Compositions and methods for the targeting of CD38

Abstract

The disclosure provides systems for modifying a cluster of differentiation 38 (CD38) gene target nucleic acid sequence, as well as methods of making and using same. The systems comprise a CasX variant protein; and a guide ribonucleic acid (gRNA), wherein the gRNA comprises a targeting sequence complementary to the CD38 gene target nucleic acid sequence.

Description

Attorney Docket No. SCRB-057 / 01WO 333322-2504 COMPOSITIONS AND METHODS FOR THE TARGETING OF CD38 CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to, and benefit of, U.S. Provisional Application No. 63 / 689,482 filed on August 30, 2024, the contents of which are incorporated by reference herein in its entirety. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (SCRB_057_01WO_SeqList_ST26.xml; Size: 2,363,987 bytes; and Date of Creation: August 26, 2025) are herein incorporated by reference in its entirety. BACKGROUND

[0003] Cluster of differentiation 38 (CD38) is a transmembrane glycoprotein expressed on the surface of healthy human cells, including natural killer (NK) cells, monocytes, dendritic cells, macrophages, granulocytes, T and B cells, and plasma cells, as well as cells associated with hematological malignancies. Specifically, CD38 expression is associated with diseases including multiple myeloma (MM), Waldenström’s disease, non-Hodgkin’s lymphoma (NHL), acute lymphocytic leukemia (ALL), chronic lymphocytic leukemia (CLL), and acute myelogenous leukemia (AML).

[0004] The anti-CD38 monoclonal antibody daratumumab has been developed as one possible treatment for CD38-associated cancers. Daratumumab targets CD38-expressing cancer cells in part via antibody-dependent cellular cytotoxicity (ADCC), a process in which NK cells bind an antibody bound to the surface of a target cell and release cytotoxic factors that cause the death of the target cell.

[0005] The use of chimeric antigen receptors (CAR) for the augmentation of allogeneic natural killer (NK) cell therapies for certain hematological malignancies has been proposed. However, CD38 expression on NK cells and its further induction during ex vivo NK cell expansion represents barriers to the development of a CD38 CAR-NK cell therapy due to NK cell “fratricide” (Gurney M., et al. CD38 knockout natural killer cells expressing an affinity optimized CD38 chimeric antigen receptor successfully target acute myeloid leukemia with reduced effector cell fratricide. Haematologica.107(2):437 (2022)). As there exists a need for compositions and methods for modifying and / or deleting the CD38 gene for cell-based therapies,Attorney Docket No. SCRB-057 / 01WO 333322-2504 the present disclosure provides CasX-based systems designed to edit the CD38 gene for such cell-based systems. SUMMARY

[0006] The present disclosure provides systems comprising or encoding CasX variant proteins and guide ribonucleic acid variants (gRNA) that have utility in the modification of a target nucleic acid of a cluster of differentiation 38 (CD38) gene in cells for adoptive cell therapies. The systems and compositions are useful in a variety of methods for CD38 target nucleic acid modification, which methods are also provided. The present disclosure also provides compositions of gRNA and messenger RNA (mRNA) encoding CasX variants for the modification of the CD38 gene in populations of cells. INCORPORATION BY REFERENCE

[0007] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. The contents of WO 2020 / 247882, WO 2020 / 247883, WO 2021 / 113772, WO 2022 / 120095, WO 2022 / 125843, WO 2022 / 261150, WO 2022 / 261149, and US11560555B2, which disclose CasX variants and gRNA variants, and methods of delivering same, are hereby incorporated by reference in their entirety. BRIEF DESCRIPTION OF THE DRAWINGS

[0008] The novel features of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings of which:

[0009] FIG.1 is a line plot showing the quantification of loss of CD38 expression (represented as the average percentage of total cells that were CD38-) upon editing of the CD38 locus in Jurkat cells treated with RNPs of CasX 491 and gRNA with the indicated spacer, as described in Example 1. A “buffer only” electroporation condition was included as an experimental control.

[0010] FIG.2 is a bar chart showing the quantification of editing activity measured as indel rate (or fraction edited) detected by NGS at the human CD38 locus, as described in Example 1.Attorney Docket No. SCRB-057 / 01WO 333322-2504 The bar chart illustrates editing rates by type of mutation generated (insertion, deletion, or both insertion and deletion) by an individual spacer at the three doses tested.

[0011] FIG.3 is a line plot showing the quantification of loss of CD38 expression (represented as the average percentage of total cells that were CD38-) upon editing of the CD38 locus in Jurkat cells treated with RNPs of CasX 491 and gRNA with the indicated spacer variant, as described in Example 2.

