Ribozyme self-splicing-based residual-sequence-free circular RNA and preparation method therefor

Abstract

Disclosed are a ribozyme self-splicing-based residual-sequence-free circular RNA, and a preparation method therefor, belonging to the field of molecular biology. The circular RNA is prepared from a DNA molecule, the DNA molecule comprising elements operably linked and arranged in the following order from 5' to 3': a promoter; a poly X fragment containing for or more identical consecutive bases; a type I intron fragment; and a target fragment. The type I intron ribozyme can initiate cleavage in a single-step transesterification reaction, such that a linear RNA transcribed from the DNA molecule is configured to self-circularize to generate the circular RNA, and the circular RNA contains only the RNA corresponding to the target fragment, thereby avoiding the additional use of wild-type exon residues at both ends of the intron known to promote cleavage, and not leaving any exon sequence residues. This solves the technical problem in the prior art of residual exons in circular RNA. The circular RNA can be used for disease diagnosis and treatment.

Description

A residual sequence-free circular RNA based on ribozyme self-splicing and its preparation method Cross-referencing

[0001] This application claims priority to Chinese patent application No. 202411203897.8, filed on August 29, 2024, the entire contents of which are incorporated herein by reference. Technical Field

[0002] This specification relates to the field of molecular biology, and in particular to a residual sequence-free circular RNA based on ribozyme self-splicing and its preparation method. Background Technology

[0003] Circular RNAs (RNAs) are a class of closed circular RNAs widely found in animals and plants. In recent years, with the development and improvement of new transcriptome sequencing technologies and the continuous evolution of corresponding computational biology analysis protocols, hundreds of thousands of exon-splicing (or cleaving) circular RNAs have been discovered in eukaryotes. These circular RNAs can act as molecular sponges for miRNAs and proteins, influence transcription, interfere with the normal splicing of mRNA precursors, regulate mRNA translation, form circular RNA-protein complexes, and competitively bind proteins to mRNA, participating in biological processes such as immunity, metabolism, nervous system development, and reproduction.

[0004] Because circular RNA has a relatively stable structure, and because it utilizes cap-independent transcription initiation elements such as internal ribosome binding sites (IRES), it can be used as a protein expression vector to be directly introduced into cells to achieve long-term expression of target proteins.

[0005] Currently, the mainstream approach for synthesizing circular RNA in vitro is based on the self-cleavage and circularization scheme of type I or type II intron ribozymes (PIE). Due to their unique structure, it is usually necessary to retain the exon linkers at both ends of the intron or to design the target circularization sequence to achieve an efficient in vitro cleavage-circularization process. These designs depend on the specific characteristics of the target sequence (also known as the target fragment). Especially for short non-coding circular RNA sequences, it is difficult to mimic the wild-type exon linker, often requiring the retention of additional exon linkers, resulting in a scar sequence (SCAR sequence) after circularization. The residual scar sequence is generally considered to increase immunogenicity or relatively alter the secondary structure of the circular RNA, thereby affecting its physiological function.

[0006] In addition, PIE self-cleavage circularization schemes based on type I or type II intron ribozymes usually require two affinity attack reactions to cleave intron fragments to obtain circular RNA. The mixture after the reaction contains in vitro transcription precursors, first cleavage intermediates, circular RNA, different intron fragments, and linear molecules of circular RNA that have broken and opened. Purifying circular RNA from the reaction mixture is a major challenge from the laboratory level to clinical therapeutic molecular applications.

[0007] Therefore, it is desirable to provide a method for the efficient one-step synthesis of circular RNA without exon and scar sequence residues in vitro. Summary of the Invention

[0008] This specification provides one or more embodiments of a DNA molecule for preparing circular RNA, comprising elements operatively linked and arranged from 5' to 3' in the following order: a promoter; a poly X fragment containing more than 5 identical consecutive bases, where X represents any one of the bases A, T, C, or G; a type I intron fragment; and a target fragment; wherein the type I intron ribozyme is capable of initiating cleavage in a one-step transesterification reaction, such that the linear RNA transcribed from the DNA molecule is configured to self-circulate to produce circular RNA containing only the RNA corresponding to the target fragment.

[0009] This specification provides one or more embodiments of a recombinant expression vector comprising the DNA molecule described above.

[0010] This specification provides one or more embodiments of a circular RNA prepared from a DNA molecule as described above.

[0011] This specification provides one or more embodiments of a method for preparing circular RNA based on the above-described DNA molecule, the method comprising:

[0012] An in vitro transcription reaction was performed to obtain linear RNA based on the DNA molecule. After transcription, a modified base X-NTP was added to the 3' end of the linear RNA via ligation. In the X-NTP, X represents a modifying group, and N is any base of A, U, C, or G. The X-NTP includes fluorescein isothiocyanate-12-NTP, biotin-16-NTP, biotin-11-NTP, digoxigenin-11-NTP, D-dethiobiotin-NTP, 5-methoxy-NTP, 5-hydroxy-NTP, 5-carboxyl-NTP, 5-formyl-NTP, dethiobiotin-16-NTP, 5-carboxymethyl ester-NTP, 5-hydroxymethyl-NTP, N1-methylpseudo-NTP, and 3... One or more of the following: '-O-methyl-NTP, 5-bromo-NTP, 2'-O-methyl pseudo-NTP, 6-aza-NTP, 5,6-dihydro-NTP, Ara-NTP, 2-thio-NTP, aminoallyl-NTP, thieno-NTP, 5-iodo-NTP, FAM-NTP, VIC-NTP, HEX-NTP, Cy3-NTP, JOE-NTP, Cy5-NTP, ROX-NTP, Cy5.5-NTP, Cy7-NTP, TAMRA-NTP, Texas red-NTP, TET-NTP, NED-NTP; and self-circularizing the linear RNA to produce the circular RNA containing only the RNA corresponding to the target fragment.

[0013] The preparation of circular RNA using the DNA molecules provided in the embodiments of this specification contains only the RNA corresponding to the target fragment. This avoids the additional use of wild-type exon residues at both ends of introns known to promote splicing, thus eliminating exon and scar sequence residues and effectively preventing structural changes or increased immunogenicity of the circular RNA. Attached Figure Description

[0014] This specification will be further described by way of exemplary embodiments, which will be described in detail with reference to the accompanying drawings. These embodiments are not limiting; in these embodiments, the same reference numerals denote the same structures, wherein:

[0015] Figure 1 is a schematic sequence of the T7 promoter, SP6 promoter and T3 promoter according to some embodiments of this specification;

[0016] Figure 2 is a schematic diagram of the full-length secondary structure of wild-type Tetrahymena thermophila type I intron RNA according to some embodiments of this specification;

[0017] Figure 3 is a schematic diagram of the secondary structure of the reverse sequence of mmu_circ_0001254 according to some embodiments of this specification;

[0018] Figure 4 is a schematic diagram of the secondary structure of the mmu_circ_0001254 sequence after artificial design of the connector according to some embodiments of this specification;

[0019] Figure 5 is a schematic diagram of the connector design of mmu_circ_0001254 according to some embodiments of this specification;

[0020] Figure 6 is a schematic diagram of a DNA molecule containing artificially designed Tetrahymena thermophila type I introns for forming circular RNA, according to some embodiments of this specification.

[0021] Figure 7 is a schematic diagram of the secondary structure of linear RNA transcribed from DNA molecules, as shown in some embodiments according to this specification;

[0022] Figure 8 is a gel electrophoresis result of RNase R tolerance verification of the cyclized products shown in some embodiments of this specification;

[0023] Figure 9 is a gel electrophoresis result of RT-PCR verification of the cyclized products shown in some embodiments of this specification;

[0024] Figure 10 is a diagram of adapter sequencing according to some embodiments of this specification;

[0025] Figure 11 is a gel electrophoresis result of RNase R tolerance verification of Cy5-UTP-labeled cyclized products according to some embodiments of this specification;

[0026] Figure 12 is a schematic diagram of the secondary structure of the mmu_circ_0007509 sequence according to some embodiments of this specification and the mmu_circ_0007509 sequence after designing connector schemes 1 and 2;

[0027] Figure 13 is a schematic diagram of a cyclic framework formed by the combination of type I introns of Anabaena according to some embodiments of this specification;

[0028] Figure 14 is a gel electrophoresis result of the cyclization product of the mmu_circ_0007509 linker scheme shown in some embodiments of this specification;

[0029] Figure 15 is a gel electrophoresis result of cyclized products with 0.1% and 5% Cy5-UTP incorporated according to some embodiments of this specification;

[0030] Figure 16 is a gel electrophoresis result of RNase R tolerance verification of Cy5-UTP-labeled cyclized products according to some embodiments of this specification;

[0031] Figure 17 is a schematic diagram of the circularized framework of two adapter sequence selection methods based on the CVB3-GFP of Anabaena type I introns according to some embodiments of this specification.

[0032] Figure 18 is a schematic diagram of a ring-shaped architecture for two connector types designed on the IRES of CVB3 according to some embodiments of this specification; and

[0033] Figure 19 is a gel electrophoresis result of the cyclized products generated from plasmids circCVB3-GFP-pure-01 and circCVB3-GFP-pure-02, as shown in some embodiments of this specification. Detailed Implementation

[0034] To more clearly illustrate the technical solutions of the embodiments in this specification, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are merely some examples or embodiments of this specification. For those skilled in the art, these drawings can be applied to other similar scenarios without creative effort. Unless obvious from the context or otherwise specified, the same reference numerals in the drawings represent the same structures or operations.

[0035] As indicated in this specification and claims, unless the context clearly indicates otherwise, the words "a," "an," "an," and / or "the" are not specifically singular and may include the plural. Generally speaking, the terms "comprising" and "including" only indicate the inclusion of explicitly identified steps and elements, which do not constitute an exclusive list; for example, a method may also include other steps.

[0036] Circular RNAs (RNAs) are a class of single-stranded, closed RNA molecules produced from mRNA precursors through alternative splicing (AS, exon circularization, or intron circularization). Endogenous circular RNAs include both coding and non-coding RNAs, lacking a 5' cap and a 3' poly-A tail, and thus lacking free ends. Therefore, they are less susceptible to degradation by exonucleases and are more stable than linear RNAs. In-depth research on circular RNAs relies heavily on their in vitro preparation to further validate their biological functions, and in vitro circularization is a crucial process in this regard.

[0037] Currently, common methods for synthesizing circular RNA in vitro using linear RNA as a precursor involve chemical ligation, enzymatic ligation, or ribozyme splicing to connect the ends of two exons, forming a covalently closed circular structure. However, these methods retain some exon adapters, resulting in scar sequences after circularization. These residual scar sequences are generally considered to increase immunogenicity or relatively alter the secondary structure of the target circular RNA, thus affecting its physiological function. This specification provides a circular RNA free of exon and scar sequence residues (also referred to as sequence-residual-free or residue-free), containing only the RNA corresponding to the target fragment (e.g., a DNA fragment encoding the target protein), effectively avoiding structural changes or increased immunogenicity of the target circular RNA. Specifically, based on the recognition characteristics of type I intron ribozymes, without altering the target fragment sequence, suitable adapter sequences are selected from the target sequence to achieve the necessary conditions for ribozyme recognition and cleavage (or splicing). This avoids the additional use of wild-type exon residues at the ends of introns known to promote cleavage, thereby enabling precise synthesis of circular RNA using biological methods.

