Biomarkers for tissue age and stillbirth

Circular RNAs are used as markers to assess placental age and predict pregnancy complications by quantifying circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624, and circ_0111277, facilitating early intervention and reducing DNA damage.

WO2026044366A1PCT designated stage Publication Date: 2026-03-05THE FLINDERS UNIV OF SOUTH AUSTRALIA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/AU2025/050978
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-09-02
Filing Date
2025-09-02
Publication Date
2026-03-05

AI Technical Summary

Technical Problem

There is a lack of effective markers for assessing the age and function of the placenta, which is critical for predicting pregnancy complications such as stillbirth, intrauterine growth restriction, and preeclampsia, as premature aging can lead to placental dysfunction.

Method used

Identifying circular RNAs (circRNAs) like circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624, and circ_0111277 as markers of placental age, allowing for the quantification of these RNAs in biological samples to assess placental age and predict pregnancy complications.

Benefits of technology

The method provides an objective assessment of placental age and predicts pregnancy complications by quantifying specific circRNAs, enabling early intervention and potentially reducing DNA damage through interfering nucleic acids that target these RNAs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure AU2025050978_05032026_PF_FP_ABST
    Figure AU2025050978_05032026_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed is a method for assessing the age of a tissue, in particular the placenta, using circular RNAs. Further disclosed are methods for diagnosing or predicting the risk of a pregnancy complication, such as stillbirth, by quantifying circular RNAs in the placenta or a maternal blood sample.
Need to check novelty before this filing date? Find Prior Art

Description

Title of InventionBIOMARKERS FOR TISSUE AGE AND STILLBIRTHPriority Claim

[0001] The present application claims a priority benefit of Australian provisional application number 2024902762 filed on 2 September 2024, the entire disclosure of which is herein incorporated.Sequence Listing

[0002] The present specification incorporates the sequence listing entitled “Biomarkers for tissue age and stillbirth. xml”, generated on 2 September 2024 and comprising 66 sequences.Technical Field

[0003] The present invention relates to the field of circular RNAs (circRNAs) as markers of tissue age, and particularly the age of the placenta. Moreover, the present invention relates to the use of circRNAs and interfering nucleic acids in antenatal monitoring and care.Background of Invention

[0004] As organs age, their function typically declines. While organs age over time, under certain conditions they can prematurely age. In such circumstances, the biological age of the organ deviates from its chronological age and consequently the function of the organ may be below what is typical for its age.

[0005] One of the many unique aspects of pregnancy is the de novo generation of the placenta, which, unlike other fetal organs, has a short functional lifetime. Further, placental development is temporally defined and well documented (Gude N.M. et al., Growth and function of the normal human placenta. Thromb Res., 114(5-6), 397-407 (2004)). This provides a unique opportunity to study the biological age of an organ compared to its chronological age and its standard lifespan.

[0006] The placenta acts as the interface between the separated maternal and fetal circulatory system and facilitates the exchange of nutrients, gases and waste between the mother and the fetus. As such, the function of the placenta is critical to the health of the fetus. In later gestation, the increasing size of the fetus results in a greater demand on the placenta meaning any dysfunction, or premature loss of function, in the placenta can compromise the health of the fetus. Indeed, placentae from stillborn infants show hallmarks of advanced age, implicating premature aging as a causative factor in stillbirth (Maiti, K. et al. Evidence that fetal death is associated with placental aging. Am J Obstet Gynecol. 217, 441 (2017)). Moreover, placental insufficiency, which may result from premature aging, is one factor that can result in intrauterine growth restriction (IUGR) (Lean, S.C. etal., Placental Dysfunction Underlies Increased Risk of Fetal Growth Restriction and Stillbirth in Advanced Maternal Age Women. Sci Rep 7, 9677 (2017)). Additionally, placental dysfunction can compromise the health of the mother and is proposed to be an etiological factor in preeclampsia (Yagel, S. and Verlohren, S., Role of placenta in development of pre-eclampsia: revisited, Ultrasound Obstet Gynecol. 56(6), 803-808 (2020)).

[0007] In light of the unique developmental chronology of the placenta and the nexus between premature placental aging and pathologies of pregnancies, it is desirable to have a better understanding of the factors that cause or are associated with premature placental aging, and to identify markers associated with premature placental aging. The identification of such age-associated markers may allow for an objective assessment of the chronological and biological ages of a tissue and provide a means to identify pregnancies at risk of a complication related to placental dysfunction, such as stillbirth, preeclampsia or IUGR. Further, such markers, if implicated in the process of organ aging, may provide druggable targets allowing prevention or treatment of pregnancy pathologies or premature organ aging.

[0008] The discussion of documents, acts, materials, devices, articles and the like is included in this specification solely for the purpose of providing a context for the present invention. It is not suggested or represented that any or all of these matters formed part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application.Summary of Invention

[0009] The present invention is premised on the identification by the inventors that circular RNAs (circRNAs); circ_0009000 (hsa_circ_0009000), circ_0024157(hsa_circ_0024157), circ_0061017 (hsa_circ_0061017), circ_0036877(hsa_circ_0036877), circ_0054624 (hsa_circ_0054624) and circ_0111277(hsa_circ_0111277) are associated with the chronological (gestational) age of the placenta. Further, these circRNAs are associated with DNA damage implicating them as agents contributing to the decline in tissue function with age.

[0010] As such, the present invention provides a method of assessing the age of a tissue or organ, the method comprising quantifying within the tissue or organ one or more circRNAs. Preferably the circRNAs are selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0011] The performance of the above method provides a means for objectively assessing the age of the tissue or organ. In embodiments, the age is the chronological age. In other embodiments, the age is the biological age.

[0012] The inventors have identified that as the placenta ages, the quantity of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277 increases. Therefore, in embodiments, an increased quantity of any one or more of the circRNAs indicates an increase in the age of the tissue.

[0013] Several organs, in addition to the placenta, have been identified as having differential aging (such as premature aging) relative to other tissues or organs in the body. These organs include, the liver, the heart, the gastrointestinal tract, the lungs, the testes, the ovaries, the kidneys, the thymus, skeletal muscle, eyes, or the brain. Accordingly, in embodiments of the method of assessing the age of a tissue, the organ is, or the tissue is derived from, placenta, liver, heart, gastrointestinal tract, lungs, testes, ovaries, kidney, thymus, skeletal muscle, eye, or brain.

[0014] The quantity of the one or more circRNAs can be quantified within a sample of the tissue or organ, or a biological sample from an individual comprising the tissue.

[0015] To facilitate the relative assessment of the one or more circRNAs, in embodiments of the method, the one or more circRNAs is / are quantified relative to one or more reference standards. These reference standards provide a benchmark which allow for an assessment of relative age of the tissue or organ, or allows determination of the rate of aging of the tissue or organ. For example, in embodiments, the one or more circRNAs is / are quantified relative to their quantity in a prior biological sample. This allows for an assessment of the change in the one or more circRNAs over time. In some embodiments, the reference standard is a population average for the one or more circRNAs for a given chronological age, or at multiple chronological ages. Such reference standards allow the quantity (i.e. , the quantified level or number) of the one or more circRNAs to be compared to a chart of reference standards across different ages and thereby allows for the inference of an age based on the quantity of the one or more circRNAs. Where the chronological age of the organ or tissue is known, the reference standard may be a healthy population average, which allows the biological age of the tissue or organ to be assessed relative to its chronological age, thereby inferring premature or delayed aging.

[0016] As the circRNAs were identified as increasing with advanced placental age, the present invention also provides a method of assessing placental age in a pregnant subject, the method comprising quantifying within the subject, or a biological sample from the subject, one or more circular RNAs (circRNAs) selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277. In embodiments of this method, an increased quantity of any one or more of the circRNAs indicates an increased placental age.

[0017] In some embodiments of the method of assessing placental age, to allow an assessment of premature or delayed aging, the method is used to assess the biological age of the placenta compared to the gestational age of the placenta.

[0018] Further, the inventors have demonstrated that the circRNAs; circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, are significantly increased in the placentae from stillborn infants (relative to the gestational age of the placentae). Accordingly, these circRNAs may provide diagnostic or prognostic markers for pregnancy complications. Therefore, the present invention also provides a method of assessing the likelihood of a pregnancy complication, the methodcomprising quantifying one or more circRNAs in a pregnant subject, or a biological sample from the pregnant subject, the circRNAs selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0019] As the circRNAs; circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, have been identified as being increased in the placentae of stillborn infants, in embodiments, an increase in the quantity of any one or more of the circRNAs indicates an increased likelihood of a pregnancy complication.

[0020] One of the contributing factors in stillbirth is placental dysfunction. Further, the risk of an adverse pregnancy outcome is significantly increased beyond 38 weeks gestation, with a further elevation in risk beyond 42 weeks’ gestation, which in part is believed to be associated with a drop in placental function demonstrating a nexus between placental age and function.

[0021] Accordingly, in embodiments, the pregnancy complication is placental dysfunction, and the method assesses the likelihood of placental dysfunction. Placental dysfunction is associated with stillbirth, intrauterine growth restriction (IUGR), preterm labour and preeclampsia. Therefore, in some embodiments, the pregnancy complication is stillbirth, or the pregnancy complication is intrauterine growth restriction (IUGR), or the pregnancy complication is preeclampsia (PE).

[0022] To allow relative quantification of the one or more circRNAs, in embodiments, the method further comprises comparing the quantity of the circRNAs in the pregnant subject to a reference standard. In some embodiments of the method of assessing placental age or assessing the likelihood of a pregnancy complication, the reference standard is the quantity of the one or more circRNAs in a subject or biological sample from one or more uncomplicated pregnancies of comparable gestational age.

[0023] Ideally, the biological sample from the pregnant subject is easy to obtain in a minimally invasive manner. Accordingly, in embodiments, the biological sample is a blood sample, a plasma sample, a serum sample, or a urine sample. In embodiments, the biological sample comprises cell-free nucleic acids. In embodiments, the biologicalsample comprises fetal nucleic acids or cell-free fetal nucleic acids. Preferably, the nucleic acid is RNA.

[0024] Assessment of the quantity of one or more of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277 can be performed at any time during pregnancy. However, in embodiments, the one or more circRNAs is / are quantified during the third trimester of pregnancy. In embodiments, the one or more circRNAs is / are quantified during the second trimester of pregnancy. In embodiments, the one or more circRNAs is / are quantified between the 11th and 13th week of pregnancy.

[0025] The quantity of the one or more circRNAs can be assessed at multiple times during pregnancy. Accordingly, in embodiments, the one or more circRNAs is / are quantified in the second trimester and the third trimester of pregnancy. In embodiments, the methods are performed at multiple time points during pregnancy. In embodiments, the methods are performed once a week, once a fortnight or once a month.

[0026] The present invention also provides a method of medical intervention, comprising performing the method of assessing the likelihood of a pregnancy complication as described herein, and performing one or more of the following interventions if there is an increased quantity of any one or more of the circRNAs:- undertaking further assessment of the fetus;- increasing antenatal monitoring;- low-dose aspirin;- corticosteroid prophylaxis;- magnesium sulfate prophylaxis; or- delivering the fetus early.

[0027] In embodiments of the method of medical intervention, increasing antenatal monitoring includes regular assessment of the fetus. In preferred embodiments, the assessment of the fetus includes assessing one or more of: fundal height, cardiotocography (CTG), ultrasound; umbilical artery Doppler ultrasound, middle cerebral artery Doppler ultrasound, amniotic fluid volume, or fetal size measurement.

[0028] Routine fetal size measurements, which can be used with the present invention, include measuring one or more of: abdominal circumference, head circumference, biparietal diameter, femur length, or derivation of estimated fetal weight.

[0029] In embodiments of the above methods, the circRNAs; circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, have the sequences set forth in SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6 (respectively). In embodiments, the one or more circRNAs is / are a natural variant of the sequence set forth in any one of: SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6. In embodiments, the natural variant of the one or more circRNAs has / have at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity to, or comprise(s), any one of: SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6.

[0030] In embodiments of the above methods, the one or more circRNAs is / are quantified relative to its / their cognate linear RNA.

[0031] In embodiments of the above methods, at least 2, 3, 4, or 5 of the circRNAs are quantified, or all six of the circRNAs are quantified.

[0032] The present inventors demonstrated that DNA damage is elevated in placentae from stillborn infants and that the circRNAs circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, can form circR-loops which can lead to DNA damage. Therefore, reducing the quantity of these circRNAs, or preventing them from binding to their cognate genomic DNA, can reduce DNA damage and could treat or prevent pregnancy complications such as those discussed herein.

[0033] Therefore, the present invention provides an interfering nucleic acid comprising a sequence configured to hybridize with any one or more circRNA selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0034] In some embodiments, the interfering nucleic acid comprises a sequence complementary to the back-splice junction of one or more of the circRNAs. This allowstargeting of the circRNAs without targeting the cognate linear RNAs. In preferred embodiments, the interfering nucleic acid is siRNA, microRNA, shRNA, dsRNA or antisense oligonucleotide (AON).

[0035] Also provided by the present invention is a composition configured to reduce hybridisation between any one or more circRNAs selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, and its / their cognate genomic DNA.

[0036] Further provided by the present invention is a composition comprising an RNA interference system configured to reduce the quantity of one or more circRNAs selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0037] In embodiments, of the above compositions, the composition comprises one or more of a microRNA, an siRNA, an shRNA, a dsRNA, an AON, a cre-lox system, a Tigr-Tas system, or a CRISPR / Cas system.

[0038] In embodiments of the above compositions, the interfering nucleic acid is up to 30 nucleotides in length.

[0039] Also provided is a pharmaceutical composition comprising the interfering RNA or RNA interference system as discussed herein and one or more of a pharmaceutically acceptable carrier or excipient.

[0040] Also provided by the present invention is the use of the interfering nucleic acid or the composition as described herein, for the prevention of DNA damage in a cell.

[0041] Also provided by the present invention is a method for reducing DNA damage in a cell, the method comprising exposing the cell to an interfering nucleic acid, wherein the interfering nucleic acid hybridizes to its complementary circRNA and reduces hybridization between the circRNA and its complementary genomic DNA.

[0042] Also provided by the present invention is a method for reducing DNA damage in a cell, the method comprising exposing the cell to the composition comprising an RNA interference system as described herein, wherein the RNA-interference system reduces hybridization between the one or more circRNA(s) and its / their complementary genomic DNA.

[0043] Also provided by the present invention is a method of treating or preventing a pregnancy complication, the method comprising administering to a pregnant subject an interfering nucleic acid or composition as described herein, wherein the interfering nucleic acid or composition reduces hybridization between any one or more of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, and its / their complementary genomic DNA.

[0044] In embodiments, reducing hybridization between any one or more of the circRNAs and its / their complementary genomic DNA is achieved by reducing the quantity of the one or more circRNAs. In embodiments, reducing hybridization between any one or more of the circRNAs and its / their complementary genomic DNA is achieved by interfering with the hybridisation of the one or more circRNAs with its cognate genomic DNA, for example by way of steric hindrance.

[0045] The present invention also provides a kit for quantifying one or more circRNAs selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, the kit comprising one or more pairs of primers or one or more probes, wherein the primer pairs or the probes are specific for one or more of the circRNAs.

[0046] In embodiments of the kit, the one or more pairs of primers are configured for specific amplification of the back-splice junction of the one or more circRNAs. In embodiments of the kit, one of the primers in a pair is, or both of the primers in a pair are, configured to hybridize within 500nts, 450nts, 300nts, 250nts, 200nts, 100nts, 75nts, 50nts, or 25nts of the back-splice junction of the one or more circRNAs. In embodiments of the kit, one of the primers in a pair is configured to hybridize to the back-splice junction of the one or more circRNAs. In embodiments of the kit comprising one or more probes, the one or more probes is / are configured to hybridize to the back- splice junction of the one or more circRNAs. By targeting the backs-splice junction the kit can distinguish circRNAs from their cognate linear RNA or genomic RNA.

[0047] In embodiments, the kit additionally comprises RNase R. RNase R can be used to digest linear RNA and therefore enrich the sample for circRNAs helping reduceinadvertent detection of cognate linear RNA. Additionally, in embodiments, the kit comprises random primers for amplifying a circRNA. This can improve sensitivity of detection.

[0048] The kit of the invention can be used in the methods of assessing the age of an organ or tissue, the methods of assessing placental age, or the methods of assessing the likelihood of a pregnancy complication as described herein. As the method of assessing the likelihood of a pregnancy complication can be used in the method of medical intervention, the kit can also be used in the method of medical intervention as described herein.

[0049] Further provided is a use of the kit as described herein in the methods of assessing the age of an organ or tissue, the methods of assessing placental age, or the methods of assessing the likelihood of a pregnancy complication as described herein. As the method of assessing the likelihood of a pregnancy complication can be used in the method of medical intervention, embodiments also provide the use of the kit in the method of medical intervention as described herein.

[0050] Also provided herein is a system for quantifying one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277 in a sample from a subject, the system comprising: means for quantifying one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277; a computer; and a computer software program configured to be executed by the computer causing quantification of one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0051] In embodiments, the system further comprises means to amplify and / or sequence one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277. In embodiments, this is comprised in the means for quantification.

[0052] In embodiments, the system further comprises a computer-readable medium comprising a reference standard for any one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277. Preferably, the computer software causes the computer to compare the quantity of oneor more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, with the reference standard for the respective circRNA(s). Suitable reference standards are described herein.

[0053] In embodiments, the system further comprises a nucleic acid array comprising a substrate comprising a plurality of immobilised probes which hybridise to at least a portion of one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0054] In embodiments, the system as described herein, is used for performing the methods described herein, including the method of assessing placental age in a pregnant subject, the method of assessing the likelihood of a pregnancy complication or diagnosing a pregnancy complication, and the method of assessing the age of a tissue.

[0055] Also provided herein is a nucleic acid array comprising a substrate comprising a plurality of immobilised probes which separately hybridise to at least a portion of one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624, or circ_0111277. Preferably, the immobilised probes bind to the back- splice junction of the one or more circRNAs.