[0012] FIG.4A is a plot showing the quantification of the percentage of total Jurkat cells with CD38-knockout upon delivery of CasX 515 mRNA and either an unmodified or chemically modified gRNA having scaffold 316 with spacer TG-36-002 in a gRNA titration experiment, as described in Example 3.

[0013] FIG.4B is plot showing the quantification of the percentage of total Jurkat cells with CD38-knockout upon delivery of CasX 515 mRNA and an unmodified gRNA having scaffold 316 with spacer TG-36-002 in an mRNA titration experiment, as described in Example 3.

[0014] FIG.4C is plot showing the quantification of the percentage of total Jurkat cells with CD38-knockout upon delivery of CasX 515 mRNA and either an unmodified or chemically modified gRNA having scaffold 316 with spacer TG-36-002 in a co-titration experiment, as described in Example 3.

[0015] FIG.4D is a plot showing the quantification of cell viability, as described in Example 3, for the experimental conditions described in FIG.4A.

[0016] FIG.4E is a plot showing the quantification of cell viability, as described in Example 3, for the experimental conditions described in FIG.4B.

[0017] FIG.4F is a plot showing the quantification of cell viability, as described in Example 3, for the experimental conditions described in FIG.4C.

[0018] FIG.5 depicts a schematic of the relative locations in the human CD38 locus that the 48 TTC spacers target, as described in Example 4. Spacers are indicated by black vertical bars.

[0019] FIG.6 is a plot displaying a correlation between editing rate (measured as indel rate) at the CD38 locus (x-axis) and percentage of total cells that were CD38- (y-axis), as described in Example 4. The Pearson correlation coefficient was calculated and shown as r = 0.67 (p < 0.0001).

[0020] FIG.7 is a bar graph showing the quantification of percent editing measured as indel rate detected by NGS at the endogenous target locus in Hepa1-6 cells transfected with theAttorney Docket No. SCRB-057 / 01WO 333322-2504 indicated engineered CasX mRNAs and targeting spacers and harvested at 20 hours post- transfection, as described in Example 6.

[0021] FIG.8A is a plot illustrating the percent reduction of secreted levels of target protein, relative to the non-targeting (NT) control, for primary human hepatocytes from lot #31 treated with the indicated doses of lipid nanoparticles (LNPs) formulated with CasX 515 or CasX 812 mRNA and a targeting gRNA with spacer 1, as described in Example 7.

[0022] FIG.8B is a plot illustrating the percent reduction of secreted levels of target protein, relative to the non-targeting (NT) control, for primary human hepatocytes from lot #31 treated with the indicated doses of LNPs formulated with CasX 515 or CasX 812 mRNA and a targeting gRNA with spacer 2, as described in Example 7.

[0023] FIG.8C is a plot illustrating the percent reduction of secreted levels of target protein, relative to the non-targeting (NT) control, for primary human hepatocytes from lot #51 treated with the indicated doses of LNPs formulated with CasX 515 or CasX 812 mRNA and a targeting gRNA with spacer 1, as described in Example 7.

[0024] FIG.8D is a plot illustrating the percent reduction of secreted levels of target protein, relative to the non-targeting (NT) control, for primary human hepatocytes from lot #51 treated with the indicated doses of LNPs formulated with CasX 515 or CasX 812 mRNA and a targeting gRNA with spacer 2, as described in Example 7.

[0025] FIG.9A is a plot depicting the results of an editing assay measured as indel rate detected by NGS at the target locus in primary human hepatocytes from lot #31 treated with the indicated doses of LNPs formulated with CasX 515 or CasX 812 mRNA and a targeting gRNA with spacer 2, as described in Example 7.

[0026] FIG.9B is a plot depicting the results of an editing assay measured as indel rate detected by NGS at the target locus in primary human hepatocytes from lot #51 treated with the indicated doses of LNPs formulated with CasX 515 or CasX 812 mRNA and a targeting gRNA with spacer 1, as described in Example 7.

[0027] FIG.9C is a plot depicting the results of an editing assay measured as indel rate detected by NGS at the target locus in primary human hepatocytes from lot #51 treated with the indicated doses of LNPs formulated with CasX 515 or CasX 812 mRNA and a targeting gRNA with spacer 2, as described in Example 7.

