Method and kit for constructing multi-copy nucleic acid library
By constructing a multi-copy nucleic acid library through isothermal amplification and ligase in droplets, the problem of low accuracy in double-stranded sequencing of target nucleic acids in existing technologies is solved, and efficient and accurate multiple sequencing is achieved.
Patent Information
- Application Number
- PCT/CN2024/116076
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-08-30
- Publication Date
- 2026-03-05
AI Technical Summary
Existing single-molecule sequencing technologies have low accuracy in double-stranded sequencing of target nucleic acids, and suffer from problems such as numerous byproducts, complex sequencing systems, difficulty in base identification, and challenges in analyzing sequencing results.
The target nucleic acid was amplified in a microreactor using droplet-based isothermal amplification technology to form a multi-copy nucleic acid library. This library was then constructed using ligase and sequenced using single-molecule nanopore sequencing technology.
It improves sequencing accuracy and efficiency, reduces byproducts, simplifies the sequencing system, reduces the difficulty of base identification, and enables multiple sequencing runs.
Smart Images

Figure CN2024116076_05032026_PF_FP_ABST
Abstract
Description
Methods and kits for constructing multicopy nucleic acid libraries Technical Field
[0001] This invention relates to the field of sequencing technology, and more specifically, to a method and kit for constructing a multi-copy nucleic acid library. Background Technology
[0002] Single-molecule sequencing is a high-throughput sequencing technology that can directly sequence single nucleic acid molecules, providing more comprehensive and accurate sequence information. It has become an important tool in genomics and biological research, offering more possibilities for scientific research and medical applications. Nanopore sequencing is a typical single-molecule level detection technology with advantages such as high sequencing speed, long read length, direct sequencing, high throughput, low cost, small size, and portability. In nanopore sequencing, a single nanopore is embedded in an insulating impermeable membrane, forming a stable ion current channel. Under the influence of voltage, single-stranded nucleic acid molecules pass through the nanopore, thus reducing the ion current passing through the nanopore. Due to the different molecular structures and sizes of different bases on the single-stranded nucleic acid molecule, the current passing through the nanopore exhibits differences corresponding to the base sequence. By using algorithms to analyze the current change signal, the sequence of the perforated single-stranded nucleic acid can be read in real time. However, existing single-molecule sequencing technologies typically only sequence a single strand of the target nucleic acid, and the sequencing accuracy remains limited, which severely restricts the application scope of single-molecule sequencing technology.
[0003] To address the aforementioned issues, Oxford Nanopore Technologies (ONT) developed a method for double-stranded sequencing, comprising: (1) connecting the first and second strands (usually hairpin adapters) at or near one end of the target nucleic acid via a bridging portion, and connecting the other end to a sequencing adapter complex (usually a Y-type sequencing adapter complex), thereby forming a sequencing library; (2) performing single-molecule nanopore sequencing on the sequencing library. Since the double strands of the target nucleic acid are connected at one end by a bridging portion, the first and second strands of the target nucleic acid pass through the nanopore sequentially, achieving double-stranded sequencing of the target nucleic acid. Patent CN103827320B is available. Based on this, by using different anchors (usually restraint sequences modified with cholesterol or fatty acyl chains, capable of coupling the library to the membrane) to bind the hairpin adapters or Y-type sequencing adapters of the sequencing library respectively, the capture probability of libraries capable of double-stranded sequencing is increased because the anchors binding to hairpin adapters are coupled to the membrane more strongly than those binding to Y-type sequencing adapters. Patent CN106460061B is available.
[0004] However, the aforementioned patents CN103827320B and CN106460061B still have the following problems: (1) In the process of connecting the first and second strands at one end or near the target nucleic acid through a bridging portion and connecting the other end to the sequencing adapter complex to form a sequencing library, byproducts that cannot be double-stranded are also generated, namely, products where both ends of the target nucleic acid are connected by the bridging portion and products where both ends of the target nucleic acid are connected by the sequencing adapter complex, resulting in a low proportion and low efficiency of obtaining the target library. (2) Two different anchors (usually restraint sequences modified with cholesterol or fatty acyl chains that can couple the library to the membrane) are required during the sequencing process, increasing the sequencing components and increasing the complexity of the sequencing system. (3) When using this method for double-stranded sequencing, the motor protein controls the sequencing of the first strand by controlling the double strand, while the second strand is sequenced by controlling the single strand. The kinetics of the same motor protein controlling the sequencing of the double strand and controlling the sequencing of the single strand are different, which will cause differences in the sequencing electrical signals of the first and second strands, which will increase the difficulty of base recognition during sequencing result analysis. (4) When using this method for double-strand sequencing, the motor protein controls the sequencing of the first strand by controlling the double strand, while the sequencing of the second strand is controlled by controlling the single strand. After the sequencing of the first strand is completed, the second strand exists in the form of a single strand, which is prone to forming secondary structures and affecting the sequencing.
[0005] Therefore, it is of great significance to improve existing methods for single-molecule sequencing of target nucleic acids to increase sequencing accuracy.
[0006] Summary of the Invention
[0007] The main objective of this invention is to provide a method for constructing a single-molecule multiple-copy sequencing library and a sequencing method, so as to solve the problem of low sequencing accuracy when performing single-molecule sequencing of target nucleic acids in the prior art.
[0008] To achieve the above objectives, according to a first aspect of the present invention, a method for constructing a multi-copy nucleic acid library is provided. The method includes: performing droplet-based isothermal amplification on a target nucleic acid to obtain an amplification product; ligating the amplification product to obtain a multi-copy target nucleic acid; and breaking the droplet and constructing the released multi-copy target nucleic acid into a multi-copy nucleic acid library.
[0009] Furthermore, isothermal amplification of the target nucleic acid based on droplets to obtain amplification products includes: isothermal amplification of the target nucleic acid and amplification primers under the action of polymerase to obtain amplification products; wherein the 5' end of the target nucleic acid may or may not have phosphorylation modification, and the 5' end of the amplification primer has phosphorylation modification; or, the 5' end of the target nucleic acid has phosphorylation modification, and the 5' end of the amplification primer does not have phosphorylation modification.
[0010] Furthermore, the two ends of the target nucleic acid are not connected to the adapter, and the amplification primer binds to the target nucleic acid; or, the adapter is connected to the two ends of the target nucleic acid to obtain the target nucleic acid containing the adapter, and the amplification primer binds to the adapter.
[0011] Furthermore, the construction method includes: mixing the target nucleic acid, isothermal amplification components, and ligation components to obtain a reaction solution for isothermal amplification and ligation; preparing the reaction solution into water-in-oil droplets, wherein the number of target nucleic acid molecules in a single water-in-oil droplet is ≤1; performing isothermal amplification and ligation within the water-in-oil droplet to obtain multiple copies of the target nucleic acid; breaking the water-in-oil droplet and purifying the multiple copies of the target nucleic acid, and constructing the purified multiple copies of the target nucleic acid into a multiple copy nucleic acid library.
[0012] Furthermore, the water-in-oil droplets are subjected to isothermal amplification and ligation under conditions of >0℃ and incubation ≥1min to obtain multiple copies of target nucleic acid; preferably, water-in-oil droplets are prepared using microfluidic droplet generation technology.
[0013] Furthermore, isothermal amplification is performed using polymerase-mediated amplification technology with chain displacement activity, recombinase polymerase amplification technology, or helicase-dependent amplification technology.