[0056] In embodiments, the nucleic acid array is used in, or is for use in, one or more of the methods disclosed herein, including the method of assessing placental age in a pregnant subject, the method of assessing the likelihood of a pregnancy complication or diagnosing a pregnancy complication, the method of medical intervention, the method of treating or preventing a pregnancy complication, or the method of assessing the age of a tissue. Further, the nucleic acid array may be included in the kit as described herein.Brief Description of Drawings

[0057] The following Figures 1 to 6 are based on samples isolated from 37, 38, 39, 40 and 41 + uncomplicated placentae (n = 12 placentae per time point), and stillborn placentae (n = 1 ). Data are presented as scatter plots with bars indicating mean ± standard error of the mean (SEM). ns = not significant.

[0058] Figure 1 : Quantity (expressed as fold change relative to 37 weeks’ gestation) of circ_0009000 and linear CRHR2 gene variants: XM_024446665.1 , XM_017011752.2, NM_001202483.2, NM_001202482.2, NM_001202481 .1 and NM_001202475.1.

[0059] Figure 2: Quantity (expressed as fold change relative to 37 weeks’ gestation) of circ_0024157 and linear CWF19L2 gene variants XM_017017239.2, XR_947795.2, NM_152434.3 and XM_011542620.3.

[0060] Figure 3: Quantity (expressed as fold change relative to 37 weeks’ gestation) of circ_0061017 and linear RAB22A gene variant NM_020673.3.

[0061] Figure 4: Quantity (expressed as fold change relative to 37 weeks’ gestation) of circ_0036877 and linear FURIN gene variants NM_001382622.1 , NM_002569.4, NM_001382619.1 , NM_001289823.2, NR_168464.1 ,NM_001382620.1 , NM_001382621 .1 and NM_001289824.2.

[0062] Figure 5: Quantity (expressed as fold change relative to 37 weeks’ gestation) of circ_0054624 and linear PNPT1 gene variant NM_033109.5.

[0063] Figure 6: Quantity (expressed as fold change relative to 37 weeks’ gestation) of circ_0111277 and linear PAPPA2 gene variant XM_005245422.3.

[0064] Figures 7A and 7B: Representative images of (Figure 7A) healthy cells and (Figure 7B) DNA damaged cells, as imaged using epifluorescent microscopy after performing a Comet Assay.

[0065] Figure 8: Levels of DNA damage, as assessed by Tail DNA % in the Comet assay performed in cells isolated from the placentae of 37, 38, 39, 40 and 41 + uncomplicated pregnancies and cells isolated from the placentae of stillbirth pregnancies (n = 12 placentae per time point for uncomplicated gestational groups and n = 4 stillbirth placenta). One hundred cells were analysed for each placenta. Data are presented as mean ± standard error of the mean. Different letters represent statistically significant (p < 0.05) differences.

[0066] Figure 9: DRIP-qPCR analysis using primers for R-loop-positive loci TFPT and CALM3, and R-loop-negative locus EGFRI neg, with and without RNase Htreatment. DRIP-qPCR signal intensity shown as % of Input (DRIP), with indication of mean ± standard error of the mean. *** p < 0.001 , **** p < 0.0001 , ns = not significant, n = 5 placentae with RNase H treatment, and n = 5 placentae without RNase H treatment.

[0067] Figure 10: DRIP-qPCR analysis using primers for circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, with and without RNase H treatment. DRIP-qPCR signal intensity shown as % of Input (DRIP), with indication of mean ± standard error of the mean. *** p < 0.001 , **** p < 0.0001 , ns = not significant, n = 5 placentae with RNase H treatment, and n = 5 placentae without RNase H treatment.

[0068] Figure 11 : Quantity of CRHR2 mRNA (“linear”) and circ_0009000 (“circular”) in HEK293T cells, either untransfected (“control”), transfected with a scrambled siRNA (“scrambled” - SEQ ID NO: 66) or transfected with an siRNA specific to circ_0009000 (“siRNA” - SEQ ID NO: 65). n = 9 / group. Data are presented as mean ± standard error of the mean. **** p < 0.0001 , ns = not significant.

[0069] Figure 12: Levels of DNA damage, as assessed by Tail DNA %, in HEK293T cells, either untransfected (“control”), transfected with a scrambled siRNA (“scrambled” - SEQ ID NO: 66) or transfected with an siRNA specific to circ_0009000 (“siRNA” - SEQ ID NO: 65). n = 9 / group. 100 cells analysed following Comet Assay, per group. Data are presented as mean ± standard error of the mean. **** p < 0.0001 , ns = not significant.

[0070] Figure 13: Quantity (as fold-change relative to housekeeping genes) of circ_0009000, circ_0036877, circ_0111277,_circ_0024157, circ_0061017, circ_0054624, or circ_0000284 in maternal blood sampled at 15-16 weeks’ gestation from women who went on to have a stillbirth (n=16) and women who had live births n=40). Individual data points shown. Horizontal line represents mean. * p < 0.05, ** p < 0.01 , *** p < 0.001 , **** P < 0.0001 .Detailed Description

[0071] The placenta is a unique organ because it develops in placental mammals de novo following implantation of the blastocyst and follows a temporally-defineddevelopmental process over a finite period (Margherita T.Y., Moffett A., Development of the human placenta. Development 15 November 2019; 146 (22), dev163428). As a result, the placenta offers a unique model to study markers of organ and tissue aging and function.

[0072] Using this model the inventors have, for the first time, identified that the quantity of circular RNAs (circRNAs) in the placenta are associated with the gestational age of the placenta. Specifically, the circRNAs circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277 have been shown to be positively associated with placental age, with the quantity of these circRNAs increasing as the gestational age of the placenta increases. Accordingly, it is proposed that these circRNAs are general markers of organ and tissue aging.

[0073] Therefore, the present invention provides a method of assessing the age of an organ or tissue, the method comprising quantifying within the organ or tissue one or more circular RNAs (circRNAs). These circRNAs may include one or more of the circRNAs selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0074] It should be understood that quantification of circRNAs within a tissue or organ includes quantification directly within the tissue or organ (e.g., by way of a biopsy) or from a proxy sample which includes material (such as cells or nucleic acids) from the tissue or organ. Accordingly, in embodiments of the invention, the quantity of the one or more circRNAs is quantified within a sample of the tissue or organ, or a sample from a subject comprising the tissue or organ. The appropriate sample for analysis will be determined by a person skilled in the art based on the tissue or organ being assessed. In some embodiments, the sample will be a biopsy of the organ or tissue. In some embodiment, the sample will be obtained from the subject including the tissue or organ being assessed. Such samples may include one or more of: blood, serum, plasma, urine, semen, sweat, saliva, fecal, swabs (including oral swabs, nasal swabs, vaginal swabs, cervical swabs), amniotic fluid, sputum or aspirates (including lung aspirates or gastrointestinal aspirates). The selection of the appropriate sample will be determined by one skilled in the art and the tissue or organ being assessed. Preferred samples include; blood and blood components such as serum, plasma, or urine.

[0075] Methods are known in the art for collecting and assessing RNA levels in liquid samples including Zhang, L. et al., Cell-Free RNA Sequencing from Biofluid Samples., In: Huang, T., Yang, J., Tian, G. (eds), Liquid Biopsies. Methods in Molecular Biology, vol 2695. Humana, New York, (2023).

[0076] The method of the present invention can be used with any suitable tissue or organ. However, preferred tissues or organs include placenta, liver, heart, gastrointestinal tract, lungs, testes, ovaries, kidney, thymus, skeletal muscle, eye or brain. Various methods for sampling these organs or tissues are known in the art including identification of extracellular vesicles (such as exosomes, microvesicles and apoptotic bodies) from specific tissues, systemically and in the circulatory system. Examples for isolating such vesicles are known in the literature including:Liver - Newman, L.A. et al, Selective Isolation of Liver-Derived Extracellular Vesicles Redefines Performance of miRNA Biomarkers for Non-Alcoholic Fatty Liver Disease. Biomedicines, 10, 195 (2022).Kidney - Brahmadhi A et al., Exosomal proteomics in kidney disease: From technical approaches to clinical applications. J Food Drug Anal., 30(2):202-222 (2022).Lung - Wei H. et al. , Isolation of exosomes from serum of patients with lung cancer: a comparison of the ultra-high speed centrifugation and precipitation methods. Ann Transl Med. 9(10), 882 (2021 ).Brain - Vella L. J., et al. A rigorous method to enrich for exosomes from brain tissue. J Extracell Vesicles. 6(1 ) (2017).Heart - Yu H and Wang Z. Cardiomyocyte-Derived Exosomes: Biological Functions and Potential Therapeutic Implications. Front Physiol., 10, 1049 (2019), and Mu X. et al., Circulating Exosomes Isolated from Septic Mice Induce Cardiovascular Hyperpermeability Through Promoting Podosome Cluster Formation. Shock., 49(4), 429-441 (2018).Bladder - Street J. M. et al., Urine Exosome Isolation and Characterization. Methods Mol Biol. 1641 , 413-423 (2017).Eye - Liu J. et al., Roles of Exosomes in Ocular Diseases. Int J Nanomedicine. 15, 10519-10538 (2020).

[0077] Methods for taking biopsies from tissues are also known in the art including:Liver - Kouvari M. et al., Liver biopsy-based validation, confirmation and comparison of the diagnostic performance of established and novel non-invasive steatotic liver disease indexes: Results from a large multi-center study. Metabolism., Oct, 147:155666 (2023); and Al Knawy, B. and Shiftman, M., Percutaneous liver biopsy in clinical practice, Liver International, 27: 1166-1173 (2007).Kidney - Agarwal, S. K. et al. , Basics of kidney biopsy: A nephrologist's perspective. Indian Journal of Nephrology, 23(4), 243-252 (2013).Lung - Blewett C.J. et al., Open lung biopsy as an outpatient procedure, The Annals of Thoracic Surgery, 71 (4) 1113-1115 (2001 ).Brain - Deepali J. et al., Comparative analysis of diagnostic accuracy of different brain biopsy procedures. Neurology India. 54(4), 394-398 (2006).Heart - Kiamanesh O. and Toma M., The State of the Heart Biopsy: A Clinical Review, CJC Open, 3(4), 524-531 (2021 ).Bladder - Wyndaele, J. J. et al., Cystoscopy and bladder biopsies in patients with bladder pain syndrome carried out following ESSIC guidelines. Scandinavian Journal of Urology and Nephrology, 43(6), 471-475 (2009).- Eye - Eide, N. et al., Fine needle aspiration biopsy in selecting treatment for inconclusive intraocular disease., Acta Ophthalmol. Scand., 77, 448-452 (1999).

[0078] The inventors have shown that changes in the quantity of specific circRNAs (i.e., circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277) are associated with chronologically older tissue, and dysfunctional tissue. In the six circRNAs identified, the quantity of the circRNAs increased as the chronological age increased. Therefore, in embodiments of the invention an increased quantity of any one or more of the circRNAs indicates an increase in the age of the tissue.

[0079] The inventors have utilized placenta as a model for tissue aging, with the placenta having a definitive developmental process which is generally associated with its chronological age. Accordingly, in embodiments the present invention provides a method of assessing the chronological age of an organ or tissue. However, the inventors have also identified significant elevations in circRNAs in placentae from stillbirths, suggesting premature aging in these tissues. This is consistent with previous studies indicating placental age is an etiological factor in in utero fetal death (Maiti, K. et al. Evidence that fetal death is associated with placental aging. Am J Obstet Gynecol. 217, 441 (2017)). In such tissues, premature aging results in the biological age being higher than the gestational age. Accordingly, in embodiments, the invention provides a method of assessing the biological age of an organ or tissue.

[0080] “Chronological age” relates to the age of a tissue or organ based on time since formation. “Biological age” reflects the increase in an organ’s, or tissue’s, chances of becoming diseased, losing function or failing (Sagers L. et al., Prediction of chronological and biological age from laboratory data. Aging (Albany NY), 12(9), 7626- 7638(2020)). Generally, the biological age will correlate with the chronological age; however, the two can be decoupled and tissues, organs or organisms can age prematurely. Such premature aging results in the biological age being higher than expected for a chronological age.

[0081] In embodiments of the methods of the invention, the one or more circRNAs is / are quantified relative to one or more reference standards. In some embodiments, this allows the quantity of the circRNAs to be determined relative to a standard that may be indicative of a normal, healthy or diseased subject or population. In some embodiments, the reference standard is predetermined and represents the normal quantity of the one or more circRNAs in the tissue or organ (or biological sample thereof) at the relevant time, or times. Accordingly, in embodiments of the invention, the reference standard may represent the “normal” quantity of one or more of the circRNAs for a given age, or for multiple ages. The normal quantity may be determined from samples of the relevant tissue or organ, which have been isolated from healthy subjects for one or more known ages. As such, in some embodiments, the reference standard is the quantity of one or more circRNAs from one or more tissues or organs of a defined age or ages. Such tissue or organ samples may be from one or more unrelated health subject. Preferably, the reference standard is the mean quantity of thecircRNAs from multiple healthy subjects and indicates the average quantity in a healthy population. Further, the reference standard may also include a standard deviation from the mean to define a normal range for the tissue or organ within a health population for any given age or ages.

[0082] Consequently, in embodiments, the reference standard is predetermined. In embodiments, the predetermined reference standard is determined by assessing the expression level of the one or more markers in healthy tissues or organs (or a biological sample thereof). In embodiments, the reference standard represents a population standard.

[0083] In embodiments, the reference standard indicates normal changes in the quantity of the one or more circRNAs across time. In some embodiments, the reference standard is a chart of the average quantity of the one or more circRNAs in a given population across time. As such, in embodiments, the reference standard may be an equation representing the slope of a line, or a chart, that plots the average quantity of one or more circRNAs against chronological age, for a given population. Accordingly, the quantity of one or more circRNAs in a tissue or organ can be compared to the chart or equation allowing for calculation of the age of the assessed tissue or organ.

[0084] Alternatively, when the chronological age of the assessed tissue or organ is known, the quantity can be compared to a predetermined reference standard based on normal tissues or organs from the same, or comparable, chronological age. This allows the comparison of the biological age of the assessed tissue or organ to its chronological age - e.g., an abnormal quantity of one or more circRNAs compared to the age- appropriate population average or median may indicate premature aging and a higher biological age (relative to its chronological age), or a lower biological age.

[0085] Alternatively, the reference standard may be a reference quantity of one or more of the circRNAs in an abnormal tissue or organ of the same, or comparable, chronological age. Accordingly, in some embodiments, the reference standard is the quantity of one or more circRNAs in a panel of samples of diseased, or high biological aged, tissues or organs. In such embodiments, the quantified circular RNA level is compared to the reference standard and is consider as abnormal if close to, or matching, the reference standard.

[0086] In some embodiments, the predetermined level is stored on a database on a computer system. In such embodiments, the assessment of the one or more circRNAs in a tissue or organ can be automatically compared by a computer processor to the reference standard and a determination of age can be performed by a computer processor.

[0087] In embodiments, the reference standard is the quantity of one or more circRNAs in a previous sample of the tissue or organ, or a previous sample from the subject comprising the tissue or organ. Accordingly, in an embodiment, the one or more circRNAs is / are quantified relative to the quantity in a prior biological sample. In such an embodiment, the reference standard allows for assessment of the rate of change of the one or more circRNAs. This may allow an assessment of the rate of biological aging of the tissue or organ. An elevated rate of biological aging may indicate a disease state or an increased likelihood of a diseased state.

[0088] Methods for assessing placental age and pregnancy complications

[0089] The present invention also provides a method of assessing placental age in a pregnant subject, the method comprising quantifying within the subject, or a biological sample from the subject, one or more circular RNAs (circRNAs). Preferably, the circRNAs are selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277. As such, in an embodiment of the invention, there is provided a method of assessing placental age in a pregnant subject, the method comprising quantifying within the subject, or a biological sample from the subject, one or more circRNAs selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0090] The inventors of the present invention are the first to have demonstrated that circRNAs can be used to assess the age of the placenta.

[0091] In an embodiment of the method of assessing placental age in a pregnant subject, an increased quantity of any one or more circRNAs (preferably circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277) indicates an increased placental age.

[0092] It is to be understood that quantifying within a pregnant subject includes quantifying in the fetus or placenta of the pregnant subject. Accordingly, a biological sample from the pregnant subject includes biological samples from the fetus or placenta.

[0093] In some embodiments, the placental age is the biological age. In some embodiments, the biological age is relative to the gestational age of the placenta. By comparing the biological age to the gestational age, the method can assess if the placenta is aging prematurely. Such premature aging may indicate an increased likelihood of placental dysfunction, or an increased likelihood of a pregnancy complication or may diagnose a pregnancy complication which can result from impaired placental function. Such an assessment can be performed by comparing the quantity of the one or more circular RNAs in the placenta to the expected quantity of the one or more circular RNAs for the same, or comparable, gestational age. The expected quantity may be a reference standard (as discussed herein).

[0094] Accordingly, the present invention also provided a method of assessing the likelihood of a pregnancy complication, or diagnosing a pregnancy complication, the method comprising quantifying one or more circular RNAs (circRNAs) in a pregnant subject, or a biological sample from the pregnant subject, the circRNAs selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0095] As shown herein, an increase in circRNAs has been associated with the pregnancy complication stillbirth and as such, in an embodiment of the methods of the invention, the pregnancy complication is stillbirth. As discussed above, premature placental aging is proposed as an etiological factor in stillbirth with advanced placental age likely resulting in a decrease in placental function. (Maiti, K. et al. - see above.).

[0096] As there is a nexus between placental age and function (Maiti et al. - see above), it is likely that premature aging of the placenta compromises placental function. Multiple pregnancy complications are associated with compromised placental function and premature aging (Biron-Shental, T. et al., Short telomeres may play a role in placental dysfunction in preeclampsia and intrauterine growth restriction, American Journal of Obstetrics and Gynecology, 202(4), (2010)). Therefore, in someembodiments an increase in the quantity of any one or more circRNAs (preferably circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277) indicates an increased likelihood of a pregnancy complication, or diagnoses a pregnancy complication. In some embodiments, the pregnancy complication is placental dysfunction.