[0028] FIG.10A is a schematic illustrating versions 1-3 of chemical modifications made to gRNA scaffold variant 235, as described in Example 8. Structural motifs are highlighted.Attorney Docket No. SCRB-057 / 01WO 333322-2504 Standard ribonucleotides are depicted as open circles, and 2’OMe-modified ribonucleotides are depicted as black circles. Phosphorothioate bonds are indicated with * below or beside the bond. For the v2 profile, the addition of three 3’ uracils (3’UUU) is annotated with “U”s in the relevant circles.

[0029] FIG.10B is a schematic illustrating versions 4-6 of chemical modifications made to gRNA scaffold variant 235, as described in Example 8. Structural motifs are highlighted. Standard ribonucleotides are depicted as open circles, and 2’OMe-modified ribonucleotides are depicted as black circles. Phosphorothioate bonds are indicated with * below or beside the bond.

[0030] FIG.11 is a plot illustrating the quantification of percent knockout of B2M in HepG2 cells co-transfected with 100 ng of CasX 491 mRNA and with the indicated doses of end- modified (v1) or unmodified (v0) B2M-targeting gRNAs with spacer 7.37, as described in Example 8. Editing level was determined by flow cytometry as the population of cells with loss of surface presentation of the HLA complex due to successful editing at the B2M locus.

[0031] FIG.12 is a schematic illustrating versions 7-9 of chemical modifications made to gRNA scaffold variant 316, as described in Example 8. Structural motifs are highlighted. Standard ribonucleotides are depicted as open circles, and 2’OMe-modified ribonucleotides are depicted as black circles. Phosphorothioate bonds are indicated with * below or beside the bond.

[0032] FIG.13A is a schematic of gRNA scaffold variant 174 (SEQ ID NO: 117), as described in Example 8. Structural motifs are highlighted.

[0033] FIG.13B is a schematic of gRNA scaffold variant 235 (SEQ ID NO: 118), as described in Example 8. Highlighted structural motifs are the same as in FIG.13A. The differences between variant 174 and variant 235 lie in the extended stem motif and several single-nucleotide changes (indicated with asterisks).

[0034] FIG.13C is a schematic of gRNA scaffold variant 316 (SEQ ID NO: 119), as described in Example 8. Highlighted structural motifs are the same as in FIG.13A. Variant 316 maintains the shorter extended stem from variant 174 (FIG.13A) but harbors the four substitutions found in scaffold 235 (FIG.13B).

[0035] FIG.14 is a plot displaying a correlation between indel rate (depicted as edit fraction) at the target locus as measured by NGS (x-axis) and secreted levels of the target protein (ng / mL) detected by enzyme-linked immunosorbent assay (ELISA) (y-axis) in HepG2 cells lipofected with CasX 491 mRNA and targeting gRNAs containing the indicated scaffold variant and spacer combination, as described in Example 8.Attorney Docket No. SCRB-057 / 01WO 333322-2504

[0036] FIG.15A is a plot depicting the results of an editing assay measured as indel rate detected by NGS at the human B2M locus in HepG2 cells treated with the indicated doses of LNPs formulated with CasX 491 mRNA and the indicated B2M-targeting gRNA, as described in Example 8.

[0037] FIG.15B is a plot illustrating the quantification of percent knockout of B2M in HepG2 cells treated with the indicated doses of LNPs formulated with CasX 491 mRNA and the indicated B2M-targeting gRNA, as described in Example 8. Editing level was determined by flow cytometry as population of cells that did not have surface presentation of the HLA complex due to successful editing at the B2M locus.

[0038] FIG.16A is a plot depicting the results of an editing assay measured as indel rate detected by NGS at the mouse ROSA26 locus in Hepa1-6 cells treated with the indicated doses of LNPs formulated with CasX 676 mRNA #2 and the indicated ROSA26-targeting gRNA with either the v1 or v5 modification profile, as described in Example 8.

[0039] FIG.16B is a bar graph illustrating the quantification of percent editing measured as indel rate detected by NGS at the ROSA26 locus in mice treated with LNPs formulated with CasX 676 mRNA #2 and the indicated chemically-modified ROSA26-targeting gRNA, as described in Example 8.

[0040] FIG.17 is a bar graph showing the results of the editing assay measured as indel rate detected by NGS at the target locus in mice treated with LNPs formulated with CasX 676 mRNA #1 and the indicated chemically-modified targeting gRNA, as described in Example 8. Untreated mice served as experimental control.

