New double-stranded RNA based on mapt RNA sequence, and use of same

Double-stranded RNA targeting tau gene expression induces RNAi to inhibit cell proliferation, addressing the limitations of antibody drugs by effectively suppressing tau-related diseases and cancers.

WO2026048822A1PCT designated stage Publication Date: 2026-03-05TOAGOSEI CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/029999
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-30
Filing Date
2025-08-27
Publication Date
2026-03-05

AI Technical Summary

Technical Problem

Existing anti-tau antibody drugs for treating tauopathies and cancers are expensive and difficult to maintain consistent quality, while nucleic acid drugs are not effectively utilized for suppressing tau expression and inhibiting cell proliferation.

Method used

Development of double-stranded RNA comprising a first and second strand, where the first strand is determined from a base sequence encoding tau, functioning as a small interfering RNA (siRNA) to induce RNA interference (RNAi) and inhibit tau gene expression, thereby suppressing cell proliferation, particularly in tumor cells.

Benefits of technology

The double-stranded RNA effectively suppresses tau-mediated cell proliferation, including tumor cells, by inducing RNAi, providing a cost-effective and reliable method for inhibiting cell growth and metastasis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JP2025029999_05032026_PF_FP_ABST
    Figure JP2025029999_05032026_PF_FP_ABST
Patent Text Reader

Abstract

A double-stranded RNA disclosed herein has a first strand and a second strand complementary to the first strand. The first strand includes a portion of the base sequence encoding tau protein, and includes the following main sequences: GUGGCAGUGGUCCGUACUCCA (SEQ ID NO. 1); GGCAGUGGUCCGUACUCCA (SEQ ID NO. 2); CCCAUGCCAGACCUGAAGA (SEQ ID NO. 3); CCAUGCCAGACCUGAAGAA (SEQ ID NO. 4); CAUGCCAGACCUGAAGAAU (SEQ ID NO. 5); CCAGACCUGAAGAAUGUCA (SEQ ID NO. 6); CAGACCUGAAGAAUGUCAA (SEQ ID NO. 7); and GACCUGAAGAAUGUCAAGU (SEQ ID NO. 8).
Need to check novelty before this filing date? Find Prior Art

Description

Novel double-stranded RNA based on MAPT RNA sequence and its use

[0001] The present disclosure relates to double-stranded RNA, compositions containing the double-stranded RNA, and methods of using the same. Specifically, the present disclosure relates to double-stranded RNA used to suppress or inhibit tumor cell growth or metastasis, and compositions comprising the double-stranded RNA. This application claims priority to Japanese Patent Application No. 2024-150337, filed August 30, 2024, the entire contents of which are incorporated herein by reference.

[0002] Tau protein (hereinafter simply referred to as "tau"), a type of microtubule-associated protein (MAP), is known to be abundant in neurons of the central nervous system. Tau promotes the assembly and stability of microtubules (MTs) through its interaction with tubulin. There are several different isoforms of tau. Tau also has many phosphorylation sites.

[0003] Under normal conditions, tau is soluble and stabilizes microtubules. However, excessive phosphorylation causes it to dissociate from microtubules, forming insoluble aggregates that accumulate inside and outside the cells, leading to neuronal death. Such tau abnormalities cause neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, progressive supranuclear palsy, corticobasal degeneration, and Pick's disease. These neurodegenerative diseases are collectively called tauopathies.

[0004] Tau gene expression is elevated in tauopathies and other diseases and disorders (e.g., cancer, etc.). For example, JP-A-2022-541539 discloses an anti-tau antibody that specifically binds to tau. This anti-tau antibody specifically binds to tau in which the lysine at 280 is acetylated. This effect can inhibit tau aggregation. JP-A-2022-50392 also discloses an antibody that specifically binds to tau for preventing or treating tauopathies.

[0005] JP 2022-541539 A JP 2022-50392 A

[0006] The present inventors wish to provide nucleic acids that suppress various tau-related diseases and disorders, or nucleic acid drugs that utilize such nucleic acids. Drugs that utilize antibodies, such as those disclosed in the above-mentioned JP-A No. 2022-541539 and JP-A No. 2022-50392, are expensive and difficult to maintain consistent quality. On the other hand, nucleic acid drugs can be mass-produced by organic synthesis, making it easy to control the consistency of quality.

[0007] A main object of the present disclosure is to provide a technique for suppressing tau expression and suppressing or inhibiting cell proliferation.

[0008] The double-stranded RNA disclosed herein comprises a first strand and a second strand complementary to the first strand, the first strand being determined from a base sequence encoding tau. The main sequence comprises any one of the following sequences: GUGGCAGUGGUCCGUACUCCA (SEQ ID NO: 1); GGCAGUGGUCCGUACUCCA (SEQ ID NO: 2); CCCAUGCCAGACCUGAAGA (SEQ ID NO: 3); CCAUGCCAGACCUGAAGAA (SEQ ID NO: 4); CAUGCCAGACCUGAAGAAU (SEQ ID NO: 5); CCAGACCUGAAGAAUGUCA (SEQ ID NO: 6); CAGACCUGAAGAAUGUCAA (SEQ ID NO: 7); GACCUGAAGAAUGUCAAGU (SEQ ID NO: 8); and an additional sequence consisting of 2 to 4 bases added to the 3' end of the main sequence.