[0014] Furthermore, the target nucleic acid is double-stranded target DNA, and the double-stranded target DNA is end-treated to form a primer-binding region with a protruding 3' suspension at the end of the double-stranded target DNA; the amplification primer binds to the primer-binding region, and isothermal amplification is performed using polymerase-mediated amplification technology with strand displacement activity.
[0015] Furthermore, the ends of the double-stranded target DNA are processed using any one or more of the following methods to form a primer-binding region with a protruding 3' dangling structure:
[0016] 1) A 3' dangling is obtained by extending the double-stranded target DNA at the 3' end using terminal transferase;
[0017] 2) Use ligase or transposase to ligate the adaptor with a protruding 3' suspension to both ends of the target double-stranded DNA to obtain a 3' suspension;
[0018] 3) Using primers containing modified nucleotides and a DNA polymerase that can tolerate the modified nucleotides, double-stranded target DNA is amplified using a template. Then, a nuclease capable of cutting the modified nucleotides cleaves the 5' end of the amplified product, creating a nick at the modified nucleotide site. The cleaved primer fragment dissociates, yielding sticky ends, which are the 3' dangling ends; or
[0019] 4) Use 5'-3' exonuclease to digest double-stranded target DNA to obtain 3' hanging.
[0020] Further, the 5' end of the amplification primer is phosphorylated and the 5' end of the double-stranded target DNA is not phosphorylated; or the 5' end of the amplification primer is not phosphorylated and the 5' end of the double-stranded target DNA is phosphorylated; preferably, the amplification primer has the nucleotide sequence shown in SEQ ID NO: 4.
[0021] Furthermore, the target nucleic acid is double-stranded target DNA, which is amplified isothermally using recombinase polymerase amplification technology or helicase-dependent amplification technology. The 5' end of the amplification primer is phosphorylated. Optionally, the 5' end of the double-stranded target DNA is phosphorylated. Preferably, the amplification primer has the nucleotide sequence shown in SEQ ID NO: 4.
[0022] Furthermore, the target nucleic acid is a target nucleic acid containing an adapter, and the method for constructing the target nucleic acid containing the adapter includes: performing end repair on the target nucleic acid and adding a single nucleotide A to obtain a repair product; ligating the repair product to the adapter to obtain the target nucleic acid containing the adapter; preferably, the target nucleic acid is a double-stranded target DNA, and the adapter includes a first strand and a second strand; preferably, the first strand has the nucleotide sequence shown in SEQ ID NO: 2, and the second strand has the nucleotide sequence shown in SEQ ID NO: 3.
[0023] Further, the ligation component includes a ligase and a ligation reaction buffer adapted to the ligase; wherein the ligase is selected from any one or more of the following: T4 DNA ligase, T3 DNA ligase, SplintR ligase, T4 RNA ligase 1, T4 RNA ligase 2, RtcB ligase, or Thermostable 5′App DNA / RNA ligase.
[0024] Furthermore, the isothermal amplification components include:
[0025] 1) Amplification primers, recombinase, polymerase, amplification reaction buffer, and dNTPs;
[0026] 2) Amplification primers, helicase, polymerase, amplification reaction buffer, and dNTPs; or
[0027] 3) Amplification primers, polymerase with strand displacement activity, amplification reaction buffer, and dNTPs;
[0028] Preferably, the polymerase in 1) or 2) is selected from any one or more of the following: Q5 superfidelity DNA polymerase, Taq DNA polymerase, Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu large fragment DNA polymerase, Klenow fragment DNA polymerase, T4 DNA polymerase, T7 DNA polymerase, DNA Polymerase I;
[0029] Preferably, the polymerase with strand displacement activity in 3) is selected from any one or more of the following: Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu Large Fragment DNA polymerase, Klenow Fragment DNA polymerase; preferably, the amplification reaction buffer is adapted to the selected enzyme; optionally, the amplification reaction buffer contains an auxiliary reagent to enhance the polymerase extension reaction.
[0030] Optionally, the auxiliary reagents may be selected from any one or more of the following: dimethyl sulfoxide, glycerol, formamide, bovine serum albumin, ammonium sulfate, polyethylene glycol, gelatin, nonionic detergent, N,N,N-trimethylglycine, single-stranded nucleic acid-binding protein, dithiothreitol, or ethylenediaminetetraacetic acid.
[0031] Furthermore, a demulsifier is used to break the droplets, releasing multiple copies of the target nucleic acid.
[0032] Furthermore, the multi-copy nucleic acid library is a multi-copy nucleic acid sequencing library, and the construction method further includes: ligating the multi-copy target nucleic acid to the sequencing adapter to obtain the multi-copy nucleic acid sequencing library; preferably, the sequencing adapter is a Y-type adapter.
[0033] To achieve the above objectives, according to a second aspect of the present invention, a method for constructing a multi-copy nucleic acid library is provided, and the multi-copy nucleic acid library obtained is used for sequencing; preferably, the sequencing is single-molecule sequencing, more preferably, the single-molecule sequencing is single-molecule nanopore sequencing or single-molecule fluorescence sequencing.
[0034] To achieve the above objectives, according to a third aspect of the present invention, a method for single-molecule sequencing of a multi-copy nucleic acid library is provided, the method comprising: obtaining a multi-copy nucleic acid sequencing library obtained according to the above construction method; performing single-molecule sequencing on the multi-copy nucleic acid sequencing library; preferably, the single-molecule sequencing is single-molecule nanopore sequencing or single-molecule fluorescence sequencing.
[0035] To achieve the above objectives, according to a fourth aspect of the present invention, a kit for constructing a multicopy nucleic acid library is provided, the kit comprising any one of the following isothermal amplification components and optional ligation components: the isothermal amplification components include: 1) amplification primers, recombinase, polymerase, amplification reaction buffer, and dNTPs; 2) amplification primers, helicase, polymerase, amplification reaction buffer, and dNTPs; or 3) amplification primers, a polymerase with strand displacement activity, amplification reaction buffer, and dNTPs;
[0036] The ligation component includes a ligase and a ligation reaction buffer adapted to the ligase, wherein the ligase is selected from any one or more of the following: T4 DNA ligase, T3 DNA ligase, SplintR ligase, T4 RNA ligase 1, T4 RNA ligase 2, RtcB ligase, or Thermostable 5′App DNA / RNA ligase.
[0037] Further, in isothermal amplification component 1) or 2), the polymerase is selected from any one or more of the following: Q5 ultrafidelity DNA polymerase, Taq DNA polymerase, Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu large fragment DNA polymerase, Klenow fragment DNA polymerase, T4 DNA polymerase, T7 DNA polymerase, and DNA Polymerase I. Preferably, the amplification reaction buffer is adapted to the selected enzyme.
[0038] Further, in the isothermal amplification component 3), the polymerase with strand displacement activity is selected from any one or more of the following: Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu Large Fragment DNA polymerase, Klenow Fragment DNA polymerase; preferably, the amplification reaction buffer is adapted to the selected enzyme.
[0039] Furthermore, the amplification reaction buffer contains an auxiliary reagent to enhance the polymerase extension reaction; preferably, the auxiliary reagent is selected from any one or more of the following: dimethyl sulfoxide, glycerol, formamide, bovine serum albumin, ammonium sulfate, polyethylene glycol, gelatin, nonionic detergent, N,N,N-trimethylglycine, single-stranded nucleic acid binding protein, dithiothreitol or ethylenediaminetetraacetic acid.