[0038] One embodiment of this specification provides a DNA molecule for preparing circular RNA, comprising elements operatively linked and arranged from 5' to 3' in the following order: a promoter; a poly X fragment; a type I intron fragment; and a target fragment.

[0039] As used in this article, a "promoter" is a DNA sequence that RNA polymerase recognizes, binds to, and initiates transcription of. It contains conserved sequences required for RNA polymerase-specific binding and transcription initiation, and most are located upstream of the transcription start site of structural genes. The promoter itself is not transcribed.

[0040] In some embodiments, the promoter element is one of the T7 promoter, T3 promoter, and SP6 promoter.

[0041] In some embodiments, to achieve exon-free circular RNA, the selected promoter must satisfy the condition that the third base from the 5' to the 3' end of the sequence transcribed from the transcription start site into the linear RNA is G, i.e., +3 base is G. This sequence can be represented as nnG, where n can be any base among A, T, C, and G. This is merely an example and should not be taken as a limitation; nnG in the T7 promoter can be GGG; nnG in the T3 promoter can be GGG; and nnG in the SP6 promoter can be GAG.

[0042] Figure 1 shows schematic sequences of the T7, SP6, and T3 promoters. As shown in Figure 1, the +1 base (i.e., the first n) is the transcription start site. The sequence transcribed into the linear RNA from the transcription start site is the sequence from +1 to +3 bases (i.e., the last G) (i.e., the transcription start sequence). These sequences are transcribed to the 5' end of the linear RNA during transcription, while the promoter sequence preceding these sequences is not transcribed. It should be noted that the promoter sequences shown in Figure 1 are for illustrative purposes only.

[0043] As used herein, a "poly X fragment" refers to a nucleic acid sequence consisting of a predetermined number of identical consecutive bases X. Here, X represents any of the bases A, T, C, and G. The poly X fragment is located between the promoter and the intron fragment. In some embodiments, the poly X fragment contains 5-80 identical consecutive bases. In some embodiments, the poly X fragment contains 5-70 identical consecutive bases. In some embodiments, the poly X fragment contains 5-60 identical consecutive bases. In some embodiments, the poly X fragment contains 15-50 identical consecutive bases. In some embodiments, the poly X fragment contains 15-35 identical consecutive bases. In some embodiments, the poly X fragment is a poly A fragment.

[0044] The structure (nnG) whose last base near the 3' end is G in the sequence transcribed from the transcription start site into RNA can combine with the poly X fragment structure to form a universal and strong internal guiding sequence (IGS), thereby promoting splicing.

[0045] As used in this article, Group I introns are a class of introns (ribozymes) capable of self-cleavage. After transcription, these introns form a specific secondary structure with nine cores formed by base pairing, designated as P1 to P9 domains. Group I introns possess GTP and Mg... 2+ A self-splicing system is a system that undergoes self-splicing (or self-splicing) to form a ring under certain conditions. In the self-splicing reaction, a guanine nucleoside (containing a free 3'-OH) G-OH is required. G initially binds to the 5' end of the intron. When the linear intron becomes circular, its 3' end can be 15 nucleotides away from the 5' end, thus severing the original 5' end and a segment of 15 bases (or more) (including G). This self-splicing is catalyzed by the activity of endonucleases specific to the RNA sequence.

[0046] In some embodiments, type I introns include various types, such as IC1, IC2, IC3, IA2, etc. For example, type I introns of type IC1 include, but are not limited to, introns from the genera *Tetrahymena* sp., *Pneumocystis* sp., and *Neurospora* sp. (e.g., *Neurospora crassa*). In some embodiments, type I introns include, but are not limited to, introns from *Tetrahymena thermophila*, *Tetrahymena cosmopolitanis*, *Tetrahymena hyperangularis*, *Tetrahymena malaccensis*, and *Tetrahymena pigmentosa*. In some embodiments, type I introns can be type I introns of *Tetrahymena thermophila* group I intron. Type I introns of IC3 include, but are not limited to, one or more type I introns from the genera *Anabaena*, *Azoarcus*, *Glaucophyte*, *Synechococcus*, and *Prochlorothrix*. In some embodiments, type I introns of IC3 may include introns from *Anabaena* sp. PCC7120, *Anabaena variabilis* ATCC 29413, *Azoarcus* sp. BH72, *Cyanophora paradoxa*, *Synechococcus* sp. PCC 6301, and *Prochlorothrix hollandica*. In some embodiments, the type I intron can be an Anabaena group I intron. In some embodiments, the type I intron of IC3 can also be derived from type I introns of maize (Zea mays) or tobacco (Nicotiana tabacum).

[0047] The type I introns used in this invention consist of the P2 to P9 domains of wild-type introns. For IC1 and IC3 introns, the nnG sequence and a portion (e.g., the first 2-7 bases) of the poly X sequence (e.g., poly A) form a new universal and strong IGS, namely NNNNNG (where N represents any base of A, T, C, or G), which can then form an artificial P1 domain (where n represents any base of A, U, C, or G) with the 3' end of the transcript. It should be noted that NNNNNG and nnnnnu are only used to illustrate and describe the principles of this invention and are not intended to limit the length of the sequence; they can be any length that can be used to implement the technical solution of this invention within the art.

[0048] As used herein, "target fragment" refers to a DNA sequence or non-coding sequence containing a coding function. In some embodiments, the target fragment is a target DNA sequence encoding a target peptide. In some embodiments, the target peptide is a target protein. A target protein refers to a specific protein molecule of interest, study, analysis, or treatment. In some embodiments, the target fragment is an open reading frame encoding a protein (e.g., green fluorescent protein). In some embodiments, the target fragment is an open reading frame less than 5 kb in length. In some embodiments, the target fragment is an open reading frame less than 3 kb in length. In some embodiments, the target fragment is an open reading frame less than 2 kb in length. In some embodiments, the non-coding sequence is a naturally occurring circular RNA sequence in a cell.

[0049] To facilitate linear RNA cleavage and circularization, resulting in residue-free circular RNA, adapter sequences for the target fragment are selected based on the characteristic of type I introns recognizing the exon sequence recognition site. The adapter sequence is located on the target fragment and is used to join and circularize with the type I intron after self-cleavage during the formation of the circular RNA. Specifically, the DNA molecule includes a first adapter sequence and a second adapter sequence. The first adapter sequence is located at the 3' end of the target fragment, and the second adapter sequence is located at the 5' end of the target fragment. Thus, after cleavage of the type I intron, the circular RNA contains only the RNA corresponding to the target fragment.

[0050] To achieve exon-free circular RNA and ensure the self-splicing function of type I introns, the selection of the adapter sequence must meet certain criteria. Specifically, for all type I introns, the first adapter sequence must meet the following criteria: the last nucleotide of the RNA corresponding to the first adapter sequence is U, forming a G·U wobble pairing with the third base G near the 3' end of the sequence transcribed from the transcription start site into the RNA. The formation of circular RNA involves specific splicing events, including type I intron ribozyme-mediated self-splicing. G·U wobble pairing plays a crucial role in type I intron-based self-splicing, facilitating the accurate identification of the 5' splice site. Its stable formation of the P1 domain provides the necessary structural features for 3' splicing, thereby helping the spliceosome recognize and accurately ligate to the splice site (or cleavage site), promoting self-splicing.

[0051] For different types of type I introns, the first and second adapter sequences can also have other selection criteria. For type I introns of type IC1, optionally, the selection criteria for the first adapter sequence may also include: the percentage of A and U in the RNA sequence corresponding to the first adapter sequence relative to the total number of bases in the first adapter sequence is greater than a first preset value. The first preset value can be 30%, 40%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, etc. The more enriched the RNA corresponding to the first adapter sequence is in terms of nucleotides A and U, the higher the cleavage efficiency. It should be noted that this condition is not mandatory, and the first adapter sequence may also lack the base A. For type I introns of type IC3, the selection criteria for the first and second adapter sequences may also include: the RNA corresponding to the first adapter sequence and the second adapter sequence forms a complementary structure, wherein at least two base pairs in the complementary structure are completely complementary. In some embodiments, the complementary structures formed by the RNA corresponding to the first adapter sequence and the second adapter sequence have 2-4, 3-5, 4-9, 6-12, 8-12, and 2-12 base pairs that are completely complementary. In some embodiments, the complementary structures formed by the RNA corresponding to the first and second adapter sequences have 8-10 completely complementary base pairs. The more complementary base pairs in the complementary structure, the higher the cleavage efficiency. In some embodiments, the complementary structures formed by the RNA corresponding to the first and second adapter sequences have 10 completely complementary base pairs.

[0052] In some embodiments, the target fragment includes translation initiation elements, which include: IRES sequences, 5'UTR sequences, Kozak sequences, and sequences containing m 6 One or more of the following: A-modified sequences, complementary sequences of 18S ribosomal rRNA.

[0053] Translation initiation elements are any sequence elements capable of recruiting ribosomes to initiate the translation process of RNA molecules. In some embodiments, translation initiation elements can also be any other type of cap-independent translation initiation element.

[0054] In some embodiments, the translation initiation element may be an IRES sequence. An IRES sequence is an internal ribosome entry site (IRES) sequence, wherein the IRES sequence is transcribed into an RNA molecule capable of recruiting ribosomes for translation to obtain the target peptide.

[0055] In some embodiments, the IRES sequence is selected from: Taura syndrome virus, blood-sucking assassin bug virus, Tyrell's encephalomyelitis virus, simian virus 40, red imported fire ant virus 1, grain constrictor aphid virus, reticuloendotheliosis virus, Forman poliovirus 1, soybean inchworm virus, Kashmir wasp virus, human rhinovirus 2, glass leafhopper virus-1, human immunodeficiency virus type 1, glass leafhopper virus-1, and lice P virus (Himetobi P) Hepatitis virus (HiPV), Hepatitis C virus, Hepatitis A virus, GB virus, Foot-and-mouth disease virus, Human enterovirus 71, Equine rhinovirus, Tea geometrid moth-like virus, Encephalomyocarditis virus (EMCV), Drosophila C virus, Tobacco crucifera virus, Cricket paralysis virus, Bovine viral diarrhea virus 1, Black queen cell virus, Aphid lethal paralysis virus, Avian encephalomyelitis virus, Acute bee paralysis virus, Hibiscus rotundus virus, Classical swine fever virus, Human FGF2, Human SFTPA1, Human AML1 / RUNX1, Drosophila antennae and legs, Human AQP4, Human AT1R, Human BAG-1, Human BCL2, Human BiP, Human c-IAP1, Human c-myc, Human eIF4G, Mouse NDST4L, Human LEF1, mouse HIF1α, human n.myc, mouse Gtx, human p27kipl, human PDGF2 / c-sis, human p53, human Pim-1, mouse Rbm3, Drosophila reaper, canine scamper, Drosophila Ubx, salivary viruses, Coxsackieviruses, bi-Echoviruses, human UNR, mouse UtrA, human VEGF-A, human XIAP, Drosophila hairless, Saccharomyces cerevisiae TFIID, Saccharomyces cerevisiae YAP1, human c-src, human FGF-1, simian microRNA virus, turnip shrunkenness virus, aptamers of eIF4G, Coxsackievirus B1 (CVB1), Coxsackievirus B2 (CVB2), or Coxsackievirus B3 (CVB3).