[0009] In another preferred embodiment of the double-stranded RNA disclosed herein, the double-stranded RNA comprises a first strand and a second strand, wherein the first strand comprises a main sequence including a portion of a base sequence encoding tau, and the second strand comprises a main sequence that is complementary to the main sequence. Here, the main sequence is a base sequence of 19 to 23 bases, and includes the following base sequences: GUGGCAGUGGUCCGUACUCCA (SEQ ID NO: 1); GGCAGUGGUCCGUACUCCA (SEQ ID NO: 2); CCCAUGCCAGACCUGAAGA (SEQ ID NO: 3); CCAUGCCAGACCUGAAGAA (SEQ ID NO: 4); CAUGCCAGACCUGAAGAAU (SEQ ID NO: 5); CCAGACCUGAAGAAUGUCA (SEQ ID NO: 6); CAGACCUGAAGAAUGUCAA (SEQ ID NO: 7); GACCUGAAGAAUGUCAAGU (SEQ ID NO: 8);

[0010] The double-stranded RNA can function at least as a small interfering RNA (siRNA). That is, such double-stranded RNA is predicted to induce RNA interference (RNAi). This effect is at least due to the suppression of tau gene expression, thereby inhibiting the proliferation of cells in which tau is involved.

[0011] In one embodiment of the double-stranded RNA disclosed herein, the first strand includes an additional sequence of 2 to 4 bases added to the 3'-end of the main sequence. Additionally, the second strand is composed of a main sequence complementary to the first strand and an additional sequence of 2 to 4 bases added to the 3'-end of the complementary main sequence. This double-stranded RNA can function favorably as an siRNA. This allows for more reliable inhibition of tau-mediated cell proliferation.

[0012] In one embodiment of the double-stranded RNA disclosed herein, the base sequence constituting the additional sequence is thymine-thymine (TT), which can improve the stability of the double-stranded RNA.

[0013] In one embodiment of the compositions disclosed herein, the proliferation of at least one cell type is inhibited.

[0014] In one embodiment of the composition disclosed herein, the cell type whose proliferation is inhibited by the composition is a tumor cell, thereby enabling more reliable inhibition of cell proliferation.

[0015] One embodiment of the composition disclosed herein comprises a peptide fragment having cell membrane permeability that allows a foreign substance to be introduced into the cytoplasm by passing through the cell membrane from the outside of the cell, thereby facilitating the introduction of double-stranded RNA into a target cell.

[0016] The present disclosure provides a method for inhibiting the proliferation of at least one type of cell. One aspect of the method disclosed herein comprises the steps of (1) preparing a composition disclosed herein and (2) supplying the composition to a target cell in vitro. This allows the inhibition of cell proliferation associated with tau gene expression.

[0017] In one embodiment of the method disclosed herein, the biological species of the cells is the same as the biological species containing tau, thereby enabling more reliable inhibition of cell proliferation involving tau.

[0018] 1 is a graph showing cell viability of neuroblastoma cells in one embodiment of the double-stranded RNA disclosed herein.

[0019] <Definition of Terms> The technology disclosed herein is described in detail below. Matters other than those specifically mentioned in this specification (e.g., the structure of double-stranded RNA) that are necessary for implementing this technology (e.g., general matters such as methods for synthesizing polynucleotides, cell culture techniques, and constructs mainly composed of peptides or nucleic acids) can be understood as design matters of a person skilled in the art based on conventional technology in the fields of cell engineering, physiology, medicine, pharmacology, organic chemistry, biochemistry, genetic engineering, protein engineering, molecular biology, genetics, etc. The technology disclosed herein can be implemented based on the content disclosed in this specification and common general technical knowledge in the relevant field.

[0020] As used herein, the term "polynucleotide" refers to a polymer in which multiple (two or more) nucleotides are linked by phosphodiester bonds, and is not limited by the number of nucleotides. For example, a "polynucleotide" herein also encompasses those containing both deoxyribonucleotides and nucleotides. Furthermore, as used herein, the term "artificially designed polynucleotide" refers to a polynucleotide whose nucleotide chain (full length) does not exist alone in nature, but is artificially synthesized by chemical synthesis or biosynthesis (i.e., production based on genetic engineering).

[0021] As used herein, the terms "first strand" and "second strand" refer to one being a sense strand (or coding strand or passenger strand) and the other being an antisense strand (or template strand or non-coding strand or guide strand). That is, if the first strand is a sense strand, the second strand refers to an antisense strand. Also, if the second strand is a sense strand, the first strand refers to an antisense strand. The first strand and the second strand may be completely complementary to each other, or may be at least partially complementary. That is, they may be capable of hybridizing at least under physiological conditions.

[0022] In the present specification, unless the notation "5'" and "3'" is used, the left side of a base sequence always indicates the 5'-terminal side and the right side indicates the 3'-terminal side. Furthermore, in the present specification, the term "amino acid residue" includes the N-terminal amino acid and the C-terminal amino acid of a peptide chain, unless otherwise specified. Furthermore, in the amino acid sequences described in the present specification, the left side always indicates the N-terminal side and the right side indicates the C-terminal side.

[0023] As used herein, the term "tumor" is broadly interpreted and refers to tumors in general (typically malignant tumors), including carcinomas and sarcomas, as well as lesions of the blood or hematopoietic tissues (leukemia, lymphoma, etc.). Furthermore, "tumor cells" are synonymous with "cancer cells," and refer to cells that form such tumors, typically cells that have reached the stage of abnormal proliferation independent of surrounding normal tissues (so-called cancerous cells). Therefore, unless otherwise specified, any cell that is classified as a tumor cell (cancer cell) rather than a normal cell is referred to as a tumor cell, regardless of its origin or properties.

[0024] In this specification, when a numerical range is described as "A to B (where A and B are any numerical values)," it means "A or more and B or less," and also includes the meanings of "greater than A and less than B," "greater than A and B or less," and "greater than A and less than B."

[0025] <Tau> As used herein, "tau" is also referred to as tau protein or microtubule associated protein tau (MAPT). However, the term is intended to encompass all synonyms, including naturally occurring tau and its variants. The animal species from which tau is derived is not particularly limited, but is preferably the same as the animal species from which the double-stranded RNA or composition disclosed herein is to be delivered. For example, when delivering the double-stranded RNA or composition disclosed herein to human-derived cells, a base sequence based on the base sequence of tau may be used as the main sequence. Note that while human-derived tau is described as a preferred example, the present technology can also be applied to tau derived from other animal species.