[0040] By applying the technical solution of this invention, target nucleic acids are isothermally amplified and sequentially ligated within droplets to obtain multiple copies of nucleic acids. These multiple copies are then used to construct a library, resulting in a multiple-copy nucleic acid library. Sequencing of this library enables multiple sequencing of the target nucleic acid. The method for constructing multiple-copy nucleic acid libraries and the sequencing method using this type of library not only improves the construction efficiency of multiple-copy (≥2) sequencing libraries but also allows for multiple sequencing of the target nucleic acid (≥2 times), thereby improving sequencing accuracy.
[0041] In a preferred embodiment, the present invention employs motor proteins to control and drive the double-stranded sequencing process during multiple single-molecule nanopore sequencing operations. The two copies of the sequencing strand are two consecutive copies of the single-stranded molecule (sense or antisense strand) from the target nucleic acid sequence. Therefore, after the sequencing strand passes through the pore, there is no rehybridization of the sense and antisense strands, and the average current value and pore-passing speed of different copies are not affected. Thus, the technical solution of the present invention significantly improves the sequencing quality of multiple single-molecule nanopore sequencing operations. Attached Figure Description
[0042] The accompanying drawings, which form part of this specification, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings:
[0043] Figure 1 illustrates a schematic diagram of the droplet-based target nucleic acid amplification and multiple (≥2) single-molecule sequencing method according to the present invention. In this method, the target nucleic acid is not connected to either end by an adaptor, the 5' end of the amplification primer is phosphorylated, and the 5' end of the target nucleic acid may or may not be phosphorylated.
[0044] Figure 2 illustrates a schematic diagram of the droplet-based target nucleic acid amplification and multiple (≥2) single-molecule sequencing method according to the present invention, wherein the two ends of the target nucleic acid are connected to adaptors, the 5' end of the amplification primer is phosphorylated, and the 5' end of the target nucleic acid connected to the adaptors at both ends is (not shown) or not phosphorylated.
[0045] Figure 3 illustrates a schematic diagram of two sequencing of the target nucleic acid according to an embodiment of the present invention, wherein the 5' end of the amplification primer is phosphorylated and the 5' end of the target nucleic acid after the two ends are connected to the adapters is not phosphorylated.
[0046] Figure 4 shows the droplet formation and microscopic observation according to an embodiment of the present invention, wherein, from left to right, the left image is the droplet formation image, the middle image is the layering image of the droplet and water, and the right image is the microscopic observation image of the droplet.
[0047] Figure 5 shows a schematic diagram of the structure of the Y-type sequencing adapter complex according to an embodiment of the present invention.
[0048] Figure 6 shows an electrophoresis diagram of the Y-type sequencing adapter complex constructed according to an embodiment of the present invention.
[0049] Figure 7 shows a current signal diagram of a target nucleic acid double-stranded sequencing according to an embodiment of the present invention.
[0050] Figure 8 shows a schematic diagram of two sequencing of the target nucleic acid according to an embodiment of the present invention, wherein the 5' end of the amplification primer is not phosphorylated and the 5' end of the target nucleic acid after the two ends are connected to the adapters is phosphorylated. Detailed Implementation
[0051] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other. The present invention will now be described in detail with reference to the embodiments.
[0052] Terminology Explanation:
[0053] Transitional sequence: In this invention, it refers to the sequence that is directly linked to the target nucleic acid.
[0054] Sequencing adapter: In this invention, it is ligated to the target nucleic acid or the amplification product of the target nucleic acid to form a single-molecule sequencing library.
[0055] Sequencing adapter complex: In this invention, it refers to the complex composed of the sequencing adapter and the helicase bound to the sequencing adapter in nanopore sequencing.
[0056] Polymerase-mediated amplification with strand displacement activity: Double-stranded DNA is treated to form 3' suspensions at both ends. Amplification primers specifically bind to both ends of the DNA through the 3' suspensions. Under the action of strand displacement-active polymerase, the amplification primers are extended, forming two double-stranded DNA amplification products. One strand of each double-stranded DNA amplification product is the original strand, and the other strand is the amplified strand.
[0057] Recombinase polymerase amplification (RPA) is a technique for amplifying DNA fragments. It is widely used in molecular biology research due to its advantages of simple operation, short reaction time, and high amplification efficiency. The principle is as follows: a protein-DNA complex is formed by the binding of recombinase and primers. This complex searches for homologous sequences in double-stranded DNA. Once the primers locate a homologous sequence, a strand exchange reaction occurs, initiating DNA synthesis and exponentially amplifying the target region on the template. The replaced DNA strand binds to SSBs (single-strand binding proteins) to prevent further replacement.
[0058] Helicase-dependent amplification technology: This technology mimics the natural process of DNA replication in vivo. It uses helicase to untie the DNA double helix at a constant temperature, and then DNA single-strand binding proteins stabilize the untied single strands to provide a template for primers. Then, complementary double strands are synthesized under the action of DNA polymerase. The above cyclic amplification process is repeated continuously to achieve exponential growth of the target sequence.
[0059] As mentioned in the background section, existing single-molecule sequencing technologies typically only sequence a single strand of the target nucleic acid, resulting in limited sequencing accuracy and severely restricting its application. While various methods for single-molecule sequencing of double-stranded target nucleic acids have been disclosed with technological advancements, existing technologies still suffer from low library construction efficiency, complex sequencing systems, difficulty in base identification, and low sequencing accuracy. To improve the low sequencing accuracy, this application develops a single-molecule sequencing scheme completely different from previous approaches (i.e., single-molecule sequencing of double-stranded target nucleic acids). Specifically, the target nucleic acid is isothermally amplified and sequentially ligated within a droplet, followed by library construction and sequencing of multiple copies of the nucleic acid. The specific improvement approach is as follows:
[0060] This invention, based on existing droplet generation technology, precisely distributes the target nucleic acid and the corresponding isothermal amplification and ligation reaction solution into micro-reaction droplets, ensuring that the number of target nucleic acid templates in a single droplet reactor is less than or equal to one. The resulting droplets undergo isothermal amplification, amplifying a single target nucleic acid into multiple copies (≥2). These copies are then ligated within the droplet to form multiple copies (≥2). The obtained multiple copies are then used for library construction and sequencing, such as single-molecule nanopore sequencing, thereby significantly improving sequencing accuracy. Therefore, based on the above improvements, the applicant has proposed a series of protection schemes for this invention.
[0061] According to a first aspect of the present invention, a method for constructing a multicopy nucleic acid library is provided, the method comprising: performing droplet-based isothermal amplification on a target nucleic acid to obtain an amplification product; ligating the amplification product to obtain a multicopy target nucleic acid; and breaking the droplet and constructing the released multicopy target nucleic acid into a multicopy nucleic acid library.
[0062] Droplet technology is a technique that controls the generation, manipulation, and separation of tiny droplets, enabling high-throughput experiments, efficient drug screening, microfluidic control, and other applications. In this invention, a droplet acts as a microreactor, providing an independent reaction site for the isothermal amplification of target nucleic acids and ensuring that the number of target nucleic acids in each reactor is ≤1, thus avoiding the influence of other factors on the amplification of target nucleic acids. In this invention, droplet-based isothermal amplification refers to isothermal amplification combined with droplet technology.
[0063] Isothermal amplification is a method of DNA amplification performed at a constant temperature. This method utilizes DNA polymerases capable of DNA synthesis at a constant temperature, eliminating the need for periodic temperature cycling and simplifying the PCR reaction. The isothermal amplification method employed in this invention provides a suitable operating temperature for the ligase, facilitating its function. The isothermal amplification methods of this invention include isothermal amplification using polymerase-mediated amplification techniques with strand displacement activity, recombinase polymerase amplification techniques, or helicase-dependent amplification techniques.