[0097] Pregnancy complication associated with placental dysfunction include intrauterine growth restriction (IUGR) (Sharma D. etal., Intrauterine Growth Restriction: Antenatal and Postnatal Aspects. Clin Med Insights Pediatr. 10, 67-83 (2016); and Lean, S.C. et al., Placental Dysfunction Underlies Increased Risk of Fetal Growth Restriction and Stillbirth in Advanced Maternal Age Women. Sci Rep 7, 9677 (2017)), preeclampsia (Roberts J.M. and Escudero C. The placenta in preeclampsia. Pregnancy Hypertens., 2(2), 72-83 (2012)), spontaneous preterm labour (Preston M. et al. The role of placental insufficiency in spontaneous preterm birth: A literature review. Eur J Obstet Gynecol Reprod Biol., 295, 136-142 (2024)), and gestational diabetes (Calvo, M.J. et al. The placental role in gestational diabetes mellitus: A molecular perspective. touchREV Endocrinol. 20(1 ), 10-18 (2024)). Therefore, in an embodiment of the method of assessing the likelihood of a pregnancy complication, or diagnosing a pregnancy complication, the pregnancy complication is intrauterine growth restriction (IUGR). In an embodiment of the method of assessing the likelihood of a pregnancy complication, or diagnosing a pregnancy complication, the pregnancy complication is preeclampsia (PE). In an embodiment of the method of assessing the likelihood of a pregnancy complication, or diagnosing a pregnancy complication, the pregnancy complication is spontaneous preterm labour. In an embodiment of the method of assessing the likelihood of a pregnancy complication, or diagnosing a pregnancy complication, the pregnancy complication is gestational diabetes.

[0098] Further, in embodiments, the method of the present invention is performed on, or is indicated for use in, a pregnant subject having a pregnancy complication (such as those above). In such embodiments, the quantity of one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277 may inform treatment of the individual. For example, increased levels of one or more of these circRNAs may prompt early delivery of the baby. Conversely, a normal or lowlevel may indicate that premature delivery should be avoided or, if necessary, suppressed (for example in the case of preterm labour).

[0099] In embodiments, the method is performed on a pregnant subject who has an elevated risk of a stillbirth. Risk factors for stillbirth are known in the art and include (but are not limited to): age 35 years or older; tobacco, marijuana, or alcohol use during or just before pregnancy; exposure to second-hand smoke during pregnancy; diabetes; elevated blood pressure prior to 20 weeks’ gestation; being overweight or obese; no previous gestation; previous pregnancy loss, miscarriage, or stillbirth; previous low birth weight or small for gestational age infant; multifetal gestation; assisted reproduction; stress in the preceding two months or during pregnancy; and environmental factors including exposure to pollution and high temperatures (see https: / / www.nichd.nih.gov / health / topics / stillbirth / topicinfo / risk, viewed 1 September 2025). Accordingly, in some embodiments the method of assessing placental age in a pregnant subject, and / or assessing the likelihood of a pregnancy complication, or diagnosing a pregnancy complication, is performed on a subject having one or more of the above risk factors for stillbirth. In embodiments, the pregnant subject has diabetes, which may be gestational diabetes, type 1 diabetes and / or type 2 diabetes.

[0100] As discussed above, in embodiments of the invention, the quantity of one or more circRNAs can be compared to a reference standard and as such, in embodiments of the method of assessing placental age or the method of assessing the likelihood of a pregnancy complication, or diagnosing a pregnancy complication, the method comprises comparing the quantity of the circRNAs in the pregnant subject, or the biological sample from the subject, to a reference standard.

[0101] These reference standards include those discussed above. Further, in some embodiments, the reference standard is the quantity of the one or more circRNAs in an uncomplicated pregnancy of comparable gestational age. The quantity of the circRNAs in an uncomplicated pregnancy can be obtained from one, or multiple uncomplicated, pregnancies. For example, quantity of the circRNAs in an uncomplicated pregnancy may be a population average for one or more time points in gestation. In some embodiments, the reference standard is a population average for the one or more circRNAs for each week of pregnancy starting from week 10, from week 11 , from week 12, from week 13, from week 14, from week 15, from week 16,from week 17, from week 18, from week 19, from week 20, from week 21 , from week 22, from week 23, from week 24, from week 25, from week 26, from week 27, from week 28, from week 29, from week 30, from week 31 , from week 32, from week 33, from week 34, from week 35, from week 36, from week 37, from week 38, from week39, or from week 40.

[0102] In some embodiments, the reference standard relates to 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 specific time points in pregnancy. Preferred time points include the gestational age of the first trimester screening (11 to 13 weeks’ gestation) and / or the second trimester screening (15 to 20 weeks’ gestation) and / or screening for gestational diabetes (24 to 28 weeks’ gestation).

[0103] In some embodiments of the method of assessing placental age, or assessing the likelihood of a pregnancy complication, or diagnosing a pregnancy complication, the one or more circRNAs are quantified during the third trimester of pregnancy. In some embodiments, the one or more circRNAs are quantified during the second trimester of pregnancy. In some embodiments the one or more circRNAs are quantified in the second trimester and the third trimester of pregnancy.

[0104] In some embodiments of the method of assessing placental age, or assessing the likelihood of a pregnancy complication, or diagnosing a pregnancy complication, the one or more circRNAs are quantified at week 10, week 11 , or week 12, or week 13, or week 14, or week 15, or week 16, or week 17, or week 18, or week19, or week 20, or week 21 , or week 22, or week 23, or week 24, or week 25, or week26, or week 27, or week 28, or week 29, or week 30, or week 31 , or week 32, or week33, or week 34, or week 35, or week 36, or week 37, or week 38, or week 39, or week40, or week 41 .

[0105] In embodiments, of the method of assessing placental age, or assessing the likelihood of a pregnancy complication, or diagnosing a pregnancy complication, the one or more circRNAs are quantified during the first trimester screening (11 to 13 weeks’ gestation) and / or the second trimester screening (15 to 20 weeks’ gestation). Accordingly, in some embodiments, the one or more circRNAs are quantified between the 11th and 13th week of pregnancy (inclusive). In some embodiments, the one or more circRNAs are quantified between the 15th and 20th week of pregnancy(inclusive). In some embodiments, the one or more circRNAs are quantified between the 24th and 28th week of pregnancy (inclusive).

[0106] In embodiments, the method is performed at multiple time points during pregnancy. In some embodiments, the method is performed once a week, once a fortnight, once every three weeks, once every four weeks, or once a month. Performing the method at multiple time points allows for continuous monitoring of the quantity of circRNAs throughout gestation and allows a determination of the rate of change of the quantity of circRNAs during gestation. Accordingly, in embodiments where the quantity of circRNAs is quantified by the method of the invention at more than one time during pregnancy, the method can comprise determining the rate of change of circRNA quantity. In embodiments, an elevated rate of change in one or more circRNAs (relative to a reference standard) is indicative of premature placental aging or is indicative of a higher likelihood of a pregnancy complication or the presence of a pregnancy complication (such as those listed herein).

[0107] In an embodiment of the method of assessing placental age, or assessing the likelihood of a pregnancy complication, or diagnosing a pregnancy complication, the biological sample from the subject is a placental sample. In some embodiments, the sample is one or more of: blood, serum, plasma, urine, sweat, saliva, fecal, a vaginal swab or a cervical swab, amniotic fluid. Methods are known in the art for assessing RNA in liquid samples including those outlined above. Specifically, methods for sampling exosomes from the blood of pregnant subjects are known in the art including Li, N. et al. Circulating Non-coding RNAs and Exosomes: Liquid Biopsies for Monitoring Preeclampsia. In: Huang, T., Yang, J., Tian, G. (eds) Liquid Biopsies. Methods in Molecular Biology, vol 2695. Humana, New York, NY (2023). Trophoblast cells can be isolated from the cervical canal from earlier than 12 weeks’ gestation (see Yang X., et al., Trophoblast retrieval from the cervical canal to predict abnormal pregnancy early in gestation: a pilot study. BMC Pregnancy Childbirth, 23, 193 (2023). Accordingly, in embodiments, the cervical swab is from the cervical canal.

[0108] In preferred embodiments, the biological sample is a blood sample, serum sample, or plasma sample. In yet other preferred embodiments, the biological sample is urine. Such samples are desirable due to their minimally invasive nature and ease of obtention.

[0109] In embodiments, the biological sample comprises cell-free nucleic acid. Methods are known in the art for isolating and analysing cell-free nucleic acids including Pds Z, et al., Technical and Methodological Aspects of Cell-Free Nucleic Acids Analyzes. Int J Mol Sci., 21 (22), 8634 (2020); Larson, M.H. et al., A comprehensive characterization of the cell-free transcriptome reveals tissue- and subtype-specific biomarkers for cancer detection. Nat Commun. 12, 2357 (2021 ); and Cabus, L. et al., Current challenges and best practices for cell-free long RNA biomarker discovery. Biomark Res. 10, 62 (2022).

[0110] In embodiments, the biological sample comprises fetal nucleic acid or cell- free fetal nucleic acid. Methods for identifying cells and nucleic acids in maternal circulatory system are known in the art including; Lapaire, O. et al., Fetal Cells and Cell-Free Nucleic Acids in Maternal Blood: Genetic and Immunological Aspects. In: Huppertz, B., Schleuftner, E. (eds), The Placenta. Springer, Berlin, Heidelberg (2023); Nagy B. Cell-free nucleic acids in prenatal diagnosis and pregnancy -associated diseases. EJIFCC. 2019, 30(2), 215-223 (2019); Moufarrej, M.N. et al., Early prediction of preeclampsia in pregnancy with cell-free RNA. Nature, 602, 689-694 (2022); and Hui, L., Noninvasive Approaches to Prenatal Diagnosis: Historical Perspective and Future Directions. In: Levy, B. (eds), Prenatal Diagnosis. Methods in Molecular Biology, vol 1885. Humana Press, New York, NY. (2019). It is to be understood that the placenta is of fetal origin and therefore fetal-derived nucleic acids include nucleic acids derived from the placenta. As such, “fetal nucleic acids” include placenta nucleic acids. Accordingly, in embodiments, the fetal nucleic acids are placenta-derived nucleic acids.

[0111] Circular RN As

[0112] As discussed previously, the inventors have identified the circular RNAs circ_0009000 (SEQ ID NO: 1 ), circ_0024157 (SEQ ID NO: 2), circ_0061017 (SEQ ID NO: 3), circ_0036877 (SEQ ID NO: 4), circ_0054624 (SEQ ID NO: 5) and circ_0111277 (SEQ ID NO: 6) as markers of tissue aging and function, specifically placental tissue aging and function.

[0113] Databases for circular RNAs are known in the art. These include, but are not limited to, circRNADb (http: / / 202.195.183.4:8000 / circrnadb / circRNADb.php), CircAtlas (http: / / circatlas.biols.ac.cn), CircPro (http: / / bis.zju.edu.cn / CircPro), Circbase(http: / / www.circbase.org / ), Starbase v2.0 (http: / / starbase.sysu.edu.cn / ), CIRCpedia v2 (http: / / www.picb.ac.cn / rnomics / circpedia / ), DeepBase v2.0 (http: / / deepbase..s s cn / ), Circnet (http: / / circnet.mbc.nctu.edu.tw / ), Circlnteractome (http: / / circjnteractome. nia.nih.gov / ), CSCD (http: / / gb.whu.edu.cn / CSCD / ), Circ2Traits (http: / / gyanxet-beta. com / circdb / ), CircIncRNAnet (http: / / app.cgu.edu.tw / circlnc / ), CircRNA Disease (http: / / cgga.org.cn:9091 / circRNADisease), Girobank (http: / / www.circbank.cn / ), MiOncoCirc (https: / / mioncocirc.github.io / ), CircFunBase (https: / / bis.zju.edu.cn / CircFunBase / ), TSCD (http: / / gb.whu.edu.cn / TSCD / ), ExoRBase (http: / / www.exorbase.org / ).

[0114] It is to be understood that SEQ ID NOs: 1 to 6 can naturally vary in the population as the circRNAs are derived from the linear form of the RNA. Accordingly, the methods include quantification of natural variants of the sequence set forth in any one of: SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6. Further, the method can be performed in non-human animals and therefore, in some embodiments, the methods include quantification of species-specific variants of the sequences set forth in any one of: SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6.

[0115] In embodiments, the methods include quantification of natural variants or species-specific variants of circ RNAs having at least 80% identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6. In embodiments, the methods include quantification of circ RNAs having at least 85% identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6. In embodiments, the methods include quantification of circ RNAs having at least 90% identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6. In embodiments, the methods include quantification of circ RNAs having at least 92% identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6. In embodiments, the methods include quantification of circ RNAs having at least 94% identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6. In embodiments, the methods include quantification of circ RNAs having at least 95% identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6. In embodiments, the methods include quantification of circ RNAs having at least 96% identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6. In embodiments, the methods includequantification of circ RNAs having at least 97% identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6. In embodiments, the methods include quantification of circ RNAs having at least 98% identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6. In embodiments, the methods include quantification of circ RNAs having at least 99% identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6. In embodiments, the methods include quantification of circ RNAs having at least 99.5% identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6.

[0116] Alignment of sequences for assessment of sequence identity can be conducted by algorithms known in the art, such as the Basic Local Alignment Search Tool (BLAST) algorithm, which is described in Altschul et al, J. Mol. Biol. 215:403-410, 1990. A publicly available, internet interface, for performing BLAST analyses is accessible through the National Center for Biotechnology Information. Additional known algorithms include those published in: Smith & Waterman, “Comparison of biosequences”, Adv. Appl. Math. 2:482, 1981 , Needleman & Wunsch, “A general method applicable to the search for similarities in the amino acid sequence of two proteins” J. Mol. Biol. 48:443, 1970; Pearson & Lipman “Improved tools for biological sequence comparison”, Proc. Natl. Acad. Sci. USA 85:2444, 1988, or by automated implementation of these or similar algorithms. Global alignment programs may also be used to align similar sequences of roughly equal size. Examples of global alignment programs include NEEDLE (available at www.ebi.ac.uk / Tools / psa / emboss_needle / ) which is part of the EMBOSS package (Rice P et al., Trends Genet., 2000; 16: 276- 277), and the GGSEARCH program (fasta.bioch.virginia.edu / fasta_www2 / fasta_www. cgi?rm=compare&pgm=gnw), which is part of the FASTA package (Pearson W and Lipman D, 1988, Proc. Natl. Acad. Sci. USA, 85: 2444-2448). Both of these programs are based on the Needleman-Wunsch algorithm which is used to find the optimum alignment (including gaps) of two sequences along their entire length. A detailed discussion of sequence analysis can also be found in Unit 19.3 of Ausubel et al ("Current Protocols in Molecular Biology" John Wiley & Sons Inc, 1994-1998, Chapter 15, 1998).

[0117] In embodiments, the percentage alignment is assessed across the entirety of the circular RNA. In some embodiments, the alignment is assessed across a regionspanning the back-splice junction. In some embodiments, the region spanning the back-splice junction is 400 nucleotides (nts) either side of the back-splice junction. In some embodiments, the region spanning the back-splice junction is 350 nts either side of the back-splice junction. In some embodiments, the region spanning the back-splice junction is 300 nts either side of the back-splice junction. In some embodiments, the region spanning the back-splice junction is 250 nts either side of the back-splice junction. In some embodiments, the region spanning the back-splice junction is 200 nts either side of the back-splice junction. In some embodiments, the region spanning the back-splice junction is 150 nts either side of the back-splice junction. In some embodiments, the region spanning the back-splice junction is 100 nts either side of the back-splice junction. In some embodiments, the region spanning the back-splice junction is 50 nts either side of the back-splice junction.

[0118] In embodiments, the methods comprise quantifying a region including the back-splice junction of the circRNA.

[0119] In embodiments, the method comprises quantification of a circular RNA derived from any one or more of the genes CRHR2, CWF19L2, RAB22A, FURIN, PNPT1 and PAPPA2. Exemplary accession numbers for transcripts of these genes are provided in Table 4. In embodiments, the methods comprise quantification of a circRNA derived from a natural variant of any one or more of the genes CRHR2, CWF19L2, RAB22A, FURIN, PNPT1 and PAPPA2. In embodiments, the methods comprise quantification of a circRNA derived from a species-specific variant of any one or more of the genes CRHR2, CWF19L2, RAB22A, FURIN, PNPT1 and PAPPA2.

[0120] Databases of circular RNAs are known in the art and include (but are not limited to) Circbase (http: / / circbase.org / ), CircAtlas (https: / / ngdc.cncb.ac.cn / circatlas / ), CircNet (https: / / awi.cuhk.edu.cn / ~CircNet / ), riboCIRC (http: / / www.ribocirc.com), circRNADb (http: / / reprod.njmu.edu.cn / circrnadb), Girobank (www.circbank.cn), CIRCpedia (http: / / www.picb.ac.cn / rnomics / circpedia). Guides to using circular RNA databases are also known in the art including Hu D. et al., Database Resources for Functional Circular RNAs. Methods Mol Biol. 2284, 457-466 (2021 ); and Zhang P. and Chen M., Circular RNA Databases. Methods Mol Biol., 2362, Humana, New York, NY, 109-118 (2021 )).

[0121] In embodiments of the methods of the invention which quantify one or more of; circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, the method comprises quantifying at least two of the circRNAs. In embodiments, the method quantifies at least: circ_0009000 and circ_0024157; circ_0009000 and circ_0061017; circ_0009000 and circ_0036877; circ_0009000 and circ_0054624; circ_0009000 and circ_0111277; circ_0024157 and circ_0061017; circ_0024157 and circ_0036877; circ_0024157 and circ_0054624; circ_0024157 and circ_0111277; circ_0061017 and circ_0036877; circ_0061017 and circ_0054624; circ_0061017 and circ_0111277; circ_0036877 and circ_0054624; circ_0036877 and circ_0111277; circ_0054624 and circ_0111277.

[0122] In embodiments of the above methods of the invention which quantify one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, the method comprises quantifying at least three of the circRNAs. In embodiments, the method quantifies at least: circ_0009000, circ_0024157 and circ_0061017; circ_0009000, circ_0024157 and circ_0036877; circ_0009000, circ_0024157 and circ_0054624; circ_0009000, circ_0024157 and circ_0111277; circ_0009000, circ_0061017 and circ_0036877; circ_0009000, circ_0061017 and circ_0054624; circ_0009000, circ_0061017 and circ_0111277; circ_0009000, circ_0036877 and circ_0054624; circ_0009000, circ_0036877 and circ_0111277; circ_0009000, circ_0054624 and circ_0111277; circ_0024157, circ_0061017 and circ_0036877; circ_0024157, circ_0061017 and circ_0054624; circ_0024157, circ_0061017 and circ_0111277; circ_0024157, circ_0036877 and circ_0054624; circ_0024157, circ_0036877 and circ_0111277; circ_0024157, circ_0054624 and circ_0111277; circ_0061017, circ_0036877 and circ_0054624; circ_0061017, circ_0036877 and circ_0111277; circ_0061017, circ_0054624 and circ_0111277; circ_0036877, circ_0054624 and circ_0111277.

