively).

[0043] "Perfectly complementary" means that all the contiguous nucleotides of a polynucleotide molecule can base pair with the same number of contiguous nucleotides in a second polynucleotide molecule. "Substantially complementary" as used herein refers to a degree of complementarity that can be 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% over all or a portion of two polynucleotide molecules. In some embodiments, the portion of complementarity may be a region of 10, 15, 20, 25, 30, 35, 40, 45, 50, or more nucleotides. "Substantial complementary" can also refer to a 100% complementarity over a portion or a region of two polynucleotide molecules. In some embodiments, the portion or the region of complementarity between the two polynucleotide molecules is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% of the length of at least one of the two polynucleotide molecules or a functional or defined portion thereof.

[0044] As used herein, "reverse complement" refers to a nucleic acid sequence derived from an original sequence by first reversing the order of the nucleotides and then replacing each nucleotide with its complementary base pair. For example, for an RNA sequence, Adenine (A) is replaced by Uracil (U), and Guanine (G) is replaced by Cytosine (C). A nucleic acid sequence that is reverse complement of the original strand can bind to the original strand.

[0045] As used herein, a “construct” or “vector” refers to a recombinant nucleic acid, generally recombinant DNA, which has been generated for the purpose of expressing or propagating a nucleic acid of interest, or is to be used in the construction of other recombinant nucleic acids.

[0046] In some embodiments, a vector comprises a minicircle, plasmid, nanoplasmid, yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC), cosmid, phagemid, bacteriophage genome, baculovirus genome, or any combination thereof. Suitable vectors also include vectors derived from bacteriophages or plant, invertebrate, or animal (including human) viruses such as CELiD vectors, doggybone DNA (dbDNA) vectors, and closed-end linear duplex DNA vectors (e.g. wherein each end is covalently closed by chemical modification). In some embodiments, the vectors are adeno-associated viral vectors (e.g. AAV1, AAV2, AAV4, AAV5,Atty Dkt No.: 65785-704601AAV6, AAV7, AAV8, AAV9, or pseudotyped combinations thereof such as AAV2 / 5, AAV2 / 2, AAV-DJ, or AAV-DJ8), retroviral vectors (e.g. MLV or self-inactivating or SIN versions thereof, or pseudotyped versions thereof), herpes viral vectors (e.g. HS V- or EB V-based), lentiviral vectors (e.g. HIV-, FIV-, or EIAV-based, or pseudotyped versions thereof), or adenoviral vectors (e.g. Ad5-based, including replication-deficient, replication-competent, or helper-dependent versions thereof). In some embodiments, the viral vector is derived from an alphavirus, flavivirus, herpes virus, measles virus, rhabdovirus, Newcastle disease virus (NDV), poxvirus, or picornavirus.

[0047] “Expression vectors” are vectors that are designed to enable the expression of an inserted nucleic acid sequence. Expression vectors may comprise elements that provide for or facilitate transcription of nucleic acids that are cloned into the vectors. Such elements can include, e.g., promoters and / or enhancers operably coupled to a nucleic acid of interest. Suitable promoters of the present disclosure can comprise a SFFV promoter, a hEFla, a CMV promoter or a variant thereof, an inducible promoter, a CMV-tetO promoter, a tissue or cell specific promoter, or any combination thereof.

[0048] As used herein, "expression" refers to the process by which polynucleotides are transcribed into RNA (e.g., mRNA) and / or the process by which polynucleotides (e.g., mRNA or pre- mRNA)are further processed into non-coding RNA, peptides, polypeptides, proteins, or any combination thereof.

[0049] The term "encode" as it is applied to polynucleotides refers to a polynucleotide which is said to "encode" another polynucleotide, a polypeptide, or an amino acid if, in its native state or when manipulated, it can be used as polynucleotide synthesis template, e.g., transcribed into an RNA (e.g., coding RNA or non-coding RNA), reverse transcribed into a DNA or cDNA, and / or translated to produce an amino acid, or a polypeptide or a fragment thereof. In some embodiments, a polynucleotide comprising three contiguous nucleotides form a codon that encodes a specific amino acid. In some embodiments, a polynucleotide comprises one or more codons that encode a polypeptide. In some embodiments, a polynucleotide comprising one or more codons comprises a mutation in a codon compared to a wild-type reference polynucleotide. In some embodiments, the mutation in the codon encodes an amino acid substitution in a polypeptide encoded by the polynucleotide as compared to a wild-type reference polypeptide. In some embodiments, a polynucleotide encodes another polynucleotide comprising a coding RNA or a non-coding RNA. In some embodiments, the coding RNA comprises mRNA or pre-mRNA. In some embodiments, the non-coding RNA comprises microRNA (miRNA), small interfering RNA (siRNA), long noncoding RNA (IncRNA), or any combination thereof. In some embodiments, a polynucleotide encodes another polynucleotide which contains one or more target nucleotide edits to be installed in a target DNA or RNA.Atty Dkt No.: 65785-704601

[0050] The term "mutation" as used herein refers to a change and / or alteration in an amino acid sequence of a protein or nucleic acid sequence of a polynucleotide. Such changes and / or alterations may comprise the substitution, insertion, deletion and / or truncation of one or more amino acids, in the case of an amino acid sequence, and / or nucleotides, in the case of nucleic acid sequence, compared to a reference amino acid or a reference nucleic acid sequence. In some embodiments, the reference sequence is a wild-type sequence. In some embodiments, a mutation in a nucleic acid sequence of a polynucleotide encodes a mutation in the amino acid sequence of a polypeptide. In some embodiments, the mutation in the amino acid sequence of the polypeptide or the mutation in the nucleic acid sequence of the polynucleotide is a mutation associated with a disease state.

[0051] The terms “regulatory region” and “regulatory elements”, generally used interchangeably herein, generally refer to transcriptional and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, protein degradation signals, translational start and stop codons, translation initiation sites, splice enhancer / donor / branch / acceptor sites, and the like, that provide for or regulate expression of a coding sequence or production of an encoded polypeptide in a host cell. As used herein, a "promoter sequence" or “promoter” is a DNA regulatory region capable of binding / recruiting RNA polymerase (e.g., via a transcription initiation complex) and initiating transcription of a downstream (3' direction) sequence (e.g., a protein coding (“coding”) or nonprotein-coding (“non-coding”) sequence. A promoter can be a constitutively active promoter (e.g., a promoter that is constitutively in an active / ”ON” state), it may be an inducible promoter (e.g., a promoter whose state, active / ”ON” or inactive / “OFF”, is controlled by an external stimulus, e.g., the presence of a particular temperature, compound, or protein), it may be a spatially restricted promoter (e.g., tissue specific promoter, cell type specific promoter, etc.), or it may be a temporally restricted promoter (e.g., the promoter is in the “ON” state or “OFF” state during specific stages of embryonic development or during specific stages of a biological process, e.g., hair follicle cycle in mice).

[0052] As used herein, the term "operably linked" generally refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. In some embodiments, a component is operably linked to a nucleotide sequence to affect or modulate its transcription (e.g., a promoter is operably linked to a nucleotide sequence if the promoter affects transcription of the nucleotide sequence). In some embodiments, a component is operably linked to a nucleotide sequence to affect or modulate its translation (e.g., a translation initiation site such as a Kozak consensus sequence is operably linked to a nucleotide sequence if the Kozak consensus sequence affects translation of the nucleotide sequence).Atty Dkt No.: 65785-704601

[0053] The term "subject" and its grammatical equivalents as used herein may refer to a human or a non-human. A subject may be a mammal. A human subject may be male or female. A human subj ect may be of any age. A subj ect may be a human embryo. A human subj ect may be a newborn, an infant, a child, an adolescent, or an adult. A human subject may be in need of a treatment for a disease or disorder, e.g., a genetic disease or disorder, a cancer, an autoimmune, immunological or inflammatory disease or disorder, or a neurological disease or disorder. Alternatively, the human subject may be a healthy subject.

[0054] The terms "treatment" or "treating" and their grammatical equivalents may refer to the medical management of a subject with an intent to cure, ameliorate, or ameliorate a symptom of, a disease, condition, or disorder. Treatment may include active treatment, that is, treatment directed specifically toward the improvement of a disease, condition, or disorder. Treatment may include causal treatment, that is, treatment directed toward removal of the cause of the associated disease, condition, or disorder. In addition, this treatment may include palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, condition, or disorder. Treatment may include supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the disease, condition, or disorder. In some embodiments, a condition may be pathological. In some embodiments, a treatment may not completely cure or prevent a disease, condition, or disorder. In some embodiments, a treatment ameliorates, but does not completely cure or prevent a disease, condition, or disorder. In some embodiments, a subject may be treated for about 12 hours, about 24 hours, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 2 weeks, about 3 weeks, about 4 weeks, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 1 year, about 2 years, about 3 years, about 4 years, about 5 years, about 6 years, indefinitely, or for the life of the subject.

[0055] The term "ameliorate" and its grammatical equivalents means to decrease, suppress, attenuate, diminish, arrest, or stabilize the development or progression of a disease.

[0056] The terms "prevent" or "preventing" means delaying, forestalling, or avoiding the onset or development of a disease, condition, or disorder for a period of time. Prevent also means reducing risk of developing a disease, disorder, or condition. Prevention includes minimizing or partially or completely inhibiting the development of a disease, condition, or disorder. In some embodiments, a composition, e.g., a pharmaceutical composition, prevents a disorder by delaying the onset of the disorder for about 12 hours, about 24 hours, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 2 weeks, about 3 weeks, about 4 weeks, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 1 year,Atty Dkt No.: 65785-704601 about 2 years, about 3 years, about 4 years, about 5 years, about 6 years, indefinitely, or for the life of the subject.

[0057] The term "effective amount" or "therapeutically effective amount" refers to a quantity of a composition that can be sufficient to result in an intended therapeuticactivity upon introduction into a subject (e.g., a human subject) as disclosed herein. An effective amount of the compositions can be provided to the target cell, tissue or subject. In some embodiments, the "effective amount" or "therapeutically effective amount" is the amount of a composition that is sufficient to ameliorate the symptoms of a disease relative to an untreated patient. In some embodiments, the "effective amount" or "therapeutically effective amount" is the amount of a composition that is sufficient to prevent the symptoms of a disease relative to an untreated patient. In some embodiments, the “effective amount” defines an amount that can be administered to a subject without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio, but one that is sufficient to provide the intended therapeutic effect, e.g. the treatment or prophylaxis manifested by a permanent or temporary improvement in the subject's condition. The amount can vary from subject to subject, depending on the age and general condition of the individual, mode of administration and other factors.

[0058] An effective amount can be the amount to induce, for example, about a 2-fold change (e.g., increase) or more in the amount of output nucleic acid (e.g., RNA) modulation (e.g., expression of an output RNA to produce a functional protein) observed relative to a negative control. In some embodiments, an effective amount or dose can induce, for example, about 2-fold increase, about 3- fold increase, about 4-fold increase, about 5-fold increase, about 6-fold increase, about 7- fold increase, about 8-fold increase, about 9-fold increase, about 10-fold increase, about 25-fold increase, about 50-fold increase, or about 100-fold increase in output nucleic acid modulation.

[0059] The amount of output nucleic acid modulation may be measured by any suitable method. In some embodiments, the "effective amount" or "therapeutically effective amount" is the amount of a composition that can ameliorate the symptoms of a disease relative to an untreated patient.

[0060] In some embodiments, an effective amount can be an amount to induce, when administered to a population of cells, the amount sufficient to obtain a certain percentage of the population of cells to express the output (e.g., as RNA or as translated protein). For example, in some embodiments, an effective amount can be the amount to induce, when administered to or introduced to a population of cells, expression of the output, in at least 1%, at least2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of the population of cells.Atty Dkt No.: 65785-704601

[0061] In some embodiments, an effective amount can be an amount to induce, when administered to population of cells, the amount sufficient to obtain a certain quantity of RNA or expressed protein of the output of interest. In some embodiments, an effective amount can be the amount to induce, when administered to or introduced to a population of cells, expression of the output, in at least 1%, at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of the population of cells.

[0062] As used herein, the term “in combination” in the context of the administration of two or more therapies to a subject, refers to the use of more than one therapy (e.g., more than one prophylactic agent and / or therapeutic agent). The use of the term "in combination" does not restrict the order in which therapies are administered to a subject.