[0041] FIG.18A is a schematic illustrating versions 1-3 of chemical modifications made to gRNA scaffold variant 316, as described in Example 8. Structural motifs are highlighted. Standard ribonucleotides are depicted as open circles, and 2’OMe-modified ribonucleotides are depicted as black circles. Phosphorothioate bonds are indicated with * below or beside the bond.

[0042] FIG.18B is a schematic illustrating versions 4-6 of chemical modifications made to gRNA scaffold variant 316, as described in Example 8. Structural motifs are highlighted. Standard ribonucleotides are depicted as open circles, and 2’OMe-modified ribonucleotides are depicted as black circles. Phosphorothioate bonds are indicated with * below or beside the bond. DETAILED DESCRIPTION

[0043] While exemplary embodiments have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only.Attorney Docket No. SCRB-057 / 01WO 333322-2504 Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosures claimed herein. It should be understood that various alternatives to the embodiments described herein may be employed in practicing the embodiments of the disclosure. It is intended that the claims define the scope of the disclosure and that methods and structures within the scope of these claims and their equivalents be covered thereby.

[0044] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present embodiments, suitable methods and materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. Definitions

[0045] As used herein, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. For example, “a” or “an” means “at least one” or "one or more."

[0046] The term "about" as used herein refers to the usual error range for the respective value readily known to the skilled person in this technical field. Reference to “about” a value or parameter herein includes (and describes) embodiments that are directed to that value or parameter per se.

[0047] Throughout this disclosure, various aspects of the claimed subject matter are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the claimed subject matter. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, where a range of values is provided, it is understood that each intervening value, between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the claimed subject matter. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the claimed subject matter, subject to any specificallyAttorney Docket No. SCRB-057 / 01WO 333322-2504 excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the claimed subject matter. This applies regardless of the breadth of the range. Any disclosure of endpoints include disclose of ranges between each of the endpoints. For example, disclosure of 1, 2, and 3 includes the ranges 1-2, 2-3, and 1-3.

[0048] Use of ordinal terms such as “first”, “second”, “third”, etc., in the claims to modify a claim element does not by itself connote any priority, precedence, or order of one claim element over another or the temporal order in which acts of a method are performed, but are used merely as labels to distinguish one claim element having a certain name from another element having a same name (but for use of the ordinal term) to distinguish the claim elements. Similarly, use of a), b), etc., or i), ii), etc. does not by itself connote any priority, precedence, or order of steps in the claims. Similarly, the use of these terms in the specification does not by itself connote any required priority, precedence, or order.

[0049] It is understood that embodiments of the invention described herein include “consisting” and / or “consisting essentially of” embodiments.

[0050] The term " cluster of differentiation" or "CD" refers to a protocol used for the identification and investigation of cell surface molecules present on leukocytes that allows cells to be defined on the basis of what molecules are present on their surface. The proposed surface molecule is assigned a CD number once two specific monoclonal antibodies are shown to bind to the molecule.

[0051] The term “protospacer” as used herein is the region of DNA comprising the DNA sequence complementary to the targeting sequence (or spacer) of the guide RNA (the target strand sequence of the protospacer) and the DNA complementary to that sequence (the non- target strand sequence of the protospacer).

[0052] The term “target site” as used herein comprises a target strand and a non-target strand. The “target strand” comprises the DNA that is complementary to the targeting sequence of the guide RNA (with T instead of U). As used herein, the term “non-target strand” refers to the strand of the DNA target nucleic acid sequence that does not form Watson and Crick base pairs with the targeting sequence in the gRNA, and is complementary to the target DNA strand. “Target site” can be used interchangeably with “target sequence.”

[0053] As used herein, the PAM is a nucleotide sequence that is located 1 nucleotide 5' of the sequence in the non-target strand that is complementary to the target nucleic acid sequence in theAttorney Docket No. SCRB-057 / 01WO 333322-2504 target strand of the target nucleic acid that, in conjunction with the spacer of the gRNA, helps the orientation and positioning of the CasX for the potential cleavage of the protospacer strand(s).

[0054] Hybridizable” or “complementary” are used interchangeably to mean that a nucleic acid (e.g., RNA, DNA) comprises a sequence of nucleotides that enables it to non-covalently bind, i.e., form Watson-Crick base pairs and / or G / U base pairs, “anneal”, or “hybridize,” to another nucleic acid in a sequence-specific, antiparallel, manner (i.e., a nucleic acid specifically binds to a complementary nucleic acid) under the appropriate in vitro and / or in vivo conditions of temperature and solution ionic strength. It is understood that the sequence of a polynucleotide need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable; it can have at least about 70%, at least about 80%, or at least about 90%, or at least about 95% sequence identity and still hybridize to the target nucleic acid. Moreover, a polynucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure, a ‘bulge’, ‘bubble’ and the like). Thus, the skilled artisan will understand that while individual bases within a sequence may not be complementary to another sequence, the sequence as a whole is still considered to be complementary.