[0064] The target nucleic acid in the droplet is isothermally amplified to obtain multiple copies. Then, under the action of a ligase, these multiple copies of the target nucleic acid are further ligated into a complete multi-copy nucleic acid molecule. The ligation components include a ligase and a ligation reaction buffer adapted to the ligase. The ligase can be any one or more of the following: T4 DNA ligase, T3 DNA ligase, SplintR ligase, T4 RNA ligase 1, T4 RNA ligase 2, RtcB ligase, or Thermostable 5′App DNA / RNA ligase. In a preferred embodiment of the present invention, T4 DNA ligase is selected to ligate multiple copies of the target nucleic acid into a complete single-molecule multi-copy nucleic acid strand.
[0065] The above construction method includes the following steps: mixing the target nucleic acid, isothermal amplification components, and ligation components to obtain a reaction solution for isothermal amplification and ligation; preparing the reaction solution into water-in-oil droplets, wherein the number of target nucleic acids in a single water-in-oil droplet is ≤1; performing isothermal amplification and ligation within the water-in-oil droplet to obtain multiple copies of the target nucleic acid; breaking the water-in-oil droplet and purifying the multiple copies of the target nucleic acid, and constructing a multiple copy nucleic acid library from the purified multiple copies of the target nucleic acid; preferably, performing isothermal amplification and ligation of the water-in-oil droplet under conditions of >0℃ and incubation ≥1min to obtain multiple copies of the target nucleic acid; preferably, preparing the water-in-oil droplet using microfluidic droplet generation technology; preferably, performing isothermal amplification using polymerase-mediated amplification technology with chain displacement activity, recombinase polymerase amplification technology, or helicase-dependent amplification technology.
[0066] To facilitate the subsequent ligation of multiple copies of the target nucleic acid into a single multicopy nucleic acid molecule, isothermal droplet-based amplification of the target nucleic acid is performed to obtain the amplification product. This includes: isothermal amplification using the target nucleic acid and amplification primers under the action of polymerase to obtain the amplification product; wherein the 5' end of the target nucleic acid may or may not have phosphorylation modification, and the 5' end of the amplification primer has phosphorylation modification; or, the 5' end of the target nucleic acid has phosphorylation modification, and the 5' end of the amplification primer does not have phosphorylation modification. It is important to note that when the target nucleic acid is coupled with adapters at both ends, the 5' end phosphorylation modification of the target nucleic acid with adapters at both ends is located on the adapter.
[0067] Alternatively, the two ends of the target nucleic acid are not connected to the adaptor, and the amplification primer binds to the target nucleic acid; or, the adaptor is connected to the two ends of the target nucleic acid to obtain the target nucleic acid containing the adaptor, and the amplification primer binds to the adaptor. The binding of the target nucleic acid and the amplification primer is the basis for isothermal amplification.
[0068] In a preferred embodiment of the present invention, isothermal amplification is performed using polymerase-mediated amplification technology with strand displacement activity (see Figures 3 and 8), the target nucleic acid is double-stranded target DNA, the 5' end of the amplification primer is phosphorylated and the 5' end of the double-stranded target DNA is not phosphorylated (see Figure 3); or the 5' end of the amplification primer is not phosphorylated and the 5' end of the double-stranded target DNA is phosphorylated (see Figure 8); preferably, the amplification primer has the nucleotide sequence shown in SEQ ID NO: 4.
[0069] Using this technique for isothermal amplification, the obtained double-stranded target DNA has only 2 copies. Therefore, regardless of whether the 5' end of the double-stranded target DNA, the 5' end of the amplification primer, or both are phosphorylated, ligation of 2 copies can be achieved. The sequence of SEQ ID NO: 4 is: 5'-AATTAACAACCTGTGAG-3'.
[0070] In another preferred embodiment of the present invention, isothermal amplification is performed using recombinase polymerase amplification technology or helicase-dependent amplification technology, the target nucleic acid is double-stranded target DNA, and the 5' end of the amplification primers is phosphorylated (see Figures 1 and 2). Optionally, the 5' end of the double-stranded target DNA is phosphorylated (see Figure 2). Preferably, the amplification primers have the nucleotide sequence shown in SEQ ID NO: 4.
[0071] The target nucleic acid obtained using these two amplification techniques has a copy number ≥2. Phosphorylation modification is used to assist in the ligation of multiple copies; therefore, phosphorylation modification can achieve multiple copy ligation whether it is applied to the 5' end of the amplification primer or the 5' end of the double-stranded target DNA. However, to achieve ligation with the maximum possible copy number, it is preferable that the 5' end of the amplification primer has phosphorylation modification, while whether the 5' end of the double-stranded target DNA has phosphorylation modification is not specifically limited.
[0072] When isothermal amplification is performed using polymerase-mediated amplification with strand displacement activity, the target nucleic acid is double-stranded target DNA. To enable the amplification primers to bind to the double-stranded target DNA, the double-stranded target DNA needs to undergo end treatment, forming a 3' dangling primer-binding region at the end of the double-stranded target DNA; the amplification primers then bind to this primer-binding region. However, when isothermal amplification is performed using recombinase polymerase amplification or helicase-dependent amplification, the recombinase or helicase can assist the amplification primers in binding to the double-stranded target DNA. Therefore, in this case, the double-stranded target DNA does not require the aforementioned end treatment, and isothermal amplification can still be achieved.
[0073] For the reasons stated above, in one embodiment of the present invention, the double-stranded target DNA is end-processed before isothermal amplification. The end-processing of the double-stranded target DNA is performed in any one or more of the following ways to form a primer-binding region with a protruding 3' dangling region:
[0074] 1) A 3' dangling is obtained by extending the double-stranded target DNA at the 3' end using terminal transferase;
[0075] 2) Use ligase or transposase to ligate the adaptor with a protruding 3' suspension to both ends of the target double-stranded DNA to obtain a 3' suspension;
[0076] 3) Using primers containing modified nucleotides and a DNA polymerase that can tolerate the modified nucleotides, double-stranded target DNA is amplified using a template. Then, a nuclease capable of cutting the modified nucleotides cleaves the 5' end of the amplified product, creating a nick at the modified nucleotide site. The cleaved primer fragment dissociates, yielding sticky ends, which are the 3' dangling ends; or
[0077] 4) Use 5'-3' exonuclease to digest double-stranded target DNA to obtain 3' hanging.
[0078] Using the methods described above, it is possible to form 3' suspensions with known or unknown sequences at both ends of the double-stranded target DNA. These 3' suspensions can then bind efficiently and specifically to amplification primers in subsequent construction methods, thereby improving reaction efficiency.
[0079] In a preferred embodiment of the present invention, the target nucleic acid is a target nucleic acid containing an adapter. The method for constructing the target nucleic acid containing the adapter includes: performing end repair on the target nucleic acid and adding a single nucleotide A to obtain a repair product; ligating the repair product to the adapter to obtain the target nucleic acid containing the adapter; preferably, the target nucleic acid is a double-stranded target DNA, and the adapter includes a first strand and a second strand; preferably, the first strand has the nucleotide sequence shown in SEQ ID NO: 2, and the second strand has the nucleotide sequence shown in SEQ ID NO: 3.
[0080] The sequence of SEQ ID NO: 2 is 5'-GAACGACATGGCACTT-3'; the sequence of SEQ ID NO: 3 is 5'-AGTGCCATGTCGTTCCCTTGGCTCACAGGTTGTTAATT-3', with a phosphorylation modification at the 5' end. The first and second strands undergo base pairing via annealing to form a double-stranded adaptor. This double-stranded adaptor is then ligated to the product that has undergone end repair and A-addition, yielding the target nucleic acid containing the adaptor.