[0056] In some embodiments, the IRES sequence is selected from Coxsackievirus B3 (CVB3).

[0057] In some embodiments, the translation initiation element can be a 5' UTR sequence. A 5' UTR sequence refers to a 5' untranslated region sequence.

[0058] In some embodiments, the translation initiation element can be a Kozak sequence. The Kozak sequence is a nucleic acid sequence located after the 5' cap structure of eukaryotic mRNA, which can bind to translation initiation factors to mediate the translation initiation of mRNA containing the 5' cap structure.

[0059] In some embodiments, the translation initiation element may be a component containing m 6 A-modified sequence. Contains m 6 A-modified sequences refer to sequences containing m 6 A (N6-methyladenine) modified sequence.

[0060] In some embodiments, the translation initiation element can be a complementary sequence of ribosomal 18S rRNA. A complementary sequence of ribosomal 18S rRNA refers to the corresponding sequence formed with the base sequence on the 18S rRNA according to the base complementarity pairing principle (A and T are complementary, C and G are complementary).

[0061] In some embodiments, the target fragment comprises at least one open reading frame, each open reading frame independently encoding any type of target peptide, and the circular RNA is capable of tandemly encoding one or more (e.g., 1-10) target peptides. For example, the circular RNA expresses 1, 2, 3, 4, 5, 10, or other numbers of target peptides.

[0062] In linear DNA, the first and second adapter sequences can be selected from open reading frames (OPFs) or translation initiation elements in the target fragment. In some embodiments, when the first and second adapter sequences are located on the OPF, the translation initiation element divides the target fragment into a first OPF and a second OPF in a 5' to 3' direction, with the first adapter sequence located at the 3' end of the second OPF and the second adapter sequence located at the 5' end of the first OPF. That is, in this case, the order of elements from the 5' end to the 3' end is promoter, poly X, type I intron, first OPF, translation initiation element, and second OPF.

[0063] In some embodiments, when the first and second connector sequences are located on the translation initiation element, the open reading frame divides the translation initiation element into a first translation initiation element and a second translation initiation element in a 5' to 3' direction, with the first connector sequence located at the 3' end of the second translation initiation element and the second connector sequence located at the 5' end of the first translation initiation element. That is, in this case, the arrangement order of the elements from the 5' end to the 3' end is promoter, poly X, type I intron, first translation initiation element, open reading frame, and second translation initiation element.

[0064] In in vitro transcription, linear RNA transcribed from DNA molecules can undergo a one-step transesterification reaction under the action of type I intron ribozymes, initiating splicing at the splice site. This allows the linear RNA transcribed from the linear DNA molecules to be configured to self-circulate to produce circular RNA. This circular RNA contains only the RNA corresponding to the target fragment and is characterized by high efficiency, low cost, no additional sequence residues, and stability.

[0065] As used in this article, "linear RNA" refers to a precursor of circular RNA that can form circular RNA through a cyclization reaction, typically transcribed from linear DNA molecules. Further details regarding the one-step transesterification reaction and the formation of circular RNA can be found in the descriptions below.

[0066] In the embodiments of this specification, to effectively promote RNA circularization, a circular framework (i.e., a DNA molecule) is formed by combining a promoter, a poly X structure, a type I intron, and a target fragment with designed adapters (a first adapter sequence and a second adapter sequence), providing a DNA molecule capable of preparing circular RNA. The last nucleotide of the first adapter sequence in this DNA molecule is T, causing the last nucleotide U at the 3' end of the linear RNA transcribed from the DNA molecule to form a G·U swing pair with the last base G near the 3' end of the sequence transcribed from the transcription start site into the RNA in the promoter. Simultaneously, utilizing the universal and strong IGS (Neuron-Neuron-Negative) sequence, an artificial P1 domain can be formed with the 3' end of most transcription products, thereby configuring the linear RNA to self-circulate to produce stable circular RNA without additional sequence residues. The cleavage site is located between the 3' end of the RNA fragment transcribed from the type I intron fragment and the RNA fragment corresponding to the second adapter sequence. Furthermore, the more stable the artificial P1 domain, the higher the cleavage efficiency; the more enriched the nucleotides A and U are in the RNA corresponding to the first adapter sequence, the higher the cleavage efficiency. By designing adapter sequences at the ends of target fragments to replace exons so that ribozymes can recognize them, there is no need to introduce additional exon sequences into DNA molecules. This eliminates the need for these additional exon sequences in circular RNA, thereby improving the sequence accuracy of circular RNA molecules.

[0067] This specification analyzes the recognition characteristics and cyclization principles of different type I intron ribozymes. For different type I intron ribozymes, different schemes are used to artificially establish recognition sequences to achieve cleavage and cyclization, thus achieving the advantage of no exon sequence residue.

[0068] One embodiment of this specification provides a recombinant expression vector comprising the DNA molecule described above.

[0069] As used herein, a "vector" refers to a tool used to carry, replicate, and express exogenous DNA or RNA molecules. In the context of transcription in this article, a vector is a molecule used to carry exogenous DNA fragments and to carry out a transcriptional reaction in the cell to produce RNA.

[0070] Vectors are typically circular DNA molecules, such as plasmids or viruses (e.g., adenovirus, adeno-associated virus), granules, bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), etc. These vectors have the ability to self-replicate and can replicate independently within cells. They can also carry foreign genes, such as protein-coding genes and RNA genes.

[0071] In some embodiments, the vector backbone of the recombinant expression vector includes, but is not limited to, plasmid vectors, eukaryotic cell expression vectors, lentiviral vectors, adenovirus vectors, or adeno-associated virus vectors.

[0072] In some embodiments, the vector may be designed to contain specific promoters, regulatory elements, and terminators to enable the carried foreign DNA to be transcribed and produce RNA within the cell. These RNA molecules may be protein-coding mRNA or other non-coding RNA.

[0073] In some embodiments, an in vitro transcription template can be obtained based on a vector comprising DNA molecules as described above, and circular RNA can be formed in an in vitro transcription reaction based on the in vitro transcription template.

[0074] In vitro transcription templates can be obtained in various ways. For example, they can be obtained directly through artificial in vitro synthesis. In some embodiments, in vitro transcription templates can be obtained by constructing plasmids for PCR amplification or by digesting plasmids with restriction endonucleases.

[0075] One embodiment of this specification provides a circular RNA prepared from a DNA molecule as described above.

[0076] In some embodiments, one or more bases in the circular RNA are modified bases, denoted as X-NTPs, where N is any base of A, U, C, or G, and X represents a modifying group. The X-NTPs include FITC-12-NTP, biotin-16-NTP, biotin-11-NTP, digoxigenin-11-NTP, D-desthiobiotin-NTP, 5-methoxy-NTP, 5-hydroxy-NTP, 5-carboxy-NTP, 5-formyl-NTP, desthiobiotin-16-NTP, 5-carboxymethylester-NTP, 5-hydroxymethyl (hme)-NTP, and N1-methylpseudo(N-methyl)-NTP. One or more of the following: Methylpseudo-NTP, 3'-O-methyl (Methyl)-NTP, 5-bromo (Br)-NTP, 2'-O-methyl pseudo (Methylpseudo)-NTP, 6-aza (Aza)-NTP, 5,6-dihydro (Dihydro)-NTP, Ara-NTP, 2-thio (Thio)-NTP, Aminoallyl (Aminoallyl)-NTP, Thieno (Thieno)-NTP, 5-iodo (Iodo)-NTP, FAM-NTP, VIC-NTP, HEX-NTP, Cy3-NTP, JOE-NTP, Cy5-NTP, ROX-NTP, Cy5.5-NTP, Cy7-NTP, TAMRA-NTP, Texas Red (Texas Red)-NTP, TET-NTP, and NED-NTP. In some embodiments, the circular RNA may contain a modified base located at the 3' end of the linear RNA (e.g., 1-20 nt at the 3' end). In some embodiments, the modified base may be X-UTP.

[0077] Modification of the modifying group can be categorized into random modification and site-specific modification. Random modification typically involves transcriptional involvement and post-transcriptional or post-cyclization modification. Transcriptional involvement modification has been demonstrated in the examples, where the modifying group is chemically linked after transcription or cyclization (e.g., using the Mirus Label IT nucleic acid modification kit). Site-specific modification is divided into transcriptional site-specific modification and post-transcriptional site-specific modification. Transcriptional site-specific modification can employ position-specific labelling of RNA (PLOR). In this invention, post-transcriptional site-specific modification involves linking an oligonucleotide with a modified base at the 3' end (e.g., 1-20 nt) before cyclization. Note: nt represents nucleotide; bp represents base pair.

[0078] In the circular RNA prepared in this specification, by linking modified bases, the circular RNA can be coupled to other molecules (e.g., small molecule drugs) via the X group to achieve the treatment of diseases.

[0079] The circular RNA of this invention does not contain any additional introduced exon sequences and contains modified bases. It has high sequence precision, minimal changes in secondary structure, high biosafety and structural stability, and low immunogenicity, making it suitable for clinical disease diagnosis and treatment.

[0080] The PIE system-I intron self-splicing separates the RNA intron and auxiliary exon fragments into two parts. The 5' end sequence of the intron is transferred to the tail of the target sequence, and the 3' sequence is inserted at the front of the target sequence. In the presence of GTP, the 3'-hydroxyl group of GTP attacks the splice site located at the 5' end of the intron sequence. The splice site exposes newly generated 3'-free hydroxyl groups, which further attack the splice site located at the 3' end of the intron sequence, generating circular RNA. This circular RNA will remain at the exon ends.

[0081] In other words, the splicing reaction involved in the type I intron PIE system occurs through a two-step transesterification reaction, requiring no energy. In the first transesterification reaction, the 3'-hydroxyl group of the cofactor guanosine or the 2'-hydroxyl group inside the intron sequence acts on the 5' end of the intron. In the second transesterification reaction, the 3'-hydroxyl group generated at the end of the first exon acts on the splice site between the intron and the second exon. Furthermore, this PIE structure leads to self-circularization of sequences other than the introns, reducing the sequence precision of the circular RNA, increasing its innate immunogenicity, and making it more susceptible to degradation within cells.