[0123] In embodiments of the above methods of the invention which quantify one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, the method comprises quantifying at least four of the circRNAs. In embodiments the method quantifies at least: circ_0009000, circ_0024157, circ_0061017 and circ_0036877; circ_0009000, circ_0024157, circ_0061017 and circ_0054624; circ_0009000, circ_0024157, circ_0061017 and circ_0111277; circ_0009000, circ_0024157, circ_0036877 and circ_0054624; circ_0009000,circ_0024157, circ_0036877 and circ_0111277; circ_0009000, circ_0024157, circ_0054624 and circ_0111277; circ_0009000, circ_0061017 and circ_0036877, circ_0054624; circ_0009000, circ_0061017, circ_0036877 and circ_0111277; circ_0009000, circ_0061017, circ_0054624 and circ_0111277; circ_0009000, circ_0036877, circ_0054624 and circ_0111277; circ_0024157, circ_0061017, circ_0036877 and circ_0054624; circ_0024157, circ_0061017 and circ_0036877, circ_0111277; circ_0024157, circ_0061017, circ_0054624 and circ_0111277; circ_0024157, circ_0036877, circ_0054624 and circ_0111277; circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0124] In embodiments of the methods of the invention which quantify one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, the method comprises quantifying at least five of the circRNAs. In some embodiments, the method quantifies at least: circ_0009000, circ_0024157, circ_0061017, circ_0036877 and circ_0054624; circ_0009000, circ_0024157, circ_0061017, circ_0036877 and circ_0111277; circ_0009000, circ_0024157, circ_0061017, circ_0054624 and circ_0111277; circ_0009000, circ_0024157, circ_0036877, circ 0054624 and circ_0111277; circ_0009000, circ_0061017, circ_0036877, circ 0054624 and circ_0111277; circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0125] In embodiments of the methods of the invention, the method comprises quantifying all six of the circRNAs; circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0126] In embodiments of the methods of the invention described herein, the method is performed in vitro. In embodiments, the biological sample is provided or previously isolated. In embodiments, the method is performed on a biological sample from a human being but does not include obtaining the biological sample from the human being. In embodiments, the method is not performed on a human body.

[0127] In embodiments, the one or more circRNAs is / are normalised to the expression of its / their cognate linear RNA. In embodiments, the one or more circRNAs is / are quantified relative to its / their cognate linear RNA. As such, in embodiments, anincrease in the one or more circRNAs is an increase in quantity of the circRNAs relative to the quantity of its / their cognate linear RNA.Methods of medical intervention.

[0128] The present invention provides a method of medical intervention, the method comprising assessing the likelihood of a pregnancy complication, or diagnosing a pregnancy complication, according to the methods described herein, and performing one or more of the following interventions if there is an increased quantity of any one or more of the circRNAs; circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 or circ_0111277:- undertaking further assessment of the fetus;- increasing antenatal monitoring;- low-dose aspirin;- corticosteroid prophylaxis;- Tedalafil;- L-arginine;- Nitroglycerin;- Statins (such as pravastatin)- magnesium sulfate prophylaxis; or- delivering the fetus early.

[0129] Methods for antenatal assessment of the fetus are known in the art and include (but are not limited to) fundal height, cardiotocography (CTG), ultrasound; umbilical artery Doppler ultrasound, middle cerebral artery Doppler ultrasound, amniotic fluid volume, or fetal size measurement. Accordingly, in embodiments of the method of medical intervention, the assessment of the fetus includes assessing one or more of: fundal height, cardiotocography (CTG), ultrasound (including umbilical artery Doppler ultrasound and middle cerebral artery Doppler ultrasound), amniotic fluid volume, or fetal size measurement.

[0130] Methods for performing the above assessments are known in the art, including:Fundal height measurement - Fetal Growth Assessment (Clinical) In Pregnancy.Local Operating Procedure, The Royal Hospital for Women, Reviewed August2023; and Engstrom J.L. et al., Fundal height measurement: Part 1 — Techniques for measuring fundal height, Journal of Nurse-Midwifery, Volume 38, Issue 1 Pages 5-16 (1993).Cardiotocography - Diogo Ayres-de-Campos D. et al., FIGO consensus guidelines on intrapartum fetal monitoring: Cardiotocography, International Journal of Gynecology & Obstetrics, Volume 131 , Issue 1 , Pages 13-24 (2015); and Grivell R.M. et al., Antenatal cardiotocography for fetal assessment. Cochrane Database Syst Rev, 2015(9), CD007863 (2015).Ultrasound - Bilardo C.M. et al., International Society of Ultrasound in Obstetrics and Gynecology, ISUOG Practice Guidelines (updated): performance of 11-14- week ultrasound scan., Ultrasound Obstet Gynecol, 61 : 127-143 (2023).Umbilical artery doppler ultrasound and middle cerebral artery Doppler ultrasound - Madazli R. et al., Doppler assessment of umbilical artery, thoracic aorta and middle cerebral artery in the management of pregnancies with growth restriction, Acta Obstetricia et Gynecologica Scandinavica, 80(8), 702-707 (2001 ); and ISUOG Practice Guidelines: use of Doppler ultrasonography in obstetrics. Ultrasound Obstet Gynecol, 41 : 233-239 (2013).Fetal size measurements - Papageorghiou A.T. et al., International standards for early fetal size and pregnancy dating based on ultrasound measurement of crownrump length in the first trimester of pregnancy. Ultrasound Obstet Gynecol, 44: 641 - 648, (2014); and Salomon L.J. et al., ISUOG Practice Guidelines: ultrasound assessment of fetal biometry and growth. Ultrasound Obstet Gynecol, 53: 715-72 (2019).Amniotic fluid volume - Crellin H.B. and Singh V., Sonography Evaluation of Amniotic Fluid. [Updated 2023 Jan 16], In: StatPearls [Internet], Treasure Island (FL): StatPearls Publishing; 2024 Jan- Available from: https: / / www.ncbi.nlm.nih.gov / books / NBK570623 / .

[0131] In some embodiments, fetal size measurement includes measuring one or more of: abdominal circumference, head circumference, biparietal diameter, femur length, or derivation of estimated fetal weight (see Salomon, L.J. etal., ISUOG PracticeGuidelines: ultrasound assessment of fetal biometry and growth. Ultrasound Obstet Gynecol, 53: 715-723 (2019)).

[0132] In embodiments of the method of medical intervention, increasing antenatal monitoring includes regular assessment of the fetus. In embodiments, regular assessment is every week, or every two weeks, or every three weeks, or every four weeks, or every month. In embodiments, regular assessment may start from week 10, from week 11 , from week 12, from week 13, from week 14, from week 15, from week 16, from week 17, from week 18, from week 19, from week 20, from week 21 , from week 22, from week 23, from week 24, from week 25, from week 26, from week 27, from week 28, from week 29, from week 30, from week 31 , from week 32, from week 33, from week 34, from week 35, from week 36, from week 37, from week 38, from week 39, from 40 weeks, or from 41 weeks.

[0133] Low dose aspirin is routinely prescribed prophylactically in patients at high risk of preeclampsia, with commencement of prophylactic treatment between 12- and 28-weeks’ gestation. Accordingly, in embodiments of the method of medical intervention, the method comprises administration of low dose aspirin to a pregnant subject if there is an increased quantity of any one or more of the circRNAs circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 or circ_0111277.

[0134] Protocols for low dose aspirin for preeclampsia are known in the art including Bryant A.S. et al., Low-Dose Aspirin Use for the Prevention of Preeclampsia and Related Morbidity and Mortality, Practice Advisory note, American College of Obstetricians and Gynecologists (2021 ); Pathiraja PDM et al., Indications for commencing aspirin for the prevention of pregnancy-induced hypertension and preeclampsia spectrum disorders. Aust J Gen Pract. Oct;51 (10), 767-768 (2022); and LeFevre ML. Low-dose aspirin use for the prevention of morbidity and mortality from preeclampsia: U.S. Preventive Services Task Force recommendation statement. U.S. Preventive Services Task Force. Ann Intern Med, 161 , 819-826 (2014).

[0135] Due to an elevated risk of preterm delivery, subjects suffering from preeclampsia, placental insufficiency and intrauterine growth restriction are recommended to receive an administration of prophylactic corticosteroid between 29weeks’ gestation and 36 weeks’ gestation. Accordingly, in embodiments of the method of medical intervention, the method comprises administration of prophylactic corticosteroids to a pregnant subject if there is an increased quantity of any one or more of the circRNAs; circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 or circ_0111277.

[0136] Protocols for administering corticosteroids during gestation are known in the art including, Figueras F. and Gardosi J., Intrauterine growth restriction: New concepts in antenatal surveillance, diagnosis, and management. Am. J. Obstet. Gynecol., 204, 288-300 (2011).

[0137] Additionally, pregnant subjects suffering from preeclampsia, placental insufficiency and intrauterine growth restriction, or at high risk of these complications, are recommended to receive administration of magnesium sulfate before 33 weeks’ gestation or preferably before 29 weeks’ gestation. Accordingly, in embodiments of the method of medical intervention, the method comprises administration of prophylactic magnesium sulfate to a pregnant subject if there is an increased quantity of any one or more of the circRNAs circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 or circ_0111277.

[0138] Protocols for administering magnesium sulfate during gestion are known in the art including, Figueras F. and Gardosi J., Intrauterine growth restriction: New concepts in antenatal surveillance, diagnosis, and management. Am. J. Obstet. Gynecol., 204, 288-300 (2011 ) and Shennan A, et al., FIGO good practice recommendations on magnesium sulfate administration for preterm fetal neuroprotection. Int J Gynecol Obstet., 155: 31-33 (2021 ).

[0139] In situations where there is a high risk of maternal or fetal morbidity or mortality, early delivery of the fetus may be indicated. Accordingly, in embodiments of the method of medical intervention, the method comprises early delivery of the fetus if there is an increased quantity of any one or more of the circRNAs; circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 or circ_0111277. Early delivery includes any delivery instigated prior to natural labour.

[0140] Methods for early delivery include caesarean section and induced labour using misoprostol, oxytocin or a combination of prostaglandin Ei and oxytocin (seeRobinson D et al., Guideline No. 432c: Induction of Labour, SOGC Clinical Practice Guideline, 45(1 ), 70-77 (2023).

[0141] In embodiments, the method of medical intervention is a method of medical treatment or prevention of a pregnancy complication. In embodiments the pregnancy complication is selected from the group consisting of: stillbirth, intrauterine growth restriction, preterm labour, preeclampsia or gestational diabetes.Methods for quantifying circRNAs.

[0142] Methods are known in the art for quantification of specific circRNAs. For example:- Pandey PR. et al., Methods for analysis of circular RNAs. Wiley Interdiscip Rev RNA. 11 (1): e1566 (2020);- Zhang M. et al., Circular RNA detection methods: A minireview, Taianta, 238(2), 123066 (2022);- Wang P.L. etal., Circular RNA is expressed across the eukaryotic tree of life. PLoS One 9: e90859 (2014);- Zhang p. et al., Ultrasensitive detection of circular RNA by accurate recognition of the specific junction site using stem-loop primer induced double exponential amplification, Taianta, 217, 121021 (2020);- Boss M. and Arenz C., A Fast and Easy Method for Specific Detection of Circular RNA by Rolling-Circle Amplification, Chem Bio Chem, 21 (6), pp. 793-796 (2020);- Bejugam PR. et al., Seeing Is Believing: Visualizing Circular RNAs. Noncoding RNA., 6(4) pp. 45 (2020); and- Conn V. and Conn S J. , SplintQuant: a method for accurately quantifying circular RNA transcript abundance without reverse transcription bias. RNA. 25(9), pp.1202- 1210 2019.

[0143] Methods include (but are not limited to): Polymerase Chain Reaction (PCR) assays (including semiquantitative PCR, real-time quantitative PCR (qPCR) and digitalPCR (dPCR)); Northern Blotting; Microarrays; Next-Generation sequencing (NGS); isothermal amplification such as loop-mediated isothermal amplification; branched DNA assays and SplintQuant.

[0144] As such, any of the above techniques can be used for quantification in the methods disclosed herein. Further, the kits of the present invention are intended to be used in, or suitable for, any suitable quantification technique.

[0145] Techniques for NGS are known in the art; for example; Slatko BE, et al., AF. Overview of Next-Generation Sequencing Technologies. Curr Protoc Mol Biol; 122(1 ): e59 (2018); Taishan Hu. et al., Next-generation sequencing technologies: An overview., Human Immunol., 82(11 ), 801 -811 (2021 ); and Liu, Z. et al., Detection of circular RNA expression and related quantitative trait loci in the human dorsolateral prefrontal cortex., Genome Biol 20, 99 (2019).

[0146] Samples comprising RNA can include tissue or cell samples. From these total RNA (comprising circRNA) can be extracted. Methods are known in the art for performing such extraction including the use of commercially available kits such as Qiagen™ RNeasy series of kits. Further, methods for extracting RNA are provided herein. Alternatively, the RNA may be pre-extracted or purified from a sample of the tissue or cells.

[0147] As is known in the art, for next generation sequencing, and other quantification protocols, following extraction or obtention of total RNA, the RNA requires further preparation to prepare a library. This can include purification and, optionally, pre-sequencing amplification. This can comprise removal of linear RNAs, which can be achieved by various means including RNase R treatment (Xiao M.S., and Wilusz J.E., An improved method for circular RNA purification using RNase R that efficiently removes linear RNAs containing G-quadruplexes or structured 3' ends. Nucleic Acids Res., 47(16), 8755-8769 (2019)).

[0148] Library preparation can further require RNA conversion into cDNA (Kukurba K.R., and Montgomery S.B., RNA Sequencing and Analysis. Cold Spring Harb Protoc., 11 , 951 -969 (2015)). Complementary DNA is then amplified, and the amplicons are sequenced. Platforms for performing RNA sequencing are known in the art and include those set out in Table 1 .Table 1 - RNA sequencing platforms

[0149] After sequencing, sequenced fragments are counted via bioinformatic processes which align the sequenced fragments with a reference genome or sequence and then count the number of sequences which align with each annotated circular RNA. The reference genome will be a genome associated with the species from which the sample is derived.

[0150] Alternative ways to quantify circular RNAs are known in the art including quantitative PCR (qPCR), including is multiplex quantitative polymerase chain reaction. Methods are known in the art for performing such PCR reactions (see for example Panda A.C. and Gorospe M. Detection and Analysis of Circular RNAs by RT-PCR. Bio Protoc., 8(6), e2775 (2018); and You X. et al., Neural circular RNAs are derived from synaptic genes and regulated by development and plasticity. Nat Neurosci. 18(4): pp. 603-610 (2015)). Specific qPCR techniques and primers are provided herein. Further, quantification of circRNAs can be performed by digital PCR (see for example Das A. et al., Quantification of Circular RNAs Using Digital Droplet PCR, J Vis Exp., 187 (2022)).

[0151] These PCR protocols require the use of primer pairs which bind to specific portions of the target circRNAs. In some embodiments, the primers used for PCR include any primer pair provided herein in Table 4.

[0152] Other methods for circRNA quantification include nucleic acid array. Methods for using nucleic acid arrays, such as microarrays, for detection of circular RNAs are known in the art (see for example Li S. et al., Microarray expression profile analysis of circular RNAs and their potential regulatory role in bladder carcinoma. Oncol Rep., 45(1 ), 239-253 (2021 )). Such nucleic acid arrays comprise a substrate with immobilized probes in specified locations (for example Arraystar Inc’s Human circular RNA Array). These localized probes have known sequences and hybridize to specific nucleic acids in the sample, such as the circRNAs; circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, or any other desired circRNA.

[0153] The arrays are exposed to two independently-labelled samples comprising nucleic acids generated from target circular RNAs and the final fluorescence at any location is indicative of the relative quantity of a specific target RNA in one sample relative to the other.

[0154] Further, quantification methods may comprise providing a probe for detection of a portion of the one or more circRNAs disclosed herein. This probe may further comprise a reporter allowing detection of hybridization of the probe to a target. Examples of probes include hydrolysis probes (such as TaqMan® probes), dual hybridization probes, molecular beacons, and scorpion probes (see for example Artika I.M. et al., Real-Time Polymerase Chain Reaction: Current Techniques, Applications, and Role in CO VID-19 Diagnosis. Genes (Basel); 13(12) pp. 2387 (2022)). Probes may also comprise fluorescent reporters (with or without a quencher), enzymes (such as alkaline phosphatase or horseradish peroxidase) and radioactive isotopes depending on the technique used (such a PCR vs Northern blotting).

[0155] Methods and products for reducing circRNA quantity or function.

[0156] The present inventors have shown that the circRNAs; circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277 increase in quantity with chronological age of the placenta and are correlated with DNA damage.Further, the inventors have shown that there is elevated DNA damage and elevated levels of the circRNAs in stillborn-derived placentae (see examples below).

[0157] In addition, the inventors have shown that each of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277 can form a circR-loop with their cognate gene sequence, which is a known mechanism for introducing DNA damage. Finally, the inventors have demonstrated that such circR- loop formation between circ_0009000 and its cognate gene CRHR2 results in increased DNA damage, while siRNA-induced knock-down of circ_0009000 significantly reduces DNA damage. Therefore, it is proposed that knock-down of any one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, or inhibition of circR-loop formation between circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277 and their cognate DNA may reduce DNA damage caused by these circRNAs.

[0158] As such, the present invention provides a method for reducing DNA damage in a cell, the method comprising exposing the cell to an interfering nucleic acid or composition, as described herein, wherein the interfering nucleic acid or composition reduces hybridization between any one or more of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277 and its / their complementary genomic DNA. Such reduction of hybridisation between the circRNAs and their complementary genomic DNA may result from inhibition of circR-loop formation (e.g., by the interfering nucleic acid hybridising to the circRNA and preventing RNA:DNA hybridisation) or by reducing quantity of the circRNAs.