[0026] The tau gene is located on human chromosome 17 (17q21.31, more specifically, approximately base pairs 45894382-46028334 on chromosome 17). The tau gene is primarily expressed in brain tissue. Expression of the tau gene has also been confirmed in tissues such as the kidney, adrenal gland, and prostate. Known tau-related diseases and disorders include Alzheimer's disease, frontotemporal dementia, Parkinson's disease, progressive supranuclear palsy, corticobasal degeneration, Pick's disease, and other tauopathies. Tau typically consists of approximately 412 amino acid residues. Tau has multiple phosphorylation sites. Under normal conditions, tau is soluble and stabilizes microtubules by binding to them. However, excessively phosphorylated tau dissociates from microtubules and forms insoluble aggregates, which accumulate inside and outside the cells. Such tau aggregates have been confirmed in the aforementioned diseases and disorders. The tau gene contains 16 exons. Tau also has several isoforms. For example, in brain tissue, tau is encoded by 11 exons. Alternative splicing of tau exons 2, 3, and 10 results in the formation of six isoforms ranging from approximately 352 to 441 residues. Tau also contains a microtubule-binding domain. This microtubule-binding domain has four repeat segments (R1, R2, R3, and R4). Among the above-mentioned isoforms, there are 3R-type isoforms (R1, R3, and R4) that have three repeat segments, and 4R-type isoforms (R1, R2, R3, and R4) that have four repeat segments. It is known that different isoforms cause different diseases and disorders. Tau mutations can also cause various cancers, including neuroblastoma, kidney cancer, lung cancer, breast cancer, and prostate cancer. As described above, tau causes different diseases and illnesses due to structural changes, etc. Therefore, it has been difficult for antibody drugs targeting tau to stably bind antibodies to tau protein. In contrast, the double-stranded RNA and composition disclosed herein suppress or inhibit the expression level of tau, and inhibit the proliferation of abnormal cells such as cells in which tau accumulates due to the above-mentioned diseases and illnesses, and tumor cells.

[0027] The nucleotide sequence of tau can be obtained from international databases, such as the National Center for Biotechnology Information (NCBI), the European Nucleotide Archive (ENA), the DNA Data Bank of Japan (DDBJ), UniProt, Ensembl, etc. Specifically, the nucleotide sequence of human tau is provided by NCBI under the accession number AY730549.1, etc.

[0028] The entire amino acid sequence of human tau consists of 412 amino acid residues as shown in SEQ ID NO: 9. The base sequence encoding such human tau is composed of 1239 bases as shown in SEQ ID NO: 10.

[0029] <Double-Stranded RNA> The double-stranded RNA of the present disclosure is a double-stranded RNA consisting of a first strand and a second strand. Hereinafter, the first strand will be referred to as the sense strand and the second strand as the antisense strand, as will be described in detail. The sense strand is composed of a main sequence consisting of 19 to 23 bases, the 5'-terminal base of which is guanine (G) or cytosine (C), and an additional sequence consisting of 2 to 4 bases added to the 3'-terminal side of the main sequence. Furthermore, the main sequence is determined from the base sequence encoding tau.

[0030] The main sequence is typically composed of a polynucleotide, which is a polymer of ribonucleotides. In other words, the main sequence is composed of RNA. That is, the base sequence of the main sequence is typically represented by the four letters A (adenine), U (uracil), G (guanine), and C (cytosine), or the four letters a, u, g, and c. However, in the attached sequence listing, uracil may be represented by T (thymine).

[0031] The main sequence of the sense strand may be a partial base sequence of the base sequence encoding tau, allowing the double-stranded RNA to function as a tau-targeting siRNA (small interfering RNA).

[0032] The double-stranded RNA disclosed herein can at least function as an siRNA. That is, such double-stranded RNA is predicted to induce RNA interference (RNAi). RNAi is a gene silencing process in which short double-stranded RNAs such as siRNAs suppress gene expression in a sequence-specific manner. When siRNAs are introduced into cells, they form a complex called RISC (RNA-induced silencing complex) with intracellular proteins. RISC binds to homologous sequences in mRNA transcribed from the target gene (here, the tau gene) and specifically cleaves the mRNA, thereby inhibiting translation.

[0033] The main sequence of the sense strand is preferably selected from the base sequence encoding tau, but one or more bases (e.g., two bases) may be substituted with other bases, deleted, and / or added (inserted) within the scope that the effects of the present technology are exhibited.

[0034] The proportion of the base sequence encoding tau in the main sequence of the sense strand is, when the entire main sequence is taken as 100%, preferably 45% or more, and may be 60% or more, 75% or more, 90% or more, or 100% or more.

[0035] The 5' end of the main sequence of the sense strand is preferably guanine or cytosine. Because guanine and cytosine have stronger binding strength with complementary strands than adenine and uracil, the stability of the 5' end of the sense strand (i.e., the 3' end of the antisense strand) is increased. In other words, the stability of the 5' end of the antisense strand is relatively reduced. Although the details of the mechanism are unclear, RISC, an RNAi-related protein, tends to preferentially incorporate the sense strand or the antisense strand, whichever is more energetically unstable at the 5' end. Therefore, by having guanine or cytosine at the 5' end of the main sequence, the antisense strand can be more easily incorporated into RISC, thereby more effectively inducing RNAi. This allows the double-stranded RNA to function favorably as siRNA.

[0036] Of the five bases on the 3'-end of the main sequence of the sense strand, adenine and / or uracil preferably constitutes 60% or more (i.e., 3 or more bases), but may also comprise 80% or more (i.e., 4 or more bases), or even 100% (i.e., 5 bases). This makes the 5'-end of the antisense strand less stable than the 3'-end. As a result, the antisense strand is more easily incorporated into RISC, allowing for more effective induction of RNAi.

