Ascomycete strain in which UBQ14 gene and / or FLBD gene is knocked out, and use thereof

Knocking out UBQ14 and/or FLBD genes in ascomycetes enhances protein and biomass production, addressing the completeness and consumer acceptance issues of current mycoprotein products by increasing essential amino acids and reducing lipids, making them suitable for food and food additives.

WO2026049452A1PCT designated stage Publication Date: 2026-03-05SEOUL NATIONAL UNIVERSITY R&DB FOUNDATION +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/012939
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-26
Filing Date
2025-08-25
Publication Date
2026-03-05

AI Technical Summary

Technical Problem

Current mycoprotein products derived from filamentous fungi lack completeness and consumer acceptance, necessitating the development of high-value alternative protein sources with enhanced fungal biomass and protein content.

Method used

Knocking out the UBQ14 and/or FLBD genes in ascomycete strains to promote protein and biomass production, increasing essential amino acid content and reducing lipid content.

Benefits of technology

The mutant ascomycete strains exhibit increased protein and biomass production, offering a high-value alternative protein source with improved nutritional content and potential as food or food additives.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025012939_05032026_PF_FP_ABST
    Figure KR2025012939_05032026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a mutant ascomycete strain with knocked-out ubiquitination-related genes and / or spore production-related genes, the mutant ascomycete strain exhibiting an excellent protein or biomass production effect and, more specifically, provides: a mutant ascomycete strain in which UBQ14 and / or FLBD genes are knocked out; a composition for protein or biomass production comprising same; and a composition for food or food additive comprising the mutant ascomycete strain.
Need to check novelty before this filing date? Find Prior Art

Description

Ascomycetes in which the UBQ14 gene and / or FLBD gene are knocked out and their uses

[0001] This application claims priority to Republic of Korea Patent Application No. 10-2024-0114545, filed August 26, 2024, the entire disclosure of which is incorporated herein by reference.

[0002] The present invention relates to a mutant ascomycete strain in which a ubiquitination-related gene and / or a spore production-related gene is knocked out, which exhibits excellent protein and / or biomass production effects. More specifically, the present invention provides a mutant ascomycete strain in which the UBQ14 and / or FLBD genes are knocked out; a composition for protein or biomass production comprising the same; and a composition for food or food additive comprising the mutant ascomycete strain.

[0003] As population growth drives increased meat consumption, addressing this demand through traditional livestock farming is deemed difficult due to limited resource utilization. In particular, environmental issues associated with traditional livestock farming methods continue to be raised, necessitating the development of eco-friendly and sustainable alternative protein sources. Fungal-derived protein sources, known as mycoprotein, have the advantage of being able to be cultured quickly with a simple nutrient supply. However, most currently available mycoprotein products lack the completeness of plant-based meat alternatives, resulting in lower consumer acceptance. Therefore, to develop competitive and high-quality alternative protein sources derived from filamentous fungi, a collaborative effort between the biotechnology and food industries is crucial.

[0004] The microorganism used in the present invention, Ascomycota, is a phylum of the Eukaryotic Fungi subphylum, and in addition to common molds such as yeasts, blue molds, and aspergillus, many plant pathogens, and further mushrooms such as Cordyceps sinensis, Toadstool, Magnolia chinensis, Saddle mushroom, Mushroom, Rubber mushroom, and Magnolia spur, belong to this phylum. Except for unicellular yeasts, the fungus body is composed of hyphae, and the hyphae have septa, but they are different from Basidiomycota in that there is no cross-connection in the septa. Reproduction is sexual and asexual, and the formation of asci and ascospores as a result of sexual reproduction is a characteristic of Ascomycota. A novel strain of the genus Aphiochria, one of the Ascomycota, has been registered in Patent Document 1, etc.

[0005] The purpose of the present invention is to propose a target gene for enhancing the value of mycoprotein from these ascomycetes. Furthermore, the primary objective of the present invention is to develop a high-value-added alternative protein material, such as one that increases fungal biomass and protein content, by knocking out the function of the gene.

[0006] [Prior Art Literature]

[0007] [Patent Document]

[0008] (Patent Document 0001) Republic of Korea Patent No. 10-0315098

[0009] Against this backdrop, the present inventors have completed the present invention by confirming that when UBQ14 among ubiquitination-related genes and / or FLBD among sporulation-related genes are knocked out in an ascomycete, an excellent protein or biomass production effect is exhibited.

[0010] Accordingly, the purpose of the present invention is to provide a mutant ascomycota in which the UBQ14 gene and / or the FLBD gene is knocked out.

[0011] In addition, another object of the present invention is to provide a composition for producing protein or biomass comprising the mutant ascomycete strain described above.

[0012] Another object of the present invention is to provide a composition for food or food additive comprising the mutant ascomycete strain described above.

[0013] To solve the above-described problem, a mutant ascomycota strain in which the UBQ14 gene and / or the FLBD gene is knocked out is provided.