[0159] Further, reducing the quantity of any one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277 may help prevent pathologies of pregnancies including placental dysfunction, stillbirth, intrauterine growth restriction, preterm labour, or preeclampsia. Therefore, the present invention provides a method for treating or preventing a pregnancy complication, the method comprising administering to a pregnant subject an interfering nucleic acid or composition, wherein the interfering nucleic acid or composition reduces hybridization between any one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, and its / their complementary genomicDNA. In embodiments, the method of treating or preventing a pregnancy pathology is administered on a subject assessed to have an increased quantity of any one or more of; circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277. The quantity of; circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, can be assessed using the methods disclosed herein. In embodiments, the pregnancy complication is placental dysfunction, intrauterine growth restriction, preeclampsia or stillbirth.

[0160] The present invention also provides an interfering nucleic acid comprising a sequence configured to hybridize any one or more circRNA selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0161] “interfering nucleic acid” refers to the use of exogenous RNA or DNA to inhibit the function of, or knock down the level of, the one or more circRNAs.

[0162] In preferred embodiments, the interfering nucleic acid comprises a sequence complementary to the back-splice junction of one or more of the circRNAs. This allows for specific targeting of the circRNA without hybridizing to the cognate linear RNA or DNA.

[0163] The present invention also provides a composition comprising an RNA- interference system configured to reduce hybridisation between any one or more circRNA selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, and its / their cognate genomic DNA.

[0164] Means for targeting circRNA for therapy are known in the art (see for example He A.T. et al. Targeting circular RNAs as a therapeutic approach: current strategies and challenges. Sig Transduct Target Then, 6, 185 (2021 ); Wu N, et al., CircRNA perspective: new strategies for RNA therapy. Trends Mol Med., 28(4), 343- 344 (2022); and Pisignano, G. et al. Going circular: history, present, and future of circRNAs in cancer., Oncogene, 42, 2783-2800 (2023)).

[0165] In preferred embodiments, the composition, which is configured to reduce hybridisation between the one or more circRNAs and its / their cognate genomic DNA,targets the back-splice junction of one or more circRNAs. This allows for specific targeting of the circRNA without targeting the cognate linear RNA or DNA.

[0166] The present invention also provides a composition comprising an RNA- interference system configured to reduce the quantity of one or more circRNA selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0167] As used herein “RNA-interference system” means a system, or molecule, or combinations of molecules, which inhibits or reduces the binding or function of a circRNA. Such RNA-interference systems may hybridise or otherwise bind to the circRNA to inhibit or reduce its function, or may silence or reduce generation of the circRNA, or may degrade, excise or facilitate degradation of a circRNA.

[0168] Various means of reducing the quantity of circRNAs, and RNA-interference systems, are known in the art including (but not limited to):- microRNA;- siRNA;- shRNA;- dsRNA;- antisense oligonucleotides (AONs);- cre-lox systems;- Tigr-Tas; and- CRISPR / Cas systems (including Cas9 and Cas13 systems).

[0169] Accordingly, in embodiments of the method for reducing DNA damage in a cell, or the method for treating or preventing a pregnancy complication, the method comprises administering an interfering nucleic acid or composition comprising one or more of a microRNA, an siRNA, an shRNA, a dsRNA, an AON a cre-lox system, a Tigr- Tas system or a CRISPR / Cas system.

[0170] In embodiments of the present invention providing interfering nucleic acids comprising a sequence configured to hybridize with any one or more circRNA selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, the interfering nucleic acid comprises one or more of a microRNA, an siRNA, an shRNA, a dsRNA, or an AON.

[0171] In embodiments of the present invention providing a composition configured to reduce hybridisation between the one or more circular RNA (circRNA) selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, and its / their cognate genomic DNA, the composition comprises one or more of a microRNA, an siRNA, an shRNA, a dsRNA, an AON, a cre-lox system, a Tigr-Tas system, or a CRISPR / Cas system.

[0172] In embodiments of present invention providing a composition configured to reduce the quantity of the one or more circular RNA (circRNA) selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, the composition comprises one or more of a microRNA, an siRNA, an shRNA, a dsRNA, an AON, a cre-lox system, a Tigr-Tas system or a CRISPR / Cas system.

[0173] In an embodiment, the interfering nucleic acid is one or more of siRNA, microRNA, shRNA, dsRNA or AON. In an embodiment, the interfering nucleic acid is an interfering RNA. In embodiments, the interfering RNA is one or more of siRNA, microRNA, shRNA or dsRNA. In an embodiment, the interfering RNA is siRNA.

[0174] Small interfering RNA (siRNA) for circ_0009000 is provided herein (SEQ ID NO: 65). Means for designing siRNAs to target circRNAs are known in the art, including Zhang Y, et al., Characterization of circular RNAs. Methods Mol Biol. 1402: 215-227 (2016); Chen S, et al., Widespread and functional RNA circularization in localized prostate cancer. Cell, 176: 831-843 (2019); and Taxman D.J. (eds), siRNA Design: Methods and Protocols, Methods in Molecular Biology, vol. 942, Humana Totowa, NJ.

[0175] Means for designing dsRNA and microRNAs to target circRNAs are known in the art including, Pamudurti, N.R. et al., An in vivo strategy for knockdown of circular RNAs. Cell Discov., 6, 52 (2020).

[0176] Means for designing shRNAs for targeting circRNAs are known in the art including, Zhang X. etal., Circ-CUX1 accelerates the progression of neuroblastoma via miR-16-5p / DMRT2 axis. Neurochem Res., 45, 2840-55 (2020) and Chen Y., et al., Circular RNA circAGO2 drives cancer progression through facilitating HuR-repressed functions of AG02-miRNA complexes. Cell Death Differ. 26, 1346-64 (2019).

[0177] Means for designing AONs for targeting circRNAs are known in the art including, Han K, et al., CircLONP2 enhances colorectal carcinoma invasion and metastasis through modulating the maturation and exosomal dissemination of microRNA-17. Mol Cancer., 19 (2020).

[0178] Means for designing cre-lox systems are known in the art including, Guarnerio, J. et al., Intragenic antagonistic roles of protein and circRNA in tumorigenesis., Cell Res., 29, 628-640 (2019); and Jiang, Q. et al., Circular RNA- ZNF532 regulates diabetes-induced retinal pericyte degeneration and vascular dysfunction., J. Clin. Invest., 130, 3833-3847 (2020).

[0179] Means for designing Tigr-Tas systems are known in the art including, Faure G, et al. TIGR-Tas: A family of modular RNA-guided DNA-targeting systems in prokaryotes and their viruses. Science, 388, 6746 (2025).

[0180] Means for designing CRISPR / Cas systems are known in the art including, Huang, S. et al., Loss of super-enhancer-regulated circRNA Nfix induces cardiac regeneration after myocardial infarction in adult mice. Circulation., 139, 2857-2876 (2019); and Siqi Li, X. L. et al., Screening for functional circular RNAs using the CRISPR-Cas13 system. Nature Methods, 18, 51-59 (2021 ).

[0181] Also provided is a pharmaceutical composition comprising the interfering nucleic acid or composition disclosed herein and one or more of a pharmaceutically acceptable carrier, stabilizer or excipient.

[0182] Means for delivering interfering nucleic acids or RNA interfering systems are known in the art including exosomes, peptide-nucleic acid conjugates, lipid nanoparticles, polymer nanoparticles and gold nanoparticles (see for example Du W.W. et al., A circular RNA circ-DNMT1 enhances breast cancer progression by activating autophagy. Oncogene. 37 (2018); Fang L. et al., The circular RNA circ- Ccnb 1 dissociates Ccnb 1 / Cdk1 complex suppressing cell invasion and tumorigenesis. Cancer Lett. 459 (2019); Tam, Y. Y. C, etal., Advances in lipid nanoparticles for siRNA delivery. Pharmaceutics 5, 498-507 (2013); Oliveira, A. C. et al., Lipid-based nanocarriers for siRNA delivery: challenges, strategies and the lessons Learned from the DODAX: MO Liposomal System. Curr. Drug Targets 20, 29-50 (2019); Ojea- Jimenez, I. et al., Engineered inorganic nanoparticles for drug delivery applications.Cure. Drug Metab., 14, 518-530 (2013); Kulkarni, J. A. et al., Lipid nanoparticle technology for clinical translation of siRNA therapeutics. Acc. Chem. Res., 52, 2435- 2444 (2019); El-Andaloussi, S. et al., Exosome-mediated delivery of siRNA in vitro and in vivo. Nat. Protoc. 7, 2112 (2012); Shtam, T. A. et al., Exosomes are natural carriers of exogenous siRNA to human cells in vitro. Cell Commun. Signal. 11 , 1-10 (2013); Tai, W. & Gao, X. Functional peptides for siRNA delivery. Adv. Drug Deliv. Rev. 110— 111 , 157-168 (2017); and Setten, R. L. et al., The current state and future directions of RNAi-based therapeutics. Nat. Rev. Drug Discov. 18, 421-446 (2019)). Accordingly, in embodiments of the invention, the composition comprises one or more of an exosome, peptide-nucleic-acid conjugate, or a nanoparticle, preferably, a polymer nanoparticle or a gold nanoparticle. In embodiments of the method for reducing DNA damage in a cell, or the method for treating or preventing a pregnancy complication, the method comprises administering an interfering nucleic acid by way of one or more of an exosome, a peptide-nucleic acid conjugate; or a nanoparticle. Preferably, the nanoparticle is a lipid nanoparticle, a polymer nanoparticle or a gold nanoparticle.

[0183] The present invention also provides a use of the interfering nucleic acids or compositions as described herein for the prevention of DNA damage in a cell.

[0184] The present invention also provides an interfering nucleic acids or compositions as described herein for the prevention of DNA damage in a cell.Kits and systems for quantifying circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0185] The present invention provides a kit for quantifying one or more circRNAs selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, the kit comprising one or more pairs of primers or one or more probes, wherein the primer pairs or the probes are specific for one or more of the circRNAs.

[0186] In embodiments or the kit, the one or more pairs of primers are configured for specific amplification of the back-splice junction of the one or more circRNAs. Preferably, where the kit comprises one or more primer pairs, one of the primers in a pair is, or both of the primers in a pair are, configured to hybridize within 500nts, 450nts, 300nts, 250nts, 200nts, 100nts, 75nts, 50nts, or 25nts of the back-splice junction of theone or more circRNAs. In some embodiments, one of the primers in a pair is configured to hybridize to the back-splice junction of the one or more circRNAs. In embodiments of the kit comprising a probe, the one or more probes is / are configured to hybridize to the back-splice junction of the one or more circRNAs. By specifically amplifying or binding to the back-splice junction, the kit can distinguish between circular RNAs and their cognate linear mRNA or genomic DNA.

[0187] In embodiments, the kit comprises one or more pairs of primers selected from Table 4. In embodiments, the kit comprises pairs of primers, or probes, for more than one of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0188] In embodiments of the kit comprising primer pairs or probes for more than one of the circRNAs, the kit comprises primer pairs or probes specific for at least two of the circRNAs. In embodiments, the kit comprises primer pairs, or probes, specific for at least: circ_0009000 and circ_0024157; circ_0009000 and circ_0061017; circ_0009000 and circ_0036877; circ_0009000 and circ_0054624; circ_0009000 and circ_0111277; circ_0024157 and circ_0061017; circ_0024157 and circ_0036877; circ_0024157 and circ_0054624; circ_0024157 and circ_0111277; circ_0061017 and circ_0036877; circ_0061017 and circ_0054624; circ_0061017 and circ_0111277; circ_0036877 and circ_0054624; circ_0036877 and circ_0111277; circ_0054624 and circ_0111277.

[0189] In embodiments of the kit comprising primer pairs or probes for more than one of the circRNAs, the kit comprises primer pairs or probes specific for at least three of the circRNAs. In embodiments, the kit comprises primer pairs, or probes, specific for at least: circ_0009000, circ_0024157 and circ_0061017; circ_0009000, circ_0024157 and circ_0036877; circ_0009000, circ_0024157 and circ_0054624; circ_0009000, circ_0024157 and circ_0111277; circ_0009000, circ_0061017 and circ_0036877; circ_0009000, circ_0061017 and circ_0054624; circ_0009000, circ_0061017 and circ_0111277; circ_0009000, circ_0036877 and circ_0054624; circ_0009000, circ_0036877 and circ_0111277; circ_0009000, circ_0054624 and circ_0111277; circ_0024157, circ_0061017 and circ_0036877; circ_0024157, circ_0061017 and circ_0054624; circ_0024157, circ_0061017 and circ_0111277; circ_0024157, circ_0036877 and circ_0054624; circ_0024157, circ_0036877 and circ_0111277;circ_0024157, circ_0054624 and circ_0111277; circ_0061017, circ_0036877 and circ_0054624; circ_0061017, circ_0036877 and circ_0111277; circ_0061017, circ_0054624 and circ_0111277; circ_0036877, circ_0054624 and circ_0111277.

[0190] In embodiments of the kit comprising primer pairs or probes for more than one of the circRNAs, the kit comprises primer pairs or probes specific for at least four of the circRNAs. In embodiments, the kit comprises primer pairs, or probes, specific for at least: circ_0009000, circ_0024157, circ_0061017 and circ_0036877; circ_0009000, circ_0024157, circ_0061017 and circ_0054624; circ_0009000, circ_0024157, circ_0061017 and circ_0111277; circ_0009000, circ_0024157, circ_0036877 and circ_0054624; circ_0009000, circ_0024157, circ_0036877 and circ_0111277; circ_0009000, circ_0024157, circ_0054624 and circ_0111277; circ_0009000, circ_0061017 and circ_0036877, circ_0054624; circ_0009000, circ_0061017, circ_0036877 and circ_0111277; circ_0009000, circ_0061017, circ_0054624 and circ_0111277; circ_0009000, circ_0036877, circ_0054624 and circ_0111277; circ_0024157, circ_0061017, circ_0036877 and circ_0054624; circ_0024157, circ_0061017 and circ_0036877, circ_0111277; circ_0024157, circ_0061017, circ_0054624 and circ_0111277; circ_0024157, circ_0036877, circ_0054624 and circ_0111277; circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0191] In embodiments of the kit comprising primer pairs or probes for more than one of the circRNAs, the kit comprises primer pairs or probes specific for at least five of the circRNAs. In embodiments, the kit comprises primer pairs, or probes, specific for at least: circ_0009000, circ_0024157, circ_0061017, circ_0036877 and circ_0054624; circ_0009000, circ_0024157, circ_0061017, circ_0036877 and circ_0111277; circ_0009000, circ_0024157, circ_0061017, circ_0054624 and circ_0111277; circ_0009000, circ_0024157, circ_0036877, circ_0054624 and circ_0111277; circ_0009000, circ_0061017, circ_0036877, circ_0054624 and circ_0111277; circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0192] Embodiments of the kit, comprise primer pairs, or probes, specific for at least all six of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0193] In embodiments, the kit further comprises RNase R to allow digestion of linear RNAs prior to quantification.

[0194] In embodiments, the kit comprises random primers for amplifying a circRNA. This allows for prior universal amplification of the circRNAs before quantifying, which may be required when low total RNA is isolated from a sample.

[0195] The invention also provides a kit for use in one or more of the methods described herein, including the method of assessing placental age in a pregnant subject, the method of assessing the likelihood of a pregnancy complication or diagnosing a pregnancy complication, the method of medical intervention, the method of treating or preventing a pregnancy complication, or the method of assessing the age of a tissue.

[0196] The invention also provides for the use of a kit in one or more of the methods described herein, including the method of assessing placental age in a pregnant subject, the method of assessing the likelihood of a pregnancy complication or diagnosing a pregnancy complication, the method of medical intervention, the method of treating or preventing a pregnancy complication, or the method of assessing the age of a tissue.

[0197] Systems for quantification and nucleic acid arrays

[0198] Also provided herein is a system for quantifying one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277 in a sample from a subject, the system comprising: means for quantifying one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277; a computer; and a computer software program configured to be executed by the computer causing quantification of one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0199] In embodiments, the system further comprises means to amplify and / or sequence one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277. In embodiments, this is comprised in the means to for quantification.

[0200] In embodiments, the system further comprises a computer-readable medium comprising a reference standard for any one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277. Preferably, the computer software causes the computer to compare the quantity of one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, with the reference standard for the respective circRNA(s). Suitable reference standards have been described herein.

[0201] In embodiments, the system further comprises a nucleic acid array comprising a substrate comprising a plurality of immobilised probes which hybridise to at least a portion of one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0202] In embodiments, the system as described herein, is used for performing the methods described herein, including the method of assessing placental age in a pregnant subject, the method of assessing the likelihood of a pregnancy complication or diagnosing a pregnancy complication, and the method of assessing the age of a tissue.

[0203] Also provided herein is a nucleic acid array comprising a substrate comprising a plurality of immobilised probes which separately hybridise to at least a portion of one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 or circ_0111277. Preferably, the immobilised probes bind to the back- splice junction of the one or more circRNAs.

[0204] In embodiments, the nucleic acid array is used in, or is for use in, one or more of the methods disclosed herein, including the method of assessing placental age in a pregnant subjects, the method of assessing the likelihood of a pregnancy complication or diagnosing a pregnancy complication, the method of medical intervention, the method of treating or preventing a pregnancy complication, or the method of assessing the age of a tissue. Further, the nucleic acid array may be included in the kit as described herein. Specific embodiments of the present invention

[0205] Embodiment 1 : A method of assessing placental age in a pregnant subject, the method comprising quantifying within the subject, or a biological sample from the subject, one or more circular RNAs (circRNAs) selected from the group consisting of:circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0206] Embodiment 2: The method of embodiment 1 , wherein an increased quantity of any one or more of the circRNAs indicates an increased placental age.

[0207] Embodiment s: The method of embodiment 1 or embodiment 2, wherein an increased quantity of any one or more of the circRNAs indicates an increase in the biological age of the placenta relative to the gestational age.

[0208] Embodiment 4: A method of assessing the likelihood of a pregnancy complication, the method comprising quantifying one or more circular RNAs (circRNAs) in a pregnant subject, or a biological sample from the pregnant subject, the circRNAs selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0209] Embodiment 5: The method of embodiment 4, wherein an increase in the quantity of any one or more of the circRNAs indicates an increased likelihood of a pregnancy complication.

[0210] Embodiment s: The method of embodiment 4 or embodiment 5, wherein the pregnancy complication is placental dysfunction.

[0211] Embodiment 7: The method of embodiment 4 or embodiment 5, wherein the pregnancy complication is stillbirth.

[0212] Embodiment s: The method of embodiment 4 or embodiment 5, wherein the pregnancy complication is intrauterine growth restriction (IUGR).