[0081] In this invention, the advantage of using target nucleic acids containing adaptors for isothermal amplification is that the target nucleic acids in different droplets are different. If the adaptor is not connected, the target primers required to amplify different target nucleic acids are also different. For the convenience of amplification, the same adaptor is added to different target nucleic acids, and then the same amplification primers can be used to amplify target nucleic acids with different sequences, which has the advantage of simple operation.
[0082] It is important to note that for isothermal amplification using recombinase polymerase amplification or helicase-dependent amplification, the ends of the target nucleic acid containing the adaptor can be either blunt ends or 3' hanging ends. However, for isothermal amplification using polymerase-mediated amplification with strand displacement activity, the ends of the target nucleic acid containing the adaptor need to form 3' hanging ends.
[0083] When isothermal amplification is performed using polymerase-mediated amplification technology with chain displacement activity, ligating adapters at both ends of the target nucleic acid not only simplifies the operation but also forms a 3' suspension.
[0084] The specific implementation of the above-mentioned adaptor ligation is as follows: the target nucleic acid and the adaptor can be ligated using ligation, transposition, or PCR to obtain the target nucleic acid containing the adaptor. In a preferred embodiment of the present invention, the target nucleic acid and the adaptor are ligated using ligation to obtain the target nucleic acid containing the adaptor.
[0085] The above isothermal amplification components include: 1) amplification primers, recombinase, polymerase, amplification reaction buffer, and dNTPs; 2) amplification primers, helicase, polymerase, amplification reaction buffer, and dNTPs; or 3) amplification primers, polymerase with strand displacement activity, amplification reaction buffer, and dNTPs.
[0086] Preferably, the polymerase in 1) or 2) is selected from any one or more of the following: Q5 superfidelity DNA polymerase, Taq DNA polymerase, Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu large fragment DNA polymerase, Klenow fragment DNA polymerase, T4 DNA polymerase, T7 DNA polymerase, DNA Polymerase I;
[0087] Preferably, the polymerase with strand displacement activity in 3) is selected from any one or more of the following: Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu Large Fragment DNA polymerase, Klenow Fragment DNA polymerase; preferably, the amplification reaction buffer is compatible with the selected enzyme.
[0088] Optionally, the amplification reaction buffer contains an auxiliary reagent to enhance the polymerase extension reaction; optionally, the auxiliary reagent is selected from any one or more of the following: dimethyl sulfoxide, glycerol, formamide, bovine serum albumin, ammonium sulfate, polyethylene glycol, gelatin, nonionic detergent, N,N,N-trimethylglycine, single-stranded nucleic acid binding protein, dithiothreitol, or ethylenediaminetetraacetic acid.
[0089] The above-mentioned ligation components include a ligase and a ligation reaction buffer adapted to the ligase; wherein the ligase is selected from any one or more of the following: T4 DNA ligase, T3 DNA ligase, SplintR ligase, T4 RNA ligase 1, T4 RNA ligase 2, RtcB ligase, or Thermostable 5′App DNA / RNA ligase.
[0090] In a preferred embodiment of the present invention, a demulsifier is used to break the droplets, releasing multiple copies of the target nucleic acid. The aforementioned multiple-copy nucleic acid library is a multiple-copy nucleic acid sequencing library, and the construction method further includes: ligating the aforementioned multiple-copy target nucleic acid to a sequencing adapter to obtain the aforementioned multiple-copy nucleic acid sequencing library; preferably, the sequencing adapter is a Y-type adapter.
[0091] According to a second aspect of the present invention, a multi-copy nucleic acid library obtained by the above construction method is provided for sequencing; preferably, the sequencing is single-molecule sequencing; more preferably, the single-molecule sequencing is single-molecule nanopore sequencing or single-molecule fluorescence sequencing.
[0092] According to a third aspect of the present invention, a method for single-molecule sequencing of a multi-copy nucleic acid library is provided, the method comprising: obtaining a multi-copy nucleic acid sequencing library obtained according to the above-described construction method; performing single-molecule sequencing on the multi-copy nucleic acid sequencing library; preferably, the single-molecule sequencing is single-molecule nanopore sequencing or single-molecule fluorescence sequencing.
[0093] Single-molecule sequencing methods include single-molecule nanopore sequencing or single-molecule fluorescence sequencing, and the specific sequencing method can be selected as needed. In a preferred embodiment of the present invention, single-molecule nanopore sequencing is used to sequence the above-mentioned single-molecule multiple-copy sequencing library.
[0094] The sequencing adapter in the single-molecule nanopore sequencing method consists of two strands, including a first strand and a second strand. Preferably, the sequence of the first strand of the sequencing adapter is: 5'-XXXXXXXXXXXXXXXXXXXXXXXXXXXXXX-SEQ ID NO: 5-YYYY-SEQ ID NO: 6-3'; wherein, the sequence of SEQ ID NO: 5 is TTTTTTTTTT; the sequence of SEQ ID NO: 6 is GGTTGTTTCTGTTGGTGCTGATATTGCT; X represents iSpC3; Y represents iSp18.
[0095] The sequence of the second strand of the sequencing adapter is the nucleotide sequence shown in SEQ ID NO: 9, wherein the sequence of SEQ ID NO: 9 is: 5'-GCAATATCAGCACCAACAGAAACAACCTTTGAGGCGAGCGGTCAA-3', and the 5' end contains phosphorylation modification.
[0096] In single-molecule nanopore sequencing, helicases, acting as rate-controlling proteins, control the movement of single-stranded DNA molecules within the nanopore by unwinding the double helix structure of the DNA molecule. This allows single-stranded DNA molecules to pass through the nanopore at a relatively stable speed, thereby achieving DNA sequencing. Single-molecule nanopore sequencing based on helicase-controlled speed preferably uses one or more of the following helicases: Dda helicase, Pif 1 helicase, XPD helicase, T7Gp41 helicase, DnaB helicase, Rep helicase, UrvD helicase, Hel308 helicase, PcrA helicase, or RecD2 helicase. More preferably, the helicase is a mutant helicase. In a preferred embodiment of the present invention, a heterologously expressed helicase He mutant (T4Dda-(ΔM1)G1 / E94C / C109A / C136A / K194L / A360C) is selected. The helicase He mutant has the amino acid sequence shown in SEQ ID NO: 7; wherein, the sequence of SEQ ID NO: 7 is:
[0097] The nanopores used in single-molecule nanopore sequencing are either transmembrane protein pores or solid-state pores. Transmembrane protein pores are protein channels present on the cell membrane, allowing specific molecules or ions to pass through. These protein pores are typically composed of transmembrane proteins and selectively regulate the permeability of substances. Solid-state pores are channels present in solid materials, typically formed by porous structures or cracks. Solid-state pores can allow specific substances to pass through, such as gases or liquids, but unlike transmembrane protein pores, solid-state pores generally do not have selective permeability and cannot regulate the permeability of substances.
[0098] Preferably, the transmembrane protein of the transmembrane protein pore is selected from any one or more of the following: hemolysin, MspA, MspB, MspC, MspD, FraC, ClyA, PA63, CsgG, CsgD, XcpQ, SP1, phi29 connector protein, InvG, or GspD; more preferably, the transmembrane protein is linked to a polypeptide, which is selected from any one or more of the following: a tag, an enzyme cleavage site, a signal peptide, a guide peptide, or a detectable label.