[0014] Additionally, it may be characterized in that protein production is promoted when the UBQ14 gene is knocked out.

[0015] At this time, it may be characterized in that biomass production is promoted when the FLBD gene is knocked out.

[0016] At this time, it may be characterized in that protein and biomass production is promoted when the UBQ14 gene and FLBD gene are knocked out.

[0017] At this time, the UBQ14 gene may be characterized by including a base sequence of sequence number 1, and the FLBD gene may be characterized by including a base sequence of sequence number 2.

[0018] At this time, the mutant ascomycete strain may be characterized by increased protein content and / or biomass content and decreased lipid content.

[0019] At this time, the protein may be characterized by containing essential amino acids.

[0020] At this time, the essential amino acid may be at least one selected from the group consisting of phenylalanine, valine, threonine, methionine, leucine, isoleucine, lysine, and histidine.

[0021] At this time, the mutant ascomycete strain may be characterized by an increase in the content of at least one selected from the group consisting of histidine, isoleucine, and methionine.

[0022] At this time, the lipid may be at least one selected from the group consisting of pentadecanoic acid, heptadecanoic acid, arachidonic acid, palmitoleic acid, linoleic acid, stearic acid, and oleic acid.

[0023] At this time, the mutant ascomycete may be of a genus selected from the group consisting of Thermotelomyces, Myceliophthora, Trichoderma, Aspergillus, Penicillium, Rasamsonia, Chrysosporium, Corynascus, Fusarium, Neurospora, and Talaromyces.

[0024] Additionally, the present invention provides a composition for producing a protein or biomass, comprising at least one selected from the group consisting of the above-described mutant ascomycetes, ascomycetes mycelia, ascomycetes lysates, ascomycetes cultures, ascomycetes culture concentrates, ascomycetes culture extracts, and ascomycetes dried products.

[0025] Furthermore, the present invention provides a composition for food or food additive comprising at least one selected from the group consisting of the above-described mutant ascomycetes, ascomycetes mycelia, ascomycetes lysates, ascomycetes cultures, ascomycetes culture concentrates, ascomycetes culture extracts, and ascomycetes dried products.

[0026] The mutant ascomycete strain in which the UBQ14 gene and / or the FLBD gene are knocked out provided in the present invention promotes protein production when the UBQ14 gene is knocked out, promotes biomass production when the FLBD gene is knocked out, and promotes both protein and biomass production when the UBQ14 gene and the FLBD gene are knocked out simultaneously. Therefore, the mutant ascomycete strain of the present invention can be used for protein or biomass production, and has the potential to be utilized as an alternative protein by being used as a food or food additive, and thus has high utility value.

[0027] Figure 1 is a schematic diagram showing the production of mutant F. venenatum by knocking out the genes of F. venenatum.

[0028] Figure 2A shows the results of confirming the degree of vegetative growth of red mold (F. graminearum) in which ubiquitination-related genes (UBQ1, UBQ5-UBQ7, and UBQ9-UBQ14) are knocked out, Figure 2B shows the results of confirming the size of the red mold, and Figure 2C shows the results of confirming the degree of spore production of the red mold.

[0029] Figure 3A shows the results of confirming the degree of vegetative growth of F. venenatum in which the UBQ14 gene is knocked out, Figure 3B shows the results of showing the content of the amino acid series of the F. venenatum as an increase or decrease compared to the wild-type strain, and Figure 3C shows the results of showing the content of the lipid series of the F. venenatum as an increase or decrease compared to the wild-type strain.

[0030] FIG. 4A shows the results of confirming the degree of vegetative growth of F. venenatum in which sporulation-related genes (ABAA, FLBD) are knocked out, FIG. 4B shows the results of showing the size of the F. venenatum, FIG. 4C shows the results of photographing the height of aerial hyphae of the F. venenatum, FIG. 4D shows the results of quantifying the height of aerial hyphae, FIG. 4E shows the results of confirming the degree of spore production of the F. venenatum, FIG. 4F shows the results of confirming the development of spores and cells involved in spore production of the F. venenatum through a microscope, and FIG. 4G shows the results of confirming the degree of biomass content of the F. venenatum.

[0031] FIG. 5A shows the results of confirming the degree of vegetative growth of F. venenatum in which the UBQ14 gene and FLBD gene are knocked out, FIG. 5B shows the results of confirming the biomass content of the F. venenatum, FIG. 5C shows the results of showing the content of the amino acid series of the F. venenatum as an increase or decrease compared to the wild type strain, and FIG. 5D shows the results of showing the content of the lipid series of the F. venenatum as an increase or decrease compared to the wild type strain.

[0032] Figure 6 shows the results of comparing the biomass content of F. venenatum in which the UBQ14 gene and / or FLBD gene is knocked out and the wild type strain.