[0037] The GC content of the entire main sequence of the sense strand (the total proportion of G and C in the entire base sequence constituting the main sequence) is not particularly limited, but may be, for example, 20% to 60% or less, preferably 30% to 50% or less, or may be 30% to 45% or less. The GC content is a parameter related to the binding strength between the antisense strand incorporated into RISC and RNA having the main sequence, the ease of cleavage of RNA, etc. With this GC content, the effect of RNAi can be efficiently exerted.

[0038] As shown in Figure 1, for example, the main sequence of the sense strand can be selected from 19 to 23 bases of G or C of a gene encoding tau. For example, the main sequence can be any of the following base sequences: GUGGCAGUGGUCCGUACUCCA (SEQ ID NO: 1); GGCAGUGGUCCGUACUCCA (SEQ ID NO: 2); CCCAUGCCAGACCUGAAGA (SEQ ID NO: 3); CCAUGCCAGACCUGAAGAA (SEQ ID NO: 4); CAUGCCAGACCUGAAGAAU (SEQ ID NO: 5); CCAGACCUGAAGAAUGUCA (SEQ ID NO: 6); CAGACCUGAAGAAUGUCAA (SEQ ID NO: 7); GACCUGAAGAAUGUCAAGU (SEQ ID NO: 8). The base sequences shown in SEQ ID NOs: 1 and 8 are both composed of RNA. The base sequences shown in SEQ ID NOs: 1 and 8 are both specific to tau, and can avoid the risk of inhibiting translation of mRNA in a host cell having a base sequence similar to the target sequence (so-called off-target effect). SEQ ID NOs: 27 to 34 are the base sequences of genes encoding tau corresponding to the RNA sequences of SEQ ID NOs: 1 to 8.

[0039] The nucleotide sequence shown in SEQ ID NO:27 (DNA sequence corresponding to the RNA sequence of SEQ ID NO:1) is the nucleotide sequence from 591 to 611 of the nucleotide sequence encoding human tau (i.e., the sequence from the start codon to the stop codon). The nucleotide sequence shown in SEQ ID NO:28 (DNA sequence corresponding to the RNA sequence of SEQ ID NO:2) is the nucleotide sequence from 593 to 611 of the nucleotide sequence encoding human tau. The nucleotide sequence shown in SEQ ID NO:29 (DNA sequence corresponding to the RNA sequence of SEQ ID NO:3) is the nucleotide sequence from 658 to 676 of the nucleotide sequence encoding human tau. The nucleotide sequence shown in SEQ ID NO:30 (DNA sequence corresponding to the RNA sequence of SEQ ID NO:4) is the nucleotide sequence from 659 to 677 of the nucleotide sequence encoding human tau. The nucleotide sequence shown in SEQ ID NO:31 (DNA sequence corresponding to the RNA sequence of SEQ ID NO:5) is the nucleotide sequence from 660 to 678 of the nucleotide sequence encoding human tau. The nucleotide sequence shown in SEQ ID NO: 32 (DNA sequence corresponding to the RNA sequence of SEQ ID NO: 6) is the nucleotide sequence from bases 664 to 682 of the nucleotide sequence encoding human tau. The nucleotide sequence shown in SEQ ID NO: 33 (DNA sequence corresponding to the RNA sequence of SEQ ID NO: 7) is the nucleotide sequence from bases 665 to 683 of the nucleotide sequence encoding human tau. The nucleotide sequence shown in SEQ ID NO: 34 (DNA sequence corresponding to the RNA sequence of SEQ ID NO: 8) is the nucleotide sequence from bases 667 to 685 of the nucleotide sequence encoding human tau.

[0040] Double-stranded RNAs composed of the main sequences shown in SEQ ID NOs: 1 to 8 can suppress or inhibit the proliferation of at least one type of cell by supplying them to tumor cells (e.g., neuroblastoma, etc.). Typically, by supplying them to tumor cells, the proliferation of the tumor cells can be suppressed or inhibited. Note that tau is overexpressed in abnormal cells such as tumor cells compared to its expression in normal cells. Therefore, even if the double-stranded RNA disclosed herein is supplied to normal cells, the presence of tau is minimal compared to abnormal cells, and therefore the double-stranded RNA is thought to have little effect.

[0041] <Additional Sequence> The sense strand of the double-stranded RNA disclosed herein may have an additional sequence consisting of 2 to 4 bases added to the 5'-end or 3'-end of the main sequence. Preferably, the additional sequence is added to the 3'-end of the main sequence. The addition of an additional sequence can more effectively induce RNAi.

[0042] The additional sequence is composed of a polynucleotide (dimer, trimer, or tetramer). The polynucleotide constituting the additional sequence may be composed of only ribonucleotides, only deoxynucleotides, or both ribonucleotides and deoxynucleotides. That is, the sense strand and the antisense strand may be entirely RNA, or may be chimeric polynucleotides of RNA and DNA. The additional sequence may also contain modified deoxyribonucleotides, modified ribonucleotides, other known nucleotide analogs, and the like.

[0043] The base sequence constituting the additional sequence is not particularly limited, but preferably contains at least one base of adenine, uracil, or thymine. From the viewpoint of improving the stability of the double-stranded RNA, the base sequence constituting the additional sequence is more preferably TT (thymine-thymine).

[0044] <Sense strand and antisense strand> The sense strand is composed of, for example, a base sequence of 21 to 27 bases, and may be composed of 21 to 25 bases, or 21 to 23 bases. In a preferred example, it is composed of 21 bases consisting of a 19-base main sequence and a 2-base additional sequence, or 23 bases consisting of a 21-base main sequence and a 2-base additional sequence. In such an example, RNAi can be effectively induced.