[0213] Embodiment 9: The method of embodiment 4 or embodiment 5, wherein the pregnancy complication is preeclampsia (PE) or preterm labour.

[0214] Embodiment 10: The method of any one of embodiments 1 to 9, wherein the method further comprises comparing the quantity of the circRNAs in the pregnant subject to a reference standard.

[0215] Embodiment 11 : The method of embodiment 10, wherein the reference standard is the quantity of the one or more circRNAs in a subject or biological sample from one or more uncomplicated pregnancies of comparable gestational age.

[0216] Embodiment 12: The method of any one of embodiments 1 to 11 , wherein the biological sample is a blood sample, or a serum sample.

[0217] Embodiment 13: The method of any one of embodiments 1 to 11 , wherein the biological sample comprises cell-free nucleic acids.

[0218] Embodiment 14: The method of any one of embodiments 1 to 11 , wherein the biological sample comprises fetal nucleic acids or cell-free fetal nucleic acids.

[0219] Embodiment 15: The method of any one of embodiments 1 to 14, wherein the one or more circRNAs are quantified during the third trimester of pregnancy.

[0220] Embodiment 16: The method of any one of embodiments 1 to 14, wherein the one or more circRNAs are quantified during the second trimester of pregnancy.

[0221] Embodiment 17: The method of any one of embodiments 1 to 14, wherein the one or more circRNAs are quantified in the second trimester and the third trimester of pregnancy.

[0222] Embodiment 18: The method of any one of embodiments 1 to 14, wherein the one or more circRNAs are quantified between the 11th and 13th week of pregnancy.

[0223] Embodiment 19: The method of any one of embodiments 1 to 18, wherein the method is performed at multiple time points during pregnancy.

[0224] Embodiment 20: The method of any one of embodiments 15 to 19, wherein the method is performed once a week, once a fortnight or once a month.

[0225] Embodiment 21 : A method of medical intervention, the method comprising assessing the likelihood of a pregnancy complication according to themethod of any one of embodiments 1 to 20, and performing one or more of the following interventions if there is an increased quantity of one or more of the circRNAs:• undertaking further assessment of the fetus; increasing antenatal monitoring;• low-dose aspirin;• corticosteroid prophylaxis;• Tedalafil;• L-arginine;• Nitroglycerin;• Statins (such as pravastatin)• magnesium sulfate prophylaxis; or• delivering the fetus early.

[0226] Embodiment 22: The method of embodiment 21 , wherein increasing antenatal monitoring includes regular assessment of the fetus.

[0227] Embodiment 23: The method of embodiment 21 or embodiment 22, wherein assessment of the fetus includes assessing one or more of: fundal height, cardiotocography (CTG), ultrasound; umbilical artery Doppler ultrasound, middle cerebral artery Doppler ultrasound, amniotic fluid volume, or fetal size measurement.

[0228] Embodiment 24: The method of embodiment 23, wherein fetal size measurement includes measuring one or more of: abdominal circumference, head circumference, biparietal diameter, femur length, or derivation of estimated fetal weight.

[0229] Embodiment 25: A method of assessing the age of a tissue, the method comprising quantifying within the tissue one or more circular RNAs (circRNAs) selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0230] Embodiment 26: The method of embodiment 25, wherein the one or more circRNAs is quantified within a sample of the tissue or a sample from a subject comprising the tissue.

[0231] Embodiment 27: The method of embodiment 25 or embodiment 26, wherein an increased quantity of any one or more of the circRNAs indicates an increase in the age of the tissue.

[0232] Embodiment 28: The method of any one of embodiments 25 to 27, wherein the age is the biological age.

[0233] Embodiment 29: The method of any one of embodiments 25 to 27, wherein the tissue is placenta, liver, heart, gastrointestinal tract, lungs, testes, ovaries, kidney, thymus, skeletal muscle, eye or brain.

[0234] Embodiment 30: The method of any one of embodiments 21 to 29, wherein the one or more circRNAs is / are quantified relative to one or more reference standards.

[0235] Embodiment 31 : The method of any one of embodiments 21 to 30, wherein the one or more circRNAs is / are quantified relative to their quantity in a prior biological sample.

[0236] Embodiment 32: The method of any one of embodiments 1 to 31 , wherein the one or more circRNAs is / are a natural variant of the sequence set forth in any one of: SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6.

[0237] Embodiment 33: The method of embodiment 32, wherein the natural variant of the one or more circRNAs has / have at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity to, or comprise(s), any one of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6.

[0238] Embodiment 34: The method of any one of embodiments 1 to 33, wherein the one or more circRNAs is / are quantified relative to its / their cognate linear RNA.

[0239] Embodiment 35: The method of any one of embodiments 1 to 34, wherein at least 2, 3, 4, or 5 of the circRNAs are quantified, or wherein all 6 of the circRNAs are quantified.

[0240] Embodiment 36: An interfering nucleic acid comprising a sequence configured to hybridize with any one or more circular RNA (circRNA) selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0241] Embodiment 37: The interfering nucleic acid of embodiment 36, wherein the interfering nucleic acid comprises a sequence complementary to the back- splice junction of one or more of the circRNAs.

[0242] Embodiment 38: The interfering nucleic acid of embodiment 36 or embodiment 37, wherein the interfering nucleic acid is siRNA or microRNA.

[0243] Embodiment 39: The interfering nucleic acid of any one of embodiments 36 to 38, wherein the interfering nucleic acid is up to 30 nucleotides in length.

[0244] Embodiment 40: A composition comprising an RNA-interference system configured to reduce hybridisation between any one or more circular RNA (circRNA) selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, and its / their cognate genomic DNA.

[0245] Embodiment 41 : A composition comprising an RNA-interference system configured to reduce the quantity of one or more circular RNA (circRNA) selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

[0246] Embodiment 42: A composition according to embodiment 40 or embodiment 41 , wherein the interference system comprises one or more of a microRNA, an siRNA, an shRNA, a dsRNA, AON, a cre-lox system or a CRISPR / Cas system.

[0247] Embodiment 43: A pharmaceutical composition comprising the interfering RNA of any one of embodiments 36 to 39 or the composition of any one of embodiments 40 to 42, and one or more of a pharmaceutically acceptable carrier, stabilizer or excipient.

[0248] Embodiment 44: A method of treating or preventing a pregnancy complication, the method comprising administering to a pregnant subject an interfering nucleic acid of any one of embodiments 36 to 39, or a composition of any one of embodiments 40 to 42, wherein the interfering nucleic acid or the RNA-interference system of the composition reduces hybridization between any one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277 and its / their complementary genomic DNA.

[0249] Embodiment 45: A kit for quantifying one or more circular RNAs(circRNAs) selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, the kit comprising one or more pairs of primers or one or more probes, wherein the primer pairs or the probes are specific for one or more of the circRNAs.

[0250] Embodiment 46: The kit of embodiment 45, wherein the one or more pairs of primers are configured for specific amplification of the back-splice junction of the one or more circRNAs.

[0251] Embodiment 47: The kit of embodiment 45 or embodiment 46, wherein one of the primers in a pair is, or both of the primers in a pair are, configured to hybridize within 500nt, 450nt, 300nt, 250nts, 200nts, 10Ont, 75nt, 50nt, or 25nt of the back-splice junction of the one or more circRNAs.

[0252] Embodiment 48: The kit of embodiment 45 or embodiment 46, wherein one of the primers in a pair is configured to hybridize to the back-splice junction of the one or more circRNAs.

[0253] Embodiment 49: The kit of embodiment 45, wherein the one or more probes is / are configured to hybridize to the back-splice junction of the one or more circRNAs.

[0254] Embodiment 50: The kit of any one of embodiments 45 to 49, wherein the kit comprises RNase R.

[0255] Embodiment 51 : The kit of any one of embodiments 45 to 50, wherein the kit comprises random primers for amplifying a circRNA.

[0256] Embodiment 52: The kit of any one of embodiments 45 to 51 for use in a method according to any one of embodiments 1 to 35.

[0257] Embodiment 53: Use of the kit of any one of embodiments 45 to 51 in a method according to any one of embodiments 1 to 35.

[0258] Embodiment 54: Use of the interfering nucleic acid of any one of embodiments 36 to 39, or the composition of any one of embodiments 40 to 42, or the pharmaceutical composition of embodiment 43, for the prevention of DNA damage in a cell.

[0259] Embodiment 55: A method for reducing DNA damage in a cell, the method comprising exposing the cell to an interfering nucleic acid of any one of embodiments 36 to 39, wherein the interfering nucleic acid hybridizes to its complementary circRNA and reduces hybridization between the circRNA and its complementary genomic DNA.

[0260] Embodiment 56: A method for reducing DNA damage in a cell, the method comprising exposing the cell to the composition of any one of embodiment 40 to 42, or the pharmaceutical composition of embodiment 43, wherein the RNA- interference system reduces hybridization between the one or more circRNA(s) and its / their complementary genomic DNA.

[0261] Examples

[0262] The invention is further described and illustrated in the following examples. The examples are only for the purpose of describing particular embodiments of the invention and are not intended to be limiting with respect to the above description and the scope of the invention defined herein and as claimed in this application, nor future applications claiming priority from this application.

[0263] Example 1 - Circular RNAs are correlated with placenta age, stillbirth and DNA damage.

[0264] To assess the role of circRNAs in the placenta during uncomplicated pregnancy and from stillborn fetuses, samples of placental tissue were obtained from varying gestational age pregnancies and from stillborn pregnancies. These sampleswere assessed for total RNA levels, circular RNA levels, as well as expression of circRNAs and their cognate linear RNAs.

[0265] Samples

[0266] Placenta samples were collected from 60 women who had uncomplicated pregnancies (12 women per 5 gestational age groups) and 4 women who experienced stillbirth (as assessed by clinical pathologists as “unexplained fetal deaths”, with no noted congenital anomalies). The characteristics of the women and infants from the study by gestational age group (weeks+days) is provided in Table 2 below.

[0267] Table 2 - Characteristics of women and infants studied by gestational age group.The above data are presented as mean ± standard error of the mean. DM = DataMissing, as data were not available at the time of sample collection.

[0268] The quantity of circ 0009000, circ 0024157, circ 0061017, circ 0036877, circ 0054624 and circ 0111277 increases during pregnancy and are elevated in stillbirths.

[0269] Quantitative PCR was performed (as per the methods below) to determine the quantify of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277 as well as the cognate linear mRNAs CRHR2, CWF19L2, RAB22A, FURIN, PNPT1 and PAPPA2 (respectively) in placenta.

[0270] Figures 1 to 6 show the expression in the placenta of each of the six aforementioned circRNAs relative to their quantity at 37 weeks’ gestational age and the expression of each corresponding cognate linear mRNA (i.e., the linear RNA transcribed from the same gene.

[0271] Comparing the circRNA with its cognate linear RNA allows for inference of the mechanism of dysregulation that resulted in an increased quantity of circRNA. The quantity of a circRNA is a combination of expression level as well as accumulation. CircRNA can be increased by overexpressing the linear gene, or by alternative splicing promoting the circular transcripts over the linear transcripts. CircRNA accumulation indicates that the circRNA remains in the tissue, unaffected by exoribonucleases. Over time, the quantity of the circRNA in the tissue increases as the accumulated transcripts escape degradation. This occurs without change in the linear gene expression nor alternative splicing. The result is that these circRNAs can continually exert their function in the tissue well after their linear gene’s expression, and remain at a higher-than- expected quantity.

[0272] As can be seen in Figures 1 to 6, the quantity each of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277 increases progressively from 37 week to 41 + weeks. Further, the quantity of each of the six circRNAs in stillborn-derived placentae is higher than in tissue samples from uncomplicated pregnancies, and statistically significantly higher than at 37 weeks of gestational age, despite the gestational age of the stillbirth tissues ranging from 24 to 34 weeks of gestation (with an average of 28.5 weeks).

[0273] Figure 1 illustrates that the abundance of circ_0009000 was significantly increased in cells from placentae sampled at 40 weeks’ gestation compared with 37and 38 weeks’ gestation (p37 = 0.0005, p38 = 0.0079;). Circ_0009000 abundance was significantly increased in cells from placentae taken at 41 + weeks’ gestation compared with 37 and 38 weeks’ (all p < 0.0001 ), as well as in placentae from stillbirths compared with 37 and 38 weeks’ gestation (P37 < 0.0001 , p38 = 0.0006).

[0274] By comparison, the quantity of linear CRHR2 mRNA in placental samples did not significantly change during gestation for all gene variants of CRHR2 - i.e., transcripts: XM_024446665.1 , XM_017011752.2, NM_00 1202483.2,NM_001202482.2, NM_001202481 .1 , and NM_001202475).

[0275] Figure 2 illustrates that the relative quantity of circ_0024157 significantly increased each week of gestation from 37 weeks’ gestation to 41 + weeks’ gestation. Abundance of circ_0024157 was also increased in cells from placentae sampled at 41 + weeks’ gestation compared with 37, 38 and 39 weeks’ (p37 < 0.0001 , pss = 0.0002, p39 = 0.0124), as well as in stillborn-derived placentae compared with 37 and 38 weeks gestation (P37 < 0.0001 , p38 = 0.0006).

[0276] By comparison, the quantity of linear CWF19L2 mRNA in placental samples did not significantly change during gestation for all gene variants of CWF19L2 (transcripts: XM_017017239.2, XR_947795.2, NM_152434.3, and XM_011542620.3).

[0277] Figure 3 illustrates that the quantity of circ_0061017 increased each week of gestation from 37 weeks’ gestation to 41 + weeks’ gestation, as well as in stillborn- derived placenta compared with the uncomplicated gestation samples.

[0278] By comparison, the quantity of linear RAB22A mRNA in placenta samples did not significantly change during gestation (transcript: NM_020673.3).

[0279] Figure 4 illustrates that the quantity of circ_0036877 increased each week of gestation from 37 weeks’ gestation to 41 + weeks’ gestation, with statistically significant increases at weeks 39, 40 and 31 relative to week 37, as well as in stillborn- derived placentae compared with the uncomplicated gestation samples.

[0280] By comparison, the quantity of linear FURIN mRNA in placenta samples did not significantly change during gestation for all gene variants of FURIN mRNA (transcripts: NM_001382622.1 , NM_002569.4, NM_001382619.1 , NM_001289823.2, NR_168464.1 , NM_001382620.1 , NM_001382621 .1 , and NM_001289824.2).

[0281] Figures 5 illustrates that the quantity of circ_0054624 increased each week of gestation from 37 weeks’ gestation to 41 + weeks’ gestation, as well as in stillborn- derived placentae compared with the uncomplicated gestation samples.

[0282] By comparison, the quantity of linear PNPT1 mRNA (transcript: NM_033 109.5) in placenta samples did not significantly change during gestation.

[0283] Figure 6 illustrates that the quantity of circ_0111277 increased each week of gestation from 37 weeks’ gestation to 41 + weeks’ gestation, as well as in stillborn- derived placentae compared with the uncomplicated gestation samples.

[0284] By comparison, the quantity of linear PAPPA2 mRNA (transcript: XM_005245422.3) was not significantly changed between groups.

[0285] The change in the quantity of the circular RNAs relative to 37 weeks’ gestation is summarised in Table 3 below.

[0286] Table 3: Changes in the circular during pregnancy and in stillbirths

[0287] These results provide the first evidence of circRNA accumulation in human tissue. The quantities of circular RNAs; circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277 were all increased in human placenta tissue from late term (week 40, 41 +) compared with early term (weeks 37, 38, 39), while the quantities of their cognate linear mRNAs were unchanged. Furthermore, there was no evidence of changed alternative splicing patterns, as indicated by absence of differential expression of gene variants between gestational weeks. This indicates that the excess levels of these candidate circRNAs found in late term placentae compared with early term placentae were not the product of increased gene expression, nor the product of a switch to a different dominant isoform of the genewhich may result in production of a circular transcript. Hence, it can be concluded that these candidate circRNAs accumulate in the tissue as gestation continues and the organ ages.

[0288] DNA damage is elevated in placentae from late term pregnancy and stillbirth.

[0289] One mechanism by which circRNAs have been demonstrated to damage cells is via inducing DNA breaks. CircRNAs have been shown in other tissues to directly bind to genomic DNA, forming a circRNA:DNA complex referred to as a circR-loop (Conn, S. J. et al., The RNA binding protein quaking regulates formation of circRNAs. Cell 160, 1125-1134 (2015). A subset of circR-loops induces DNA fragmentation through a mechanism known as endogenous RNA-directed DNA damage (Conn, V.M. et al., Circular RNAs drive oncogenic chromosomal translocations within the MLL recombinome in leukemia. Cancer Cell 41 (7), 1309-1326 (2023)). Therefore, the inventors hypothesized that the elevated circRNA quantities described above may result in elevated DNA damage, which may be a mechanism causing placental aging or dysfunction.

[0290] DNA damage was assessed using the Comet Assay (see material and methods). The Comet Assay yields a Tail DNA% metric that indicates the level of DNA damage in cells isolated from placentae.

[0291] Figures 7A and 7B provide representative images illustrating the distinction between healthy cells and DNA damaged cells (respectively).

[0292] As illustrated in Figure 8 tail DNA % was significantly increased in cells from placentae sampled at 40 weeks’ gestation compared with 37 and 38 weeks’ (P37 = 0.0381 , and p38 = 0.0203) indicating increased DNA damage in these samples. DNA damage (Tail DNA%) was also significantly increased in cells from placentae sampled at 41 + weeks’ gestation compared with 37, 38, 39 and 40 weeks’ (all p < 0.0001 ) as well as in stillborn-derived placentae compared with 37, 38, 39 and 40 weeks’ gestation (P37, P38 P39 < 0.0001 , and P40 = 0.0001 ).

[0293] This study confirmed that the rates of DNA damage in placentae from 41 + weeks’ gestation were significantly increased compared with earlier term gestations -consistent with an association with the elevated risk of stillbirth in this cohort. The stillbirth derived placenta (n=4) had further elevated DNA damage, relative to 41 + weeks. Notably, however, the average gestational age of the stillbirth placentae was 28.5 weeks’ gestation indicating considerably accelerated DNA damage and suggesting accelerated tissue ageing; the consequence of which is a post-term phenotype early in gestation.

[0294] circ 0009000, circ 0024157, circ 0061017, circ 0036877, circ 0054624 and circ 0111277 bind to DNA to create circR-loops in term placentae.