[0063] As used herein, the terms “disease” and “disorder” are used interchangeably to refer to a condition in a subject. The condition can impair physiological function and may be associated with specific symptoms.

[0064] The term “pharmaceutically acceptable carrier” is generally intended to denote any material, which is an inert or inactive substance that does not have a therapeutic and / or prophylactic effect per se, which is added to a pharmaceutical composition to further facilitate administration of a compound. The term “carrier” can refer to a diluent, adjuvant, excipient, or vehicle with which the pharmaceutical composition is administered. Such an excipient is added with the purpose of making it possible to obtain a pharmaceutical composition having acceptable technical properties and suits the mode of administration. Examples of suitable pharmaceutically acceptable carriers or diluents can include, but are not limited to, ethanol, water, saline solutions, glycerol, propylene glycol, glycerin, diethylene glycol monoethylether, vitamin A and E oils, mineral oil, PPG2 myristyl propionate, magnesium carbonate, potassium phosphate, silicon dioxide, vegetable oils, plant gums, gelatin, animal oils, solketal, calcium carbonate, dibasic calcium phosphate, tribasic calcium phosphate, calcium sulfate, microcrystalline cellulose, powdered cellulose, dextrans, dextrin, dextrose, fructose, kaolin, lactose, mannitol, sorbitol, starch, pregelatinized starch, sucrose, glucose, lactose, maltose, sodium stearate, glycerol monostearate and the like.

[0065] As used herein, the term "primary cell" means a cell isolated from an organism, e.g., a mammal, which is grown in tissue culture (i.e., in vitro) for the first time before subdivision and transfer to a subculture. In some embodiments, the primary cell is a human primary cell.

[0066] The term “adenosine deaminase acting on RNA” or “ADAR” refers to a family of enzymes that catalyzes the hydrolytic C6 deamination of adenosine (A) to produce inosine (I) in RNAAtty Dkt No.: 65785-704601 substrates that are substantially double stranded. ADARs preferentially edit double-stranded RNAs at sites of mismatches where mismatches containing adenosines and cytosines are edited more efficiently than other mismatches. Editing by ADARs results in nucleotide substitution in RNA, because the purine I generated as the result of the deamination reaction is recognized as G instead of A, both by ribosomes during translational decoding of mRNA and by RNA-dependent polymerases during RNA replication. Unless otherwise specified, the term “ADAR” encompasses any type, isoform, or subunits of ADAR such as AD ARI (ADAR), ADARl-pl50 or ADAR2 (ADARB2).

[0067] Unless otherwise specified, the term “ADAR” may be any ADAR protein from any species. In some embodiments, the ADAR is mammalian derived (e.g., from human, mouse, rat, primate or rabbit). In some embodiments, the ADAR is human. In some embodiments, the ADAR is exogenous and is provided to the cell or organism as a nucleic acid or a protein. In some embodiments, the ADAR is endogenous, and it is found as a nucleic acid or protein in a given cell or organism at least during a part of the cell’s or organism’s life cycle.

[0068] Conversion of adenosine to inosine in an mRNA can result in a codon change, leading to an amino acid substitution in an encoded protein, extension of an encoded protein (e.g., through editing of an A in a stop codon to permit read-through during translation), initiating protein translation (e.g., through editing of the near-start codon AUA to the start codon AUG), or preventing translation of an encoded protein (e.g., through editing the start codon of the protein to destroy it). As used herein, “AD ARI” generally refers to an ADAR that catalyzes the hydrolytic C6 deamination of adenosine (A) to produce inosine (I) in RNA substrates that are double stranded. AD ARI can have 2 main isoforms, pl50 and pl 10. The term “AD ARI” can encompass ADAR1 from various species. Amino acid sequences of ADAR1 from various species can be publicly available. See, e.g., GenBank Accession Nos. NP_001102 (Homo sapiens AD ARI pl 50), NP 001180424.1 (Homo sapiens AD ARI pl 10), NP_001139768 (Mus musculus AD ARI pl50), NP 001033676 (Mus musculus ADAR1 pl 10). The term "ADAR1" as used herein can also encompass polypeptide domains, fusion proteins, or variants thereof (e.g., variants having one or more amino acid substitutions, addition, deletions, or insertions) that retain ADAR1 enzymatic activity.

[0069] As used herein, “ADAR2” generally refers to an ADAR that catalyzes the hydrolytic C6 deamination of adenosine (A) to produce inosine (I) in RNA substrates that are double stranded. ADAR2 can be localized to the nucleus. The term “ADAR2” can encompass ADAR2 from various species. Amino acid sequences of ADAR2 from various species can be publicly available. See, e.g., GenBank Accession Nos. NP_056648.1 (Homo sapiens ADAR2), NP_001020008.1 (Mus musculus ADAR2), ACO52474.1 (Doryteuthis opalescens ADAR2). The term "ADAR2" as usedAtty Dkt No.: 65785-704601 herein can also encompass polypeptide domains, fusion proteins, and variants thereof (e.g., variants having one or more amino acid substitutions, addition, deletions, or insertions) that retain ADAR2 enzymatic activity.

[0070] The term “editable codon” as used herein generally refers to a 3 -nucleotide sequence that is editable by an ADAR protein, or a polypeptide domain, fusion protein, or variant thereof (e.g., an editable codon comprises a sequence with an adenosine base). In some embodiments, the codon is a start codon, a stop codon, or a non-start codon (e.g., AUA). In some embodiments, the codon is a start codon that is edited to become a non-start codon. In the methods disclosed herein, the editable codon can be a start codon that is edited to become a non-start codon, a stop codon that is edited to become a non-stop codon, or a non-start codon (e.g., AUA) that is edited to become a start codon. In some embodiments, the editable codon comprises a stop codon that is editable to permit read-through. In some embodiments, a codon is editable by ADAR protein when it is located within or close to a double-stranded RNA region.

[0071] The term “lipid” generally refers to a group of organic compounds that include, but are not limited to, esters of fatty acids.

[0072] The term “lipid particle” generally includes a lipid formulation that can be used to deliver an active agent or therapeutic agent, such as a nucleic acid (e.g., an RNA or a vector encoding the RNA), to a target or predetermined site of interest (e.g., cell, tissue, organ, and the like). In some embodiments, the lipid particle is a lipid nanoparticle (LNP), which can be formed from a cationic lipid or a non-cationic lipid. The LNP can optionally comprise a conjugated lipid which prevents aggregation of the particle. In other embodiments, the active agent or therapeutic agent, such as a nucleic acid, may be encapsulated in the lipid particle, thereby protecting it from enzymatic degradation.

[0073] As used herein, the term “LNP” generally refers to a lipid nanoparticle. An LNP generally represents a particle made from lipids (e.g., a cationic lipid, a non-cationic lipid, and optionally one or more additional components), wherein the nucleic acid (e.g., an engineered nucleic acid molecule or an engineered RNA as described herein) can be fully encapsulated within the LNP.

[0074] As used herein, a “conditional RNA sensor” can be referred to herein as an “RNA sensor”, which comprises an editable stem-loop whose formation is conditional on target RNA binding. The editing ability of the RNA sensor is “switched on” in response to the target RNA binding.

[0075] As used herein, the term “target RNA” refers to any RNA that can “trigger” or “signal” the RNA sensor to proceed from an inactive state (uneditable by ADAR) to an active state (editable by ADAR). The target RNA can be inside a cell. The target RNA can be any RNA expressed by a cell or otherwise introduced into a cell.Atty Dkt No.: 65785-704601

[0076] As used herein, the term “upstream” refers to a nucleotide sequence that is 5’ to a nucleotide sequence on the same nucleic acid molecule. Similarly, the term “downstream” refers to a nucleotide sequence that is 3’ to a nucleotide sequence on the same nucleic acid molecule.Conditional RNA Sensors

[0077] The disclosure provides conditional RNA sensors comprising one or more elements selected from the group consisting of: a) an Upstream Target Binding Region (a “UTBR”); b) an Upstream Stem -Loop Arm (a “USTA”); c) a Downstream Stem-Loop Arm (a “DSTA”); d) a Downstream Target Binding Region (a “DTBR”); and e) a Decoy Sequence (a “DecSeq”).

[0078] The RNA components are arranged within the RNA sensor as follows, wherein the 5 ’-3’ orientation of the RNA sensor runs from left to right:

[0079] UTBR— USTA— DSTA— DTBR— DecSeq

[0080] The disclosure provides RNA sensors comprising a target binding region, which can comprise an Upstream Target Binding Region and a Downstream Target Binding Region, capable of binding a target RNA of interest. The RNA sensor can comprise a first nucleotide sequence, an Upstream Target Binding Region, comprising a nucleotide sequence that is at least partially reverse complementary to a first nucleotide sequence in a target RNA of interest and a second nucleotide sequence, a Downstream Target Binding Region, comprising a nucleotide sequence that is at least partially reverse complementary to a second nucleotide sequence in the target RNA of interest. The RNA sensor can comprise a third nucleotide sequence, an Upstream Stem-Loop Arm, and a fourth nucleotide sequence, a Downstream Stem-Loop Arm, each of which comprise nucleotide sequences capable of hybridizing with each other to form a stem-loop in the nucleic acid molecule (e.g., RNA molecule) when a target RNA binds to the RNA sensor. The RNA sensor can comprise a fifth nucleotide sequence, a Decoy Sequence, which hybridizes with one or more of the regions comprising the Upstream Target Binding Region, the Upstream Stem-Loop Arm, the Downstream Stem -Loop Arm, or the Downstream Target Binding Region, if no target RNA is present. In some embodiments, the Upstream Stem-Loop Arm binds the Decoy Sequence in the absence of target RNA. In some embodiments, the Downstream Stem-Loop Arm binds the Decoy Sequence in the absence of target RNA.

[0081] In some embodiments, the target RNA is an RNA in a cell. In some embodiments, the target RNA is an mRNA. In some embodiments, the target RNA comprises coding RNA or noncoding RNA. In some embodiments, the target RNA comprises pre-mRNA, mRNA, or long nonAtty Dkt No.: 65785-704601 coding RNA (IncRNA). In some embodiments, the target RNA is a pre-mRNA. In some embodiments, the target RNA is a long non-coding RNA (a IncRNA).

[0082] In some embodiments, the USTA contains an editable codon. In some embodiments, the DecSeq comprises a sequence that is reverse complementary to the USTA. In the absence of target RNA, the DecSeq binds the USTA and prevents ADAR from editing the editable codon. In some embodiments, the DecSeq further comprises an editing inhibiting sequence. In some embodiments, when a target RNA binds the RNA sensor, DecSeq no longer can hybridize with the USTA, thereby permitting hybridization between the USTA and DSTA and enabling a stemloop to form that is editable by ADAR.

[0083] In some embodiments, the DSTA contains an editable codon. In some embodiments, the DecSeq comprises a sequence that is reverse complementary to the DSTA. In the absence of target RNA, the DecSeq binds the DSTA and prevents ADAR from editing the editable codon. In some embodiments, the DecSeq further comprises an editing inhibiting sequence. In some embodiments, when a target RNA binds the RNA sensor, DecSeq no longer can hybridize with the DSTA, thereby permitting hybridization between the DSTA and USTA and enabling a stemloop to form that is editable by ADAR.

[0084] The conditional RNA Sensor, referred to herein as an RNA sensor, is comprised within a polynucleotide. In some embodiments, the polynucleotide comprises DNA, RNA, or DNA / RNA hybrid. In some embodiments, the polynucleotide comprising the RNA sensor further comprises a coding sequence (e.g., output sequence). In some embodiments, the polynucleotide comprising the RNA sensor further comprises a regulatory sequence. In some embodiments, the regulatory sequence comprises one or more untranslated regions (e.g., 5’ or 3’ UTRs), promoters, introns, restriction sites, nuclease cleavage sequences, polyadenylation sequences, riboswitches, splicing sites, non-coding RNA (ncRNA), other common RNA features, or any combination thereof.

[0085] In some embodiments, the RNA sensor is operably linked to an Output (as defined below), thereby controlling its expression. In some embodiments, the RNA sensor controls expression of the Output by controlling translation of the Output RNA (the RNA sensor controls the quantity of Output protein that is produced).