[0099] The membrane used in single-molecule nanopore sequencing is an amphiphilic membrane or a polymer membrane; preferably, the membrane is a phospholipid bilayer, a diblock copolymer, or a triblock copolymer. The sequencing voltage is 10 mV or higher, preferably 50 mV-250 mV. The nanopore is placed on and passes through the membrane, thereby forming two independent reaction chambers located on both sides of the membrane: a cis chamber and a trans chamber, and the two reaction chambers are connected at the nanopore.
[0100] The main function of sequencing buffer is to provide a suitable and stable sequencing environment. The sequencing buffer used in single-molecule nanopore sequencing contains a pH buffer system; preferably, the pH buffer system is selected from any one or more of the following: dihydrogen phosphate-hydrogen phosphate buffer system, carbonate-sodium bicarbonate buffer system, Tris-HCl buffer system, HEPES buffer system, MOPS buffer system, or any combination thereof.
[0101] Preferably, the sequencing buffer contains K + Or Na + Additionally, the sequencing buffer contains any one or more of the following ions: Mg 2+ Mo 2+ Cu 2+ Fe 2+ Zn 2+ Ca 2+ Pb 2+ or Cd 2+Optionally, the sequencing buffer or sequencing buffer contains any one or more of the following components: NTP, ddNTP, or modified dNTP.
[0102] In single-molecule nanopore sequencing, a restraint sequence is typically added to trap the sequencing library near the nanopore. This restraint sequence binds to the membrane material via a cholesterol-terminated modification at its end. The restraint sequence is complementary to the second strand of the sequencing adapter in the sequencing library, thereby binding the library around the nanopore and increasing the permeation efficiency of the sequencing library.
[0103] In a preferred embodiment of the present invention, before performing single-molecule sequencing on the multicopy sequencing library, the method further includes: using a restraint sequence to attach the multicopy sequencing library to a membrane containing nanopores; preferably, the nucleotide sequence of the restraint sequence is 5'-YYYY-SEQ ID NO: 8-3', wherein the sequence of SEQ ID NO: 8 is 5'-TTGACCGCTCGCCTC-3', Y represents iSP18, and the 5' end of the restraint sequence contains cholesterol modification; preferably, the multicopy sequencing library is attached to the membrane containing nanopores by the cholesterol-modified restraint sequence.
[0104] In other preferred embodiments, the multicopy sequencing library can also be localized to the vicinity of the nanopore without restraint sequences. For example, when the end of the second strand of the sequencing adapter contains cholesterol modification, the library is immobilized on the membrane through this cholesterol modification. The multicopy sequencing library includes a sequencing adapter, which is formed by annealing the first and second strands of the sequencing adapter. The end of the second strand of the sequencing adapter contains cholesterol modification, which allows the multicopy sequencing library to attach to the membrane.
[0105] Preferably, the sequence of the first strand of the sequencing adapter is: 5'-XXXXXXXXXXXXXXXXXXXXXXXXXXXXXX-SEQ ID NO: 5-YYYY-SEQ ID NO: 6-3'; wherein, the sequence of SEQ ID NO: 5 is TTTTTTTTT; the sequence of SEQ ID NO: 6 is GGTTGTTTCTGTTGGTGCTGATATTGCT-3'; X represents iSpC3; Y represents iSp18; the sequence of the second strand of the sequencing adapter is the nucleotide sequence shown in SEQ ID NO: 9; wherein, the sequence of SEQ ID NO: 9 is: 5'-GCAATATCAGCACCAACAGAAACAACCTTTGAGGCGAGCGGTCAA-3', and the 5' end contains phosphorylation modification.
[0106] According to a fourth aspect of the present invention, a kit for constructing a multicopy nucleic acid library is provided, the kit comprising any one of the following isothermal amplification components and optional ligation components: the isothermal amplification components include: 1) amplification primers, recombinase, polymerase, amplification reaction buffer and dNTPs; 2) amplification primers, helicase, polymerase, amplification reaction buffer and dNTPs; or 3) amplification primers, polymerase with strand displacement activity, amplification reaction buffer and dNTPs;
[0107] The ligation component includes a ligase and a ligation reaction buffer adapted to the ligase, wherein the ligase is selected from any one or more of the following: T4 DNA ligase, T3 DNA ligase, SplintR ligase, T4 RNA ligase 1, T4 RNA ligase 2, RtcB ligase, or Thermostable 5′App DNA / RNA ligase.
[0108] In some embodiments, the isothermal amplification component is 1) or 2), and the polymerase is selected from any one or more of the following: Q5 superfidelity DNA polymerase, Taq DNA polymerase, Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu Large Fragment DNA polymerase, Klenow Fragment DNA polymerase, T4 DNA polymerase, T7 DNA polymerase, DNA Polymerase I.
[0109] In other embodiments, the isothermal amplification component is 3), and the polymerase with strand displacement activity is selected from any one or more of the following: Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu Large Fragment DNA polymerase, and Klenow Fragment DNA polymerase.
[0110] Preferably, the amplification reaction buffer is compatible with the selected enzyme.
[0111] In some embodiments, the amplification reaction buffer contains an auxiliary reagent to enhance the polymerase extension reaction; optionally, the auxiliary reagent is selected from any one or more of the following: dimethyl sulfoxide, glycerol, formamide, bovine serum albumin, ammonium sulfate, polyethylene glycol, gelatin, nonionic detergent, N,N,N-trimethylglycine, single-stranded nucleic acid binding protein, dithiothreitol, or ethylenediaminetetraacetic acid.
[0112] The above-mentioned kit has the advantage of being easy to use and can improve the construction efficiency of multi-copy (≥2) nucleic acid libraries.
[0113] The beneficial effects of the present invention will be explained in more detail below with reference to specific embodiments.
[0114] Example 1:
[0115] Figure 3 shows a schematic diagram of the target nucleic acid undergoing two sequencing operations in this invention. The specific steps include the following:
[0116] (1) Repair and end preparation
[0117] Following the manufacturer's instructions, NEBNext FFPE DNA Repair Mix (NEB, M6630) and NEBNext Ultra II End repair / dA-tailing Module (NEB, E7546) were used to repair and prepare the ends of the target nucleic acid (SEQ ID NO: 1) with the characteristic sequence. The reaction conditions were: incubation at 20°C for 10 minutes and then at 65°C for 10 minutes.
[0118] The repair and end-preparation products were purified using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions.
[0119] The sequence of SEQ ID NO: 1 is:
[0120]
[0121] (2) Connecting connector
[0122] Following the manufacturer's instructions, the first strand (SEQ ID NO: 2) and the second strand (SEQ ID NO: 3) of the adapter sequence were dissolved in TE buffer (pH=8) and annealed to form the adapter. The annealing process involved incubation at 95°C for 5 minutes, followed by cooling to 25°C at a rate of 0.1°C / s, and then incubation for another 30 minutes.
[0123] The repair and end-prepared products and the annealed adaptor were ligated using T4 DNA ligase (NEB, M0202) according to the manufacturer's instructions. The reaction conditions were incubation at 25°C for 60 minutes.
[0124] The ligation product was purified using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions.
[0125] (3) Preparation of microdroplets from reaction solution
[0126] Amplification primers with phosphorylation modification at the 5' end (SEQ ID NO: 4), phi29 DNA polymerase and reaction buffer (NEB, M0269), T4 DNA ligase and reaction buffer (NEB, M0202), and dNTPs were added to the ligation product to form a reaction system.