[0045] The antisense strand has a base sequence complementary to the main sequence of the sense strand. This allows the antisense strand to hybridize with the sense strand, forming a double-stranded structure. The base sequence of the antisense strand may also be partially complementary to the main sequence of the sense strand. That is, one or more bases (e.g., two bases) of the antisense strand may be substituted, deleted, and / or added (inserted) with other bases. As long as the sense strand and the antisense strand can hybridize at least under physiological conditions, they can function as siRNA. The complementary base sequence is typically composed of a ribonucleotide polymer (RNA).

[0046] In the double-stranded RNA disclosed herein, the sense strand or antisense strand is typically composed of chemically unmodified ribonucleotides (RNA). However, the double-stranded RNA of the present disclosure may also contain DNA, as well as chemically modified DNA or RNA, or other known nucleotide analogs, to the extent that the technology of the present disclosure is not significantly impaired. That is, one or more bases (e.g., two or more to five or less bases) in the sense strand or antisense strand may be substituted with chemically modified RNA (or DNA) such as methylated or pseudouridylated. Examples of such chemically modified RNA or DNA include pseudouridine, N1-methylpseudouridine, 5-methylcytosine, inosine, and acyclic artificial nucleic acids. For example, one or more uridine bases (e.g., two bases) in the double-stranded RNA of the present disclosure can be substituted with pseudouridine. Furthermore, the sense strand or antisense strand may have a ligand that binds to a receptor specifically expressed in the target cells. The ligand can be added, for example, to the 5'-end and / or 3'-end of the sense strand or antisense strand. The ligand can be, for example, N-acetylgalactosamine (GalNAc) or a derivative thereof. Having GalNAc as the ligand can improve delivery to hepatocytes.

[0047] In the double-stranded RNA of the present disclosure, the antisense strand may be composed of a main sequence complementary to the main sequence of the sense strand and an additional sequence consisting of 2 to 4 bases added to the 5'-end or 3'-end of the complementary main sequence. From the viewpoint of improving the function of the siRNA, the additional sequence may be added to the 3'-end of the complementary base sequence. In a preferred example, when the additional sequence of the sense strand is added to the 3'-end of the main sequence, the additional sequence of the antisense strand is added to the 3'-end of the complementary base sequence. The configuration of the additional sequence in the antisense strand may be the same as the configuration of the additional sequence in the sense strand described above. Typically, the base sequence of the additional sequence in the antisense strand is the same as the additional sequence in the sense strand to which it hybridizes, but it may also be a different base sequence.

[0048] The antisense strand is composed of, for example, a base sequence of 21 to 27 bases, and may be composed of 21 to 25 bases, or 21 to 23 bases. The antisense strand is composed of a base sequence of the same length as the sense strand, and all or part of the base sequence excluding the additional sequence is composed of a base sequence complementary to the main sequence of the sense strand. In a preferred example, the antisense strand is composed of a base sequence of the same length as the sense strand, and all of the base sequence excluding the additional sequence is composed of a base sequence complementary to the main sequence of the sense strand.

[0049] <Method for Producing Double-Stranded RNA> The sense strand and antisense strand constituting the double-stranded RNA disclosed herein can be produced according to a general chemical synthesis method. For example, they can be synthesized using a commercially available DNA / RNA automatic synthesizer. Alternatively, the sense strand and antisense strand may be synthesized in vitro or in vivo based on genetic engineering techniques. The synthesized sense strand and antisense strand are preferably purified, and can be purified, for example, by HPLC or the like.

[0050] The double-stranded RNA disclosed herein can be produced, for example, by annealing (hybridizing) a sense strand and an antisense strand. Annealing can be performed according to conventional methods. For example, annealing can be performed by mixing equal amounts of the sense strand and the antisense strand in a solvent, heating at 90°C for 1 to 5 minutes, and then cooling to 4°C to room temperature. Examples of such solvents that can be used include distilled water, pure water, ultrapure water, and buffers (e.g., HEPES-KOH buffer at pH 7.4, PBS, etc.). To prevent active RNase (RNA degrading enzyme) from being mixed into the solvent, solvents that have been treated with, for example, DEPC or autoclaved are preferably used.

[0051] <Other Embodiments of Double-Stranded RNA> The double-stranded RNA disclosed herein also includes those in which the first strand and the second strand form a locally double-stranded structure via a loop structure. That is, the double-stranded RNA can also be used as an shRNA (short hairpin RNA) in another embodiment. shRNA is an RNA in which a main sequence and its complementary sequence exist on a single strand, and a loop sequence exists to form these loop structures. By having the loop structure, the shRNA hybridizes with the main sequence and its complementary sequence to form a locally double-stranded structure. This allows the shRNA to be processed by Dicer, an enzyme present in cells, to form the siRNA of the above-mentioned embodiment.

[0052] The structure of the shRNA may be the same as that of conventionally known shRNA. The length of the shRNA may be, for example, 50 to 70 bases. The length of the loop sequence may be, for example, 19 to 29 bases. The shRNA may be incorporated into a vector (e.g., a lentivirus expression vector). Use of the shRNA can stably induce RNAi in cells and stably suppress viral proliferation.

[0053] <Composition> The composition disclosed herein contains the double-stranded RNA described above. In addition to the double-stranded RNA described above, the composition may contain various pharmaceutically acceptable carriers depending on the intended use. Preferred carriers include those commonly used in medicines as diluents, excipients, etc. The carriers vary depending on the intended use and form of the composition. Typical examples include water, physiological buffer solutions, various organic solvents, etc. The carrier may also be an aqueous solution of an appropriate concentration of alcohol (e.g., ethanol), glycerol, a non-drying oil such as olive oil, or liposomes. Examples of secondary components that may be contained in the pharmaceutical composition include various fillers, extenders, binders, humectants, surfactants, dyes, fragrances, etc. The composition may also contain carriers used in conventional drug delivery systems (DDS).