[0082] The DNA molecule of this invention forms a hydroxyl group at the 3' end of the RNA sequence corresponding to the target fragment transcribed in the in vitro transcription reaction. This hydroxyl group can initiate splicing at the splice site in a one-step transesterification reaction, enabling the linear RNA to self-circulate to produce circular RNA. The splice site is located between the RNA fragment transcribed from the intron fragment and the RNA corresponding to the target fragment (second linker) generated by the DNA molecule in the in vitro transcription reaction. Circulation is achieved in a single transesterification step, eliminating the need for additional attack steps and reducing the number of circularization steps required to obtain circular RNA.

[0083] In some embodiments, the 3' end of the target fragment is configured to generate a hydroxyl group during an in vitro transcription reaction. This hydroxyl group can initiate splicing at the splice site during a one-step transesterification reaction, thereby configuring the linear RNA to self-circulate to produce circular RNA.

[0084] The embodiments in the specification provide a DNA molecule capable of preparing circular RNA by combining a promoter, a poly X structure, a type I intron fragment, and a target fragment (containing a first adapter sequence and a second adapter sequence) to form a circular framework. Linear RNA obtained based on this DNA molecule can undergo a one-step transesterification reaction under optimized circularization conditions, generating stable circular RNA without additional sequence residues while ensuring circularization efficiency.

[0085] Specifically, one embodiment of this specification provides a method for preparing circular RNA based on the DNA molecule described above. The method includes: performing an in vitro transcription reaction to obtain linear RNA based on the DNA molecule, wherein, after transcription, a modified base X-NTP is added to the 3' end of the linear RNA by a ligation method (e.g., enzymatic method, chemical synthesis method), wherein X in the X-NTP represents a modifying group, and N is any base of A, U, C, or G. The X-NTP includes fluorescein isothiocyanate-12-NTP, biotin-16-NTP, biotin-11-NTP, digoxigenin-11-NTP, D-dethiobiotin-NTP, 5-methoxy-NTP, 5-hydroxy-NTP, 5-carboxyl-NTP, 5-formyl-NTP, dethiobiotin-16-NTP, 5- One or more of the following: carboxymethyl ester-NTP, 5-hydroxymethyl-NTP, N1-methyl pseudo-NTP, 3'-O-methyl-NTP, 5-bromo-NTP, 2'-O-methyl pseudo-NTP, 6-aza-NTP, 5,6-dihydro-NTP, Ara-NTP, 2-thio-NTP, aminoallyl-NTP, thieno-NTP, 5-iodo-NTP, FAM-NTP, VIC-NTP, HEX-NTP, Cy3-NTP, JOE-NTP, Cy5-NTP, ROX-NTP, Cy5.5-NTP, Cy7-NTP, TAMRA-NTP, Texas red-NTP, TET-NTP, and NED-NTP; and self-circularizing the linear RNA to produce the circular RNA containing only the RNA corresponding to the target fragment.

[0086] In some embodiments, DNA molecules can be produced through in vitro synthesis.

[0087] In some embodiments, DNA molecules can be generated by constructing a recombinant plasmid containing a DNA molecule sequence, and using the recombinant plasmid as a template, performing PCR amplification to prepare an in vitro transcription template.

[0088] In some embodiments, the DNA molecule may be generated by digestion of a recombinant plasmid with a Type II restriction endonuclease; in some embodiments, the DNA molecule may be generated by digestion of a recombinant plasmid with a Type IIs restriction endonuclease.

[0089] Recombinant plasmids can be constructed using a variety of methods. In some embodiments, recombinant plasmids can be constructed using a seamless cloning method.

[0090] In some embodiments, the reaction temperature of the in vitro transcription reaction is 30℃-50℃, and the reaction time of the in vitro transcription reaction is 0.5-3h.

[0091] In some embodiments, the reaction temperature of the in vitro transcription reaction is 30°C-40°C. In some embodiments, the reaction temperature of the in vitro transcription reaction is 40°C-50°C. In some embodiments, the reaction temperature of the in vitro transcription reaction is 37°C, 40°C, or 50°C. In some embodiments, the reaction temperature of the in vitro transcription reaction is 37°C. In some embodiments, the reaction time of the in vitro transcription reaction is 0.5h-3h. In some embodiments, the reaction time of the in vitro transcription reaction is 0.75h-3h. In some embodiments, the reaction time of the in vitro transcription reaction is 0.5h, 0.75h, 1h, 1.5h, 1.75h, 2h, or 3h. In some embodiments, the reaction time of the in vitro transcription reaction is 2h. In some embodiments, the reaction time of the in vitro transcription reaction is 3h.

[0092] In some embodiments, the in vitro transcription reaction includes: preparing a mixture in an in vitro transcription system to obtain a mixed mixture; and performing an in vitro transcription reaction of the mixed mixture at 37°C for 2-3 hours to obtain a reaction product.

[0093] In some embodiments, the mixture comprises: a nucleotide mixture consisting of ATP, CTP, GTP, and UTP, DNA molecules, 10× transcription buffer, RNA polymerase, and nuclease-free water.

[0094] In some embodiments, ATP, CTP, GTP, and UTP may be partially or completely replaced by 1-4 modified NTPs (i.e., X-NTPs). Specifically, the mixture may include X-NTPs. In some embodiments, X-NTPs may be present with ATP, CTP, GTP, or UTP in a certain concentration ratio (e.g., 1:4). In some embodiments, X-NTPs may be present with ATP, CTP, GTP, and UTP in a certain concentration ratio. By way of example only, the X-NTP is Cy3-NTP, and the ratio of ATP, CTP, GTP, or UTP:Cy3-NTP is 4:1; or the ratio of ATP:CTP:GTP:UTP:Cy5-UTP is 2:2:2:1.9:0.1.

[0095] In this invention, an oligonucleotide with a modified base at position 1 is ligated to the 3' end of the uncircularized linear RNA within a 1-20 nt range. In some embodiments, N-1 length linear RNA (the N-1 position cannot be U) can be transcribed in vitro, and an X-NTP is ligated to the 3' end of the N-1 length in vitro transcribed linear RNA, forming an RNA chain of target length N with an X-modified group at the 3' end, followed by a circularization reaction to form the final target circular RNA. In some embodiments, N-5 length linear RNA (the N-5 position cannot be U) can be transcribed, and then an oligonucleotide with a consistent last 5 positions is chemically synthesized, wherein, for example, the 3rd position can be an X-NTP modified base and the last position is U, and this oligonucleotide is ligated to the transcribed N-5 length linear RNA before a circularization reaction. It should be noted that the above methods are merely examples and should not be construed as limiting the modification methods.

[0096] In some embodiments, the method for preparing circular RNA further includes: treating the reaction product at 37°C for 20 min using DNase I enzyme to remove DNA molecules.

[0097] In some embodiments, the method for preparing circular RNA further includes purifying the circular RNA. In some embodiments, the circular RNA can be separated from the reaction product by the principle of affinity adsorption. For example, purified circular RNA is obtained using oligo dX magnetic beads, wherein: when the poly X fragment is poly A, oligo dT or oligo dU magnetic beads are used; when the poly X fragment is poly T, oligo dA magnetic beads are used; when the poly X fragment is poly C, oligo dG magnetic beads are used; and when the poly X fragment is poly G, oligo dC magnetic beads are used.

[0098] In some embodiments, the method for purifying RNA further includes using an oligo dX-coupled packing centrifuge column or chromatography column to purify the target circular RNA using a negative selection method based on an affinity reaction.

[0099] In this process, due to the high affinity between the polynucleotide sequence and its complementary sequence, oligo dX magnetic beads bind to the corresponding polynucleotide sequence of linear RNA or other RNA fragments containing poly X. Then, a magnetic field can be used to separate the magnetic beads containing linear RNA or other RNA fragments containing poly X, thereby obtaining purified circular RNA.

[0100] In some embodiments, the method for preparing RNA further includes: adding DNase I enzyme to the reaction product to remove DNA molecules; and adding a chelating agent to the reaction product to remove Mg.2+ ; and RNase R is added to the reaction product to digest linear RNA and further purify the circular RNA in the reaction product.

[0101] In some embodiments, the chelating agent may include EDTA or other agents that chelate Mg. 2+ Functional chelating agents.

[0102] The embodiments described in this specification have at least the following beneficial effects:

[0103] A DNA molecule for preparing circular RNA is provided by combining a promoter, a poly X structure, a type I intron fragment, and a target fragment (containing a first adapter sequence and a second adapter sequence) to form a circular framework. Based on this DNA molecule, linear RNA is obtained through ligation to produce linear RNA containing modified bases. This RNA can undergo a one-step transesterification reaction under optimized circularization conditions, generating stable circular RNA without additional sequence residues while ensuring circularization efficiency. This reduces changes in the secondary structure of the circular RNA, thereby lowering its immunogenicity and improving its intracellular stability. Furthermore, by using the universal oligo dX affinity purification protocol, the circular precursor with the poly X structure (i.e., linear RNA generated from in vitro transcription) and the cleaved intron ribozymes can be rapidly removed simply by collecting the flow-through solution, thus quickly preparing high-purity circular RNA. The entire process is simple and quick, and can be completed using mainstream reagents, materials and commonly used instruments and equipment. It is especially suitable for the rapid synthesis of circular RNA with less than 2000 nucleotides, and can effectively meet the needs of therapeutic circular RNA research and development and production.

[0104] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Some contents in these embodiments can be replaced or combined with corresponding contents in other embodiments to form new embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments are all purchased from conventional biochemical reagent companies. The quantitative experiments in the following embodiments are all repeated three times, and the results are averaged. It should be understood that the following embodiments are for better explanation of the present invention and are not intended to limit the present invention. Example 1: In vitro synthesis of circBase ID:mmu_circ_0001254 based on ribozyme self-circulation circular RNA synthesis method

[0105] 1. Ribozyme selection

[0106] The ribozyme was selected from a partial sequence of the type I intron (P2-P9 domains) of *Tetrahymena thermophila*, NCBI ID: V01416. The DNA sequence of the type I intron of *Tetrahymena thermophila* is as follows:

[0107]

[0108] The corresponding RNA sequence is:

[0109]

[0110] The full-length secondary structure of the RNA of the wild-type Tetrahymena thermophila type I intron is shown in Figure 2.

[0111] 2. Connector Design

[0112] The sequence of mmu_circ_0001254 (corresponding transcript NCBI ID: NM_001159630) is as follows (*indicates the linker):

[0113] The reverse sequence of circular RNA is the same as the forward sequence. In order to facilitate further analysis of its sequence and secondary structure features, the above sequence needs to be modified into a reverse sequence and an artificial adapter site needs to be designed.

[0114] The reverse sequence of mmu_circ_0001254 is:

[0115] The secondary structure of the above sequence (RNAfold-p-d2--noLP–circ) was analyzed using RNAfold, resulting in the structural diagram shown in Figure 3. The figure shows the location of the natural adapter site.