[0033] Figure 7 shows the results of comparing the body length and activity of F. venenatum with the UBQ14 gene and FLBD gene knocked out and the wild-type strain, and then treating the mycelia to C. elegans.

[0034] Hereinafter, the present invention will be described in more detail.

[0035] Meanwhile, each description and embodiment disclosed herein can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed herein fall within the scope of the present invention. Furthermore, the scope of the present invention is not limited by the specific descriptions described below.

[0036] Furthermore, those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific embodiments of the invention described in this application. Furthermore, such equivalents are intended to be encompassed by the present invention.

[0037] As described above, the present inventors confirmed that when the UBQ14 gene and / or the FLBD gene are knocked out in an ascomycete strain, the protein or biomass content is increased.

[0038] In a specific embodiment of the present invention, as shown in Fig. 1, an ascomycete strain was produced in which a target ubiquitination-related gene and / or a sporulation-related gene was knocked out.

[0039] In another specific embodiment of the present invention, as shown in FIG. 2, when the UBQ14 gene among the ubiquitination-related genes was knocked out in red mold, it was confirmed that the vegetative growth was superior and the size of the fungus also increased compared to when other ubiquitination-related genes (UBQ1, UBQ5-UBQ7, UBQ9-UBQ13) were knocked out, and therefore the UBQ14 gene was selected as the target gene for knockout. In addition, when the UBQ14 gene was knocked out in F. venenatum belonging to the same ascomycete, it was confirmed through FIG. 3 that the vegetative growth was superior, the protein content increased, and the lipid content decreased.

[0040] In another specific embodiment of the present invention, as shown in FIG. 4, when the sporulation-related genes (ABAA, FLBD) were knocked out in F. venenatum, it was confirmed that the biomass content of the mutant F. venenatum was significantly increased when the FLBD gene was knocked out compared to when the ABAA gene was knocked out.

[0041] In another specific embodiment of the present invention, as shown in FIGS. 5 and 6, when both the UBQ14 gene and the FLBD gene were knocked out in F. venenatum, it was confirmed that the biomass content and protein content increased, and the lipid content decreased.

[0042] Accordingly, the first aspect of the present invention relates to a mutant ascomycete strain in which the UBQ14 gene and / or the FLBD gene is knocked out.

[0043] In the present invention, when the UBQ14 gene is knocked out, protein production may be promoted.

[0044] In the present invention, when the FLBD gene is knocked out, biomass production may be promoted.

[0045] In the present invention, when the UBQ14 and FBLD genes are knocked out, protein and biomass production may be promoted.

[0046] In the present invention, UBQ14 is a gene involved in ubiquitination, and the mRNA of the ascomycete UBQ14 gene may include a nucleotide sequence disclosed in NCBI Reference Sequence: XM_031206350.1, XM_018383801.1, XM_018890060.1 or XM_025731527.2, etc., but may include, without limitation, any nucleotide sequence that exhibits substantially the same or corresponding effect as the gene.

[0047] In the present invention, FLBD is a gene involved in sporulation, and the mRNA of the FLBD gene of the ascomycete may include a nucleotide sequence disclosed in NCBI Reference Sequence: XM_031205844.1, XM_018382161.1, XM_018895950.1 or XM_025730339.2, etc., but may include, without limitation, any nucleotide sequence that exhibits substantially the same or corresponding effect as the gene.

[0048] In a specific embodiment of the present invention, the UBQ14 gene including the base sequence of SEQ ID NO: 1 was knocked out with the UBQ14 gene, and the FLBD gene including the base sequence of SEQ ID NO: 2 was knocked out with the FLBD gene to produce a mutant ascomycete strain of the present invention.

[0049] Therefore, in the present invention, the UBQ14 gene may include or consist of the base sequence of SEQ ID NO: 1, and the FLBD gene may include or consist of the base sequence of SEQ ID NO: 2, and SEQ ID NO: 1 and SEQ ID NO: 2 are as described in the table below.

[0050]

[0051] In the present invention, the UBQ14 gene may include a base sequence having at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 99%, or 100% identity to the base sequence of the ascomycete UBQ14 gene or the base sequence of SEQ ID NO: 1.

[0052] In the present invention, the FLBD gene may include a base sequence having at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 99%, or 100% identity to the base sequence of the FLBD gene of an ascomycete or the base sequence of SEQ ID NO: 2.

[0053] In the present invention, the mutant ascomycete strain may have an increased protein content and / or biomass content and a decreased lipid content compared to the wild-type ascomycete strain.

[0054] In a specific embodiment of the present invention, it was confirmed through B of FIG. 3 that the contents of histidine (His), methionine (Met), isoleucine (Ile), glutamic acid (Glu), proline (Pro), serine (Ser), aspartic acid (Asp), lysine (Lys), threonine (Thr), phenylalanine (Phe), leucine (Leu), valine (Val), tyrosine (Tyr), glycine (Gly), arginine (Arg), and alanine (Ala) among amino acids increased in F. venenatum in which the UBQ14 gene was knocked out.