[0086] In some embodiments, the nucleic acid molecule comprising the RNA sensor further comprises a 5’ UTR. In some embodiments, the RNA sensor further comprises a 3’ UTR. In some embodiments, the RNA sensor comprises both a 5’ UTR and a 3’ UTR.

[0087] In some embodiments, the nucleic acid molecule comprising the RNA sensor further comprises a 5’ RNA cap. In some embodiments, the 5’ cap is attached to or part of the 5’ nucleotide of the RNA sensor.Atty Dkt No.: 65785-704601

[0088] In some embodiments, the nucleic acid molecule comprising the RNA sensor further comprises a polyadenylation signal or a poly A tail. In some embodiments, the polyadenylation signal is located after the coding sequence in the RNA sensor.Target Binding Regions

[0089] The RNA sensor comprises target binding regions comprising nucleotide sequences that are reverse complementary to a target RNA and capable of specifically binding the target RNA. In some embodiments, there are two target binding regions in an RNA sensor, an Upstream Target Binding Region (UTBR) and a Downstream Target Binding Region (DTBR). The UTBR is located on the RNA sensor 5’ to the DTBR and is reverse complementary to a region of the target RNA that is 3’ to the region of the target RNA that the DTBR is reverse complementary to (see, e.g., Figure 1).

[0090] In some embodiments, the RNA sensor comprises a UTBR and a DTBR, each of which is reverse complementary to a target RNA and capable of specifically binding the target RNA, wherein the UTBR and DTBR together have a combined length of at least 24 nucleotides and no more than 500 nucleotides, and wherein the UTBR and DTBR nucleotide sequences are at least 80% reverse complementary to the target RNA. The length of the UTBR and the DTBR may the same as each other or may be different. In some embodiments, the UTBR and the DTBR together can have a combined length of at least 30, at least 33, at least 36, at least 39, at least 42, at least 45, at least 49, at least 54, at least 57, at least 60, at least 63, at least 66, at least 69, at least 72, at least 75, at least 78, at least 81, at least 84, at least 87, at least 90, at least 93, at least 96, at least 99, at least 102, at least 105, at least 108, at least 111, at least 120, at least 132, at least 141, at least 150, at least 169, at least 201, at least 252, at least 300, at least 325, at least 350, at least 375, at least 400, at least 425, at least 450, at least 475, or at least 500 nucleotides and at least 80% reverse complementary to the target RNA.

[0091] In some embodiments, the UTBR and the DTBR together can have a combined length of at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 102, at least 111, at least 120, at least 125, at least 130, at least 135, at least 140, at least 145, or at least 150 nucleotides and at least 85% reverse complementary to the target RNA. In some embodiments, the UTBR and the DTBR together can have a combined length of at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 102, at least 111, at least 120, at least 125, at least 130, at least 135, at least 140, at least 145, or at least 150 nucleotides and at least 90% reverse complementary to the target RNA In some embodiments, the UTBR and the DTBR together have a combined length of at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at leastAtty Dkt No.: 65785-704601100, at least 110, at least 120 at least 125, at least 130, at least 135, at least 140, at least 145, or at least 150 nucleotides and at least 90% reverse complementary to the target RNA. In some embodiments, the UTBR and the DTBR together have a combined length of at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 110, at least 120 at least 125, at least 130, at least 135, at least 140, at least 145, or at least 150 nucleotides and at least 95% reverse complementary to the target RNA.

[0092] The RNA sensor comprises an Upstream Target Binding Region (UTBR) comprising a nucleotide sequence that is reverse complementary to a target RNA and capable of specifically binding the target RNA, wherein the UTBR is at least 12 nucleotides and no more than about 201 nucleotides in length, and wherein the UTBR nucleotide sequence is at least 80% reverse complementary to a target RNA. In some embodiments, the RNA sensor comprises UTBR that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% reverse complementary to a target RNA. In some embodiments, the RNA sensor comprises UTBR that is 100% reverse complementary to a target RNA. In some embodiments, the UTBR is at least 6 nucleotides and no more than 150 nucleotides in length. In some embodiments, the UTBR is at least 12 nucleotides and no more than 102 nucleotides in length. In some embodiments, the UTBR is at least 15 nucleotides and no more than 60 nucleotides in length. In some embodiments, the UTBR is at least 18 nucleotides and no more than 54 nucleotides in length. In some embodiments, the UTBR is at least 21 nucleotides and no more than 51 nucleotides in length.

[0093] The RNA sensor comprises a Downstream Target Binding Region (DTBR) comprising a nucleotide sequence that is reverse complementary to a target RNA and capable of specifically binding the target RNA, wherein the DTBR is at least 12 nucleotides and no more than about 201 nucleotides in length, and wherein the DTBR nucleotide sequence is at least 80% reverse complementary to a target RNA. In some embodiments, the RNA sensor comprises a DTBR that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% reverse complementary to a target RNA. In some embodiments, the RNA sensor comprises a DTBR that is 100% reverse complementary to a target RNA. In some embodiments, the DTBR is at least 6 nucleotides and no more than 150 nucleotides in length. In some embodiments, the DTBR is at least 12 nucleotides and no more than 102 nucleotides in length. In some embodiments, the DTBR is at least 15 nucleotides and no more than 60 nucleotides in length. In some embodiments, the DTBR is at least 18 nucleotides and no more than 54 nucleotides in length. In some embodiments, the DTBR is at least 21 nucleotides and no more than 51 nucleotides in length.Atty Dkt No.: 65785-704601Stem-Loop Arms

[0094] The RNA sensor comprises an Upstream Stem-Loop Arm (a USTA) comprising a nucleotide sequence capable of hybridizing with a Downstream Stem-Loop Arm (aDSTA) within the RNA sensor to form an editable stem-loop in the RNA molecule when a target RNA binds to the RNA sensor. In some embodiments, the USTA comprises a “stem-loop portion”, that is, a nucleotide sequence that is reverse complementary to the DSTA, of at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at leastl5 bases. In some embodiments, the stem-loop portion of the USTA is at least 60% but less than 100% reverse complementary to the DSTA within the RNA sensor. In some embodiments, the stem-loop portion of the USTA is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% but less than 100%, reverse complementary to the DSTA within the RNA sensor.

[0095] In some embodiments, the stem-loop portion of the USTA is about 3, about 6, about 9, about 12, about 15, about 18, about 21, about 24, about 27, about 30, about 33, about 36, about 39, about 42, about 45, about 48, about 51, about 54, about 60, about 72, about 81, about 90, about 102, about 105, about 108, about 111, about 114, about 117, about 120, about 123, about 126, about 129, about 132, about 135, about 138, about 141, about 144, about 147, about 150, about 153, about 156, about 159, about 162, about 165, about 168, about 171, about 174, about 177, about 180, about 183, about 186, about 189, about 192, about 195, about 198, about 201, about 204, about 207, about 210, about 213, about 216, about 219, about 222, about 225, about 228, about 231, about 234, about 237, about 240, about 243, about 246, or about 249 or more bases in length. In some embodiments, the stem-loop portion of the USTA is no more than 150 bases in length. In some embodiments, the stem-loop portion of the USTA is no more than 250 bases in length.

[0096] In some embodiments, the USTA comprises an editable codon when the USTA is hybridized with the DSTA, when the target RNA is present and the DSTA does not comprise an editable codon. In some embodiments, the USTA does not comprise an editable codon when the USTA is hybridized with the DSTA, when the target RNA is present and the DSTA comprises an editable codon.

[0097] The RNA sensor comprises a Downstream Stem-Loop Arm (a DSTA) comprising a nucleotide sequence capable of hybridizing with an Upstream Stem-Loop Arm (a USTA) within the RNA sensor to form an editable stem-loop in the RNA molecule when a target RNA binds to the RNA sensor. In some embodiments, the DSTA comprises a “stem-loop portion”, that is, a nucleotide sequence that is reverse complementary to the USTA, of at least 3, at least 4, at leastAtty Dkt No.: 65785-7046015, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at leastl5bases. In some embodiments, the stem-loop portion of the DSTA is at least 60% but less than 100% reverse complementary to the DSTA within the RNA sensor. In some embodiments, the stem-loop portion of the DSTA is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, reverse complementary to the DSTA within the RNA sensor. In some embodiments, the stem-loop portion of the DSTA is about 3, about 6, about 9, about 12, about 15, about 18, about 21, about 24, about 27, about 30, about 33, about 36, about 39, about 42, about 45, about 48, about 51, about 54, about 60, about 72, about 81, about 90, about 102, about 105, about 108, about 111, about 114, about 117, about 120, about 123, about 126, about 129, about 132, about 135, about 138, about 141, about 144, about 147, about 150, about 153, about 156, about 159, about 162, about 165, about 168, about 171, about 174, about 177, about 180, about 183, about 186, about 189, about 192, about 195, about 198, about 201, about 204, about 207, about 210, about 213, about 216, about 219, about 222, about 225, about 228, about 231, about 234, about 237, about 240, about 243, about 246, or about 249 or more bases in length. In some embodiments, the stem-loop portion of the DSTA is no more than 150 bases in length. In some embodiments, the stem-loop portion of the DSTA is no more than 250 bases in length. In some embodiments, the DSTA comprises an editable codon when the DSTA is hybridized with the USTA, when the target RNA is present and the USTA does not comprise an editable codon. In some embodiments, the DSTA does not comprise an editable codon when the DSTA is hybridized with the USTA, when the target RNA is present and the USTA comprises an editable codon.

[0098] In some embodiments, the editable moiety comprises an editable codon. In some embodiments, the editable codon comprises a stop codon, a start codon, or a near-start codon (e.g., AUA). In some embodiments, the editable codon is a near-start codon (e.g., AU A). In some embodiments, the editable codon is a stop codon (e.g., UAG). In some embodiments, the stop codon comprises UAG, UAA or UGA. In some embodiments, the start codon comprises AUG, ACG, AUA, or AUU. In some embodiments, the editable codon comprises a mammalian codon. In some embodiments, the editable codon comprises a non-mammalian codon.

[0099] In some embodiments, the stem-loop arm comprises a sequence from a ADAR editing substrate. In some embodiments, the stem-loop arm comprises a sequence from antizyme inhibitor 1 (AZINI), glutamate receptor 2 (GRIA2), gamma-aminobutyric acid receptor subunit alpha 3 (GABRA3), GLI family zinc finger 1 (GLI1), Nei like DNA glycosylase 1 (NEIL1), bladder cancer associated protein (BLCAP), dihydrofolate reductase (DHFR), and focal adhesion kinase (FAK), Pri-let-7, PU.l, miR-200b, PCA3, miR-455-5p, miR-378a-3p, miR221, miR222, miR-21,Atty Dkt No.: 65785-704601 miR-376*, miR-589-3p, miR-214, miR-122, miR-142, Cyclin I (CCNI), Cell division cycle 14B (CDC14B), Coatom er protein complex subunit alpha (COP A), Insulin like growth factor binding protein 7 (IGFBP7), Solute carrier family 22 member 3 (SLC22A3), Heterogeneous nuclear ribonucleoprotein L-like (HNRPLL), Podocalyxin like (PODXL), Protein tyrosine phosphatase non-receptor type 6 (PTPN6), or any combination thereof. For example, the stem -loop arm can comprise an exonic sequence of antizyme inhibitor 1 (AZINI). In some embodiments, the stemloop arm comprises an exonic sequence. In some embodiments, the stem-loop arm comprises an intronic sequence. For example, the stem-loop arm can comprise an intronic sequence of antizyme inhibitor 1 (AZINI). In some embodiments, the nucleic acid molecule described herein comprises a first stem-loop arm sequence from an exon of AZINI and a second stem-loop arm sequence from an intron of AZIN 1.

[0100] In some embodiments, the stem-loop comprising the editable codon can comprise any stem-loop. In some embodiments, the stem loop contains natural ADAR editing sites. Examples of natural editing sites can comprise editing sites found in GRIA2, GRIA3, IGFBP7, NEIL1, FLNA, GRIK2, CDK13, GABRA3, GLI1, SPEG, HTR2C, GRIA4, CYFIP2, CADPS, CADPS, RICTOR, COG3, GRIK1, COPA, HBE1, SON, FLNB, MAGEL2, N0VA1, PNMT, WASH1, LAT, DACT3, FXYD5, ZNF717, ZNF551 CAPS1, etc. In some embodiments, the stemloop sequence is a GluR-B stem-loop or a modified variant thereof. In some embodiments, the stem region of the stem-loop contains a natural editing site while the loop region of the stem-loop comprises a synthetic sequence. In some embodiments, the sequence of the stem is altered compared to the natural editing site by the addition or removal of nucleotides in order to add or remove mismatches or by altering the peptide encoded by the sequence.