[0116] The mmu_circ_0001254 sequence after artificially designed adapter sites (* indicates the adapter site, and the underline indicates the RNA sequence corresponding to the adapter sequence): The RNA sequence corresponding to the first adapter sequence is GGUUGCU; the RNA sequence corresponding to the second adapter sequence is GGCACCG.

[0117] The secondary structure of the above sequence (RNAfold-p-d2--noLP–circ) was analyzed using RNAfold, yielding a schematic diagram as shown in Figure 4. Figure 4 shows the location of the artificial adapter site. The adapter design for mmu_circ_0001254 is shown in Figure 5.

[0118] To form a residue-free circular RNA, the components are combined to form a circular framework, as shown in Figure 6. The DNA molecule consists of the following components from the 5' end to the 3' end: T7 promoter, poly A structure, Tetrahymena thermophila type I intron (P2-P9 domain), and target fragment with designed adapter.

[0119] Figure 7 illustrates the secondary structure of linear RNA transcribed from DNA molecules. In the figure, blue indicates the RNA corresponding to the target fragment, nnnnnnn schematically represents the RNA sequence corresponding to the second adapter sequence, and unnnnn schematically represents the RNA sequence corresponding to the first adapter sequence, where n represents any of the bases A, U, C, or G. The 5' GGG in the linear RNA molecule represents the sequence transcribed from the promoter, the subsequent string of A bases represents the Poly A structure, and the remaining structures represent the RNA transcribed from the Tetrahymena thermophila type I intron (P2-P9 domains).

[0120] In this sequence, the last base U of the RNA corresponding to the first adapter sequence forms a G·U swing pair with the third base G after transcription by the promoter, which promotes the cleavage of the 3' end G of the Tetrahymena thermophila type I intron (i.e., the position indicated by the arrow in Figure 7), thereby configuring the linear RNA to self-circularize to produce stable circular RNA without additional sequence residues.

[0121] 3. Prepare in vitro transcription template

[0122] To form a residue-free circular RNA, the components were combined to form a circular framework, which, from the 5' end to the 3' end, consisted of: a T7 promoter, a poly A structure, a Tetrahymena thermophila type I intron fragment, and a circRNA mmu_circ_0001254 with a designed adapter. The entire sequence is as follows:

[0123] The above sequences were synthesized, and recombinant plasmids were constructed. Using the recombinant plasmid as a template, PCR amplification was performed to prepare an in vitro transcription template (IVT template) containing the T7 promoter sequence. 150 μL of the PCR reaction mixture was aliquoted into three PCR tubes, and the PCR sample components in each tube are shown in Table 1.

[0124] The primer sequences are as follows:

[0125] F primer: ATTCAGGCTGCGCAACTGTT (SEQ ID NO:7).

[0126] R primer: AGCAACCTAACTGTCCACGG (SEQ ID NO: 8). Table 1

[0127] The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min; (95℃, 15 sec; 55~65℃, 15 sec; 72℃, 60 sec / kb) 35 cycles; 72℃ complete extension for 5 min; end.

[0128] The PCR products were recovered using a PCR product purification and recovery kit (Aidlab#DR0202). The specific steps are as follows:

[0129] (1) Column equilibration: Add 100 μl of equilibration solution to the adsorption column EC, centrifuge at 12,000 rpm for 1 min, discard the filtrate, and set aside for later use;

[0130] (2) Pipette 750 μL of binding buffer BB into a 1.5 mL EP tube, and add 150 μL of PCR product into the binding buffer and vortex to mix.

[0131] (3) Transfer all the mixture from step (2) to the adsorption column EC, incubate at room temperature for 1 min, centrifuge at 12000 rpm for 1 min at room temperature, and discard the filtrate.

[0132] (4) Add 600 μL of washing solution to the EC adsorption column, centrifuge at 12000 rpm for 30 s, discard the filtrate, and repeat the washing once.

[0133] (5) Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm for 2 min to remove ethanol residue;

[0134] (6) Transfer the EC adsorption column to a new EP tube and add 55 μL of elution buffer to the EC column. Incubate at room temperature for 2 min.

[0135] (7) Centrifuge at 12000 rpm for 1 min, discard the adsorption column and collect the filtrate;

[0136] (8) Take 1 μL and use BioDrop to measure the DNA concentration.

[0137] (9) The bands were verified by 1% agarose gel electrophoresis.

[0138] The PCR product sequence is as follows:

[0139] 4. In vitro transcription reaction

[0140] Using the in vitro transcription template obtained in the above steps as a substrate, in vitro transcription was performed using the T7 High Yield RNA Synthesis Kit (10623ES50).

[0141] (1) Add the components required for the in vitro transcription reaction to the EP tube, as shown in Table 2. Table 2

[0142] (2) After mixing the above components evenly, incubate them in a 37°C incubator for 3 hours.

[0143] (3) Then add 2 μL of DNase I to the tube, mix it evenly with the pipette tip, and incubate it in a 37°C incubator for 20 min.

[0144] (4) Add LiCl to a final concentration of 2.5M, mix well, and incubate at -20℃ for 30 min to precipitate RNA.

[0145] (5) Centrifuge at 12000rpm at 4℃ for 15min, remove the supernatant, add 600μL of 75% ethanol to rinse the precipitate, remove the ethanol completely at 12000rpm at 4℃, air dry at room temperature for 5min, add 200μL of enzyme-free water to dissolve the RNA, and measure the concentration using a micro spectrophotometer.

[0146] The linear RNA sequence generated by in vitro transcription via T7 RNA polymerase is as follows:

[0147] 5. Cycling reaction

[0148] (1) Transfer the in vitro transcription product digested by DNase I to a 1.5 mL EP tube containing 8 volumes of enzyme-free water and 1 volume of 10× cyclization buffer. Vortex to mix and centrifuge for a few seconds. Place the reaction tube in a 55℃ metal bath for 15 min.

[0149] (2) Remove the reaction tube, add 12 μL of 0.5 M EDTA and mix thoroughly to terminate the reaction.

[0150] (3) Add LiCl to a final concentration of 2.5M, mix well, and incubate at -20℃ for 30 min to precipitate RNA.

[0151] (4) Centrifuge at 12000rpm at 4℃ for 15min, remove the supernatant, add 600μL of 75% ethanol to rinse the precipitate, remove the ethanol completely at 12000rpm at 4℃, and then air dry at room temperature for 5min.

[0152] The thermophilic tetrahymenium type I intron sequence generated via autosplicing is as follows:

[0153] 6. RNase R Tolerance Verification

[0154] Take 30 μg of the cyclized product precipitated with ethanol, add 1 μL of RNase R, 10 μL of 10x buffer, and enzyme-free water to a final volume of 100 μL. Incubate at 37°C in a metal bath for 20 min. Then, purify the RNA using an RNA purification and concentration kit (TR115, Jian Shi Biotechnology). The specific steps are as follows:

[0155] (1) Add 200 μL of binding solution to the sample, mix well, then add 300 μL of anhydrous ethanol and mix thoroughly.

[0156] (2) Add the above mixture to the purification column, centrifuge at 12000 rpm for 1 min at room temperature, and remove the filtrate.

[0157] (3) Add 400 μL of RNA prewash buffer to the purification column, centrifuge at 12,000 rpm for 1 min at room temperature, and remove the filtrate.

[0158] (4) Add 700 μL of RNA washing buffer to the purification column, centrifuge at 12,000 rpm for 1 min at room temperature, and remove the filtrate.

[0159] (5) Add 400 μL of RNA washing buffer to the purification column and centrifuge at 12,000 rpm for 2 min at room temperature.

[0160] (6) Take out the purification column and place it in a new 1.5 mL EP tube. Add 20 μL of preheated enzyme-free water to the column membrane, let it stand at room temperature for 2 min, centrifuge at 12000 rpm for 1 min, and collect the filtrate.

[0161] (7) After using Biodrop to detect the concentration, the bands were detected by 2% agarose gel electrophoresis.

[0162] (8) Prepare a 2% agarose 0.5×TBE gel. Take 1 μg of sample and add 5 μL of 2×RNA loading buffer. Add enzyme-free water to make up to 10 μL. Mix well and incubate in a metal bath at 70℃ for 5 min. Place on ice for 1-3 min and then add to the sample well.

[0163] (9) After electrophoresis at 100V for 75 minutes, the gel block was removed and photographed using a gel imaging system. The electrophoresis results are shown in Figure 8.

[0164] 7. RT-PCR verification of adapter sequences

[0165] Primer pairs are specific primers designed for adapters (also known as transcircularization site primers). If an RNA molecule is circularized at the designed adapter site, reverse transcription can yield cDNA containing the adapter sequence that can be detected by the primer pair.

[0166] (1) Take 700 ng of the product digested by RNase R and use a reverse transcription kit (Aidlab PC5401 TRUEscript RT Kit (+gDNA Eraser)) to prepare cDNA.

[0167] (2) Thaw the template RNA and 5×TRUE RT MasterMix on ice; thaw 4×gDNA Eraser Mix and RNase-free H2O at room temperature (15-25℃) and place them on ice immediately after thawing. Before use, gently tap or vortex each solution to mix, and briefly centrifuge to collect any liquid remaining on the tube wall to the bottom of the tube.

[0168] (3) Add the following components to the RNase-free H2O tube (it is recommended to prepare this on ice using PCR tubes): Table 3

[0169] (4) Gently pipette to mix, and incubate at 42°C for 2 min (or 37°C for 5 min). It is recommended that all temperature control steps be performed on the PCR instrument.

[0170] (5) Continue to add 4 μl of 5×TRUE RT MasterMix directly to the same tube, gently pipette to mix (total volume 20 μl) and place in the PCR instrument.

[0171] (6) The PCR program is as follows: 25℃ for 10 min; 42℃ for 20 min; 85℃ for 5 s; end.

[0172] (7) Use primer PCR to verify the results. Dilute cDNA 10 times and take 2 μL as PCR template. Use Pfu enzyme to perform 50 μL PCR electrophoresis to detect the results.

[0173] The upstream primer sequence used was GTCTCCTCAGTTGGTCAGAGG (SEQ ID NO:12), and the downstream primer sequence was CTATTGGACGTCGGTGGACC (SEQ ID NO:13).

[0174] The electrophoresis results are shown in Figure 9.

[0175] 8. Sequencing Validation Connector

[0176] PCR products were recovered using a PCR product purification and recovery kit (Aidlab#DR0202), and TOPO vector cloning was performed using the Aidlab CV17-Zero Background pTOPO-Blunt Simple Cloning Kit. The specific steps for sequencing verification of the adapters are as follows:

[0177] (1) Prepare the reaction mixture at room temperature according to the system in Table 4: Table 4

[0178] Mix the above components with a pipette and react at room temperature for 5 minutes.

[0179] (2) Take 100 μL of DH5α competent cells and thaw them on ice. Add 5 μL of the reaction mixture, mix gently, and let stand at room temperature for 5 min.

[0180] (3) After heat shock in a metal bath at 42℃ for 70s, add 500μL of LB medium and incubate at 37℃ and 200rpm for 10min.