[0055] In another specific embodiment of the present invention, it was confirmed through Fig. 5C that the contents of histidine (His), glutamic acid (Glu), aspartic acid (Asp), isoleucine (Ile), methionine (Met), alanine (Ala), proline (Pro), serine (Ser), valine (Val), phenylalanine (Phe), leucine (Leu), threonine (Thr), and tyrosine (Tyr) among amino acids increased in F. venenatum in which the UBQ14 gene and FLBD gene were knocked out.

[0056] Therefore, in the present invention, the protein may include essential amino acids, and the essential amino acids may be at least one selected from the group consisting of phenylalanine, valine, threonine, methionine, leucine, isoleucine, lysine, and histidine.

[0057] Preferably, the mutant ascomycete strain may have an increased content of at least one of the group consisting of histidine, isoleucine, and methionine compared to the wild-type ascomycete strain.

[0058] In a specific embodiment of the present invention, F. UBQ 14 gene is knocked out. It was confirmed through Figure 3C that the contents of nervonic acid, erucic acid, oleic acid, 11-eicosenoic acid, myristic acid, palmitic acid, tricosanoic acid, lignoceric acid, behenic acid, cis-11,14-eicosadienoic acid, arachidonic acid, stearic acid, linoleic acid, palmitoleic acid, heptadecanoic acid, and pentadecanoic acid in lipids in venenatum were reduced.

[0059] In another specific embodiment of the present invention, it was confirmed through Figure 5D that the contents of nervonic acid, tricosan acid, lignoceric acid, cis-11,14-icosadienoic acid, 11-eicosenoic acid, linoleic acid, pentadecanoic acid, myristic acid, palmitic acid, behenic acid, erucic acid, oleic acid, palmitoleic acid, heptadecanoic acid, arachidic acid, and stearic acid in lipids were reduced in F. venenatum in which the UBQ14 gene and FLBD gene were knocked out.

[0060] Accordingly, in the present invention, the lipid may be at least one selected from the group consisting of nervonic acid, erucic acid, oleic acid, 11-eicosenoic acid, myristic acid, palmitic acid, tricosanoic acid, lignoceric acid, behenic acid, cis-11,14-icosadienoic acid, arachidic acid, stearic acid, linoleic acid, palmitoleic acid, heptadecanoic acid, and pentadecanoic acid, and preferably at least one selected from the group consisting of pentadecanoic acid, heptadecanoic acid, arachidic acid, palmitoleic acid, linoleic acid, stearic acid, and oleic acid.

[0061] In the present invention, the mutant ascomycete may be of a genus selected from the group consisting of Thermotelomyces, Myceliophthora, Trichoderma, Aspergillus, Penicillium, Rasamsonia, Chrysosporium, Corynascus, Fusarium, Neurospora, and Talaromyces.

[0062] In the present invention, the mutant ascomycetes are Thermotelomyces heterothallica, Myceliophthora lutea, Aspergillus nidulans, Aspergillus funiculosus, Aspergillus niger, Aspergillus oryzae, Trichoderma reesei, Trichoderma harzianum, Trichoderma longibrachiatum, Trichoderma viride, and Rasamsonia emersonii. It may be a species selected from the group consisting of Penicillium chrysogenum, Penicillium verrucosum, Sporotrichum thermophile, Corynascus fumimontanus, Corynascus thermophilus, Chrysosporium lucknowense, Fusarium graminearum, Fusarium venenatum, Neurospora crassa, and Talaromyces piniphilus.

[0063] According to the specific embodiments of the present invention described above, it can be seen that the mutant ascus strain in which the UBQ14 gene and / or the FLBD gene is knocked out has a superior protein or biomass content compared to the wild type strain.

[0064] Accordingly, the second aspect of the present invention relates to a composition for producing a protein or biomass, comprising at least one selected from the group consisting of the mutant ascomycete, ascomycete mycelia, ascomycete lysate, ascomycete culture, ascomycete culture concentrate, ascomycete culture extract, and ascomycete dried product.

[0065] The effect of the active ingredient included in the composition for producing protein or biomass of the present invention is the same as that of the mutant ascomycete strain of the first aspect, and therefore, its description is omitted.

[0066] As used herein, the term "ascomycete mycelia" refers to a general term for hyphae that grow in a densely entangled state. "Ascomycete lysate" refers to something obtained by culturing ascomycetes and mechanically or chemically disrupting them, and may include anything that has undergone additional processes such as extraction, dilution, concentration, and purification therefrom. "Ascomycete culture" may refer to a medium (solid, liquid, etc.) containing ascomycetes, the medium (solid, liquid, etc.) itself from which ascomycetes are separated after culturing the ascomycetes, or the supernatant thereof. "Ascomycete culture concentrate" refers to something that is purified from an ascomycete culture through ultrafiltration, ammonium sulfate treatment, column purification, concentration, etc., or a culture concentrate obtained through ultrafiltration, concentration, etc. "Ascomycete culture extract" means an extract obtained from the culture or a concentrate thereof, and may include an extract, a diluted or concentrated extract, a dried product obtained by drying the extract, or a controlled or purified product thereof, or a fraction obtained by fractionating the same. The dried product may include a freeze-dried product.