[0127] Droplets were prepared using a droplet generation chip (Pengzan Biotechnology, PDMS-FF series microdroplet chip), with an outlet size of 30 μm. The oil phase used for droplet generation was microdroplet generation oil HFE7500 (Pengzan Biotechnology), with a flow rate of 4 μL / min; the aqueous phase was the pre-constructed reaction system, with a flow rate of 2 μL / min. The formed droplets were collected into a reaction tube, and uniform droplet formation was observed under a microscope (Figure 4).
[0128] (4) Isothermal amplification and ligation
[0129] Place the reaction tube containing the collected droplets in a 30°C incubate for 60 minutes.
[0130] (5) Break the droplet
[0131] Add Drop-Surf demulsifier (Pengzan Biotechnology) to the reaction system to break the droplets.
[0132] The reaction product was purified using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions to obtain multiple copies of nucleic acid (=2).
[0133] (6) Nanopore sequencing
[0134] The sequencing adapter complex construction process is shown in Figure 5. Following the manufacturer's instructions, the first strand (top strand) and the second strand (bottom strand) of the sequencing adapter (SEQ ID NO: 9) were dissolved in TE buffer (pH=8) and annealed to form the sequencing adapter. The annealing process involved incubation at 95°C for 5 minutes, followed by cooling to 25°C at a rate of 0.1°C / s, and then incubation for another 30 minutes. The sequence of the first strand of the sequencing adapter is: 5'-XXXXXXXXXXXXXXXXXXXXXXXXXXXXXX-SEQ ID NO: 5-YYYY-SEQ ID NO: 6-3'; where SEQ ID NO: 5's sequence is TTTTTTTTT; and SEQ ID NO: 6's sequence is 5'-GGTTGTTTCTGTTGGTGCTGATATTGCT-3'; X represents iSpC3; and Y represents iSp18.
[0135] Prokaryotic expression of the helicase He(T4Dda-(ΔM1)G1 / E94C / C109A / C136A / K194L / A360C, SEQ ID NO: 7) was completed in *E. coli*, and the target protein was obtained after multi-step purification. The helicase and sequencing adapter were mixed at a molecular ratio of 9:1, and the final concentration of the reaction buffer was 25 mM HEPES, 50 mM KCl, 0.5 mM EDTA, 2.5 mM MgCl2, pH 8.0, and incubated at room temperature for 30 minutes.
[0136] The incubation product was incubated with 0.25 volumes of 5 mM ATP at room temperature for 30 minutes. The sequencing adapter complex was purified using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions. Electrophoresis was performed, and the results are shown in Figure 6, indicating a large quantity of 1:1 sequencing adapter complex was obtained.
[0137] The obtained multi-molecule, multi-copy nucleic acid (=2) was end-repaired using the NEBNext Ultra II End repair / dA-tailing Module (NEB, E7546) according to the manufacturer's instructions. The reaction conditions were 20°C for 10 minutes followed by 65°C for 10 minutes. The end-repaired product was purified using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions.
[0138] Following the manufacturer's instructions, ligate two copies of nucleic acid (=2) to the sequencing adapter complex using T4 DNA ligase (NEB, M0202) and incubate at 25°C for 60 minutes. Purify the sequencing library using AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions.
[0139] A single-channel nanopore detection system was built using patch-clamp and signal amplifier to complete the embedding of a single porin CsgG. The sequencing library and the restraint sequence were mixed and added to the single-channel system. Changes in the current signal were observed and obtained at 180 mV. The sequencing buffer consisted of 470 mM KCl, 25 mM HEPES, 10 mM MgCl2, and 30 mM ATP, pH 8.10. The sequencing temperature was 30 °C. The restraint sequence was 5'-YYYY-SEQ ID NO: 8-3'; SEQ ID NO: 8 was 5'-TTGACCGCTCGCCTC-3'; Y represents iSp18, and the 5' end of the restraint sequence contained cholesterol modification.
[0140] Experimental results: The current signal obtained by sequencing the double-stranded nanopore sequencing of the target nucleic acid was shown in Figure 7. The current signals of the two strands were represented by 1D and 2D, respectively. The average current value and perforation time of the electrical signals of the two sequencing were almost the same.
[0141] From the above description, it can be seen that the above embodiments of the present invention achieve the following technical effects: (1) The present invention can perform multiple sequencing (≥2 times) of the target nucleic acid, thereby improving the sequencing accuracy. (2) The present invention can improve the construction efficiency of multi-copy (≥2) sequencing libraries. (3) When the present invention performs two sequencing of the target nucleic acid, the two copies of the sequencing strand are two consecutive copies of the sense strand or antisense strand of the target nucleic acid sequence. After the sequencing strand passes through the well, there is no situation where the two copies, one from the sense strand and the other from the antisense strand, will rehybridize, and the average current value of the electrical signal and the well speed of different copies will not be affected.
[0142] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A method for constructing a multi-copy nucleic acid library, characterized in that, The construction method includes: The target nucleic acid is amplified isothermally based on droplets to obtain the amplification product; The amplification product is ligated to obtain multiple copies of the target nucleic acid; The droplets are broken up and the released multi-copy target nucleic acids are used to construct the multi-copy nucleic acid library.
2. The construction method according to claim 1, characterized in that, Droplet-based isothermal amplification of the target nucleic acid yields amplification products including: The target nucleic acid and amplification primers are used to perform isothermal amplification under the action of polymerase to obtain the amplification product. The target nucleic acid may or may not have phosphorylation at its 5' end, and the amplification primers may have phosphorylation at their 5' end; or, The target nucleic acid has a phosphorylation modification at its 5' end, while the amplification primer does not have a phosphorylation modification at its 5' end.
3. The construction method according to claim 2, characterized in that, The two ends of the target nucleic acid are not connected to adaptors, and the amplification primers bind to the target nucleic acid; or, The adapter is attached to both ends of the target nucleic acid to obtain the target nucleic acid containing the adapter, and the amplification primer is bound to the adapter.
4. The construction method according to claim 2 or 3, characterized in that, The construction method includes: The target nucleic acid, isothermal amplification components, and ligation components are mixed to obtain the reaction solution for isothermal amplification and ligation. The reaction solution is prepared into water-in-oil droplets, wherein the number of target nucleic acid molecules in a single water-in-oil droplet is ≤1; Isothermal amplification and ligation were performed within the water-in-oil droplet to obtain the multi-copy target nucleic acid. The water-in-oil droplet is broken up and the multi-copy target nucleic acid is purified. The purified multi-copy target nucleic acid is then used to construct the multi-copy nucleic acid library.
5. The construction method according to claim 4, characterized in that, The water-in-oil solution was placed at >0°C and incubated for ≥1 min for isothermal amplification and ligation to obtain the multi-copy target nucleic acid; Preferably, the water-in-oil droplets are prepared using microfluidic droplet generation technology.
6. The construction method according to any one of claims 1-5, characterized in that, The isothermal amplification was performed using polymerase-mediated amplification technology with chain displacement activity, recombinase polymerase amplification technology, or helicase-dependent amplification technology.
7. The construction method according to claim 6, characterized in that, The target nucleic acid is double-stranded target DNA, and the double-stranded target DNA is end-treated to form a primer-binding region with a protruding 3' dangling at the end of the double-stranded target DNA; the amplification primer is then bound to the primer-binding region, and isothermal amplification is performed using polymerase-mediated amplification technology with strand displacement activity.