[0181] (4) Take 200 μL of bacterial culture, spread it on an ampicillin-resistant LB plate, incubate it overnight at 37°C with the plate upside down, pick single clones for culture, and use primer M13R for sequencing.

[0182] The sequencing results analysis is shown in Figure 10, where * indicates the adapter.

[0183] 9. Affinity purification

[0184] (1) Add an equal volume of 2× solution I to dilute the 2000 ng / μl sample to 1000 ng / μl. The 2× solution I contains 20 mM Tirs-HCl, 1 M NaCl, 2 mM EDTA, and has a pH of 7.5.

[0185] (2) Add 500 μl of packing material (NanoGel dT20 affinity chromatography medium) to a centrifuge empty column (2 ml, 20 μm pore size sieve plate), mix well, centrifuge and discard the filtrate.

[0186] (3) Add ultrapure water to the packed column, mix well, briefly centrifuge and discard the filtrate, repeat the washing process three times. Add solution I to the packing material, mix well, briefly centrifuge and discard the filtrate, repeat the washing process three times. Solution I consists of 10 mM Tirs-HCl, 0.5 M NaCl, and 1 mM EDTA.

[0187] (4) Add the sample from step 1 (500 μL of packing material to 500 μg of sample) to the packed column. Mix the sample and packing material thoroughly and transfer to a new 1.5 ml centrifuge tube. (Add in multiple batches until all the packing material in the adsorption column is completely removed.)

[0188] (5) Incubate at 37℃ for 30 minutes. Invert the container every 10 minutes to mix.

[0189] (6) Attach the centrifuge column to a new 1.5ml centrifuge tube, add the mixture from step 5 to the column, and briefly centrifuge to collect the filtrate into another new 1.5ml centrifuge tube. (Add the filtrate in multiple batches to avoid submerging the bottom of the column.)

[0190] (7) Based on the collected filtrate, add 7.5M LiCl to make the final concentration reach 2.8M, and then precipitate at -20℃ for 30min.

[0191] (8) Centrifuge at 4℃ and 12000rpm for 15min. Remove the supernatant and add 75% pre-cooled ethanol, then invert the container to mix.

[0192] (9) Centrifuge at 4℃ and 12000rpm for 3min. Remove the supernatant and air dry for 5min.

[0193] (10) After dissolving in ultrapure water, the concentration is measured.

[0194] (11) The bands were detected by 2% agarose gel electrophoresis.

[0195] 10. Verify the splicing circularization of Cy5-UTP-tagged in vitro transcripts.

[0196] 10.1 Cy5-UTP-involved in vitro transcription and circularization

[0197] (1) In vitro transcription was performed using 5% Cy5-UTP. The required components for in vitro transcription were added sequentially to the EP tube, as shown in Table 5. Table 5

[0198] (2) After mixing the above components, incubate them in a 37°C incubator for 3 hours.

[0199] (3) Then add 2 μL of DNase I enzyme to the reaction tube, mix with a pipette tip, and incubate in a 37°C incubator for 20 min.

[0200] (4) Transfer the in vitro transcription product digested by DNase I to a 1.5 mL EP tube containing 8 volumes of enzyme-free water and 1 volume of 10× cyclization buffer. Vortex to mix, centrifuge for a few seconds, and incubate in a 55℃ metal bath for 15 min.

[0201] (5) Remove the reaction tube, add 0.15 mM EDTA to it and mix thoroughly to terminate the reaction.

[0202] (6) Add LiCl to a final concentration of 2.5M, mix well, and incubate at -20℃ for 30 min to precipitate RNA.

[0203] (7) Centrifuge at 12000rpm at 4℃ for 15min, remove the supernatant, add 600μL of 75% ethanol to rinse the precipitate, remove the ethanol completely at 12000rpm at 4℃, and air dry at room temperature for 5min. Then take a certain amount of enzyme-free water to dissolve the RNA and measure the concentration using a micro spectrophotometer.

[0204] 10.2 Validation of RNase R tolerance of Cy5-UTP-labeled cyclized products

[0205] Take 30 μg of the cyclized product after ethanol precipitation, add 1 μL of RNase R, 10 μL of 10x buffer, and enzyme-free water to a final volume of 100 μL. Incubate at 37°C in a metal bath for 30 min. Subsequently, purify the RNA using an RNA purification and concentration kit (TR115, Jian Shi Biotechnology). The specific steps are as follows:

[0206] (1) Add 200 μL of binding solution to the sample, mix well, then add 300 μL of anhydrous ethanol and mix thoroughly.

[0207] (2) Add the above mixture to the purification column, centrifuge at 12000 rpm for 1 min at room temperature, and remove the filtrate.

[0208] (3) Add 400 μL of RNA prewash buffer to the purification column, centrifuge at 12,000 rpm for 1 min at room temperature, and remove the filtrate.

[0209] (4) Add 700 μL of RNA washing buffer to the purification column, centrifuge at 12,000 rpm for 1 min at room temperature, and remove the filtrate.

[0210] (5) Add 400 μL of RNA washing buffer to the purification column and centrifuge at 12,000 rpm for 2 min at room temperature.

[0211] (6) Take out the purification column and place it in a new 1.5 mL EP tube. Add 20 μL of preheated enzyme-free water to the column membrane, let it stand at room temperature for 2 min, centrifuge at 12000 rpm for 1 min, and collect the filtrate.

[0212] (7) After detecting the concentration using Biodrop, the bands were then detected by 2% agarose gel electrophoresis. The electrophoresis results are shown in Figure 11.

[0213] Electrophoresis results showed that Cy5-circular RNA can undergo cleavage and circularization, and linear RNA containing Cy5-UTP can be digested by RNase R. Simultaneously, Cy5-circular RNA is resistant to RNase R digestion. Example 2: In vitro synthesis of circRNA based on ribozyme self-circulation (circBase ID: mmu_circ_0007509)

[0214] 1. Connector Design

[0215] The sequence of mmu_circ_0007509 is:

[0216]

[0217] Based on the forward sequence of the above sequence, two artificial connector schemes are designed, as shown in the following sequence.

[0218] Connector Scheme 1 (* indicates the connector location, underline indicates the connector sequence):

[0219]

[0220] The first connector sequence is: AGCTTCATTTT (SEQ ID NO:16); the second connector sequence is: ACATATGAAG (SEQ ID NO:17).

[0221] Connector Option 2 (* indicates the connector location, underline indicates the connector sequence):

[0222]

[0223] The first connector sequence is TGGTACAGTT (SEQ ID NO:19); the second connector sequence is AATCACTGATA (SEQ ID NO:20).

[0224] The secondary structure (RNAfold-p-d2--noLP–circ) of the mmu_circ_0007509 sequence and the mmu_circ_0007509 sequence after adapter schemes 1 and 2 was analyzed using RNAfold, and the structural diagram shown in Figure 12 was obtained.

[0225] 2. Prepare in vitro transcription template

[0226] To form a residue-free circular RNA, the components were combined to form a circular framework, which, from the 5' end to the 3' end, consisted of: a T7 promoter, a poly A structure, a Houttuynia cordata type I intron, and a target sequence with a designed adapter. This framework was synthesized and placed in the pUC57 vector. A schematic diagram of the circular framework is shown in Figure 13.

[0227] The synthetic sequence 1 for connector scheme 1 is as follows:

[0228] The synthetic sequence 2 for connector scheme 2 is as follows:

[0229] The linear RNA sequence generated by in vitro transcription via T7 RNA polymerase is as follows:

[0230] Connector Option 1:

[0231]

[0232] Connector Option 2:

[0233] The above sequences were synthesized, and a recombinant plasmid was constructed. Using the recombinant plasmid as a template, PCR amplification was performed to prepare an in vitro transcription template containing the T7 promoter sequence. 150 μL of the PCR reaction mixture was aliquoted into three PCR tubes, and the PCR sample preparation components in each tube are shown in Table 6. The primer sequences for each protocol are as follows.

[0234] The primer sequences for adapter scheme 1 are as follows:

[0235] F primer: ATTCAGGCTGCGCAACTGTT (SEQ ID NO:7).

[0236] R primer: AAAATGAAGCTGCAGCTCTTCC (SEQ ID NO:25).

[0237] The primer sequences for adapter scheme 2 are as follows:

[0238] F primer: ATTCAGGCTGCGCAACTGTT (SEQ ID NO:7).

[0239] R primer: AACTGTACCAAGCTGCAGAGC (SEQ ID NO:26). Table 6

[0240] The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min; (95℃, 15 sec; 55~65℃, 15 sec; 72℃, 60 sec / kb) 35 cycles; 72℃ complete extension for 5 min; end.

[0241] The PCR products were recovered using a PCR product purification and recovery kit (Aidlab#DR0202). The specific steps are as follows:

[0242] (1) Column equilibration: Add 100 μl of equilibration solution to the adsorption column EC, centrifuge at 12,000 rpm for 1 min, discard the filtrate, and set aside for later use;

[0243] (2) Pipette 750 μL of binding buffer BB into a 1.5 mL EP tube, and add 150 μL of PCR product into the binding buffer and vortex to mix.

[0244] (3) Transfer all the mixture from step 2 to the adsorption column EC, incubate at room temperature for 1 min, centrifuge at 12000 rpm for 1 min at room temperature, and discard the filtrate.

[0245] (4) Add 600 μL of washing solution to the EC adsorption column, centrifuge at 12000 rpm for 30 s, discard the filtrate, and repeat the washing once.

[0246] (5) Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm for 2 min to remove ethanol residue;

[0247] (6) Transfer the EC adsorption column to a new EP tube and add 55 μL of elution buffer to the EC column. Incubate at room temperature for 2 min.

[0248] (7) Centrifuge at 12000 rpm for 1 min, discard the adsorption column and collect the filtrate;

[0249] (8) Take 1 μL and use BioDrop to measure the DNA concentration.

[0250] The PCR product sequences are as follows:

[0251] Connector Option 1:

[0252] Connector Option 2:

[0253] 3. In vitro transcription and cyclization reaction

[0254] Using the in vitro transcription template obtained in step 2 as a substrate, in vitro transcription was performed using the T7 High Yield RNA Synthesis Kit (10623ES50).

[0255] The components required for the in vitro transcription reaction were added to the EP tubes, as shown in Table 7. Table 7

[0256] After mixing the above components evenly, incubate in a 37°C incubator for 3 hours.

[0257] Then add 2 μL of DNase I enzyme to the tube, mix well with a pipette tip, incubate in a 37°C incubator for 20 min, then retain the sample, and place the remaining reaction solution in a 50°C metal bath for 20 min for cyclization.

[0258] After adding LiCl to a final concentration of 2.5M and mixing well, incubate at -20℃ for 30 min to precipitate RNA.

[0259] Centrifuge at 12,000 rpm for 15 min at 4℃, remove the supernatant, add 600 μL of 75% ethanol to wash the precipitate, remove the ethanol completely at 12,000 rpm at 4℃, air dry at room temperature for 5 min, add 200 μL of enzyme-free water to dissolve the RNA, and measure the concentration using a micro spectrophotometer.