[0067] In addition, a third aspect of the present invention relates to a composition for food or food additive comprising at least one selected from the group consisting of the mutant ascomycete, ascomycete mycelia, ascomycete lysate, ascomycete culture, ascomycete culture concentrate, ascomycete culture extract, and ascomycete dried product.

[0068] The composition and effect of the effective ingredient included in the food or food additive composition of the present invention are the same as those of the protein or biomass production composition of the second aspect, and therefore, description thereof is omitted.

[0069] The term "food" used in the present invention includes meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, vitamin complexes, health functional foods, and health foods, and includes all foods in the conventional sense.

[0070] The term "food additive composition" used in the present invention refers to a composition used by adding, mixing, infiltrating, or other methods to food for the purpose of manufacturing, processing, or preserving food. The food additive composition of the present invention comprises a mutant ascomycete strain with a high protein or biomass content, and thus can be used as an alternative protein in the manufacture of various foods.

[0071] The above food additive composition may contain additional additives in addition to the mutant ascomycetes of the present invention, depending on the function and purpose. For example, such additives may mainly include, depending on the purpose, preservatives, bactericides, antioxidants, colorants, coloring agents, bleaching agents, seasonings, sweeteners, flavoring agents, leavening agents, reinforcing agents, improvers, emulsifiers, thickeners (pastry agents), stabilizers, film-forming agents, antifoaming agents, solvents, release agents, insect repellents, quality-improving agents, and other additives for food manufacturing.

[0072] The form of the food additive composition of the present invention is not limited thereto, but may include powder, granule, or liquid forms. The powder form of the additive composition can be prepared by powdering the mutant ascomycete strain of the present invention by a conventional method. The liquid form of the additive can be prepared by adding water, a flavoring agent, a coloring agent, a preservative, etc. to the mutant ascomycete strain of the present invention. The granular form of the food additive composition can be prepared by granulating the mutant ascomycete strain of the present invention by an appropriate method, and may contain a flavoring agent, a maturing agent, etc., as needed.

[0073] In addition, the fourth aspect of the present invention relates to a method for producing the above-described mutant ascomycete strain, comprising a step of knocking out the UBQ14 gene and / or the FLBD gene of the ascomycete strain.

[0074] Furthermore, the fifth aspect of the present invention relates to a method for producing a protein or biomass, comprising a step of culturing the mutant ascomycete strain described above.

[0075] In the present invention, the method for producing the protein or biomass may include a step of culturing the mutant ascomycete strain in a suitable medium; and / or a step of recovering the produced protein or biomass.

[0076] In the present invention, the medium may include a carbon source selected from the group consisting of glucose, sucrose, xylose, arabinose, galactose, fructose, lactose, cellobiose, glycerol, and any combination thereof.

[0077] In the present invention, the carbon source may be a waste obtained from ethanol production or other production from starch, sugar beet, and sugar cane, lignocellulosic biomass including high molecular weight carbohydrates such as molasses, starch, cellulose, and hemicellulose, which contain fermentable sugars.

[0078] In the present invention, the medium may contain glucose and ammonium ions.

[0079] In addition, the sixth aspect of the present invention relates to a method for producing a feed or feed additive using the mutant ascomycete strain described above, a culture of the ascomycete strain, or a protein produced from the ascomycete strain.

[0080] In addition, the seventh aspect of the present invention relates to a method for producing a food or food additive using the mutant ascomycete strain described above, a culture of the ascomycete strain, or a protein produced from the ascomycete strain.

[0081] Furthermore, the eighth aspect of the present invention relates to the use of the aforementioned mutant ascomycete strain for improving crude protein production.

[0082] Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the following examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention.

[0083] <Example 1>

[0084] 1. Production of ascomycetes with knockout of UBQ14 or FLBD genes

[0085] To construct a gene knockout strain of Fusarium venenatum, a method of replacing the open reading frame (ORF) of the gene with a geneticin resistance gene cassette (GEN) through homologous recombination was used, as shown in Fig. 1. The PCR construct for replacing the ORF was prepared using the double joint PCR method (Yu et al. Fungal Genet Biol. 2004 Nov;41(11):973-81). To prepare the PCR construct, first, the base sequence of UBQ14 (SEQ ID NO: 1) or FLBD (SEQ ID NO: 2) of F. venenatum was confirmed, and 1 kb of the upstream or downstream region of the corresponding gene was amplified using gene-specific primers. The gene-specific primers of SEQ ID NOs: 3 to 10 are shown in Table 2 below. Afterwards, the geneticin resistance marker gene amplified from the pII99 plasmid vector (Namiki et al. Mol Plant Microbe Interact. 2001 Apr;14(4):580-4) was fused with the up / downstream region (1 kb) of the ORF through overlapping PCR as shown in Table 3 below, and the PCR result was used for fungal transformation.