[0101] In some embodiments, the stem-loop sequence comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identical to SEQ ID NOs: 1-9. In some embodiments, the stem-loop sequence comprises a nucleic acid sequence selected from the group consisting of: SEQ ID NOs: 1-9.

[0102] CAAGGUCAAUGAGGAGAUGUACAUAGAAAUACAAUCCUGUGUACAU CUUCUAGCAUGACCCAC (SEQ ID NO: 1).CAAGGUCAAUGAGGAGAUGUACAUAAUACAAUGUGUACAUCUUCUAGCAUGACC CAC (SEQ ID NO: 2).CCCAACCUCUGUCUACUCACCACAGCCCCCCAGCAUCACUGUGAAUGCUGCCAUG GAUGCUAGAGGGCUACAGGAAGAGCCAGAAGUUGG (SEQ ID NO: 3);CUCACCACAGCCCCCCAGCAUCACUGUGAAUGCUGCCAUGGAUGCUAGAGGGCUA CAGGA (SEQ ID NO: 4).Atty Dkt No.: 65785-704601AAGUGGCAUAUGCGACGGCCAUGGACUGGUUCAUAGCCGUCUGUUAUGCCU (SEQ ID NO: 5).UGGCAUAUGCGACGGCCAUGGACUGGUUCAUAGCCGUCUGUUAUG (SEQ ID NO: 6). CAUUAAGGUGGGUGGAAUAGUAUACAAAGUAUCCCACCUACCCUGAUG (SEQ ID NO: 7).CAUUAAGGUGGGUGGAAUAGUAUACAAAGUAUCCCACCUACCCCGAUG (SEQ ID NO: 8).UCCGUUUAGGUGGGUGGAAUAGUAAUACAAAGUAUCCCACCUACCCAGACG (SEQ ID NO: 9).Decoy Sequences

[0103] The RNA sensor comprises a Decoy Sequence (a DecSeq) comprising a nucleotide sequence which, (i) in the absence of the target RNA, hybridizes with one or more elements of the RNA sensor, and (ii) in the presence of the target RNA, no longer hybridizes with the element of the RNA sensor, thereby allowing the USTA and the DSTA to hybridize to form an editable codon that ADAR edits. In some embodiments, the DecSeq can hybridize with at least a portion of the USBR, the USTA, the DSTA, the DTBR, or any combination thereof. In some embodiments, the DecSeq comprises a region that is reverse complementary to at least a portion of the USBR. In some embodiments, the DecSeq comprises a region that is reverse complementary to at least a portion of the USTA. In some embodiments, the DecSeq comprises a region that is reverse complementary to at least a portion of the DSTA. In some embodiments, the DecSeq comprises a region that is reverse complementary to at least a portion of the DSBR. In some embodiments, the DecSeq comprises a region that is reverse complementary to a portion of the USTA and at least a portion of the UTBR. In some embodiments, the DecSeq comprises a region that is reverse complementary to a portion of the USTA and at least a portion of the DSTA.

[0104] In some embodiments, the DecSeq comprises a region that is reverse complementary to the 3’ portion of the UTBR and the 5’ portion of the USTA. In some embodiments, the DecSeq comprises a region that is reverse complementary to the 3’ portion of the UTBR and the 5’ portion the USTA. In some embodiments, the DecSeq comprises a region that is reverse complementary to the full lengths of both the USTA and the DSTA. In some embodiments, the DecSeq comprises a region that is reverse complementary to 3’ portion of the USTA and the 5’ portion of the DSTA. In some embodiments, the DecSeq comprises a region that is reverse complementary to the 3’ portion of the DSTA and the 5’ portion of the DTBR.

[0105] In some embodiments, the DecSeq comprises a region that is reverse complementary to the USTA or to a portion thereof. In some embodiments, the DecSeq comprises a region that is reverse complementary to the DSTA or to a portion thereof. In some embodiments,Atty Dkt No.: 65785-704601 the DecSeq is at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 bases. In some embodiments, the region of reverse complementarity is at least 80% but less than 100% reverse complementary to the USTA or DSTA. In some embodiments, the region of reverse complementarity is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%or 100% to the USTA or DSTA. In some embodiments, the region of reverse complementarity is 100% to the USTA or DSTA. In some embodiments, the region of reverse complementarity to the USTA or DSTA is about 3, about 6, about 9, about 12, about 15, about 18, about 21, about 24, about 27, about 30, about 33, about 36, about 39, about 42, about 45, about 48, about 51, about 54, about 60, about 72, about 81, about 90, or about 102or more bases in length. In some embodiments, the region of reverse complementarity to the USTA or DSTA is no more than about 150 bases in length. In some embodiments, the region of reverse complementarity to the USTA or DSTA is about 24, about 27, about 30, about 33, about 36, about 39, about 42, about 45, about 48, about 51, about 54 or about 60 bases in length.

[0106] In some embodiments, the DecSeq further comprises an editing inhibiting sequence. The inhibitory sequence can have one or more bases that can base pair with the editable codon. The choice of the inhibitory sequence can depend on the sequence of the editable moiety (e.g., editable codon). For example, when the editable codon is UAG, the inhibitory sequence can comprise CGG, AAG, AAC, UGC, AUC, AGG, AUG, UGG, or any combination thereof.

[0107] The DecSeq can be an inhibitory nucleotide sequence able to form a stable uneditable “decoy” structure by hybridizing with one or more regions in the RNA sensor to prevent an ADAR protein from editing a potentially editable codon. In some embodiments, the DecSeq sequence forms a stable decoy stem-loop with either the USTA or DSTA, depending upon its sequence, in the absence of the target RNA. Without wishing to be bound by theory, the decoy stem-loop is not editable either because (i) the base pairing opposite the editable codon of the USTA or DSTA is not conducive to editing when it is paired with the DecSeq or (ii) the doublestranded region of the stem-loop formed between the USTA or DSTA and the DecSeq does not include the editable codon of the USTA or DSTA (the editable codon is not editable because it is in the single-stranded loop or bulge of the stem-loop). The decoy stem-loop formed by the hybridization of the DecSeq with either the USTA or DSTA is designed to be more stable than the USTA-DSTA stem-loop when no target RNA is present and therefore prevent ADAR editing; however, the decoy stem-loop is not so stable as to prevent binding of the target RNA when it is present, thereby allowing the USTA and DSTA to hybridize to form an editable codon that ADARAtty Dkt No.: 65785-704601 edits. In some embodiments, the editable codon permits expression of an Output after editing by ADAR.

[0108] The decoy stem-loop described herein can be longer than a stem-loop comprising the editable moiety (e.g., editable codon). In some embodiments, the decoy stem-loop is at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20 bases longer than the stem-loop comprising the editable codon. In some embodiments, the decoy stem-loop is at most 1, at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, at most 10, at most 11, at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 19, at most 20 bases longer than the stem-loop comprising the editable codon. In some embodiments, the decoy stem-loop is about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20 longer than the stem-loop comprising the editable codon. In some embodiments, the decoy stem-loop is from about 3 bases to about 20 bases longer than the stem-loop comprising the editable codon. In some embodiments, the decoy stem-loop is from about 5 bases about 15 bases longer than the stem-loop comprising the editable codon. The decoy stem-loop described herein can be shorter than a stem-loop comprising the editable moiety (e.g., editable codon).5’ UTRs and 3’ UTRs

[0109] In some embodiments, the RNA sensors provided in this disclosure have a 5’ untranslated region (UTR) that is 5’ (or “upstream”) to the first nucleotide sequence. In some embodiments, the RNA sensors provided in this disclosure have a 3’ UTR that is 3’ (or “downstream”) to the sequence encoding the Output. In some embodiments, the RNA sensors provided in this disclosure have both a 5’ UTR and a 3’ UTR. In some embodiments, the 5’ UTR is directly downstream of a 5’ cap on the RNA sensor. In some embodiments, the 3’ UTR is directly upstream of the poly A tail or the polyadenylation site.

[0110] In some embodiments, the 5’ UTR and 3’ UTR is any UTR that confers a benefit to the RNA sensor compared to an RNA sensor without such UTR, for example, by increasing expression levels, increasing stability, altering localization, or any combination thereof.

[0111] In some embodiments, a 5’ UTR has a nucleotide sequence that has at least 75% sequence identity to the nucleotide sequence of the 5’ UTRs selected from the group consisting of: a HsPeglO 5' UTR, a mmPeglO 5' UTR, a HsPNMAl 5' UTR, a mmPNMAl 5' UTR, a HsPNMA3 5’ UTR, a mmPNMA3 5' UTR, a HsMAOPl 5' UTR, a mmMAOPl 5' UTR, a HsPNMA5 5' UTR, ammPNMA5 5' UTR, aHsRTLl 5' UTR, ammRTLl 5' UTR, aHsZCCHC12 5' UTR, a mmZCCHC12 5' UTR, a HsASPRVl 5' UTR, a mmADPRVl 5' UTR, a HsARCl 5'Atty Dkt No.: 65785-704601UTR, and a mmARCl 5' UTR. In some embodiments, the 5’ UTR has a nucleotide sequence that has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% nucleotide sequence identity to the nucleotide sequence of the aforementioned 5’ UTRs.

[0112] In some embodiments, a 3’ UTR has a nucleotide sequence that has at least 75% sequence identity to the nucleotide sequence of the 3’ UTRs selected from the group consisting of: a HsPeglO 3' UTR, a mmPeglO 3' UTR, a HsPNMAl 3' UTR, a mmPNMAl 3' UTR, a HsPNMA3 3’ UTR, a mmPNMA3 3' UTR, a HsMAOPl 3' UTR, a mmMAOPl 3' UTR, a HsPNMA5 3' UTR, ammPNMA5 3' UTR, aHsRTLl 3' UTR, ammRTLl 3' UTR, aHsZCCHC12 3' UTR, a mmZCCHC12 3' UTR, a HsASPRVl 3' UTR, a mmADPRVl 3' UTR, a HsARCl 3' UTR, and a mmARCl 3' UTR. In some embodiments, the 3’ UTR has a nucleotide sequence that has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% nucleotide sequence identity to the nucleotide sequence of the aforementioned 3’ UTRs.

[0113] In some embodiments, the 5’ UTR and 3’ UTR have nucleotide sequences that have at least 75% sequence identity to the nucleotide sequences of the 5’ UTRs and 3’ UTRs of the following group: a HsPeglO 5' and 3' UTR, a mmPeglO 5' and 3' UTR, a HsPNMAl 5' and 3' UTR, a mmPNMAl 5' and 3' UTR, a HsPNMA3 5’ and 3' UTR, a mmPNMA3 5' and 3' UTR, a HsMAOPl 5' and 3' UTR, a mmMAOPl 5' and 3' UTR, a HsPNMA5 5' and 3' UTR, a mmPNMA5 5' and 3' UTR, a HsRTLl 5' and 3' UTR, a mmRTLl 5' and 3' UTR, a HsZCCHC12 5' and 3' UTR, a mmZCCHC12 5' and 3' UTR, a HsASPRVl 5' and 3' UTR, a mmADPRVl 5' and 3' UTR, a HsARCl 5' and 3' UTR, and a mmARCl 5' and 3' UTR. In some embodiments, the 5’ and 3’ UTRs have nucleotide sequences that have at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% nucleotide sequence identity to the nucleotide sequences of the aforementioned 5’ and 3’ UTRs.Outputs

[0114] In some embodiments, the engineered nucleic acid molecule described herein further comprises a coding sequence. A coding sequence can be a nucleotide sequence encoding an Output polypeptide, which can be any type of protein or polypeptide for which regulation is relevant. In some embodiments, an Output polypeptide is a therapeutic protein. In some embodiments, the Output polypeptide is an enzyme, a subunit of an enzyme, an enzyme precursorAtty Dkt No.: 65785-704601 protein, or any combination thereof. In some embodiments, the Output polypeptide is a transcription factor, nucleic acid binding protein, a genomic modification protein, or any combination thereof. In some embodiments, the Output polypeptide is a structural protein, a receptor, an ion channel protein, or any combination thereof. In some embodiments, the Output polypeptide is a growth or differentiation factor, a peptide hormone, a signaling peptide, a cytokine, a chemokine, or any combination thereof. In some embodiments, the Output polypeptide is an antigen, a killing factor, a toxin or any combination thereof. In some embodiments, the Output polypeptide comprises a fluorescence protein.