[0260] The bands were detected using 2% agarose gel electrophoresis, and the electrophoresis results are shown in Figure 14.

[0261] The results showed that mmu_circ_0007509 adapter scheme 2 can efficiently generate circular RNA.

[0262] 4. RNase R Tolerance Verification

[0263] Take 30 μg of the cyclized product precipitated with ethanol, add 1 μL of RNase R, 10 μL of 10x buffer, and enzyme-free water to a final volume of 100 μL. Incubate at 37°C in a metal bath for 20 min. Then, purify the RNA using an RNA purification and concentration kit (TR115, Jian Shi Biotechnology). The specific steps are as follows:

[0264] (1) Add 200 μL of binding solution to the sample, mix well, then add 300 μL of anhydrous ethanol and mix thoroughly.

[0265] (2) Add the above mixture to the purification column, centrifuge at 12,000 rpm for 1 min at room temperature, and remove the filtrate;

[0266] (3) Add 400 μL of RNA prewash buffer to the purification column, centrifuge at 12,000 rpm for 1 min at room temperature, and remove the filtrate.

[0267] (4) Add 700 μL of RNA washing buffer to the purification column, centrifuge at 12,000 rpm for 1 min at room temperature, and remove the filtrate.

[0268] (5) Add 400 μL of RNA washing buffer to the purification column and centrifuge at 12,000 rpm for 2 min at room temperature;

[0269] (6) Take out the purification column and place it in a new 1.5 mL EP tube. Add 20 μL of preheated enzyme-free water to the column membrane, let it stand at room temperature for 2 min, centrifuge at 12000 rpm for 1 min, and collect the filtrate.

[0270] 5. Verify the splicing and circularization of Cy5-UTP-labeled in vitro transcripts.

[0271] 5.1 Verify whether NTP modification affects cyclization

[0272] In vitro transcription reactions were performed with 1% and 5% Cy5-UTP, respectively, and the reaction was carried out by direct post-transcriptional circularization. The results are shown in Figure 14.

[0273] The results showed that Cy5-UTP incorporation did not affect the recognition and cleavage cyclization of type I introns in Anabaena.

[0274] 5.2 Validation of RNase R tolerance of Cy5-UTP-labeled cyclized products

[0275] Take 30 μg of the cyclized product after ethanol precipitation, add 1 μL of RNase R, 10 μL of 10x buffer, and enzyme-free water to a final volume of 100 μL. Incubate at 37°C in a metal bath for 30 min. Subsequently, purify the RNA using an RNA purification and concentration kit (TR115, Jian Shi Biotechnology). The specific steps are as follows:

[0276] (1) Add 200 μL of binding solution to the sample, mix well, then add 300 μL of anhydrous ethanol and mix thoroughly.

[0277] (2) Add the above mixture to the purification column, centrifuge at 12000 rpm for 1 min at room temperature, and remove the filtrate.

[0278] (3) Add 400 μL of RNA prewash buffer to the purification column, centrifuge at 12,000 rpm for 1 min at room temperature, and remove the filtrate.

[0279] (4) Add 700 μL of RNA washing buffer to the purification column, centrifuge at 12,000 rpm for 1 min at room temperature, and remove the filtrate.

[0280] (5) Add 400 μL of RNA washing buffer to the purification column and centrifuge at 12,000 rpm for 2 min at room temperature.

[0281] (6) Take out the purification column and place it in a new 1.5 mL EP tube. Add 20 μL of preheated enzyme-free water to the column membrane, let it stand at room temperature for 2 min, centrifuge at 12000 rpm for 1 min, and collect the filtrate.

[0282] (7) After using Biodrop to detect the concentration, the bands were then detected by 2% agarose gel electrophoresis. The electrophoresis results are shown in Figure 16.

[0283] The results showed that Cy5-UTP did not affect RNase R digestion, and the Cy5-UTP-tagged RNA generated by the cleavage of Houttuynia cordata type I introns was resistant to RNase R. Example 3: Synthesis of circular RNA circCVB3-GFP-pure without additional sequence residues.

[0284] Existing circular RNA design frameworks include wild-type flanking exon 1 (E1) and exon 2 (E2) terminal sequences. After recognizing a specific linker sequence structure, the intronic ribozyme catalyzes a transesterification reaction to perform cleavage and circularization, joining the E1 and E2 ends together. In this embodiment, a method is used to simulate the E1 and E2 ends using a specific sequence region (i.e., the linker sequence) from the target sequence to verify whether it is possible to synthesize circular RNA expressing green fluorescent protein (GFP) without any additional sequence residue.

[0285] To form a residue-free circular RNA, the components are combined to form a circular framework, from the 5' end to the 3' end: T7 promoter, poly A30, Houttuynia cordata type I intron, and CVB3-GFP. For the target fragment, since the adapter sequence can be located either on the IRES sequence (first IRES sequence and second IRES sequence) or on the open reading frame (first open reading frame and second open reading frame), there are two possible arrangements of DNA elements, as shown in Figure 17.

[0286] 1. Connector Design

[0287] Specifically, using CVB3-GFP as the target fragment of circular RNA, the in vitro synthesis of circular RNA circCVB3-GFP-pure without any additional sequence residues was verified.

[0288] Two connector sequences were selected from the IRES sequences of CVB3.

[0289] Adapter scheme 1: circCVB3-GFP-pure-01. The target fragment comprises elements operatively linked and arranged in the following order from 5' to 3': 3' CVB3 IRES part 3-739 (IRES sequence 1), kozak sequence GCCACC, GFPCDS, and TT terminus (IRES sequence 2). The first adapter sequence of CircCVB3-GFP-pure-01 is AGTGATT, and the second adapter sequence is AAAACAG, indicated by underscores.

[0290] The 3'CVB3 IRES part 3-739 sequence is as follows:

[0291] The sequences at the ends of GFPCDS and TT are as follows:

[0292] Adapter scheme 2: circCVB3-GFP-pure-02. The target fragment comprises elements operatively linked and arranged in the following order from 5' to 3': 5' CVB3 IRES part 1-38nt (IRES sequence 1), kozak sequence GCCACC, GFPCDS, and 3' CVB3 IRES part 39-741nt (IRES sequence 2). The first adapter sequence of CircCVB3-GFP-pure-02 is AGAGGTT, and the second adapter sequence is AAAACAT, indicated by underscores.

[0293] The 3'CVB3 IRES part 39-741nt sequence is as follows:

[0294] The 5'CVB3 IRES part 1-38nt sequence is as follows:

[0295] Figure 18 shows schematic diagrams of two connector schemes based on CVB3 IRES design.

[0296] 2. Prepare in vitro transcription template

[0297] According to the method disclosed in WO2024051842, the plasmids circCVB3-GFP-pure-01 and circCVB3-GFP-pure-02 were constructed using seamless cloning technology and verified by sequencing.

[0298] The plasmids were prepared using the Aidlab PL03 High Purity Plasmid Small-Scale Rapid Extraction Kit. The specific steps are as follows:

[0299] (1) Column equilibration: Add 100 μl of equilibration solution to the adsorption column AC, centrifuge at 12,000 rpm for 1 min, discard the filtrate, and keep it for later use.

[0300] (2) Take 5 ml of overnight culture and add it to a 1.5 ml centrifuge tube in portions. Centrifuge at 12,000 rpm for 30 seconds, drain the supernatant as much as possible, and collect the bacterial cells.

[0301] (3) Add 250 μl of solution P1 to resuspend the bacterial precipitate and vortex until completely suspended.

[0302] (4) Add 250 μl of solution P2, gently invert the container 6-8 times to fully lyse the cells, and let it stand at room temperature for 4 min.

[0303] (5) Add 350 μl of solution P3, and immediately gently invert the container 6-8 times to mix thoroughly. A white flocculent precipitate will appear at this time. Centrifuge at 12,000 rpm for 10 min, and carefully aspirate the supernatant into the adsorption column AC (place the adsorption column in the collection tube), avoiding aspirating the floating white precipitate.

[0304] (6) Centrifuge at 12,000 rpm for 1 min and discard the filtrate.

[0305] (7) Add 600 μl of washing buffer WB, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate.

[0306] (8) Add 600 μl of rinsing solution WB and rinse once more, then discard the filtrate.

[0307] (9) Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm for 2 min to remove as much of the washing liquid as possible, so as to avoid the residual ethanol in the washing liquid inhibiting the downstream reaction.

[0308] (10) Take out the adsorption column and put it into a clean centrifuge tube. Add 100 μl of elution buffer EB to the middle of the adsorption membrane, place it at room temperature for 2 min, centrifuge at 12,000 rpm for 1 min, and discard the adsorption column.

[0309] (11) Biodrop measures plasmid concentration.

[0310] A recombinant plasmid was used as a template for PCR amplification to prepare an in vitro transcription template containing the T7 promoter sequence. 150 μL of the PCR reaction mixture was aliquoted into three PCR tubes. The PCR sample components in each tube are shown in Table 8. The primer sequences for CVB3-GFP-pure-01 were as follows:

[0311] F primer: ATTCAGGCTGCGCAACTGTT (SEQ ID NO:7).

[0312] R primer: AATCACTTGTACAGCTCGTCCAT (SEQ ID NO:32).

[0313] The primer sequence for CVB3-GFP-pure-02 is as follows:

[0314] F primer: ATTCAGGCTGCGCAACTGTT (SEQ ID NO:7).

[0315] R primer: AACCTCTTTCAAGCTAAGTGGT (SEQ ID NO:33). Table 8

[0316] The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min; (95℃, 15 sec; 55~65℃, 15 sec; 72℃, 60 sec / kb) 35 cycles; 72℃ complete extension for 5 min; end.

[0317] The PCR products were recovered using a PCR product purification and recovery kit (Aidlab#DR0202). The specific steps are as follows:

[0318] (1) Column equilibration: Add 100 μl of equilibration solution to the adsorption column EC, centrifuge at 12,000 rpm for 1 min, discard the filtrate, and set aside for later use;

[0319] (2) Pipette 750 μL of binding buffer BB into a 1.5 mL EP tube, and add 150 μL of PCR product into the binding buffer and vortex to mix.

[0320] (3) Transfer all the mixture from step 2 to the adsorption column EC, incubate at room temperature for 1 min, centrifuge at 12000 rpm for 1 min at room temperature, and discard the filtrate.

[0321] (4) Add 600 μL of washing solution to the EC adsorption column, centrifuge at 12000 rpm for 30 s, discard the filtrate, and repeat the washing once.

[0322] (5) Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm for 2 min to remove ethanol residue;

[0323] (6) Transfer the EC adsorption column to a new EP tube and add 55 μL of elution buffer to the EC column. Incubate at room temperature for 2 min.

[0324] (7) Centrifuge at 12000 rpm for 1 min, discard the adsorption column and collect the filtrate;

[0325] (8) Take 1 μL and use BioDrop to measure the DNA concentration.