[0054] The form of the composition disclosed herein is not particularly limited. For example, typical composition forms include solutions, suspensions, emulsions, aerosols, foams, granules, powders, tablets, capsules, and ointments. Furthermore, for use in injections, etc., the composition can be made into a lyophilized product or granulated product that is dissolved in physiological saline or an appropriate buffer solution (e.g., PBS) immediately before use to prepare a medicinal solution. Furthermore, the process of preparing various forms of drugs (compositions) using double-stranded RNA (main component) and various carriers (secondary components) can be based on conventionally known methods. Since such formulation methods do not characterize the present disclosure, detailed explanations are omitted. For example, a detailed source of information regarding formulations is "Comprehensive Medicinal Chemistry," edited by Corwin Hansch, published by Pergamon Press (1990).

[0055] The compositions disclosed herein inhibit the proliferation of at least one type of cell. The cells whose proliferation is inhibited are cells in which expression of the tau gene is involved, such as tumor cells (e.g., sarcoma, neuroblastoma, breast cancer cells, prostate cancer cells, etc.), brain cells, and nerve cells. Among these, the compositions disclosed herein preferably inhibit the proliferation of tumor cells because they overexpress tau. In other words, the double-stranded RNA and compositions disclosed herein can be preferably used as antitumor agents (anticancer agents) that suppress the proliferation of tumor cells.

[0056] One embodiment of the composition disclosed herein includes, in addition to the double-stranded RNA described above, a peptide fragment (cell-penetrating peptide, CPP) that has cell membrane permeability and can pass through the cell membrane from the outside of a cell to introduce a foreign substance into the cytoplasm. The peptide fragment is directly or indirectly linked to the double-stranded RNA of the present disclosure to construct a construct of the peptide fragment and double-stranded RNA. Generally, double-stranded RNA is negatively charged and therefore cannot pass through the cell membrane. However, for example, by directly or indirectly linking the double-stranded RNA disclosed herein to the N-terminus and / or C-terminus of the peptide fragment, the construct of the peptide fragment and the double-stranded RNA can be introduced into the cytoplasm. The number of amino acid residues in the peptide fragment is not limited as long as cell membrane permeability is not impaired.

[0057] When the peptide fragment and the double-stranded RNA are indirectly bound, for example, a linker is placed between the peptide fragment and the double-stranded RNA. The type of linker is not particularly limited. Typically, it is a peptidic linker, a non-peptidic linker, or the like. Furthermore, the method for binding the peptide fragment and the double-stranded RNA is not particularly limited, and can be carried out according to various conventionally known scientific techniques.

[0058] One embodiment of the composition disclosed herein comprises a peptide fragment and the double-stranded RNA of the present disclosure. However, the double-stranded RNA does not necessarily have to be bound to the N- or C-terminus of the peptide fragment. In such an embodiment, the double-stranded RNA and the peptide fragment may form a complex, for example, through electrical or molecular interaction. Such a complex is more easily introduced into eukaryotic cells, thereby enabling efficient introduction of the double-stranded RNA. Nucleic acids such as double-stranded RNA are typically negatively charged. Therefore, the peptide fragment used preferably has a high proportion of basic amino acids and is positively charged. Furthermore, the proportion of the peptide fragment in this case may be 5 to 100 times, preferably 40 to 60 times, the molar ratio of the double-stranded RNA.

[0059] <Method for producing the composition disclosed herein and use thereof> The present disclosure may provide a method for inhibiting the proliferation of at least one type of cell using the composition disclosed herein. The method disclosed herein includes the steps of preparing the composition disclosed herein and supplying the composition to a target cell.

[0060] In the preparation step, for example, as described above, the composition disclosed herein may be prepared by a conventionally known method.

[0061] In the supplying step, the composition disclosed herein is supplied to at least one type of cell (e.g., tumor cells, etc.) in vivo or ex vivo. The species of the cells to be supplied is not particularly limited and may be, for example, mammals, birds, amphibians, reptiles, fish, etc. Preferably, the species from which tau, which is the basis for the main sequence of the double-stranded RNA contained in the composition, is derived is the same as the species of the target cells. The type of target cells is also not particularly limited, but is preferably tumor cells, more preferably neuroblastoma or lung cancer cells. Note that, although cells other than tumor cells may be present at the destination of the composition, the composition may be supplied only to the target cells (i.e., tumor cells).

[0062] The method of administering the composition may be similar to methods conventionally used in animal treatments and is not particularly limited. The composition can be used in vivo in a manner and dosage appropriate for its form and purpose. For example, as a liquid formulation, it can be administered in a desired amount to the affected area (e.g., malignant tumor tissue, virus-infected tissue, inflammatory tissue, etc.) of a patient or animal (i.e., living body) by intravenous, intralymphatic, intramuscular, subcutaneous, intradermal, or intraperitoneal injection. Alternatively, a solid form such as a tablet, or a gel or aqueous jelly such as an ointment, can be administered directly to a specific tissue (e.g., an affected area such as a tissue or organ containing tumor cells, inflammatory cells, etc.). Alternatively, a solid form such as a tablet can be administered orally. For oral administration, encapsulation or application of a protective (coating) material is preferred to prevent degradation by digestive enzymes in the digestive tract.

[0063] The amount of the composition to be supplied in vivo is not particularly limited. For example, the lower limit of the amount of double-stranded RNA per kg of animal may be, for example, 0.01 mg or more, 0.05 mg or more, or 0.1 mg or more. The upper limit of the amount of double-stranded RNA per kg of animal may be, for example, 10 mg or less, 5 mg or less, or 1 mg or less. Furthermore, the amount of the composition to be supplied in vitro is not particularly limited. In the culture medium of the subject to be supplied, such as cells, the lower limit of the double-stranded RNA concentration may be, for example, 1 nM or more, 5 nM or more, or 10 nM or more. Furthermore, the upper limit of the double-stranded RNA concentration in such culture medium may be, for example, 5 μM or less, 2 μM or less, 1 μM or less, or 100 nM or less.