[0115] In some embodiments, the RNA sensor comprises an editable near-start codon and ADAR editing converts the near-start codon to a start codon. In this way, the RNA sensor can prevent the Output polypeptide from being translated in the absence of a target RNA. In some embodiments, the RNA sensor comprises an editable start codon and ADAR editing converts the start codon to a non-start codon. In this way, the RNA sensor can allow the Output polypeptide to be translated from the RNA sensor before binding to the target RNA.

[0116] In some embodiments, the Output polypeptide comprises an antibody, a modified form, or a variant thereof. The antibody can comprise a multispecific antibody. In some embodiments, the Output polypeptide comprises a T cell receptor (a “TCR”), a modified TCR, or a variant thereof. In some embodiments, the Output polypeptide comprises a chimeric antigen receptor (a “CAR”).

[0117] In some embodiments, the Output polypeptide comprises a polypeptide used in diagnostics. In some embodiments, the Output polypeptide comprises a biomarker. In some embodiments, the Output polypeptide comprises a fluorescent protein. In some embodiments, the Output polypeptide comprises a member of a specific binding pair (e.g., a ligand or aptamer).

[0118] The coding sequence can comprise a nucleotide sequence encoding an Output polynucleotide. In some embodiments, the Output polynucleotide comprises a regulatory RNA or a non-coding RNA. In some embodiments, the Output polynucleotide comprises a member of a specific binding pair (e.g., a ligand or aptamer).

[0119] In some embodiments, the RNA sensor contains one or more editable stop codons or one or more editable near-start codons which is followed by a nucleotide sequence encoding an Output polypeptide. In some embodiments, in the presence of the target RNA, the RNA sensor hybridizes to the target RNA thereby forming a double stranded RNA molecule that can recruit an ADAR protein and the editable one or more stop codons or editable one or more near-start codon are edited. In some embodiments, the editing removes the stop codon(s) which then allows the Output polypeptide to be produced from the RNA sensor. In some embodiments, the editing converts the near-start codon to a start codon, which allows the Output polypeptide to be producedAtty Dkt No.: 65785-704601 from the RNA sensor. In some embodiments, the editing converts the near-start codon to a start codon, which prevents the Output polypeptide from being produced from the RNA sensor. In some embodiments, the editing converts a start codon to a non-start codon, which prevents the Output polypeptide from being produced from the RNA sensor. In some embodiments, the editing converts a start codon to a non-start codon, which allows the Output polypeptide to be produced from the RNA sensor.Chemical Modifications

[0120] In some embodiments, the nucleic acid molecules (e.g., RNA molecules) provided in this disclosure comprise chemical or biological modifications. Modifications may be made at any position within the RNA and may include modification to a nucleobase or to a phosphate backbone of the RNA. In some embodiments, a chemical modification is at the 5' end and / or the 3' end of an RNA molecule. In some embodiments, a chemical modification may be within any portion of the RNA molecule. In some embodiments, a chemical modification may be within 20 nucleotides of the 3' most end of the RNA molecule. In some embodiments, the chemical modification comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 chemically modified nucleotides at the 3' end. In some embodiments, a chemical modification may be within 20 nucleotides of the 5' most end of the RNA molecule. In some embodiments, the chemical modification comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 chemically modified nucleotides at the 5' end. In some embodiments, the RNA molecule comprises a chemical modification selected from a pseudouridine, a N1 -methylpseudouridine, a 5-methyl-cytidine, or any combination thereof. In some embodiments, the RNA molecules may have a chemical modification at the 5’ end of the RNA molecule known as a 5’ cap.Cleavage sequences

[0121] In some embodiments, the nucleic acid molecule described herein further comprises a nucleic acid sequence encoding a cleavable linker sequence. In some embodiments, the cleavable linker sequence comprises a peptide that causes ribosome skipping. In some of any embodiments, the peptide that causes ribosome skipping comprises a 2A peptide. In some embodiments, the 2A peptide is selected from the group consisting of: foot-and-mouth disease virus (FMDV) 2A (F2A), equine rhinitis A virus (ERAV) 2A (E2A), porcine teschovirus-1 2A (P2A), and Thosea asigna virus 2 A (T2A).Pharmaceutical Compositions

[0122] Provided herein are compositions comprising any of the polynucleotides, vectors, modified cells or other materials of the present disclosure. In some embodiments, the composition comprises a pharmaceutical composition. In some embodiments, a pharmaceutical composition comprises one or more of a polynucleotide (e.g., a nucleic acid molecule), a vector, a modifiedAtty Dkt No.: 65785-704601 cell, or other material as disclosed herein, and further comprises a pharmaceutically acceptable carrier.

[0123] In some embodiments, a pharmaceutical composition comprises one or more polynucleotides and a pharmaceutically acceptable carrier. In some embodiments, a pharmaceutical composition comprises one or more vectors and a pharmaceutically acceptable carrier. In some embodiments, a pharmaceutical composition comprises one or more modified cells and a pharmaceutically acceptable carrier. In some embodiments, a pharmaceutical composition comprises one or more of a polynucleotide (e.g., a nucleic acid molecule), a vector, a cell, or other material as disclosed herein in combination with another pharmaceutically active agent(s) or drug(s), such as chemotherapeutic agent(s).

[0124] In some embodiments, the pharmaceutical composition further comprises cryoprotectants, buffers, chelators, stabilizers, or any combination thereof.

[0125] The compositions of the present disclosure may be formulated in any manner suitable for delivery. The formulation may be, but is not limited to, lipid nanoparticles, poly- (lactic-co-glycolic acid) (PLGA) microspheres, lipidoids, lipoplex, liposome, polymers, carbohydrates (including simple sugars), cationic lipids and combinations thereof.

[0126] A pharmaceutical composition in accordance with the present disclosure may be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unit doses. As used herein, a “unit dose” is discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and / or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.

[0127] In some embodiments, the disclosure relates to kits for administering one or more molecules and / or compositions as disclosed herein. The representative kits include one or more dosage units comprising an effective amount of one or more molecules and / or compositions disclosed herein for administration to a subject, at a given frequency, and / or via a given route of administration. In some embodiment, the kits provide a nucleic acid molecule, a modified cell or a vector comprising any of the molecules and / or compositions disclosed herein. In some embodiments, instructions for performing any of the methods disclosed here and administering the agent may also be included in the kits described herein.Delivery

[0128] In some embodiments, the nucleic acid molecules described herein (e.g., the RNA sensors operably linked to Output sequences) are delivered to cells or subjects, including to human subjects. In some embodiments, the nucleic acid molecules are delivered by a vector encoding theAtty Dkt No.: 65785-704601 nucleic acid molecules. In some embodiments, the vector is an expression vector. In some embodiments, the vector is a non-viral vector or a viral vector. In some embodiments, the vector comprises DNA, RNA, or DNA / RNA hybrid. In some embodiments, the viral vector comprises an adenoviral vector, an adeno-associated viral (AAV) vector, a retroviral vector, a lentiviral vector, or any combination thereof. In some embodiments, the viral vector comprises a vector derived from alphavirus, flavivirus, herpes virus, measles virus, rhabdovirus, retrovirus, lentivirus, Newcastle disease virus (NDV), poxvirus, vaccinia virus, picornavirus, or any combination thereof. In some embodiments, the vector is a lentiviral vector. In some embodiments, the vector is an AAV vector.

[0129] In some embodiments, the nucleic acid molecules or the vector encoding the nucleic acid molecules are delivered to cells or subjects, including to human subjects, by non-viral delivery methods. In some embodiments, non-viral delivery methods comprise delivery by lipid nanoparticles, liposomes, exosomes, erythrocyte ghosts, engineered bacteriophages, polymeric nanoparticles, virus-like particles, or any combination thereof. In some embodiments, the RNA molecules are delivered by lipid nanoparticles. In some embodiments, the nucleic acid molecules or the vector encoding the nucleic acid molecules are delivered by polymeric nanoparticles.

[0130] In some embodiments, the nucleic acid molecules or the vector encoding the nucleic acid molecules are delivered to a cell by non-viral delivery, e.g., by electrical, mechanical or chemical methods. In some embodiments, the nucleic acid molecules or the vector encoding the nucleic acid molecules are delivered by electroporation. When nucleic acid molecules (the RNA sensor or vector encoding the RNA sensor) are delivered by electroporation, cells can be isolated from a subject, the cells can then be subjected to electroporation ex vivo to deliver the RNA molecules to the cells, and then the modified cells can be reintroduced into the subject. In some embodiments, nucleic acid molecules are delivered to a cell by physical or chemical methods, including, without limitation, calcium phosphate precipitation, mechanoporation or particle gun.Therapeutic Methods and Indications

[0131] In some cases, the target RNA is determined by the target cell to which the nucleic acid molecule (comprising or encoding the RNA sensor) hybridizes. For example, the target cell can be a diseased cell, such as a cancerous cell. In these cases, the target RNA is either specific to a disease state or is present in higher abundance in cells within that state. The cell may be in any disease state. In other embodiments, the target cell is a particular cell type. In these instances, the target RNA is specific to the cell type or is present in higher abundance in that particular cell type. The cell may be any cell type.Atty Dkt No.: 65785-704601

[0132] Cells of any origin can be candidate cells for combining with a nucleic acid molecule comprising the RNA sensor of the present disclosure. Non-limiting examples of candidate cell types include connective tissue elements such as fibroblasts; skeletal tissue (bone and cartilage); skeletal, cardiac, and smooth muscle; epithelial tissues (e.g., liver, lung, breast, skin, bladder, and kidney); neural cells (glia and neurons); endocrine cells (adrenal, pituitary, and pancreatic islet cells); bone marrow cells; melanocytes; and many different types of hematopoietic cells. Suitable cells can also be cells representative of a specific body tissue from a subject. The types of body tissues include, but are not limited to blood, muscle, nerve, brain, eye, ear, heart, lung, liver, pancreas, spleen, thymus, esophagus, stomach, intestine, kidney, testis, ovary, hair, skin, bone, breast, uterus, bladder, spinal cord, and various kinds of body fluids.

[0133] Cells suitable for use in a subject method comprise cells from a variety of subject hosts. Generally, such subject hosts are "mammals" or "mammalian," where these terms are used broadly to describe organisms within the class Mammalia, including the orders Carnivora (e.g., dogs and cats), Rodentia (e.g., mice, guinea pigs, and rats), and Primates (e.g., humans, chimpanzees, and monkeys). In many aspects, the subject host will be a human.

[0134] In some embodiments, the editing of the nucleic acid molecule comprising or encoding the RNA sensor will be performed by the endogenous ADAR protein in the cells of the subject host. In some embodiments, the editing of the nucleic acid molecule comprising or encoding the RNA sensor will be performed by an ADAR protein that is delivered to the cells (an “exogenous ADAR protein”). An exogenous ADAR protein may be any ADAR protein from any species and includes engineered, modified and functional fragments of ADAR proteins.

[0135] In some embodiments, it is useful to promote the death of a cell if the cell is infected by a pathogen or is a cancer cell. In such embodiments, an output polypeptide to promote death of the cancer cell is desirable. Such output proteins include, without limitation, toxins, tumor necrosis factor family members and caspase family members.

[0136] In some embodiments, it is useful to activate immune cells to fight infections or cancer cells within a subject. In some embodiments, it is useful to modulate immune cells that are responsible for autoimmune diseases in human subjects. In such embodiments, an output protein that activates or modulates the activity of the immune cell is desirable. Such output proteins include certain CARs, and various cytokines, growth factors, and chemokines.