[0326] 3. In vitro transcription reaction

[0327] Using the in vitro transcription template obtained in step 2 as a substrate, in vitro transcription was performed using the T7 High Yield RNA Synthesis Kit (10623ES50).

[0328] (1) Add the components required for the in vitro transcription reaction to the EP tube, as shown in Table 9. Table 9

[0329] (2) After mixing the above components evenly, incubate them in a 37°C incubator for 3 hours.

[0330] (3) Then add 2 μL of DNase I to the reaction tube, mix with a pipette tip, and incubate in a 37°C incubator for 20 min.

[0331] (4) Add LiCl to a final concentration of 2.5M, mix well, and incubate at -20℃ for 30 min to precipitate RNA.

[0332] (5) Centrifuge at 12000rpm at 4℃ for 15min, remove the supernatant, add 600μL of 75% ethanol to rinse the precipitate, remove the ethanol completely at 12000rpm at 4℃, air dry at room temperature for 5min, add 200μL of enzyme-free water to dissolve the RNA, and measure the concentration using a micro spectrophotometer.

[0333] 4. Cycling reaction

[0334] (1) Take 10 μg and add 10 μL of 1× cyclization buffer, then add enzyme-free water to make up to 100 μg and incubate at 55℃ for 20 min.

[0335] (2) Use 1.5% agarose gel to detect the bands. Take 15 μL of circularized sample and add 15 μL of 2×RNA loading buffer. Mix well and incubate in a metal bath at 70℃ for 5 min. Place on ice for 1-3 min before loading the sample.

[0336] (3) Electrophoresis conditions: 1×TAE 120V 60min. After the electrophoresis, the gel was removed and the bands were detected by the gel imaging instrument, as shown in Figure 19.

[0337] The results show that the design based on circCVB3-GFP-pure-02 can effectively generate circular RNA without any additional sequence residues.

[0338] The basic concepts have been described above. Obviously, for those skilled in the art, the detailed disclosure above is merely illustrative and does not constitute a limitation of this specification. Although not explicitly stated herein, those skilled in the art may make various modifications, improvements, and corrections to this specification. Such modifications, improvements, and corrections are suggested in this specification and therefore remain within the spirit and scope of the exemplary embodiments described herein.

[0339] Furthermore, this specification uses specific terms to describe embodiments thereof. For example, "an embodiment," "one embodiment," and / or "some embodiments" refer to a particular feature, structure, or characteristic associated with at least one embodiment of this specification. Therefore, it should be emphasized and noted that references to "an embodiment," "one embodiment," or "an alternative embodiment" in different locations throughout this specification do not necessarily refer to the same embodiment. Moreover, certain features, structures, or characteristics in one or more embodiments of this specification can be appropriately combined.

[0340] Similarly, it should be noted that, in order to simplify the description disclosed herein and thus aid in the understanding of one or more embodiments of the invention, the foregoing description of embodiments in this specification may sometimes combine multiple features into a single embodiment, drawing, or description thereof. However, this method of disclosure does not imply that the subject matter of this specification requires more features than those mentioned in the claims. In fact, the embodiments contain fewer features than all the features of a single embodiment disclosed above.

[0341] In some embodiments, numbers describing the quantity of components and attributes are used. It should be understood that such numbers used in the description of embodiments are modified in some examples with the terms "approximately," "approximately," or "generally." Unless otherwise stated, "approximately," "approximately," or "generally" indicates that the numbers are allowed to vary by ±20%. Accordingly, in some embodiments, the numerical parameters used in the specification and claims are approximate values, which may be changed depending on the characteristics required by individual embodiments. In some embodiments, numerical parameters should take into account specified significant digits and employ a general method of digit reservation. Although the numerical ranges and parameters used to confirm their breadth of range in some embodiments of this specification are approximate values, in specific embodiments, such values ​​are set as precisely as feasible.

[0342] For each patent, patent application, patent application publication, and other material, such as articles, books, specifications, publications, and documents, referenced in this specification, the entire contents of which are incorporated herein by reference. This excludes historical application documents that are inconsistent with or conflict with the content of this specification, as well as documents that limit the broadest scope of the claims in this specification (currently or subsequently appended to this specification). It should be noted that in the event of any inconsistency or conflict between the descriptions, definitions, and / or terminology used in the supplementary materials to this specification and the content of this specification, the descriptions, definitions, and / or terminology used in this specification shall prevail.

[0343] Finally, it should be understood that the embodiments described in this specification are merely illustrative of the principles of the embodiments described herein. Other variations may also fall within the scope of this specification. Therefore, alternative configurations of the embodiments described herein are intended to be illustrative rather than limiting, and should be considered consistent with the teachings of this specification. Accordingly, the embodiments described herein are not limited to those explicitly introduced and described herein.

Claims

1. A DNA molecule for preparing circular RNA, comprising elements operatively linked and arranged from 5' to 3' in the following order: promoter; The poly X fragment contains more than 5 identical consecutive bases, where X represents any base of A, T, C, or G; Type I intron fragments; and Target segment; among which Type I intron ribozymes can initiate cleavage in a one-step transesterification reaction, enabling the linear RNA transcribed from the DNA molecule to be configured to self-circulate to produce circular RNA containing only the RNA corresponding to the target fragment.

2. The DNA molecule as described in claim 1, characterized in that, The type I intron is composed of P2 to P9 structural domains.

3. The DNA molecule as described in claim 2, characterized in that, The promoter is one of the following: the third base from the 5' end to the 3' end of the sequence transcribed from the transcription start site into the linear RNA is G; the promoter is a T7 promoter, an SP6 promoter, or a T3 promoter.

4. The DNA molecule as described in claim 3, characterized in that, The DNA molecule further includes a first adapter sequence and a second adapter sequence, wherein the first adapter sequence is located at the 3' end of the target fragment and the second adapter sequence is located at the 5' end of the target fragment; The selection criteria for the first adapter sequence include: the last base of the RNA corresponding to the first adapter sequence is U, so as to form a G·U swing pair with the third base G in the sequence transcribed from the transcription start site into the linear RNA.

5. The DNA molecule as described in claim 4, characterized in that, The type I intron is of type IC1, and the type I intron of type IC1 includes one or more type I introns from the genera Tetrahymena, Pneumocystis, and Neurospora.

6. The DNA molecule as described in claim 5, characterized in that, The selection criteria for the first adapter sequence also include: the percentage of A and U in the RNA corresponding to the first adapter sequence relative to the total number of bases in the first adapter sequence is greater than a first preset value.

7. The DNA molecule as claimed in claim 4, characterized in that, The selection criteria for the first and second connector sequences also include: The RNA corresponding to the first adapter sequence and the second adapter sequence forms a complementary structure, wherein at least two base pairs in the complementary structure are completely complementary.

8. The DNA molecule as claimed in claim 7, characterized in that, The type I intron is of type IC3, and the type I intron of type IC3 includes one or more type I introns from the genera Anabaena, Vibrio azotocinae, Gynostemma, Synechococcus, and Protochlorophyllium; or type I introns from maize or tobacco.

9. The DNA molecule according to any one of claims 1-8, characterized in that, The target fragment includes an open reading frame encoding a protein.

10. The DNA molecule as claimed in claim 9, characterized in that, The target fragment also includes translation initiation elements, which include: an IRES sequence, a 5' UTR sequence, a Kozak sequence, and a sequence containing m 6 One or more of the following: A-modified sequences and complementary sequences of 18S ribosomal rRNA.

11. The DNA molecule as claimed in claim 10, characterized in that, When the first and second connector sequences are located on the open reading frame, the translation initiation element divides the open reading frame into a first open reading frame and a second open reading frame in a direction from 5' to 3', with the first connector sequence located at the 3' end of the second open reading frame and the second connector sequence located at the 5' end of the first open reading frame.

12. The DNA molecule as claimed in claim 10, characterized in that, When the first and second connector sequences are located on the translation initiation element, the open reading frame divides the translation initiation element into a first translation initiation element and a second translation initiation element in a direction from 5' to 3', with the first connector sequence located at the 3' end of the second translation initiation element and the second connector sequence located at the 5' end of the first translation initiation element.

13. A recombinant expression vector, characterized in that, Includes the DNA molecule as described in any one of claims 1-12.

14. A circular RNA, characterized in that, It is prepared from the DNA molecule according to any one of claims 1-12.

15. The circular RNA as described in claim 14, characterized in that, One or more bases in the circular RNA are modified bases, denoted as X-NTPs, where N is any base from A, U, C, and G, and X represents a modifying group. The X-NTPs include fluorescein isothiocyanate-12-NTP, biotin-16-NTP, biotin-11-NTP, digoxin-11-NTP, D-desulfurized biotin-NTP, 5-methoxy-NTP, 5-hydroxy-NTP, 5-carboxyl-NTP, 5-formyl-NTP, desulfurized biotin-16-NTP, 5-carboxymethyl ester-NTP, 5-hydroxymethyl-NTP, N1-methylpseudo-NTP, 3'-O-methyl-NTP, 5-bromo-NTP, and 2'-O-methylpseudo-N... One or more of the following: TP, 6-aza-NTP, 5,6-dihydro-NTP, Ara-NTP, 2-thio-NTP, aminoallyl-NTP, thieno-NTP, 5-iodo-NTP, FAM-NTP, VIC-NTP, HEX-NTP, Cy3-NTP, JOE-NTP, Cy5-NTP, ROX-NTP, Cy5.5-NTP, Cy7-NTP, TAMRA-NTP, Texas Red-NTP, TET-NTP, and NED-NTP.

16. A method for preparing circular RNA based on the DNA molecule according to any one of claims 1-12, characterized in that, The method includes: An in vitro transcription reaction was performed to obtain linear RNA based on the DNA molecule. After transcription, a modified X-NTP was added to the 3' end of the linear RNA via ligation. In the X-NTP, X represents a modifying group, and N is any base from A, U, C, and G. The X-NTP includes fluorescein isothiocyanate-12-NTP, biotin-16-NTP, biotin-11-NTP, digoxigenin-11-NTP, D-dethiobiotin-NTP, 5-methoxy-NTP, 5-hydroxy-NTP, 5-carboxyl-NTP, 5-formyl-NTP, dethiobiotin-16-NTP, 5-carboxymethyl ester-NTP, and 5- One or more of the following: hydroxymethyl-NTP, N1-methylpseudo-NTP, 3'-O-methyl-NTP, 5-bromo-NTP, 2'-O-methylpseudo-NTP, 6-aza-NTP, 5,6-dihydro-NTP, Ara-NTP, 2-thio-NTP, aminoallyl-NTP, thieno-NTP, 5-iodo-NTP, FAM-NTP, VIC-NTP, HEX-NTP, Cy3-NTP, JOE-NTP, Cy5-NTP, ROX-NTP, Cy5.5-NTP, Cy7-NTP, TAMRA-NTP, Texas Red-NTP, TET-NTP, and NED-NTP; and The linear RNA is self-circularized to produce circular RNA containing only the RNA corresponding to the target fragment.

Images