8. The construction method according to claim 7, characterized in that, The ends of the double-stranded target DNA are processed using any one or more of the following methods to form a primer-binding region with a protruding 3' dangling region: 1) The 3' suspension is obtained by extending the double-stranded target DNA to the 3' end using terminal transferase; 2) Use ligase or transposase to connect the adaptor with the protruding 3' suspension to both ends of the target double-stranded DNA to obtain the 3' suspension; 3) Using primers containing modified nucleotides and a DNA polymerase capable of tolerating the modified nucleotides, amplification is performed using the double-stranded target DNA as a template. Then, a nuclease capable of cutting the modified nucleotides is used to cleave the 5' end of the amplified product, forming a nick at the modified nucleotide position. The cleaved primer fragment dissociates, yielding sticky ends, which are the 3' dangling ends; or 4) The double-stranded target DNA is digested using a 5'-3' exonuclease to obtain the 3' suspension.
9. The construction method according to claim 7 or 8, characterized in that, The amplification primers have phosphorylation at their 5' ends, while the double-stranded target DNA does not have phosphorylation at its 5' end; or The amplification primers do not have phosphorylation at their 5' ends, while the double-stranded target DNA does have phosphorylation at its 5' ends. Preferably, the amplification primers have the nucleotide sequence shown in SEQ ID NO:
4.
10. The construction method according to claim 6, characterized in that, The target nucleic acid is a double-stranded target DNA, and isothermal amplification is performed using the recombinase polymerase amplification technology or the helicase-dependent amplification technology, wherein the 5' end of the amplification primer is phosphorylated, and optionally, the 5' end of the double-stranded target DNA is phosphorylated. Preferably, the amplification primers have the nucleotide sequence shown in SEQ ID NO:
4.
11. The construction method according to claim 3, characterized in that, The target nucleic acid is a target nucleic acid containing an adaptor, and the method for constructing the target nucleic acid containing the adaptor includes: The target nucleic acid is subjected to end repair and the addition of mononucleotide A to obtain the repair product; The repair product is ligated to the adaptor to obtain the target nucleic acid containing the adaptor; Preferably, the target nucleic acid is a double-stranded target DNA, and the adaptor includes a first strand and a second strand; Preferably, the first chain has the nucleotide sequence shown in SEQ ID NO: 2, and the second chain has the nucleotide sequence shown in SEQ ID NO:
3.
12. The construction method according to claim 4, characterized in that, The ligation component includes a ligase and a ligation reaction buffer adapted to the ligase. The ligase is selected from any one or more of the following: T4 DNA ligase, T3 DNA ligase, SplintR ligase, T4 RNA ligase 1, T4 RNA ligase 2, RtcB ligase, or Thermostable 5′App DNA / RNA ligase.
13. The construction method according to claim 4, characterized in that, The isothermal amplification component includes: 1) Amplification primers, recombinase, polymerase, amplification reaction buffer, and dNTPs; 2) Amplification primers, helicase, polymerase, amplification reaction buffer, and dNTPs; or 3) Amplification primers, polymerase with strand displacement activity, amplification reaction buffer, and dNTPs; Preferably, the polymerase described in 1) or 2) is selected from any one or more of the following: Q5 superfidelity DNA polymerase, Taq DNA polymerase, Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu Large Fragment DNA polymerase, Klenow Fragment DNA polymerase, T4 DNA polymerase, T7 DNA polymerase, DNA Polymerase I; Preferably, the polymerase with strand displacement activity described in 3) is selected from any one or more of the following: Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu Large Fragment DNA polymerase, and Klenow Fragment DNA polymerase; Preferably, the amplification reaction buffer is compatible with the selected enzyme; Optionally, the amplification reaction buffer contains an auxiliary reagent to enhance the polymerase extension reaction; Optionally, the auxiliary reagent is selected from any one or more of the following: dimethyl sulfoxide, glycerol, formamide, bovine serum albumin, ammonium sulfate, polyethylene glycol, gelatin, nonionic detergent, N,N,N-trimethylglycine, single-stranded nucleic acid binding protein, dithiothreitol, or ethylenediaminetetraacetic acid.
14. The construction method according to any one of claims 1-13, characterized in that, The droplets are broken up using a demulsifier, releasing the multiple copies of the target nucleic acid.
15. The construction method according to any one of claims 1-14, characterized in that, The multicopy nucleic acid library is a multicopy nucleic acid sequencing library, and the construction method further includes: ligating the multicopy target nucleic acid with a sequencing adapter to obtain the multicopy nucleic acid sequencing library; Preferably, the sequencing adapter is a Y-type adapter.
16. The use of the multicopy nucleic acid library obtained by the method for constructing a multicopy nucleic acid library according to any one of claims 1-15 for sequencing; Preferably, the sequencing is single-molecule sequencing. More preferably, the single-molecule sequencing is single-molecule nanopore sequencing or single-molecule fluorescence sequencing.
17. A method for single-molecule sequencing of a multi-copy nucleic acid library, characterized in that, The method includes: Obtain the multi-copy nucleic acid sequencing library obtained by the construction method according to claim 15; Single-molecule sequencing was performed on the multicopy nucleic acid sequencing library; Preferably, the single-molecule sequencing is single-molecule nanopore sequencing or single-molecule fluorescence sequencing.
18. A kit for constructing a multi-copy nucleic acid library, characterized in that, The kit includes any one of the following isothermal amplification components and an optional ligation component: The isothermal amplification component includes: 1) Amplification primers, recombinase, polymerase, amplification reaction buffer, and dNTPs; 2) Amplification primers, helicase, polymerase, amplification reaction buffer, and dNTPs; or 3) Amplification primers, polymerase with strand displacement activity, amplification reaction buffer, and dNTPs; The ligation component includes a ligase and a ligation reaction buffer adapted to the ligase, wherein the ligase is selected from any one or more of the following: T4 DNA ligase, T3 DNA ligase, SplintR ligase, T4 RNA ligase 1, T4 RNA ligase 2, RtcB ligase, or Thermostable 5′App DNA / RNA ligase.
19. The reagent kit according to claim 18, characterized in that, In the isothermal amplification component 1) or 2), the polymerase is selected from any one or more of the following: Q5 superfidelity DNA polymerase, Taq DNA polymerase, Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu large fragment DNA polymerase, Klenow fragment DNA polymerase, T4 DNA polymerase, T7 DNA polymerase, or DNA Polymerase I.
20. The reagent kit according to claim 18, characterized in that, In the isothermal amplification component 3), the polymerase with strand displacement activity is selected from any one or more of the following: Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu Large Fragment DNA polymerase, and Klenow Fragment DNA polymerase; Preferably, the amplification reaction buffer is compatible with the selected enzyme.
21. The reagent kit according to any one of claims 18-20, characterized in that, The amplification reaction buffer contains auxiliary reagents that enhance the polymerase extension reaction; Preferably, the auxiliary reagent is selected from any one or more of the following: dimethyl sulfoxide, glycerol, formamide, bovine serum albumin, ammonium sulfate, polyethylene glycol, gelatin, nonionic detergent, N,N,N-trimethylglycine, single-stranded nucleic acid binding protein, dithiothreitol, or ethylenediaminetetraacetic acid.
Citation Information
Patent Citations
Clonal pre-amplification in emulsion
CN102311948A
Processes and systems for preparing nucleic acid sequencing libraries and libraries prepared using same
CN107427808A
Methods for constructing copies of nucleic acid molecules
CN110382710A
Construction method and application of sequencing library based on rolling circle amplification
CN113667716A
Nanopore sequencing method and kit
CN118207308A