[0137] In some embodiments, it is useful to provide targeted immunotherapy to fight cancer cells or to treat autoimmune disorders within subjects. In such embodiments, an output polypeptide that is targeted by the RNA sensor to the cancer cells or to the immune cells is desirable. Such output proteins can include CARs and TCRs.Atty Dkt No.: 65785-704601

[0138] In some embodiments, it is useful to correct a genetic disorder within a subject. In such embodiments, an output protein that is targeted by the RNA to the affected cells is desirable to treat the disease. Output proteins include the replacement proteins, or functional variants thereof, for the monogenic disease.

[0139] In some embodiments, it is useful to promote the growth or regrowth of tissue after tissue degradation or disease. In embodiments in which the disease or condition is associated with tissue degradation it may be desirable to have an RNA sensor that is targeted to the diseased cells where, upon contact with the diseased cell that contains the target RNA, the cell produces the output protein that promotes the growth or regrowth of the tissue. In such embodiments, the output protein that promote growth or regrowth of tissues include hormones and growth and differentiation factors.Diagnostic Uses

[0140] The RNA sensors and nucleic acid molecules of this disclosure may be used to determine whether a target RNA is present in a biological sample by measuring Output protein levels. In some embodiments, the assays used to determine whether the target RNA is present may include such techniques as immunoblotting, ELISA, immunofluorescent microscopy, flow cytometry and the like.EmbodimentsEmbodiment 1. An engineered nucleic acid molecule, comprising:(a) a first nucleic acid sequence comprising an editable moiety; and(b) a second nucleic acid sequence capable of hybridizing to a target ribonucleic acid (RNA); and wherein the engineered nucleic acid molecule is configured such that: i) when the second nucleic acid sequence is not hybridized to the target RNA, the editable moiety is not susceptible to adenosine deaminase acting on RNA (ADAR) editing; and ii) when the second nucleic acid sequence hybridizes to the target RNA, the engineered nucleic acid molecule changes form such that the editable moiety is susceptible to ADAR editing. Embodiment 2. The engineered nucleic acid molecule of embodiment 1, further comprising a stem-loop structure.Embodiment 3. The engineered nucleic acid molecule of embodiment 2, wherein the stemloop structure comprises the first nucleic acid sequence comprising the editable moiety.Embodiment 4. The engineered nucleic acid molecule of embodiment 2, wherein the second nucleic acid sequence is a sequence of the stem-loop structure and is not hybridized to the target RNA.Atty Dkt No.: 65785-704601Embodiment 5. The engineered nucleic acid molecule of embodiment 2, wherein the first nucleic acid sequence is not a sequence of the stem loop.Embodiment 6. The engineered nucleic acid molecule of embodiment 2, wherein the stem loop comprises a decoy sequence in a loop region of the stem loop.Embodiment 7. The engineered nucleic acid molecule of embodiment 2, wherein the stem loop comprises a decoy sequence in a stem region of the stem loop.Embodiment 8. The engineered nucleic acid molecule of embodiment Embodiment 7, wherein: (i) the stem region comprises said first nucleic acid sequence hybridized to said decoy sequence; and (ii) the decoy sequence comprises an additional moiety that renders said editable moiety not susceptible to editing by ADAR.Embodiment 9. The engineered nucleic acid molecule of embodiment 2, further comprising a decoy sequence that is not a component of the stem loop.Embodiment 10. The engineered nucleic acid molecule of any one of the preceding embodiments, further comprising the target RNA hybridized to the second nucleic acid sequence. Embodiment 11. The engineered nucleic acid molecule of any one of the preceding embodiments, further comprising a third nucleic acid sequence capable of hybridizing to at least a portion of the target RNA.Embodiment 12. The engineered nucleic acid molecule of embodiment 11, further comprising the target RNA hybridized to the third nucleic acid sequence.Embodiment 13. The engineered nucleic acid molecule of any one of the preceding embodiments, wherein the editable moiety is an editable codon.Embodiment 14. An engineered nucleic acid molecule, comprising, 5’ to 3’ : a first nucleic acid sequence comprising an editable codon; a second nucleic acid sequence capable of hybridizing to a target ribonucleic acid (RNA); and a stem-loop structure, wherein: i) when the second nucleic acid sequence is not hybridized to the target RNA, the editable codon is not susceptible to adenosine deaminase acting on RNA (ADAR) editing; and ii) when the second nucleic acid sequence hybridizes to the target RNA, the stem-loop structure changes form such that the decoy sequence of the stem-loop structure changes position in the engineered nucleic acid molecule and such that the editable codon is susceptible to ADAR editing.Embodiment 15. The engineered nucleic acid molecule of embodiment Embodiment 14, wherein the stem-loop structure comprises the first nucleic acid sequence comprising the editable codon.Atty Dkt No.: 65785-704601Embodiment 16. The engineered nucleic acid molecule of embodiment Embodiment 14, wherein the second nucleic acid sequence is a sequence of the stem-loop structure and is not hybridized to the target RNA.Embodiment 17. The engineered nucleic acid molecule of embodiment Embodiment 14, wherein the first nucleic acid sequence is not a sequence of the stem-loop structure.Embodiment 18. The engineered nucleic acid molecule of embodiment Embodiment 14, further comprising a decoy sequence, wherein the decoy sequence is in a loop region of the stemloop structure.Embodiment 19. The engineered nucleic acid molecule of embodiment Embodiment 14, further comprising a decoy sequence, wherein the decoy sequence is in a stem region of the stemloop structure.Embodiment 20. The engineered nucleic acid molecule of embodiment Embodiment 19, wherein: (i) the stem region comprises said first nucleic acid sequence hybridized to said decoy sequence; and (ii) the decoy sequence comprises an additional moiety that renders said editable codon not susceptible to editing by ADAR.Embodiment 21. The engineered nucleic acid molecule of embodiment Embodiment 14, further comprising a decoy sequence that is not a component of the stem-loop structure.Embodiment 22. The engineered nucleic acid molecule of any one of the preceding embodiments, further comprising the target RNA hybridized to the second nucleic acid sequence. Embodiment 23. The engineered nucleic acid molecule of any one of the preceding embodiments, further comprising a third nucleic acid sequence capable of hybridizing to at least a portion of the target RNA.Embodiment 24. The engineered nucleic acid molecule of embodiment 23, further comprising the target RNA hybridized to the third nucleic acid sequence.Embodiment 25. The engineered nucleic acid molecule of any one the preceding embodiments, further comprising a protein coding sequence that encodes a protein.Embodiment 26. The engineered nucleic acid molecule of any one the preceding embodiments, further comprising a regulatory element.Embodiment 27. The engineered nucleic acid molecule of embodiment Embodiment 26, wherein the regulatory element comprises a 5 ’-untranslated region (UTR), a 3’-UTR, a promoter, or any combination thereof.Embodiment 28. The engineered nucleic acid molecule of any one the preceding embodiments, further comprising a nucleic acid sequence encoding a cleavable peptidyl linker.Atty Dkt No.: 65785-704601Embodiment 29. The engineered nucleic acid molecule of any one of the preceding embodiments, wherein the decoy sequence comprises an inhibitory sequence selected from the group consisting of: CGG, AAG, AAC, UGC, AUC, AGG, AUG, and UGG.Embodiment 30. The engineered nucleic acid molecule of any one of the preceding embodiments, wherein the editable codon comprises a stop codon, a start codon, or a near-start codon.Embodiment 31. The engineered nucleic acid molecule of any one of the preceding embodiments, wherein the target RNA comprises an RNA expressed in a cell.Embodiment 32. A composition comprising the engineered nucleic acid molecule of any one of the embodiments 1 -Embodiment 31 and a pharmaceutically acceptable carrier.Embodiment 33. A composition comprising the engineered nucleic acid molecule of any one of embodiments 1 -Embodiment 31 and an ADAR enzyme.Embodiment 34. A vector comprising or encoding the engineered nucleic acid molecule of any one of embodiments 1 -Embodiment 31.Embodiment 35. The vector of embodiment Embodiment 34, wherein the vector comprises a viral vector.Embodiment 36. The vector of embodiment Embodiment 34, wherein the vector comprises a non-viral vector.Embodiment 37. A cell expressing the engineered nucleic acid molecule of any one of embodiments 1 -Embodiment 31.Embodiment 38. A method, comprising:(a) providing a nucleic acid molecule comprising an editable moiety not susceptible to an adenosine deaminase acting on RNA (ADAR) editing; and(b) hybridizing the nucleic acid molecule comprising the editable moiety to a target RNA, wherein upon hybridizing the nucleic acid molecule comprising the editable moiety to the target RNA, the editable moiety becomes susceptible to ADAR editing.Embodiment 39. The method of embodiment Embodiment 38, wherein, in (a), the nucleic acid molecule comprises a stem-loop structure.Embodiment 40. The method of embodiment Embodiment 39, wherein, upon hybridizing the nucleic acid molecule comprising the editable moiety to the target RNA, the stem-loop structure shifts position within the nucleic acid molecule.Embodiment 41. The method of embodiment Embodiment 40, wherein, in (a), the stem -loop structure comprises a decoy sequence, and wherein the decoy sequence is no longer a component of the stem-loop structure after the stem-loop structure shifts position within the nucleic acid molecule.Atty Dkt No.: 65785-704601Embodiment 42. The method of embodiment Embodiment 40, wherein the first nucleic acid sequence comprising the editable moiety is a component of the stem-loop structure after the stemloop shifts position within the nucleic acid molecule.Embodiment 43. The method of any one of embodiments Embodiment 38-Embodiment 42, wherein, in (a), the stem-loop structure does not comprise the first nucleic acid sequence comprising the editable moiety.Embodiment 44. The method of embodiment Embodiment 38-Embodiment 42, wherein, in (a), the stem-loop structure comprises the first nucleic acid sequence comprising the editable moiety.Embodiment 45. The method of any one of embodiments Embodiment 38-Embodiment 44, wherein, in (a), the second nucleic acid sequence is a component of the stem-loop structure.Embodiment 46. The method of any one of embodiments Embodiment 38-Embodiment 45, wherein the editable moiety is an editable codon.Embodiment 47. The method of any one of embodiments Embodiment 38-Embodiment 46, further comprising, after (b), subjecting the editable moiety to ADAR editing.Embodiment 48. The method of any one of embodiments Embodiment 38-Embodiment 47, wherein the nucleic acid molecule comprises a protein coding sequence that encodes a protein, and wherein the method further comprises, after (b), expressing the protein.Embodiment 49. The method of any one of embodiments Embodiment 38-Embodiment 48, further comprising, prior to (b), administering the nucleic acid molecule to a subject.Embodiment 50. A nucleic acid molecule (e.g., an RNA sensor) comprising one or more elements selected from the group consisting of: a) an Upstream Target Binding Region (a “UTBR”); b) an Upstream Stem -Loop Arm (a “USTA”); c) a Downstream Stem-Loop Arm (a “DSTA”); d) a Downstream Target Binding Region (a “DTBR”); and e) a Decoy Sequence (a “DecSeq”).Embodiment 51. The nucleic acid molecule of embodiment 50, wherein the DecSeq is capable of hybridizing to at least a portion of one or more elements selected from the group consisting of: a) an Upstream Target Binding Region (a “UTBR”); b) an Upstream Stem -Loop Arm (a “USTA”); c) a Downstream Stem-Loop Arm (a “DSTA”); and d) a Downstream Target Binding Region (a “DTBR”).Atty Dkt No.: 65785-704601Embodiment 52. The nucleic acid molecule of embodiment 50, wherein the DecSeq is capable of hybridizing to at least a portion of the UTBR.Embodiment 53. The nucleic acid molecule of embodiment 50, wherein the DecSeq is capable of hybridizing to at least a portion of the USTA. As shown in FIG. 2 and FIG. 4, the nucleic acid molecule can comprise a DecSeq capable of hybridizing to at least a portion of the USTA in the absence of a target RNA. Either the USTA or the DSTA can comprise an editable moiety.Embodiment 54. The nucleic acid molecule of embodiment 50, wherein the DecSeq is capable of hybridizing to at least a portion of the DSTA. As shown in FIG. 1 and FIG. 3, the nucleic acid molecule can comprise a DecSeq capable of hybridizing to at least a portion of the DSTA in the absence of a target RNA. Either the USTA or the DSTA can comprise an editable moiety.Embodiment 55. The nucleic acid molecule of embodiment 50, wherein the DecSeq is capable of hybridizing to at least a portion of the DTBR.Embodiment 56. The nucleic acid molecule of embodiment 50, wherein the DecSeq is capable of hybridizing to at least a portion of the UTBR and the USTA.Embodiment 57. The nucleic acid molecule of embodiment 50, wherein the DecSeq is capable of hybridizing to at least a portion of the USTA and the DSTA.Embodiment 58. The nucleic acid molecule of embodiment 50, wherein the DecSeq is capable of hybridizing to at least a portion of the DSTA and the DTBR.Embodiment 59. The nucleic acid molecule of embodiment 50, wherein the DecSeq is capable of hybridizing to at least a portion of the UTBR and the DSTA.Embodiment 60. The nucleic acid molecule of embodiment 50, wherein the DecSeq is capable of hybridizing to at least a portion of the UTBR and the DTBR.Embodiment 61. The nucleic acid molecule of embodiment 50, wherein the DecSeq is capable of hybridizing to at least a portion of the USTA and the DTBR.Embodiment 62. The nucleic acid molecule of embodiment 50, comprising from 5’ to 3’ end, UTBR— USTA— DSTA— DTBR— DecSeq.Embodiment 63. The nucleic acid molecule of embodiment 50, further comprising an inhibitory sequence within the DecSeq.Embodiment 64. The nucleic acid molecule of embodiment 50, further comprising a 5’UTR or a 3’UTR.Embodiment 65. The nucleic acid molecule of embodiment 50, comprising from 5’ to 3’ end, 5 ’UTR— UTBR— USTA— DSTA— DTBR— DecSeq— 3 ’UTR.Atty Dkt No.: 65785-704601Embodiment 66. The nucleic acid molecule of embodiment 50, further comprising an Output coding sequence (OCS).Embodiment 67. The nucleic acid molecule of embodiment 50, comprising from 5’ to 3’ end, 5 ’UTR— UTBR— USTA— DSTA— DTBR— DecSeq— OCS— 3 ’UTR.Embodiment 68. The nucleic acid molecule of embodiment 50, further comprising a nucleic acid sequence encoding a cleavage site (CLS).Embodiment 69. : The nucleic acid molecule of embodiment 50, comprising from 5’ to 3’ end, 5 ’UTR— UTBR— USTA— DSTA— DTBR— DecSeq— CLS— OCS— 3 ’UTR.Embodiment 70. The nucleic acid molecule of embodiment 50, further comprising a selection marker sequence (SMS).Embodiment 71. The nucleic acid molecule of embodiment 50, comprising from 5’ to 3’ end, 5 ’UTR— SMS— UTBR— USTA— DSTA— DTBR— DecSeq— 3 ’UTR.Embodiment 72. The nucleic acid molecule of embodiment 50, comprising from 5’ to 3’ end, 5’UTR— SMS— UTBR— USTA— DSTA— DTBR— DecSeq— CLS— OCS— 3’UTR.EXAMPLES