[0295] In view of the demonstrated elevation in DNA damage as the placenta ages, and the elevated damage in stillborn-derived placentae, the inventors sought to determine if circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277 bind to DNA and created circR-loops, which precede DNA damage.

[0296] Assessment of interaction between the circRNAs and genomic DNA (from pooled placental samples of gestations 37-41 + weeks) was determined using DRIP- qPCR (as discussed in the Materials and Methods).

[0297] After completing DRIP, DRIP-qPCR analysis was undertaken using predesigned primers (Sanz, L. A. & Chedin, F. High-resolution, strand-specific R-loop mapping via S9. 6-based DNA-RNA immunoprecipitation and high-throughput sequencing., Nature protocols 14, 1734-1755 (2019)) for known R-loop-positive loci TFPT and CALM3, and known R-loop-negative locus EGFRIneg as well as using custom-designed primers (sequences listed in Materials and Methods - SEQ ID NOs: 19, 20; 29, 30; 32, 33; 49, 50; 53, 54; and 57, 58) to target the back-splice junctions of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277. All DRIP-qPCR analysis was completed both in samples treated with RNase H (as a negative control) and without RNase H treatment prior to DRIP. RNase H cleaves the RNA of RNA:DNA hybrids and therefore the addition of RNase H to the sample should result in a significantly suppressed R-loop signal and hence, a reduced DRIP-qPCR signal. The results confirmed this.

[0298] Based on prior publications, R-loop positive loci should be recovered with an efficiency ranging from 1 -15% of total input, while negative loci should be recovered with values of <0.1 %. This was replicated in the results for placenta tissue (Figure 9),where TFPT (mean 11.499%, p = 0.0008) and CALM3 (mean 8.644129%, p = 0.0009) produced DRIP-qPCR signals (shown as a % of total DRIP input) significantly larger than their RNase H-treated controls. There was no significant difference between the DRIP-qPCR signals of EGFRI neg (mean 0.389%) with and without RNase H treatment.

[0299] Figure 10 illustrates that DRIP-qPCR signal for circ_0009000 (mean 0.173%, p < 0.0001 ), circ_0024157 (mean 0.166%, p < 0.0001 ), circ_0061017 (mean 0.172%, p < 0.0001 ), circ_0036877 (mean 0.169%, p < 0.0001 ), circ_0054624 (mean 0.173%, p < 0.0001 ) and circ_0024157 (mean 0.177%, p < 0.0001 ) was significantly larger than their RNase H-treated controls, indicating that these circRNAs are forming circR-loops with DNA.

[0300] Due to the relatively lower quantities of the candidate circRNAs, the inventors investigated their interaction with DNA as a stoichiometrically favourable potential function (given that there are only 2 copies of DNA per cell, compared with thousands of microRNAs and proteins). By performing DRIP on RNA which was later treated with RNase R to degrade linear transcripts, this allowed isolation of circRNA moieties that bind placental DNA. As discussed above, DRIP-qPCR analysis showed that circRNAs; circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, which accumulate with gestational age and in stillbirth, also form circR-loops in term placentae. The formation of such circR-loops can have functional ramifications due to the ability of such circR-loops to cause DNA damage or reduce cognate gene expression.

[0301] Circ_0009000 is formed by non-canonical splicing of CRHR2, the gene for corticotrophin releasing hormone receptor 2 (CRHR2). Corticotrophin releasing hormone (CRH) production in the placenta is largely in the second and third trimesters of pregnancy (Frim, D. et al., Characterization and gestational regulation of corticotropin-releasing hormone messenger RNA in human placenta. The Journal of clinical investigation, 82, 287-292 (1988)), with CRH playing a critical role in parturition. Most CRH is secreted into the maternal bloodstream (Campbell, E. et al., Plasma corticotropin-releasing hormone concentrations during pregnancy and parturition. , The Journal of Clinical Endocrinology & Metabolism, 64, 1054-1059 (1987)), however CRH receptors 1 (CRHR1 ) and 2 (CRHR2) (and their various isoforms) can be found in theplacenta, with immunohistochemical staining localising CRHR2 mainly to the syncytiotrophoblast (Sehringer, B. et al., mRNA expression profiles for corticotrophin- releasing hormone, urocortin, CRH-binding protein and CRH receptors in human term gestational tissues determined by real-time quantitative RT-PCR. Journal of molecular endocrinology 32, 339-348 (2004)). As circ_0009000 forms a circR-loop in placenta, binding its cognate locus, it is possible that this inhibits the translation of CRHR2, reducing availability of CRHR2 for CRH binding. Indeed, one study noted a significant downregulation in CRH mRNA expression in placentae from idiopathic stillbirths compared with live births (Vasconcelos, S. et al., Syncytiotrophoblast Markers Are Downregulated in Placentas from Idiopathic Stillbirths. International Journal of Molecular Sciences, 25, 5180 (2024)), implying that CRH mRNA may be downregulated to produce less CRH protein, which is in accordance with reduced availability of CRHR2 for binding.

[0302] Depletion of circ 0009000 reduces DNA damage

[0303] In view of the potential role of circRNA in binding to, and inducing damage in, DNA the inventors investigated if siRNA inhibition of circR-loop formation of circ_0009000 could reduce DNA damage in cells. This is particularly germane in view of the accumulation of circ_0009000 (and other circRNAs) in the placenta during gestation and in stillbirth.

[0304] Cultured HEK293T cells were treated with custom designed siRNA, having the sequence set forth in SEQ ID NO: 65, specific for circ_0009000, or treated with scrambled siRNA, having the sequence set forth in SEQ ID NO: 66. Cells were then cultured for 72 hours prior to harvesting for qPCR analysis (Figure 11 ) as well as Comet Assay analysis (Figure 12).

[0305] As shown in Figure 11 , transfection of HEK293T cells with the scrambled siRNA and siRNA specific for circ_0009000 did not alter the expression of the linear CRHR2 mRNA (shown as the quantity relative to the housekeeping genes YWHAZ and ACTB) compared to control. However, importantly, transfection of HEK293T cells with siRNA specific for circ_0009000 did significantly reduced the intracellular quantity of this circular RNA relative to control (untreated) cells and scrambled siRNA treated cells (P < 0.0001 ). This demonstrated the efficacy of siRNA inhibition of circ_0009000.

[0306] Having demonstrated the efficacy of siRNA in reducing circ_0009000 quantity, the inventors investigated if a reduction in the quantity of circ_0009000 would reduce DNA damage in HEK293T cells.

[0307] As can be seen in Figure 12, transfection with the siRNA specific to circ_0009000 in HEK293T cells significantly reduced the level of DNA damage (tail DNA%) compared with both the control (reduced by 41.3%) and scrambled (reduced by 39.5%) groups (all p < 0.0001 ). However, transfection with the scrambled siRNA in HEK293T cells did not alter the level of DNA damage (tail DNA%) compared with the control. These results indicate that depletion of circ_0009000 reduces DNA damage within a cell and infers a role for elevated circ_0009000 in mediating DNA damage in the aging placenta and in placentae in stillbirths.

[0308] Results from this study indicate that targeted knockdown of circ_0009000 with an siRNA reduces double-stranded DNA damage in HEK293T cells. Importantly, this occurred in the absence of any change in the linear mRNA expression, indicating that this is a circRNA-specific result. This finding provides compelling evidence to further support the hypothesis that circ_0009000 causes DNA breaks by forming circR- loops with placental DNA.

[0309] Due to their demonstrated binding to DNA to form circR-loops, it is proposed that circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277 may perform a similar role to circ_0009000 in promoting DNA damage, or down regulating expression of their cognate gene. Further, many of the circRNAs in this study form circR-loops in placenta with genes that encode proteins which have a role in placental function and pregnancy. For example, FURIN (bound by circ_0036877) encodes a proprotein convertase that facilitates placental syncytialisation in first trimester trophoblasts (Zhou, Z., etal., The proprotein convertase furin is required for trophoblast syncytialization. Cell Death and Disease 4, e593 (2013)), and PAPPA2 (bound by circ_0111277) encodes a metalloproteinase which cleaves Insulin-Like Growth Factor (IGF) Binding Protein-3 and -5 (IGFBR3, IGFBP5), liberating IGF-1 for binding to surface receptors (Overgaard, M. T. et al., Pregnancy-associated plasma protein-A2 (PAPP-A2), a novel insulin-like growth factor-binding protein-5 proteinase., Journal of Biological Chemistry, 276, 21849-21853 (2001 )). Accordingly, it is proposed that circ_0036877 and circ_0111277 (from FURIN and PAPPA2, respectively) bind at theircognate loci and reduce production of their respective encoded proteins. Abnormally low PAPPA2 expression at term is associated with fetal growth restriction in humans (Dauber, A. et al., Mutations in pregnancy associated plasma protein A2 cause short stature due to low IGF-I availability. EMBO Molecular Medicine 8, 363-374 (2016)).

[0310] Accordingly, it is proposed that reducing the quantity of one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277 may reduce DNA damage, and or may reduce suppression of their cognate genes, and result in reduced tissue aging or alleviate pregnancy complications or pathologies, such as stillbirth.

[0311] Fetal circular RNAs can be detected in maternal blood as a proxy measurement of placental aging.

[0312] As discussed above, the quantities of circular RNAs circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277 in the placenta correlate with placental age and are increased in the placentae of stillborn infants. However, sampling of placental tissue during pregnancy is invasive and introduces significant risks. Therefore, the quantity of the candidate circular RNAs in maternal blood was determined to confirm that this was an appropriate proxy for the levels in the placenta.

[0313] As shown in Figure 13, the quantities of all candidate circRNAs (circ_0009000, circ_0036877, circ_011277, circ_0054624, circ_0024157, and circ_0061017) were statistically significantly higher in maternal blood sampled at 15- 16 weeks’ gestation in women who subsequently had a stillbirth compared with women who delivered live babies. Accordingly, blood may provide a minimally invasive biological sample for assessing the quantity of the circular RNA markers in pregnant individuals, even early in pregnancy (such as the first trimester).

[0314] Materials and Methods

[0315] Tissue Samples

[0316] Placentae including healthy placentae from 37-41+ weeks’ gestation, and unexplained stillbirth: Placentae were obtained at the Lyell McEwin Hospital in Elizabeth, South Australia, from women recruited as part of the Screening Tests topredict poor Outcomes of Pregnancy (STOP) (2015-2018) cohort study (Mohammed, H. et al., Safety and protective effects of maternal influenza vaccination on pregnancy and birth outcomes: A prospective cohort study., EClinicalMedicine, 26, 100522 (2020)). The study was registered with the Australian and New Zealand Clinical Trials Registry (ACTRN 12614000985684). All but one placentae were associated with uncomplicated pregnancies and were collected from white women. Tissue biopsies from placentae were washed in phosphate-buffered saline (PBS) before being snap frozen and held in liquid nitrogen for 15 min, then stored at -80°C. Ethics approvals were obtained from the Women’s and Children’s Health Network Human Research Ethics Committee (HREC / 14 / WCHN / 90; STOP). All women provided written informed consent.

[0317] Placentae collected from unexplained stillbirths: Small placental biopsies from unexplained stillbirth cases were obtained from women who had been recruited in to the NHMRC- and GHFM-MRFF-funded Genomic Autopsy Study (Byrne, A. B. et al. , Genomic autopsy to identify underlying causes of pregnancy loss and perinatal death. Nature Medicine, 29, 180-189 (2023)). Placental biopsies were obtained as part of the standard autopsy procedure and were stored at -80°C as approved by the Human Ethics Committee of the Women’s and Children’s Health Network, South Australia, Australia and Melbourne Health as part of the Australian Genomics Health Alliance protocol. Informed consent was obtained to allow access to relevant medical information and subsequent storage of anonymized samples, genomic data and / or medical information in relevant databases and publications.

[0318] RNA Extraction

[0319] Placental tissues (25mg) were weighed and washed with phosphate- buffered saline (PBS). Tissue was disrupted by homogenizing for 3.5 min at 30 Hz (TissueLyser, QIAGEN) in 1 mL TRIzol Reagent (Sigma-Aldrich). The manufacturer’s protocol was then followed to isolate total RNA. The purity and integrity of extracted RNA samples were determined using the Experion™ (BioRad™) and samples used had an RNA Quality Index > 8. Samples were split into two aliquots, with one aliquot to be assessed for circRNA expression levels and the other to be assessed for linear transcript expression levels. Samples to be assessed for circRNA expression levels were heated to 70°C for 5 mins, then immediately cooled below 40°C before incubationwith RNase R (10U / reaction; Astral Scientific) for 1 h at 40°C. This step was essential to digest all linear RNAs, leaving only lariat or circular RNA structures.

[0320] RNA Quantification

[0321] Total RNA for each sample, after incubation of 1 pg of RNA either with RNase R or untreated, was quantified using the Qubit 2.0 fluorimeter (Thermo Fisher Scientific™) - As per Drula, R. et al., Investigating circular RNAs using qRT-PCR; roundup of optimization and processing steps. International Journal of Molecular Sciences 24, 5721 (2023).

[0322] Qubit measurement was accomplished using the Qubit™ RNA High Sensitivity (HS) assay kit using 1 pL of the RNA sample, 198 pL of the kit Qubit™ working solution and 1 pL of the provided fluorophore, as per manufacturer’s instructions. RNA amount was normalised based on the standard curve and input and compared between RNase R treated and untreated groups per sample to quantify bulk circRNA levels.

[0323] cDNA Synthesis and Quantitative Polymerase Chain Reaction (qPCR)

[0324] Synthesis of complementary DNA (cDNA) was conducted beginning with 1 pg of total RNA using the QuantiNova™ Rev Transcription Kit (QIAGEN™) according to the manufacturer’s protocol. Quantitative PCR was performed in triplicate and conducted with SYBR™ Green (QIAGEN™) according to manufacturer’s instructions, with YWHAZ, GAPDH and ACTB as housekeeping genes (all primer sequences in Table 4). Custom divergent primers were designed for each circRNA, flanking the backsplice junction, with an amplicon size <300 base pairs. As an additional confirmation of amplification specificity, all primers were assessed using the Primer design BLAST™ tool (as per Drula, R. et al., above). Furthermore, primer specificity was confirmed via melt curve analysis from qRT-PCR. The qPCR conditions were PCR initial activation at 95°C for 5 min followed by 50 cycles of 95°C for 15s, Tm (detailed in Table 4) for 20s and 72°C for 20s. Quantitative PCR results were analysed using the 2-AACT method (Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2- AACT method. Methods, 25, 402- 408 (2001 )). Samples were sorted into groups depending on gestational age of tissue (see Table 2 for numbers and characteristics of women’s samples used).

[0325] Table 4 - Primers used for quantification“For” = Forward; “Rev” = Reverse; Tm = Melting temperature

[0326] Cell culture and siRNA transfection

[0327] HEK293T cells (CRL-3216; ATCC) were cultured (n = 3, in triplicate; final n = 9) at 37°C with 5% CO2 in air in Dulbecco’s Modified Eagle Medium with GlutaMAX™ supplement (Gibco™), with 10% v / v fetal bovine serum (Sigma-Aldrich™). Small interfering (si) RNA was produced by Thermo Fisher Scientific™ (Silencer™ Select siRNA). Small interfering RNA sequence was designed to be complementary to the backsplice junction of circ_0009000 (sequence: SEQ ID NO: 65 CTGCTCCACGGCTTGGCCACCTGTTCCCA; scrambled siRNA sequence: SEQ ID NO: 66 - GACCTCGTGCTCGTCACCTCCGACTCGTC). Cells were transfected (24- well plates) with the siRNA and scrambled siRNA at 5, 10 and 20 nM final concentrations using Lipofectamine RNAiMAX™ (Life Technologies™) following the manufacturer’s instructions. After optimisation, experiments proceeded with 10 nM final concentration (as the lowest siRNA concentration producing the desired level ofknockdown). At 96 hours post-siRNA transfection cells were collected before either (i) immediately performing the Comet assay analysis or (ii) snap freezing in liquid nitrogen prior to storage at -80°C before RNA analysis.

[0328] Comet Assay

[0329] The Abeam CometAssay™ Kit (ab238544; Abeam ™) was used to assess DNA damage in isolated trophoblasts. Approximately 25mg tissue (stored at -80°C) in 1.5mL ice-cold PBS containing 20 mM EDTA (without Mg2+and Ca2+) was minced using dissection scissors. The tissue suspension settled for 5 min (4°C) prior to removal of the supernatant for centrifugation (700xg, 2 min). The supernatant was then discarded, and the cell pellet was resuspended at 1x105cells / mL in ice-cold PBS (without Mg2+and Ca2+). Cell samples were combined with Comet Agarose at a 1 / 10 (v / v) ratio, mixed by pipetting and transferred onto pre-prepared Comet Agarose glass slides. Slides were incubated (in the dark, 15 min, 4°C) prior to immersion in Lysis Buffer (14.6g NaCI, 20 mL EDTA [provided], 10 mL 10X Lysis Solution [provided], 10 mL DMSO, volume adjusted to 90 mL with deionised H2O, pH = 10.0) for 45 min (in the dark, 4°C). Slides were then transferred and immersed in Alkaline Solution (1.2g NaOH, 0.2 mL EDTA [provided], volume adjusted to 100 mL with deionised H2O) for 30 min (in the dark, 4°C).

[0330] Alkaline electrophoresis was then performed as follows: slides were carefully transferred from the Alkaline Solution into the electrophoresis chamber containing Alkaline Electrophoresis Solution (1 L of 300 mM NaOH, 1 mM EDTA; pH > 13, 4°C) and electrophoresis conditions were applied (30V, 300mA, 30 min). Following electrophoresis, slides were carefully washed by immersion in deionised H2O (3 washes at 2 min each; 4°C) prior to submersion in 70% EtOH (5 min, 4°C) and then drying at room temperature. Slides were visualised by staining with the supplied Vista Green DNA Dye and imaged by epifluorescence microscopy using a FITC filter.

[0331] The DNA integrity of 100 cells per placenta was analysed using CometScore 2.0 software (RexHoover.com). The fluorescence intensity of the comet ‘tail’ was used as a measure of DNA damage (indicated as tail DNA%). The results illustrate tail DNA as a percentage increase in damage relative to averaged control samples.