[0086] To produce protoplasts for fungal transformation of Fusarium venenatum (Rural Development Administration Seed Bank KACC No. 49797), a cell wall-degrading enzyme (driselase, Basidiomycetes sp.) was used. To obtain protoplasts, 1.0 × 10 6After inoculating the spore solution at a concentration of 10 spores / ml and shaking culture for 18 hours, only the collected mycelia were filtered using filter paper. This was added to a solution containing 20 ml of cell wall-degrading enzyme (driselase) (1 M NH4Cl 20 ml, driselase 0.20 g) and incubated at 30°C for 4 hours. Complete degradation of the cell wall was confirmed under a microscope. The formed protoplasts were filtered through miracloth to isolate only pure protoplasts.

[0087] The isolated protoplasts were concentrated using a hemocytometer (Superior-Marienfeld, Germany) and then 1.0×10 7 After mixing at a concentration of 10 protoplasts / ml, 1.2 ml of PEG solution [PEG (polyethylene glycol, MW=3350) 60 g, 10 mM Tris-Cl, 10 mM CaCl2] and the previously amplified PCR construct were mixed and reacted on ice for 10 minutes. After adding 1 ml of STC solution (1.2 M Sorbitol, 10 mM Tris-Cl, 50 mM CaCl2), the mixture was slowly mixed, and 450 μl of the solution and 20 ml of regeneration medium (Casein 0.5 g, Yeast extract 0.5 g, Sucrose 171 g) were mixed together and cultured for 1 day. The next day, 12 ml of water agar containing 300 ppm geneticin was overlaid on the cultures containing the regeneration medium, and the cultures were further cultured for 2-3 days.

[0088] The strains grown after culture were candidate strains in which the target ORF may have been knocked out, and the strains were confirmed by confirming whether the ORF was replaced with a geneticin resistance marker gene through diagnostic PCR and Southern blot. To confirm the strains through Southern blot, genomic DNA was extracted from the candidate strains grown after transformation using the cationic detergent cetyltrimethylammonium bromide (CTAB), and 5 μg of DNA was treated with Bgl1 restriction enzyme. Then, for FLBD, the primers of sequence numbers 3 and 4 in Table 2 below were used, and for UBQ14, the primers of sequence numbers 7 and 8 in Table 2 below were used, and the amplified results were used to produce probes using the North2South Biotin Random Prime DNA Labeling Kit (Thermo Scientific, Waltham, MA, USA). The fragmented DNA obtained by restriction enzyme treatment was subjected to electrophoresis on a 1.0% agarose gel, transferred to a Southern Blot nitrocellulose membrane, and Southern blotting was performed using the North2South Chemiluminescent Hybridization and Detection Kit (Thermo Scientific, Waltham, MA, USA). As a result, a fragment of 3.2 kb was detected for the UBQ14 knockout strain, and a fragment of 5.2 kb was detected for the FLBD knockout strain.

[0089] Sequence name sequence (5' → 3') SEQ ID NO. FvUBQ14_5FCATTGGATCCGGCTTCTTCAGTAG7FvUBQ14_5RgcacaggtacacttgtttagagTTCCTGTGAAGATCCTGGCTGC8FvUBQ14_3FccttcaatatcatcttctgtcgTTTCGAAGCTTCAGGTACAGAGGC9FvUBQ14_3RAACGATCCGGCCATTATTTTCAC10

[0090] * The sequence indicated by the uppercase letters above is a sequence overlapping with the GEN cassette amplified from the pII99 plasmid, and corresponds to the tail sequence for overlapping PCR.

[0091] PCR mixture (final 25μl)PCR reactionPurified 5'-flanking amplicon 1μl94℃ 2 minPurified 3'-flanking amplicon 1μl94℃ 30 secPurified argB amplicon 3μl58℃ 20 min X 10 cyclesdNTP (2.5 mM each) 2μl72℃ 5 min10X PCR buffer 2.5μl72℃ 10 minDW 15.25μl4℃foreverTaq pol 0.25μl

[0092] <Example 2>

[0093] 2. Confirmation of the effect of increasing protein production in ascomycetes with the UBQ14 gene knocked out.

[0094] First, deletion mutants of genes involved in ubiquitination (UBQ1, UBQ5-UBQ7, and UBQ9-UBQ14) were constructed using homologous recombination, diagnostic PCR, and Southern blot using red mold (F. graminearum strain Z-3639; Bowden and Leslie, Phytopathology. 1999 Feb;89(2):182-8) as a model. The vegetative growth of the UBQ1, UBQ5-UBQ7, and UBQ9-UBQ14 knockout strains of red mold was examined. As shown in Fig. 2, the growth increased when UBQ14 was knocked out compared to the wild-type strain (WT; Z-3639), and the growth of most of the other strains was confirmed to be reduced.