[0055] A “gene,” for the purposes of the present disclosure, includes a DNA region encoding a gene product (e.g., a protein, RNA), as well as all DNA regions which regulate the production of the gene product, whether or not such regulatory sequences are adjacent to coding and / or transcribed sequences. Accordingly, a gene may include accessory element sequences including, but not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions. Coding sequences encode a gene product upon transcription or transcription and translation; the coding sequences of the disclosure may comprise fragments and need not contain a full-length open reading frame. A gene can include both the strand that is transcribed as well as the complementary strand containing the anticodons.

[0056] The term "downstream" refers to a nucleotide sequence that is located 3' to a reference nucleotide sequence. In certain embodiments, downstream nucleotide sequences relate to sequences that follow the starting point of transcription. For example, the translation initiation codon of a gene is located downstream of the start site of transcription.Attorney Docket No. SCRB-057 / 01WO 333322-2504

[0057] The term "upstream" refers to a nucleotide sequence that is located 5' to a reference nucleotide sequence. In certain embodiments, upstream nucleotide sequences relate to sequences that are located on the 5' side of a coding region or starting point of transcription. For example, most promoters are located upstream of the start site of transcription.

[0058] The term “adjacent to” with respect to polynucleotide or amino acid sequences refers to sequences that are next to, or adjoining each other in a polynucleotide or polypeptide. The skilled artisan will appreciate that two sequences can be considered to be adjacent to each other and still encompass a limited amount of intervening sequence, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides or amino acids.

[0059] The term “regulatory element” is used interchangeably herein with the term “regulatory sequence,” and is intended to include promoters, enhancers, and other expression regulatory elements. It will be understood that the choice of the appropriate regulatory element will depend on the encoded component to be expressed (e.g., protein or RNA) or whether the nucleic acid comprises multiple components that require different polymerases or are not intended to be expressed as a fusion protein.

[0060] The term “accessory element” is used interchangeably herein with the term “accessory sequence,” and is intended to include, inter alia, polyadenylation signals (poly(A) signal), enhancer elements, introns, posttranscriptional regulatory elements (PTREs, sometimes also referred to as TREs), nuclear localization signals (NLS), deaminases, DNA glycosylase inhibitors, additional promoters, factors that stimulate CRISPR-mediated homology-directed repair (e.g. in cis or in trans), self-cleaving sequences, and fusion domains, for example a fusion domain fused to a CRISPR protein. It will be understood that the choice of the appropriate accessory element or elements will depend on the encoded component to be expressed (e.g., protein or RNA) or whether the nucleic acid comprises multiple components that require different polymerases or are not intended to be expressed as a fusion protein.

[0061] The term "promoter" refers to a DNA sequence that contains a transcription start site and additional sequences to facilitate polymerase binding and transcription. Exemplary eukaryotic promoters include elements such as a TATA box, and / or B recognition element (BRE) and assists or promotes the transcription and expression of an associated transcribable polynucleotide sequence and / or gene (or transgene). A promoter can be synthetically produced or can be derived from a known or naturally occurring promoter sequence or another promoter sequence. A promoter can also include a chimeric promoter comprising a combination of two orAttorney Docket No. SCRB-057 / 01WO 333322-2504 more heterologous sequences to confer certain properties. A promoter of the present disclosure can include variants of promoter sequences that are similar in composition, but not identical to, other promoter sequence(s) known or provided herein. A promoter can be classified according to criteria relating to the pattern of expression of an associated coding or transcribable sequence or gene operably linked to the promoter, such as constitutive, developmental, tissue-specific, inducible, etc. A promoter can also be classified according to its strength. As used in the context of a promoter, “strength” refers to the rate of transcription of the gene controlled by the promoter. A “strong” promoter means the rate of transcription is high, while a “weak” promoter means the rate of transcription is relatively low.

[0062] A promoter of the disclosure can be a Polymerase II (Pol II) promoter. Polymerase II transcribes all protein coding and many non-coding genes. A representative Pol II promoter includes a core promoter, which is a sequence of about 100 base pairs surrounding the transcription start site, and serves as a binding platform for the Pol II polymerase and associated general transcription factors. The promoter may contain one or more core promoter elements such as the TATA box, BRE, Initiator (INR), motif ten element (MTE), downstream core promoter element (DPE), downstream core element (DCE), although core promoters lacking these elements are known in the art. All Pol II promoters are envisaged as within the scope of the instant disclosure.