[0141] The following examples are provided to further illustrate some embodiments of the present disclosure, but are not intended to limit the scope of the disclosure; it will be understood by their exemplary nature that other procedures, methodologies, or techniques may alternatively be used.Example 1: Preparation of Lentiviral RNA Sensor Library

[0142] Preparation of Lentiviral RNA Sensor Library for High-Throughput Screening.

[0143] In this example, we describe RNA sensors having an editable stem-loop and add decoy sequence that is capable of forming a more stable “decoy” stem-loop with either the upstream or downstream part of the stem-loop (with respect to the loop). This decoy stem-loop is not editable by ADAR, either because the basepairing opposite the edited codon is not conducive to editing, or the stem-loop is formed with the un-edited part of the editable stem-loop. If the editable codon is not part of the decoy stem-loop, it is not editable in the single-stranded state, as ADAR edits double-stranded RNA substrates. The decoy stem-loop is not so stable so as to prevent binding of the target RNA. This way, when the target RNA is not present, the more stable decoy stem-loop is formed, preventing ADAR editing, but when the target RNA is present, the editable stem-loop forms instead, and ADAR is able to edit the editable codon. This RNA sensor can be particularly useful in therapeutic contexts where the sensor output (therapeutic payload) is toxic, or where target-independent signaling is unacceptable. Computational prediction can be used to estimate the secondary structure of sensor RNAs containing different inhibitory sequences,Atty Dkt No.: 65785-704601 and the structures that have lower energies (increased formation likelihood) for the folding state where the decoy stem-loop is formed compared to the folding state where the editable stem-loop is formed can be selected.

[0144] RNA sensors with various Decoy Sequences (DecSeqs) of different lengths and sequences were designed. The DecSeq used in this example did not contain any inhibitory sequence. A lentiviral library was prepared to enable high-throughput screens for identification of RNA sensors with target binding regions that are reverse complementary to the human lumican (hLUM) mRNA. Nucleic acid barcodes were included in the lentiviral RNA sensor library for ease of screening. Target-binding regions (i.e., a UTBR and a DTBR capable of binding hLUM) were combined with different stem-loop arms capable of hybridizing to each other (i.e., a USTA and a DSTA) and with a variety of Decoy Sequences (i.e., a DecSeq). DNA barcodes were used for ease of screening. The lentiviral RNA sensor library was prepared by standard molecular biological techniques. Single-stranded oligonucleotides with highly diverse sequences are amplified by PCR and assembled with standard restriction cloning into a backbone plasmid derived from the pCDH lentiviral vector containing a puromycin selection cassette, the EFla promoter, a stable mCherry transfection marker and a multiple-cloning-site for nucleotide insertion. After transformation, amplification in E. coli and purification, the DNA is used to prepare lentivirus using standard molecular biological techniques in mammalian cells.

[0145] Lentiviral Transduction and Proviral Integration Analysis

[0146] A lentiviral RNA sensor library pooling RNA sensors with various stem-loop sequences (with or without Decoy Sequences) was used. HeLa cells and HeLa cells expressing hLUM RNA were seeded and incubated overnight. The following day, the cells were transduced with the lentiviral RNA sensor libraries at a multiplicity of infection (MOI) sufficient to achieve one integration per cell of an RNA sensor construct in the majority of transduced cells (confirmed via digital PCR, dPCR in a series of transductions with various MOIs, e.g., 1, 5, 10, 20). Transduced cells were selected using puromycin starting on day 3, and cells were monitored for proviral integration by dPCR. Cells were harvested for next generation sequence (NGS) preparation on day 8.

[0147] The lentiviral RNA sensor library RNA sensors were evaluated in a pooled manner, using lentiviral vectors to achieve one integration per cell of a sensor construct containing either no DecSeq or a DecSeq variant without inhibitory activity. After the RNA sensors are introduced to the cells, RNA from the cells expressing the RNA sensors was extracted and sequenced. The rate of TAG (unedited) versus TGG (edited) reads was calculated using next-generation sequencing.Atty Dkt No.: 65785-704601Example 2: Evaluation of RNA Sensor Designs

[0148] Using the RNA sensor library described in Example 1, numerous lentiviral RNA sensor designs were tested using NGS to determine whether the presence of Decoy Sequences would improve ADAR editing specificity of RNA sensors in the presence of target RNA.

[0149] To evaluate the lentiviral RNA sensor designs, target-binding regions (i.e., a UTBR and a DTBR capable of binding hLUM) were combined with different stem-loop arms capable of hybridizing to each other (i.e., a USTA and a DSTA) and with numerous Decoy Sequences (i.e., a DecSeq). Lentiviral RNA sensors lacking a DecSeq or containing a DecSeq variant not capable of binding to the RNA sensor in the absence of target RNA were used as negative controls.

[0150] FIG. 7 shows the editing ratio in target cells (HeLa-hLUM) compared to non-target cells (HeLa). The results show that adding a Decoy Sequence to an RNA sensor improves the ADAR editing specificity for numerous RNA sensors using four different exemplary stem-loop combinations. All RNA sensor designs with statistically significant (Bonferroni-corrected) editing rate differences for the given stem-loop in the pooled evaluation are shown, p-values were calculated based on observed A (unedited) and G (edited) counts using a Chi-squared test. The results demonstrate that including a Decoy Sequence in an RNA sensor improves the ADAR editing specificity for RNA sensors.Example 3: Location of Decoy Sequence in RNA Sensors

[0151] The results provided in Example 2 and shown in FIG. 7 demonstrate that including a Decoy sequence in an RNA sensor improves editing specificity. As shown in this Example 3, the Decoy Sequence can be designed to hybridize to different regions or portions of the RNA sensor and effectively improve editing specificity.

[0152] FIG. 6A depicts the editing frequency of the target tAg codon in hLUM RNA from HeLa hLUM cells for a specific RNA sensor as assessed by NGS. The RNA sensor has a Decoy Sequence that is reverse complementary to the USTA and to a portion of the UTBR and exhibited 52.2% editing of the target tAg codon in the presence of the target RNA. Editing of the RNA sensor without the presence of the target RNA was 9.6%, resulting in an editing ratio (the specificity ratio) for the RNA sensor with the DecSeq of 5.4. FIGS. 5A-5B show the predicted structures for the RNA sensor from FIG. 6 A in the absence of target RNA (FIG. 5 A) and presence of target RNA (FIG. 5B).

[0153] FIG. 6B depicts the editing frequency of the target tAg codon in hLUM RNA from HeLa hLUM cells for a specific RNA sensor as assessed by NGS. In the presence of the target RNA, the RNA sensor has a Decoy Sequence that is reverse complementary to the UTBR and exhibited 15.4% editing of the target tAg codon. Editing of the RNA sensor without the presenceAtty Dkt No.: 65785-704601 of the target RNA was 0.4%, resulting in an editing ratio (i.e., the specificity ratio) for the RNA sensor with the DecSeq of 38.6.

[0154] FIG. 6C depicts the editing frequency of the target tAg codon in hLUM RNA from HeLa hLUM cells for a specific RNA sensor as assessed by NGS. The RNA sensor has a Decoy Sequence that is reverse complementary to the USTA and DSTA and exhibited 31.4% editing of the target tAg codon in the presence of the target RNA. Editing of the RNA sensor without the presence of the target RNA was 0.9%, resulting in an editing ratio (i.e., the specificity ratio) for the RNA sensor with the DecSeq of 33.6. FIG. 6D depicts the editing frequency of the target tAg codon in hLUM RNA from HeLa hLUM cells for a specific RNA sensor as assessed by NGS. The RNA sensor has a Decoy Sequence that is reverse complementary to the DSTA and exhibited 5.1% editing of the target tAg codon in the presence of the target RNA. Editing of the RNA sensor without the presence of the target RNA was 0.4%, resulting in an editing ratio (i.e., the specificity ratio) for the RNA sensor with the DecSeq of 13.3.

[0155] FIG. 6E depicts the editing frequency of the target tAg codon in hLUM RNA from HeLa hLUM cells for a specific RNA sensor as assessed by NGS. The RNA sensor has a Decoy Sequence that is reverse complementary to the USTA and exhibited 36.2% editing of the target tAg codon in the presence of the target RNA. Editing of the RNA sensor without the presence of the target RNA was 2.9%, resulting in an editing ratio (i.e., the specificity ratio) for the RNA sensor with the DecSeq of 12.5.

[0156] While preferred embodiments of the present disclosure have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosure. It should be understood that various alternatives to the embodiments of the present disclosure may be employed in practicing the present disclosure. It is intended that the following claims define the scope of the present disclosure and that methods and structures within the scope of these claims and their equivalents be covered thereby.

Claims

Atty Dkt No.: 65785-704601CLAIMSWHAT IS CLAIMED IS:

1. An engineered nucleic acid molecule, comprising: a) a first nucleic acid sequence comprising an editable moiety; and b) a second nucleic acid sequence capable of hybridizing to a target ribonucleic acid (RNA); and c) a third nucleic acid sequence capable of hybridizing to either the first nucleic acid sequence or the second nucleic acid sequence; wherein the engineered nucleic acid molecule is configured such that: i) when the second nucleic acid sequence is not hybridized to the target RNA, the third nucleic acid sequence is hybridized to all or a portion of the first nucleic acid sequence or the second nucleic acid sequence, and the editable moiety is not susceptible to adenosine deaminase acting on RNA (ADAR) editing; and ii) when the second nucleic acid sequence hybridizes to the target RNA, the engineered nucleic acid molecule changes form such that the third nucleic acid sequence dehybridizes from all or a portion of the first nucleic acid sequences or the second nucleic acid sequences such that the editable moiety is susceptible to ADAR editing.