[0095] Afterwards, a deletion mutant of the UBQ14 gene was produced in F. venenatum and cultured in a glucose-ammonium ion medium (Vogel's medium). Only the mycelia were collected using a miracloth and ground into powder using liquid nitrogen. The powder sample was used for nutritional analysis. The nutritional analysis measured the contents of amino acids and lipids. To measure the content of amino acids, pretreatment was performed using substances such as OPA (o-Phthalaldehyde) and FMOC-Cl (9-fluorenylmethyl chloroformate), and the amino acid content was measured using a high-performance 166 liquid chromatography-fluorescence detector (HPLC-FLD). The content of lipids was analyzed using gas chromatography-mass spectrometry (GC-MS) after a pretreatment process to convert them to fatty acid methyl esters. As shown in Figure 3, the results of nutritional analysis showed that the content of amino acids increased, while the content of lipids decreased. These results confirmed the value of the UBQ14 gene as a target gene for enhancing the protein content of Fusarium venenatum.

[0096] <Example 3>

[0097] 3. Confirmation of the biomass-enhancing effect of ascomycetes with the FLBD gene knocked out.

[0098] In the present invention, in addition to the UBQ14 gene, which has a protein-promoting effect, a spore production-related gene capable of increasing fungal biomass was selected as a knockout target gene candidate. Accordingly, deletion mutants in which the ABAA or FLBD genes, which are genes involved in spore production, were knocked out were created in F. venenatum, and the biomass was examined. As shown in Fig. 4, when both genes were knocked out, spore production was inhibited, but only when FLBD was deleted, it was confirmed that biomass was significantly increased compared to the wild-type strain.

[0099] <Example 4>

[0100] 4. Confirmation of the enhanced biomass and protein production of ascomycetes with knockout of the UBQ14 and FLBD genes.

[0101] To produce FLBD and UBQ14 double knockout strains in F. venenatum, protoplasts of the FLBD and UBQ14 knockout strains were harvested using the cell wall-degrading enzyme solution in the same manner as described in Example 1. The protoplasts were transformed with a PCR amplification product using primers of SEQ ID NOs. 3 to 6 in Table 2 and a PCR product fused with a geneticin cassette amplified from the pII99 plasmid vector. The transformants grown after fungal transformation using the PEG and STC solutions were confirmed as double knockout strains through Southern blot. Nutritional analysis and biomass measurement experiments were performed on the confirmed double knockout strains, and the nutritional analysis was performed in the same manner as described in Example 2. As a result, F. When FLBD and UBQ14 were double knocked out in Ascomycetes venenatum, biomass was significantly increased compared to the wild-type strain under glucose-ammonium medium conditions, and the content of amino acids was increased and the content of lipids was decreased, as shown in Fig. 5. Furthermore, it was confirmed through Fig. 6 that biomass was maximized when FLBD and UBQ14 genes were double knocked out compared to when UBQ14 or FLBD genes were knocked out alone. Therefore, it was demonstrated that the target genes UBQ14 and FLBD disclosed in the present invention can be utilized to enhance the value of alternative protein materials derived from Ascomycetes.

[0102] <Example 5>

[0103] 5. Toxicity evaluation of ascomycete mycelia with knockout of UBQ14 and FLBD genes

[0104] Toxicological evaluation experiments were conducted to determine whether UBQ14 and FLBD gene knockouts induce protein toxicity (side effects).

[0105] Specifically, a strain (DB) in which the UBQ14 gene and the FLBD gene were simultaneously knocked out and a wild-type strain (WT) were cultured, and only the mycelia were harvested, dehydrated, and manufactured into a powder form. The powder was then used as a feed for Caenorhabditis elegans. As shown in Fig. 7, it was confirmed that there was no significant difference in body length and activity compared to the control, confirming that it did not exhibit toxicity (Control: E. coli OP50, a common C. elegans feed).

[0106] The present invention is an invention carried out through the following tasks.