[0332] DNA:RNA ImmunoPrecipitation (DRIP)

[0333] DRIP was performed according to steps 3-25 in the protocol published in Sanz, L. A. & Chedin, F., High-resolution, strand-specific R-loop mapping via S9. 6- based DNA-RNA immunoprecipitation and high-throughput sequencing., Nature protocols 14, 1734-1755 (2019), with some notable exceptions. Because tissue was used as a starting material, instead of cultured cells, tissue was first prepared as set out below before progressing to step 3 of the protocol.

[0334] About 50mg frozen placental villous tissue was submerged in 1 mL RLT+ buffer (QIAGEN™) with added 0.01 % (v / v) [3-mercaptoethanol and 0.5% (v / v) Reagent DX (QIAGEN™) with 1 g beads. Tissue was disrupted by homogenizing for 3.5 min at 30 Hz (TissueLyser, QIAGEN™). Cell suspensions were then centrifuged (3 min, max speed, 4°C) prior to removal of the supernatant. The cell pellet was washed (sterile DPBS, 5mL) before centrifugation (3 min, 1000 RPM, 4°C) and removal of the supernatant. Steps 3-25 of the protocol of Sanz et al., above) were then followed.

[0335] Blood collection and analysis

[0336] Peripheral non-fasting blood samples were collected as part of the STOP cohort study (see above) and placed on ice prior to processing to isolate plasma. Samples were then stored at -80°C prior to subsequent analyses.

[0337] Abundance of circRNAs in maternal blood sampled between 15-16 weeks’ gestation (n=40 control, n=16 women who went on to have a stillbirth) was determined using qPCR as described herein.

[0338] Statistical Analysis

[0339] Statistical analysis for differences between groups for qPCR and CometAssay™ data was undertaken using SPSS™ Statistics Software. Outliers were removed from the data using a Grubbs’ test. Data were assessed for normality distribution and either a Kruskal-Wallis test or two-way ANOVA test was conducted. Adjustments were made for multiple comparisons (Tukey’s). Differences between groups were considered significant at p < 0.05. Asterisks indicate levels of significancy * p < 0.05, ** p < 0.01 , ***p < 0.001 ****p < 0.0001 . Groups indicated by different letters are statistically significantly different.

[0340] Discussion

[0341] The functionality of the placenta appears to decline as the placenta ages, resulting in a reduced capacity of the placenta to support the fetus (Maiti, K. et al. - see above.). Further, premature and accelerated aging of the placenta is believed to be a hallmark of stillbirth with characteristics of late term placentae being seen in placentae of stillbirths, despite the earlier gestational age (Maiti, K. et al., see above).

[0342] The results disclosed herein provide new and compelling evidence to support the notion that premature aging of the placenta is a causative factor in stillbirths and other pregnancy pathologies. The inventors found increased DNA breaks in placentae from late term (40, 41 + weeks’ gestation) compared with those from early term (37-39 weeks’), and stillborn-derived placentae demonstrated a high level of DNA breaks relative to 37 weeks’ gestation, despite the average gestational age of the stillbirth-derived placentae being 28.5 weeks’ gestation. In fact, the level of DNA damage in stillbirth-derived placentae was higher than placentae from 41 + week uncomplicated pregnancies.

[0343] This study provides evidence that (a) multiple circRNAs (circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277) accumulate in human aged placental tissue and stillbirth placentae, (b) these circRNAs bind to DNA in the human term placenta to form circR-loops and (c) circRNAs (such as circ_0009000) have the capacity to facilitate DNA damage in human cells. As such, the inventors propose that circRNAs, and in particular circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, provide an objective measure of the biological age of tissue, including the placenta. Further, elevations in the quantity of circRNAs in the placenta during gestation relative to the gestational age of the placenta may indicate accelerated placental aging and reduced function, indicating a higher likelihood of pregnancy complication - in particular stillbirth.

[0344] The inventors proposed that in uncomplicated pregnancy, circRNAs naturally accumulate in placental cells as the tissue ages with gestation. However, in pregnancies resulting in unexplained stillbirth, premature placental ageing results in accelerated accumulation of circRNAs. These circRNAs form circRNA:DNA complexes in the placenta and facilitate DNA damage leading to genomic instability, and cellular senescence and apoptosis. This may reduce placental function to the detriment of thefetus which can manifest as multiple complications such as (but not limited to) stillbirth, IUGR, preterm labour / birth, preeclampsia, and gestational diabetes.

[0345] The placenta is a unique tissue for studying aging as it is created de novo following blastocyst implantation and follows a definitive and coordinated growth and development process. Accordingly, it is submitted that this is the first study to confirm that circRNAs accumulate in human issue during aging. The result confirms that the circRNAs are unique in their ability to accumulate with age as there is no global increase in the total quantity of circular RNAs with placental age, indicating specific changes for certain circRNAs.

[0346] Definitions and qualifications

[0347] “Quantity” in relation to a nucleic acid, such as circRNA of mRNA, refers to the quantified level of one or more nucleic acids (such as circular RNAs). This can be determined as an absolute value (such as total counts, mass, concentration, cycle threshold value etc.) or may be a relative amount (such as relative to one or more housekeeping genes, relative to an internal control within a sample, or relative to a reference standard - as discussed herein). Processes for including spike-in internal controls in circular RNA quantification are known in the art including Conn, V.M et al. Use of synthetic circular RNA spike-ins (SynCRS) for normalization of circular RNA sequencing data. Nature Protocols 20, 387-406 (2025).

[0348] As used herein an “increase” in a circRNA, or an “increased circRNA” is defined relative to a reference. As discussed herein, this reference may be a reference standard. The appropriate reference can be determined by a person skilled in the art, with reference standard of particular embodiments provided herein. As used herein an “increase” may be at least: a 10% increase, a 20% increase, a 30% increase, a 40% increase, a 50% increase, a 60% increase, a 70% increase, an 80% increase, a 90% increase, a 100% increase, a 120% increase, a 140% increase, a 160% increase, a 180% increase, a 200% increase, a 2.5-fold increase, a 3-fold increase, a 3.5-fold increase, a 4-fold increase, a 4.5-fold increase, a 5-fold increase, a 6-fold increase, a 7-fold increase, an 8-fold increase, a 9-fold increase or a 10-fold increase, relative to a reference standard. When compared to a population distribution an increase may be at least one standard deviation away from the mean, or two standard deviations awayfrom the mean, or three standard deviations away from the mean, or one quartile away from the median. Alternatively, an increase could be when the quantity falls within in the top 1 %, top 2%, top 3%, top 4%, top 5%, top 6%, top 7%, top 8%, top 9%, top 10%, top 15%, top 20%, top 25%, top 30%, top 35% or top 40% of a population distribution. Alternatively, those of ordinary skill in the art are capable of identifying what constitutes a clinically relevant increase in one or more of the circular RNAs based on clinical data across a population, or various populations. In such embodiments, an increase is compared to a reference standard determined to be clinically relevant (a clinically- relevant reference standard). Means for performing such determinations are known in the art.

[0349] The term “intrauterine growth restriction” is used interchangeably in the art with “fetal growth restriction” (see Schlembach D. Fetal Growth Restriction - Diagnostic Work-up, Management and Delivery., Geburtshilfe Frauenheilkd. 80(10), 1016-1025 (2020). Therefore, where the specification refers to intrauterine growth restriction (IUGR) this should be considered as synonymous with fetal growth restriction (FGR).

[0350] Throughout this specification, unless the context requires otherwise, the word “comprise”, or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

[0351] The contents of the electronic sequence listing (1297095 - Biomarkers for tissue aging and stillbirth. xml; Size: 224kb; and Date of Creation: 02 Sept 2024) is herein incorporated by this reference in its entirety.

[0352] Reference is made to standard textbooks of molecular biology that contain methods for carrying out basic techniques encompassed by the present invention. See, for example, Green MR and Sambrook J eds., Molecular Cloning: A Laboratory Manual (4th edition), Cold Spring Harbor Laboratory Press, (2012); Dieterich C. and Papantonis A. eds., Circular RNAs Methods and Protocols, Humana New York, Methods in Molecular Biology (2018).

[0353] Referenced documents, publications and patents are to be included in their entirety by way of reference. The teachings and disclosures in such documents,publications and patents are therefore considered to form part of the disclosure of this specification.

[0354] All methods described herein can be performed in any suitable order unless indicated otherwise herein or clearly contradicted by context or the understanding of a skilled addressee. The use of any and all examples, or exemplary language (e.g., "such as", “i.e.”, “for example”), is intended merely to better illuminate the example embodiments and does not pose a limitation on the scope of the claimed invention, unless otherwise claimed or stated. No language in the specification should be construed as indicating any non-claimed element as essential.

[0355] The description provided herein is in relation to several embodiments which may share common characteristics and features. It is to be understood that one or more features of one embodiment may be combinable with one or more features of the other embodiments. Accordingly, is not intended that a reference to one or more features in an embodiment excludes the disclosed features from being combined in the claims with those of other embodiments. As such it is expressly intended that each embodiment can be combined with other compatible embodiments. In addition, a single feature or combination of features of the embodiments may constitute additional embodiments.

[0356] The subject headings used herein are included only for the ease of reference of the reader and should not be used to limit the subject matter found throughout the disclosure or the claims. The subject headings should not be used in construing the scope of the claims or the claim limitations.

[0357] Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to, or indicated in this specification, separately or collectively, and any and all combinations of any two or more of the steps or features.

[0358] Also, it is to be noted that, as used herein, the singular forms “a”, “an” and “the” include plural aspects unless the context already dictates otherwise.

[0359] It will be apparent to the person skilled in the art that while the invention is described herein in detail for the purposes of clarity and understanding, various modifications and alterations to the embodiments and methods described herein may be made without departing from the scope of the inventive concept disclosed in this specification.

[0360] Future patent applications may be filed on the basis of, or claiming priority from, the present application. It is to be understood that the following claims are not intended to limit the scope of what may be claimed in any such future application(s). Features may be added to or omitted from the claims at a later date so as to further define or re-define the claimed invention.

Claims

The claims defining the invention are as follows:

1. A method of assessing placental age in a pregnant subject, the method comprising quantifying within the subject, or a biological sample from the subject, one or more circular RNAs (circRNAs) selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

2. The method of claim 1 , wherein an increased quantity of any one or more of the circRNAs indicates an increased placental age.

3. The method of claim 1 or claim 2, wherein an increased quantity of any one or more of the circRNAs indicates an increase in the biological age of the placenta relative to the gestational age.

4. A method of assessing the likelihood of a pregnancy complication, the method comprising quantifying one or more circular RNAs (circRNAs) in a pregnant subject, or a biological sample from the pregnant subject, the circRNAs selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

5. The method of claim 4, wherein an increase in the quantity of any one or more of the circRNAs indicates an increased likelihood of a pregnancy complication.

6. The method of claim 4 or claim 5, wherein the pregnancy complication is placental dysfunction.

7. The method of claim 4 or claim 5, wherein the pregnancy complication is stillbirth.

8. The method of claim 4 or claim 5, wherein the pregnancy complication is intrauterine growth restriction (IUGR).

9. The method of claim 4 or claim 5, wherein the pregnancy complication is preeclampsia (PE) or preterm labour.

10. The method of any one of claims 1 to 9, wherein the method further comprises comparing the quantity of the circRNAs in the pregnant subject to a reference standard.

11. The method of claim 10, wherein the reference standard is the quantity of the one or more circRNAs in a subject or biological sample from one or more uncomplicated pregnancies of comparable gestational age.

12. The method of any one of claims 1 to 11 , wherein the biological sample is a blood sample, or a serum sample.

13. The method of any one of claims 1 to 11 , wherein the biological sample comprises cell-free nucleic acids.

14. The method of any one of claims 1 to 11 , wherein the biological sample comprises fetal nucleic acids or cell-free fetal nucleic acids.

15. The method of any one of claims 1 to 14, wherein the one or more circRNAs are quantified during the third trimester of pregnancy.

16. The method of any one of claims 1 to 14, wherein the one or more circRNAs are quantified during the second trimester of pregnancy.

17. The method of any one of claims 1 to 14, wherein the one or more circRNAs are quantified in the second trimester and the third trimester of pregnancy.

18. The method of any one of claims 1 to 14, wherein the one or more circRNAs are quantified between the 11thand 13thweek of pregnancy.

19. The method of any one of claims 1 to 18, wherein the method is performed at multiple time points during pregnancy.

20. The method of any one of claims 15 to 19, wherein the method is performed once a week, once a fortnight or once a month.

21. A method of medical intervention, the method comprising assessing the likelihood of a pregnancy complication according to the method of any one of claims 1 to 20, and performing one or more of the following interventions if there is an increased quantity of one or more of the circRNAs: undertaking further assessment of the fetus; increasing antenatal monitoring; low-dose aspirin;corticosteroid prophylaxis;Tedalafil;L-arginine;Nitroglycerin;Statins (such as pravastatin) magnesium sulfate prophylaxis; or delivering the fetus early.

22. The method of claim 21 , wherein increasing antenatal monitoring includes regular assessment of the fetus.

23. The method of claim 21 or claim 22, wherein assessment of the fetus includes assessing one or more of: fundal height, cardiotocography (CTG), ultrasound; umbilical artery Doppler ultrasound, middle cerebral artery Doppler ultrasound, amniotic fluid volume, or fetal size measurement.

24. The method of claim 23, wherein fetal size measurement includes measuring one or more of: abdominal circumference, head circumference, biparietal diameter, femur length, or derivation of estimated fetal weight.

25. A method of assessing the age of a tissue, the method comprising quantifying within the tissue one or more circular RNAs (circRNAs) selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

26. The method of claim 25, wherein the one or more circRNAs is quantified within a sample of the tissue or a sample from a subject comprising the tissue.

27. The method of claim 25 or claim 26, wherein an increased quantity of any one or more of the circRNAs indicates an increase in the age of the tissue.

28. The method of any one of claims 25 to 27, wherein the age is the biological age.

29. The method of any one of claims 25 to 27, wherein the tissue is placenta, liver, heart, gastrointestinal tract, lungs, testes, ovaries, kidney, thymus, skeletal muscle, eye or brain.

30. The method of any one of claims 21 to 29, wherein the one or more circRNAs is / are quantified relative to one or more reference standards.31 . The method of any one of claims 21 to 30, wherein the one or more circRNAs is / are quantified relative to their quantity in a prior biological sample.

32. The method of any one of claims 1 to 31 , wherein the one or more circRNAs is / are a natural variant of the sequence set forth in any one of: SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6.

33. The method of claim 32, wherein the natural variant of the one or more circRNAs has / have at least 80%, 85%, 90%, 95%, 98% or 99% sequence identity to, or comprise(s), any one of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6.

34. The method of any one of claims 1 to 33, wherein the one or more circRNAs is / are quantified relative to its / their cognate linear RNA.

35. The method of any one of claims 1 to 34, wherein at least 2, 3, 4, or 5 of the circRNAs are quantified, or wherein all 6 of the circRNAs are quantified.

36. An interfering nucleic acid comprising a sequence configured to hybridize with any one or more circular RNA (circRNA) selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

37. The interfering nucleic acid of claim 36, wherein the interfering nucleic acid comprises a sequence complementary to the back-splice junction of one or more of the circRNAs.

38. The interfering nucleic acid of claim 36 or claim 37, wherein the interfering nucleic acid is siRNA or microRNA.

39. The interfering nucleic acid of any one of claims 36 to 38, wherein the interfering nucleic acid is up to 30 nucleotides in length.

40. A composition comprising an RNA-interference system configured to reduce hybridisation between any one or more circular RNA (circRNA) selected fromthe group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, and its / their cognate genomic DNA.41 . A composition comprising an RNA-interference system configured to reduce the quantity of one or more circular RNA (circRNA) selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277.

42. A composition according to claim 40 or claim 41 , wherein the interference system comprises one or more of a microRNA, an siRNA, an shRNA, a dsRNA, AON, a cre-lox system or a CRISPR / Cas system.

43. A pharmaceutical composition comprising the interfering RNA of any one of claims 36 to 39 or the composition of any one of claims 40 to 42, and one or more of a pharmaceutically acceptable carrier, stabilizer or excipient.

44. A method of treating or preventing a pregnancy complication, the method comprising administering to a pregnant subject an interfering nucleic acid of any one of claims 36 to 39, or a composition of any one of claims 40 to 42, wherein the interfering nucleic acid or the RNA-interference system of the composition reduces hybridization between any one or more of circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277 and its / their complementary genomic DNA.

45. A kit for quantifying one or more circular RNAs (circRNAs) selected from the group consisting of: circ_0009000, circ_0024157, circ_0061017, circ_0036877, circ_0054624 and circ_0111277, the kit comprising one or more pairs of primers or one or more probes, wherein the primer pairs or the probes are specific for one or more of the circRNAs.

46. The kit of claim 45, wherein the one or more pairs of primers are configured for specific amplification of the back-splice junction of the one or more circRNAs.

47. The kit of claim 45 or claim 46, wherein one of the primers in a pair is, or both of the primers in a pair are, configured to hybridize within 500nt, 450nt, 300nt,250nts, 200nts, 10Ont, 75nt, 50nt, or 25nt of the back-splice junction of the one or more circRNAs.

48. The kit of claim 45 or claim 46, wherein one of the primers in a pair is configured to hybridize to the back-splice junction of the one or more circRNAs.

49. The kit of claim 45, wherein the one or more probes is / are configured to hybridize to the back-splice junction of the one or more circRNAs.

50. The kit of any one of claims 45 to 49, wherein the kit comprises RNase R.51 . The kit of any one of claims 45 to 50, wherein the kit comprises random primers for amplifying a circRNA.

52. The kit of any one of claims 45 to 51 for use in a method according to any one of claims 1 to 35.

53. Use of the kit of any one of claims 45 to 51 in a method according to any one of claims 1 to 35.

54. Use of the interfering nucleic acid of any one of claims 36 to 39, or the composition of any one of claims 40 to 42, or the pharmaceutical composition of claim 43, for the prevention of DNA damage in a cell.

55. A method for reducing DNA damage in a cell, the method comprising exposing the cell to an interfering nucleic acid of any one of claims 36 to 39, wherein the interfering nucleic acid hybridizes to its complementary circRNA and reduces hybridization between the circRNA and its complementary genomic DNA.

56. A method for reducing DNA damage in a cell, the method comprising exposing the cell to the composition of any one of claim 40 to 42, or the pharmaceutical composition of claim 43, wherein the RNA-interference system reduces hybridization between the one or more circRNA(s) and its / their complementary genomic DNA.