[0064] The compositions disclosed herein can be delivered to the interior of target cells by known transfection methods. Examples include chemical gene transfer methods using cationic molecules (e.g., commercially available transfection reagents), physical transfer methods such as microinjection and electroporation, and biological gene transfer methods using viruses. Alternatively, as described above, the compositions may be delivered to the interior of cells using cell membrane-permeable peptide fragments.

[0065] Below, several test examples relating to the technology disclosed herein will be described, but it is not intended that the technology disclosed herein be limited to those shown in these test examples.

[0066] <Preparation of siRNA> Polynucleotides having the base sequences shown in SEQ ID NOS: 11 to 26 were artificially synthesized. The base sequences of each polynucleotide are shown in Table 1. In each polynucleotide, the "TT" (additional sequence) at the 3' end is DNA, and the remaining sequence (main sequence) is composed of RNA. The obtained polynucleotides were annealed with a sense strand and an antisense strand having complementary sequences to prepare the siRNAs used in Samples 1 to 8 shown in Table 1. Each of the siRNAs shown in Samples 1 to 8 was dissolved in PBS to give an RNA concentration of 2 mM, preparing an RNA solution.

[0067]

[0068] As shown in Table 1, the sense strand of the siRNA of Sample 1 is composed of a main sequence (part of the base sequence encoding human tau) consisting of SEQ ID NO: 1 and an additional sequence consisting of TT added to the 3'-end of the main sequence. Similarly, the sense strands of the siRNA of Samples 2 to 8 shown in Table 1 are composed of a main sequence (part of the base sequence encoding human tau) consisting of SEQ ID NOs: 2 to 8 and an additional sequence consisting of TT added to the 3'-end of the main sequence. The antisense strand in each example is composed of a sequence complementary to the main sequence of the sense strand and an additional sequence consisting of TT added to the 3'-end of the sequence.

[0069] <Cell proliferation test> Human neuroblastoma cells, the SK-N-SH strain, were used as tumor cells. The SK-N-SH strain was pre-cultured in a culture medium containing 10% FBS (fetal bovine serum) + E-MEM (Fujifilm Wako Pure Chemical Industries, Ltd., Cat No. 051-07615) + 1% MEM non-essential amino acid solution (Fujifilm Wako Pure Chemical Industries, Ltd., Cat No. 139-15651). Note that 0.5% penicillin-streptomycin (Fujifilm Wako Pure Chemical Industries, Ltd., Cat No. 168-23191) was added to the culture medium only during pre-culture, but was not added during the following culture and evaluation.

[0070] On day 1, the SK-N-SH cells that had adhered to the culture plate were washed with PBS, and then a 0.25% trypsin / EDTA solution was added and incubated at 37°C for 2 minutes. After this incubation, the above-mentioned culture medium was added to inactivate the trypsin. The cells were then precipitated by centrifugation at 150 x g for 5 minutes. After removing the supernatant resulting from centrifugation, the above-mentioned culture medium was added to the precipitate (cell pellet), and approximately 5 x 10 4 Three commercially available 96-well plates were prepared, and the cell suspension was added to each well at 5 × 10 cells / mL. 3 The cells were seeded at 100 μL per well and incubated at 37°C, 5% CO 2 and incubated overnight under

[0071] (Sample 1) On the second day, 3 μL of RNA solution adjusted to 2 mM with PBS was mixed with 75 μL of Opti-MEM™ to prepare Solution A. Furthermore, 4.5 μL of Lipofectamine™ RNAiMAX was mixed with 75 μL of Opti-MEM™ to prepare Solution B. Next, equal amounts of Solution A and Solution B were mixed to prepare Solution C, which was then incubated at room temperature for 5 minutes. The prepared Solution C was added to wells where SK-N-SH cells had been cultured, at 11 μL / well (final siRNA concentration: 0.4 μM). The mixture was then incubated at 37°C, 5% CO 2 The mixture was incubated under reduced pressure for 3 days.

[0072] Cell proliferation was evaluated using Cell Counting Kit-8 (CCK-8, Dojin Kagaku Kenkyusho). On day 5 (day 3 after siRNA addition), one 96-well plate containing SK-N-SH cells was removed, 10 μL of CCK-8 was added to each well, and the cells were incubated at 37°C, 5% CO 2 The wells were incubated under 450 nm for 3 hours. The absorbance at 450 nm was measured for each well. The absorbance was calculated as the average value of three wells. In addition, a blank well was prepared containing only the culture medium and CCK-8 reagent. The absorbance of Sample 1 minus the absorbance of the blank was used as the measured value for Sample 1.

[0073] (Samples 2 to 8) Samples 2 to 8 were prepared in the same manner as Sample 1, except that the siRNA in Sample 1 was changed to the siRNA of Samples 2 to 8 shown in Table 1.

[0074] Comparative Example In the comparative example, the same procedure was followed as in sample 1, except that a PBS solution was used instead of the RNA solution in sample 1. In other words, no siRNA was introduced in the comparative example.

[0075] Untreated wells were prepared in the same manner as in Example 1, except that the RNA solution and Lipofectamine™ RNAiMAX were not added. The cell viability in each test example is expressed as a percentage, with the measured value for the untreated well set at 100%, and is shown in Figure 1.

[0076] As shown in Figure 1, Samples 1 to 8 had significantly lower cell viability than the comparative example. Furthermore, among these, the siRNAs of Samples 1 to 8 were particularly effective in inhibiting the proliferation of neuroblastoma cells. Therefore, it is believed that the siRNAs of Samples 1 to 8 have the function of inhibiting the proliferation of tumor cells (here, neuroblastoma).

[0077] Although specific examples of the technology disclosed herein have been described in detail above, these are merely examples and do not limit the scope of the claims. The technology described in the claims includes various modifications and alterations of the specific examples exemplified above.

[0078] In the technology disclosed herein, each component and each process mentioned herein may be omitted or combined as appropriate, unless a particular problem arises. This specification also includes the disclosures described in the following sections.