[0107] [National Research and Development Project Supporting This Invention]

[0108] [Project ID] 1711203711

[0109] [Assignment Number] 2Z06820 (2Z07012)

[0110] [Ministry Name] Ministry of Science and ICT

[0111] [Name of Project Management (Specialist) Institution] Korea Institute of Science and Technology

[0112] [Research Project Name] Korea Institute of Science and Technology Research Operational Expenses Support (Main Project Expenses)

[0113] [Research Project Name] Gangneung Branch Operation Project (Modulating Pancreatic Cancer Immune Response Using Natural Products-Microbiome Interactions)

[0114] [Name of Project Performing Organization] Korea Institute of Science and Technology

[0115] Research Period: January 1, 2022 - December 31, 2024

[0116] [National Research and Development Project Supporting This Invention]

[0117] [Project ID] 1711196537

[0118] [Assignment Number] 2E32610 (2E33311)

[0119] [Ministry Name] Ministry of Science and ICT

[0120] [Name of Project Management (Specialist) Institution] Korea Institute of Science and Technology

[0121] [Research Project Name] Korea Institute of Science and Technology Research Operational Expenses Support (Main Project Expenses)

[0122] [Research Project Name] Natural Product New Material Development Project (Development of Natural Product-Antibody Fusion Technology)

[0123] [Name of Project Performing Organization] Korea Institute of Science and Technology

[0124] Research Period: January 1, 2022 - December 31, 2024

[0125] [National Research and Development Project Supporting This Invention]

[0126] [Project ID] 2540000305

[0127] [Project Number] RS-2024-00398300

[0128] [Ministry Name] Ministry of Agriculture, Food and Rural Affairs

[0129] [Name of project management (specialized) organization] National Institute of Agricultural and Food Technology Planning and Evaluation

[0130] [Research Project Name] Agricultural and Food Science and Technology Convergence Research Personnel

[0131] [Research Project Name] (Plants) Development of cutting-edge technologies for improving plant health and training of convergent research personnel.

[0132] [Name of the project performing organization] Seoul National University Industry-Academic Cooperation Foundation

[0133] Research Period: April 1, 2024 - December 31, 2028

[0134] [National Research and Development Project Supporting This Invention]

[0135] [Task ID] Not assigned

[0136] [Project Number] RS-2024-00397586

[0137] [Ministry Name] Rural Development Administration

[0138] [Name of Project Management (Specialist) Agency] Rural Development Administration

[0139] [Research Project Name] Joint Research Project (Development of New Crop Protection Technology for Export Strategy)

[0140] [Research Project Name] Development of Crop Protection Agent Efficacy Diagnostic and Screening Technologies

[0141] [Name of the project performing organization] Seoul National University Industry-Academic Cooperation Foundation

[0142] Research Period: April 1, 2024 - December 31, 2028

Claims

1. Mutant ascomycota in which the UBQ14 gene and / or FLBD gene are knocked out.

2. A mutant ascomycete strain characterized in that protein production is promoted when the UBQ14 gene is knocked out in the first paragraph.

3. A mutant ascomycete strain characterized in that biomass production is promoted when the FLBD gene is knocked out in the first paragraph.

4. A mutant ascomycota strain characterized in that protein and biomass production are promoted when the UBQ14 gene and FLBD gene are knocked out in the first paragraph.

5. A mutant ascus strain characterized in that in paragraph 1, the UBQ14 gene comprises the base sequence of sequence number 1, and the FLBD gene comprises the base sequence of sequence number 2.

6. In the first paragraph, the mutant ascomycete strain is characterized by an increased protein content and / or biomass content and a decreased lipid content.

7. A mutant ascomycete strain characterized in that in paragraph 6, the protein comprises an essential amino acid, and the essential amino acid is at least one selected from the group consisting of phenylalanine, valine, threonine, methionine, leucine, isoleucine, lysine, and histidine.

8. In the 7th paragraph, the mutant ascomycete strain is characterized by an increased content of at least one selected from the group consisting of histidine, isoleucine, and methionine.

9. A mutant ascus strain according to claim 6, characterized in that the lipid is at least one selected from the group consisting of pentadecanoic acid, heptadecanoic acid, arachidonic acid, palmitoleic acid, linoleic acid, stearic acid, and oleic acid.

10. In the first paragraph, the mutant ascomycete is a mutant ascomycete of a genus selected from the group consisting of Thermotelomyces, Myceliophthora, Trichoderma, Aspergillus, Penicillium, Rasamsonia, Chrysosporium, Corynascus, Fusarium, Neurospora, and Talaromyces.

11. A composition for producing a protein or biomass, comprising at least one selected from the group consisting of a mutant ascomycete, ascomycete mycelia, ascomycete lysate, ascomycete culture, ascomycete culture concentrate, ascomycete culture extract, and ascomycete dried product of any one of claims 1 to 10.

12. A composition for food or food additive comprising at least one selected from the group consisting of a mutant ascomycete, ascomycete mycelia, ascomycete lysate, ascomycete culture, ascomycete culture concentrate, ascomycete culture extract, and ascomycete dried product of any one of claims 1 to 10.

13. A method for producing a protein or biomass, comprising a step of culturing a mutant ascomycete strain of any one of claims 1 to 10.

14. A method for producing a food or food additive using a mutant ascomycete strain of any one of claims 1 to 10, a culture of the ascomycete strain, or a protein produced from the ascomycete strain.

Citation Information

Patent Citations

  • Mutated filamentous fungus, and method for producing protein using the same

    JP2024044738A

  • Fungal high-level protein production system

    US20170240909A1