2. The engineered nucleic acid molecule of claim 1, wherein the first nucleic acid sequence is a stem-loop arm.

3. The engineered nucleic acid molecule of claim 1, wherein the second nucleic acid sequence is a target binding region.

4. The engineered nucleic acid molecule of claim 1, wherein the third nucleic acid sequence is a decoy sequence.

5. The engineered nucleic acid molecule of claim 4, wherein the decoy sequence comprises an additional moiety that renders said editable moiety not susceptible to editing by ADAR.

6. The engineered nucleic acid molecule of any one of the preceding claims, further comprising the target RNA hybridized to the second nucleic acid sequence.

7. The engineered nucleic acid molecule of any one of the preceding claims, wherein the editable moiety is an editable codon.

8. The engineered nucleic acid molecule of any one of the preceding claims, further comprising a fourth nucleic acid sequence wherein the second nucleotide sequence comprises two separate regions capable of hybridizing to the target RNA.

9. An engineered nucleic acid molecule, comprising, from 5’ to 3’ : i) a first nucleic acid sequence that is reverse complementary to a first region of a target RNA and capable of specifically binding the target RNA;Atty Dkt No.: 65785-704601 ii) a second nucleic acid sequence comprising an editable codon capable of forming a stem-loop in the engineered nucleic acid molecule, wherein, when formed, the stem-loop comprises the editable codon and the editable codon is susceptible of being edited by an ADAR protein; iii) a third nucleic acid sequence that is reverse complementary to a second region of a target RNA and capable of specifically binding the target RNA; andiv) a fourth nucleic acid sequence that is reverse complementary or partially reverse complementary to a contiguous nucleotide sequence selected from: all or a portion of the first nucleic acid sequence; all or a portion of the second nucleic acid sequence; all or a portion of the third nucleic acid sequence; or a nucleotide sequence comprising all or a portion of the first nucleic acid sequence, all or a portion of the second nucleic acid sequence, and all or a portion of the third nucleic acid sequence.

10. The engineered nucleic acid molecule of claim 9, wherein the fourth nucleic acid sequence is a decoy sequence that, in an absence of the target RNA, hybridizes with all or a portion of the first nucleic acid sequence, to all or a portion of the second nucleic acid sequence, all or a portion of the third nucleic acid sequence, or a nucleotide sequence comprising all or a portion of the first nucleic acid sequence, all or a portion of the second nucleic acid sequence, and all or a portion of the third nucleic acid sequence, and, in a presence of the target RNA, dehybridizes from all or the portion of the first nucleic acid sequence, from all or the portion of the second nucleic acid sequence, from all or a portion of the third nucleic acid sequence or from the nucleotide sequence comprising all or the portion of the first nucleic acid sequence, all or the portion of the second nucleic acid sequence, and all or a portion of the third nucleic acid sequence.

11. The engineered nucleic acid molecule of claim 9, wherein the first nucleic acid sequence is reverse complementary to a region of the target RNA that is 3’ to the region of the target RNA that the third nucleic acid sequence is reverse complementary to.

12. The engineered nucleic acid molecule of claim 9, wherein the third nucleic acid sequence is reverse complementary to a region of the target RNA that is 5’ to the region of the target RNA that the first nucleic acid sequence is reverse complementary to.

13. The engineered nucleic acid molecule of claim 9, wherein the second nucleic acid sequence comprises an upstream stem-loop arm and a downstream stem-loop arm.

14. The engineered nucleic acid molecule of claim 13, wherein in the absence of the target RNA, the editable codon cannot be edited by the ADAR protein, and wherein in the presence of the target RNA, the editable codon can be edited by the ADAR protein.Atty Dkt No.: 65785-70460115. The engineered nucleic acid molecule of any one the preceding claims, wherein the editable codon is a stop codon, a start codon, or a near-start codon.

16. The engineered nucleic acid molecule of any one the preceding claims, further comprising a protein coding sequence that encodes an output protein.

17. The engineered nucleic acid molecule of claim 16, wherein the output protein is a diagnostic protein or a therapeutic protein.

18. The engineered nucleic acid molecule of claim 16, further comprising a cleavage sequence.

19. The engineered nucleic acid molecule of claim 18, wherein the cleavage sequence encodes a peptide that causes ribosome skipping.

20. The engineered nucleic acid molecule of any one of claims 8-19, further comprising the first region of the target RNA hybridized to the first nucleic acid sequence and the second region of the target RNA hybridized to the third nucleic acid sequence.

21. The engineered nucleic acid molecule of any one the preceding claims, further comprising a 5 ’-untranslated region (UTR) or a 3’-UTR sequence.

22. A composition comprising the engineered nucleic acid molecule of any one of the preceding claims and a pharmaceutically acceptable carrier.

23. A composition comprising the engineered nucleic acid molecule of any one of claims 1-21 and an ADAR enzyme.

24. The composition of claim 23, wherein the ADAR enzyme is endogenous.

25. A vector comprising or encoding the engineered nucleic acid molecule of any one of claims 1-21.

26. The vector of claim 25, wherein the vector comprises a viral vector.

27. The vector of claim 25, wherein the vector comprises a non-viral vector.

28. A cell expressing the engineered nucleic acid molecule of any one of claims 1-21.

29. A method, comprising:(a) providing an engineered nucleic acid molecule, comprising: i) a first nucleic acid sequence comprising an editable moiety; and ii) a second nucleic acid sequence capable of hybridizing to a target ribonucleic acid (RNA); and iii) a third nucleic acid sequence hybridized to all or a portion of the first nucleic acid sequence or the second nucleic acid sequence; wherein the editable moiety is not susceptible to adenosine deaminase acting on RNA (ADAR) editing; andAtty Dkt No.: 65785-704601(b) hybridizing the target RNA to the second nucleic acid sequence such that the third nucleic acid sequence dehybridizes from all or the portion of the first nucleic acid sequence or the second nucleic acid sequence, wherein the editable moiety becomes susceptible to ADAR editing.

30. The method of claim 29, wherein, in (a), the first sequence is a stem-loop arm.

31. The method of claim 30, wherein, in (a), the engineered nucleic acid molecule comprises a stem-loop comprising the stem-loop arm.

32. The method of claim 30, wherein, in (a), the engineered nucleic acid molecule comprises a stem-loop that does not comprise the stem-loop arm.

33. The method of claim 29, further comprising, in (b), forming a stem-loop that comprises the first nucleic acid sequence in a stem region of the stem-loop.

34. The method of claim 29, wherein, in (a), the third nucleic acid sequence is hybridized to all or a portion of the first nucleic acid sequence.

35. The method of claim 34, wherein, in (a), the third nucleic acid molecule comprises an additional moiety that renders the editable moiety not susceptible to ADAR editing.

36. The method of 29, wherein, in (a), the third nucleic acid sequence is hybridized to all or a portion of the second nucleic acid sequence.

37. The method of any one of claims 26-36, further comprising, after (b), subjecting the editable moiety to ADAR editing.

38. The method of any one of claims 26-37, wherein the editable moiety is an editable codon.

39. The method of any one of claims 26-38, wherein the engineered nucleic acid molecule comprises a protein coding sequence that encodes a protein.

40. The method of claim 39, wherein: (i) the editable moiety is a stop codon; (ii) after (b), the method further comprises editing the stop codon such that it is no longer a stop codon; and (iii) the method further comprises, after editing the stope codon, expressing the protein.

41. The method of claim 38, wherein: (i) the editable moiety is a start codon; and (ii) after (b), the method further comprises editing the start codon such that it is no longer a start codon; and (iii) as a result of the start codon no longer being a start codon, expression of the protein from the engineered nucleic acid molecule cannot occur.

42. A method, comprising:(a) providing an engineered nucleic acid molecule, comprising, from 5’ to 3’: i) a first nucleic acid sequence that is reverse complementary to a first region of a target RNA and capable of specifically binding the target RNA;Atty Dkt No.: 65785-704601 ii) a second nucleic acid sequence comprising an editable codon capable of forming a stem-loop in the engineered nucleic acid molecule, wherein, when formed, the stem-loop comprises the editable codon and the editable codon is susceptible of being edited by an ADAR protein; iii) a third nucleic acid sequence that is reverse complementary to a second region of a target RNA and capable of specifically binding the target RNA; and iv) a fourth nucleic acid sequence that is hybridized or partially hybridized to a contiguous nucleotide sequence selected from: all or a portion of the first nucleic acid sequence; all or a portion of the second nucleic acid sequence; all or a portion of the third nucleic acid sequence; or hybridized or partially hybridized to all or a portion of the first nucleic acid sequence, all or a portion of the second nucleic acid sequence, and all or a portion of the third nucleic acid sequence; and(b) hybridizing the first region of the target RNA to the first nucleic acid sequence and hybridizing the third nucleic acid sequence to the second region of the target RNA; such that, upon hybridizing the first region of the target RNA to the first nucleic acid sequence and hybridizing the third nucleic acid sequence to the second region of the target RNA, the fourth nucleic acid sequence or a portion thereof dehybridizes from: (1) all or a portion of the first nucleic acid sequence; (2) from all or a portion of the second nucleic acid sequence; (3) all or a portion of the third nucleic acid sequence; or (4) all or a portion of the first nucleic acid sequence, all or a portion of the second nucleic acid sequence, and all or a portion of the third nucleic acid sequence, wherein, after (b), the engineered nucleic acid molecule comprises the stem loop comprising the editable codon susceptible to editing by the ADAR protein.

43. The method of claim 41, wherein: (1) in (a), the fourth nucleic acid sequence is hybridized or partially hybridized to all or a portion of the first nucleic acid sequence; and (2) in (b), upon hybridizing the first region of the target RNA to the first nucleic acid sequence and hybridizing the third nucleic acid sequence to the second region of the target RNA, the fourth nucleic acid sequence dehybridizes from all or the portion of the first nucleic acid sequence.

44. The method of claim 41, wherein: (1) in (a), the fourth nucleic acid sequence is hybridized to all or a portion of the second nucleic acid sequence; and (2) in (b), upon hybridizing the first region of the target RNA to the first nucleic acid sequence and hybridizing the third nucleic acid sequence to the second region of the target RNA, the fourth nucleic acid sequence or a portion thereof dehybridizes from all or a portion of the second nucleic acid sequence.Atty Dkt No.: 65785-70460145. The method of claim 42, wherein: (1) in (a), the fourth nucleic acid sequence is hybridized or partially hybridized to all or a portion of the third nucleic acid sequence; and (2) in (b), upon hybridizing the first region of the target RNA to the first nucleic acid sequence and hybridizing the third nucleic acid sequence to the second region of the target RNA, the fourth nucleic acid sequence or a portion thereof dehybridizes from all or a portion of the third nucleic acid sequence.

46. The method of claim 42, wherein: (1) in (a), the fourth nucleic acid sequence is hybridized or partially hybridized to all or a portion of the first nucleic acid sequence, all or a portion of the second nucleic acid sequence, and all or a portion of the third nucleic acid sequence; and (2) in (b), upon hybridizing the first region of the target RNA to the first nucleic acid sequence and hybridizing the third nucleic acid sequence to the second region of the target RNA, the fourth nucleic acid sequence or a portion thereof dehybridizes from all or a portion of the first nucleic acid sequence, all or a portion of the second nucleic acid sequence, and all or a portion of the third nucleic acid sequence.

47. The method of any one of claims 40-46, further comprising subjecting the editable codon of the stem loop to ADAR editing.

48. The method of any one of claims 40-47, wherein the engineered nucleic acid molecule comprises a protein coding sequence that encodes a protein.

49. The method of any one of claims 40-48, wherein: (i) the editable codon is a stop codon; (ii) after (b), the method further comprises editing the stop codon such that it is no longer a stop codon; and (iii) the method further comprises, after (b), expressing the protein.

50. The method of claim 40-48, wherein: (i) the editable codon is a start codon; and (ii) after (b), the method further comprises editing the start codon such that it is no longer a start codon; and (iii) as a result of the start codon no longer being a start codon, expression of the protein from the engineered nucleic acid molecule cannot occur.

51. The method of any one of claims 26-50, further comprising, prior to (b), administering the engineered nucleic acid molecule to a subject.

Images