[0079] Item 1: A double-stranded RNA consisting of a first strand and a second strand complementary to the first strand, comprising a main sequence determined from the base sequence encoding tau, and an additional sequence consisting of 2 to 4 bases added to the 3'-end of the main sequence, the double-stranded RNA comprising: GUGGCAGUGGUCCGUACUCCA (SEQ ID NO: 1); GGCAGUGGUCCGUACUCCA (SEQ ID NO: 2); CCCAUGCCAGACCUGAAGA (SEQ ID NO: 3); CCAUGCCAGACCUGAAGAA (SEQ ID NO: 4); CAUGCCAGACCUGAAGAAU (SEQ ID NO: 5); CCAGACCUGAAGAAUGUCA (SEQ ID NO: 6); CAGACCUGAAGAAUGUCAA (SEQ ID NO: 7); GACCUGAAGAAUGUCAAGU (SEQ ID NO: 8);

[0080] Item 2: The double-stranded RNA according to Item 1, wherein the second strand comprises a main sequence complementary to the first strand and an additional sequence consisting of 2 to 4 bases added to the 3'-end of the complementary main sequence.

[0081] Item 3: A double-stranded RNA having a first strand and a second strand, wherein the first strand comprises a main sequence including a part of a base sequence encoding tau, and the second strand comprises a complementary main sequence that binds to the main sequence, wherein the main sequence is a base sequence of 19 to 23 bases, and has one of the following base sequences: GUGGCAGUGGUCCGUACUCCA (SEQ ID NO: 1); GGCAGUGGUCCGUACUCCA (SEQ ID NO: 2); CCCAUGCCAGACCUGAAGA (SEQ ID NO: 3); CCAUGCCAGACCUGAAGAA (SEQ ID NO: 4); CAUGCCAGACCUGAAGAAU (SEQ ID NO: 5); CCAGACCUGAAGAAUGUCA (SEQ ID NO: 6); A double-stranded RNA comprising either of the following: CAGACCUGAAGAAUGUCAA (SEQ ID NO: 7); GACCUGAAGAAUGUCAAGU (SEQ ID NO: 8);

[0082] Item 4: The double-stranded RNA according to Item 3, wherein the first strand comprises an additional sequence consisting of 2 to 4 bases added to the 3'-end of the main sequence, and the second strand comprises an additional sequence consisting of 2 to 4 bases added to the 3'-end of the complementary main sequence.

[0083] Item 5: The double-stranded RNA according to Item 2 or 4, wherein the base sequence constituting the additional sequence is thymine-thymine (TT).

[0084] Item 6: A composition that inhibits the proliferation of at least one type of cell, comprising the double-stranded RNA of any one of Items 1 to 5.

[0085] Item 7: The composition of Item 4, wherein the cells are tumor cells.

[0086] Item 8: The composition according to Item 6 or 7, wherein the composition comprises a peptide fragment having cell membrane permeability that can pass through the cell membrane from the outside of the cell and introduce a foreign substance into the cytoplasm.

[0087] Item 9: A method for suppressing the proliferation of at least one type of cell, the method comprising: preparing the composition according to any one of Items 6 to 8; and supplying the composition to the cell in vitro.

[0088] Item 10: The method according to Item 9, wherein the biological species of the cells is the same as the biological species containing the tau.

[0089] As described above, the double-stranded RNA disclosed herein can inhibit (or suppress) cell proliferation, and therefore, by using the double-stranded RNA, a composition (e.g., an anti-tumor agent) that inhibits the proliferation of at least one type of cell (e.g., tumor cell) can be provided.

Claims

1. A double-stranded RNA having a first strand and a second strand, wherein the first strand comprises a main sequence including a portion of a base sequence encoding tau, and the second strand comprises a complementary main sequence that binds to the main sequence, wherein the main sequence is a base sequence of 19 to 23 bases, and has one of the following base sequences: GUGGCAGUGGUCCGUACUCCA (SEQ ID NO: 1); GGCAGUGGUCCGUACUCCA (SEQ ID NO: 2); CCCAUGCCAGACCUGAAGA (SEQ ID NO: 3); CCAUGCCAGACCUGAAGAA (SEQ ID NO: 4); CAUGCCAGACCUGAAGAAU (SEQ ID NO: 5); CCAGACCUGAAGAAUGUCA (SEQ ID NO: 6); A double-stranded RNA comprising either of the following: CAGACCUGAAGAAUGUCAA (SEQ ID NO: 7); GACCUGAAGAAUGUCAAGU (SEQ ID NO: 8); 2. The double-stranded RNA according to claim 1, wherein the first strand comprises an additional sequence consisting of 2 to 4 bases added to the 3' end of the main sequence, and the second strand comprises an additional sequence consisting of 2 to 4 bases added to the 3' end of the complementary main sequence.

3. The double-stranded RNA according to claim 1, wherein the base sequence constituting the additional sequence is thymine-thymine (TT).

4. A composition for inhibiting the proliferation of at least one type of cell, comprising the double-stranded RNA according to any one of claims 1 to 3.

5. The composition of claim 4, wherein the cells are tumor cells.

6. The composition according to claim 4, comprising a peptide fragment having cell membrane permeability that can pass through the cell membrane from the outside of the cell and introduce a foreign substance into the cytoplasm.

7. A method for inhibiting the proliferation of at least one type of cell, comprising the steps of: providing a composition according to claim 4; and delivering said composition to said cells in vitro.

8. The method according to claim 7, wherein the biological species of the cells is the same as the biological species in which the tau is contained.

Citation Information

Patent Citations

  • NOVEL siRNA BASED ON SARS-CoV-2 RNA SEQUENCE, AND USE OF THE SAME

    JP2023013932A

  • Microtubule associated protein TAU (MAPT) irna agent compositions and methods of use thereof

    WO2023154900A2

  • MAPT siRNA AND USES THEREOF

    WO2023175091A2