[0063] A promoter of the disclosure can be a Polymerase III (Pol III) promoter. Pol III transcribes DNA to synthesize small ribosomal RNAs such as the 5S rRNA, tRNAs, and other small RNAs. Representative Pol III promoters use internal control sequences (sequences within the transcribed section of the gene) to support transcription, although upstream elements such as the TATA box are also sometimes used. All Pol III promoters are envisaged as within the scope of the instant disclosure.

[0064] The term “enhancer” refers to regulatory DNA sequences that, when bound by specific proteins called transcription factors, regulate the expression of an associated gene. Enhancers may be located in the intron of the gene, or 5’ or 3’ of the coding sequence of the gene. Enhancers may be proximal to the gene (i.e., within a few tens or hundreds of base pairs (bp) of the promoter), or may be located distal to the gene (i.e., thousands of bp, hundreds of thousands of bp, or even millions of bp away from the promoter). A single gene may be regulated by more than one enhancer, all of which are envisaged as within the scope of the instant disclosure.Attorney Docket No. SCRB-057 / 01WO 333322-2504

[0065] As used herein, a “post-transcriptional regulatory element (PTRE, or TRE),” such as a hepatitis PTRE, refers to a DNA sequence that, when transcribed creates a tertiary structure capable of exhibiting post-transcriptional activity to enhance or promote expression of an associated gene operably linked thereto.

[0066] “Recombinant,” as used herein, means that a particular nucleic acid (DNA or RNA) is the product of various combinations of cloning, restriction, and / or ligation steps resulting in a construct having a structural coding or non-coding sequence distinguishable from endogenous nucleic acids found in natural systems. Generally, DNA sequences encoding the structural coding sequence can be assembled from cDNA fragments and short oligonucleotide linkers, or from a series of synthetic oligonucleotides, to provide a synthetic nucleic acid which is capable of being expressed from a recombinant transcriptional unit contained in a cell or in a cell-free transcription and translation system. Such sequences can be provided in the form of an open reading frame uninterrupted by internal non-translated sequences, or introns, which are typically present in eukaryotic genes. Genomic DNA comprising the relevant sequences can also be used in the formation of a recombinant gene or transcriptional unit. Sequences of non-translated DNA may be present 5’ or 3’ from the open reading frame, where such sequences do not interfere with manipulation or expression of the coding regions, and may indeed act to modulate production of a desired product by various mechanisms (see “enhancers” and “promoters”, above).

[0067] The term “recombinant polynucleotide” or “recombinant nucleic acid” refers to one which is not naturally occurring, e.g., is made by the artificial combination of two otherwise separated segments of sequence through human intervention. This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. Such is usually done to replace a codon with a redundant codon encoding the same or a conservative amino acid, while typically introducing or removing a sequence recognition site. Alternatively, it is performed to join together nucleic acid segments of desired functions to generate a desired combination of functions. This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.

[0068] Similarly, the term “recombinant polypeptide” or “recombinant protein” refers to a polypeptide or protein which is not naturally occurring, e.g., is made by the artificial combination of two otherwise separated segments of amino sequence through humanAttorney Docket No. SCRB-057 / 01WO 333322-2504 intervention. Thus, e.g., a protein that comprises a heterologous amino acid sequence is recombinant.

[0069] As used herein, the term “contacting” means establishing a physical connection between two or more entities. For example, contacting a target nucleic acid with a guide nucleic acid means that the target nucleic acid and the guide nucleic acid are made to share a physical connection; e.g., can hybridize if the sequences share sequence similarity.

[0070] The disclosure provides systems and methods useful for editing a target nucleic acid sequence. As used herein “editing” is used interchangeably with “modifying” and "modification" and includes but is not limited to cleaving, nicking, deleting, knocking in, knocking out, and the like.

[0071] “Dissociation constant”, or “Kd”, are used interchangeably and mean the affinity between a ligand “L” and a protein “P”; i.e., how tightly a ligand binds to a particular protein. It can be calculated using the formula Kd=[L] [P] / [LP], where [P], [L] and [LP] represent molar concentrations of the protein, ligand and complex, respectively.

[0072] The disclosure provides systems and methods useful for editing a target nucleic acid sequence. As used herein “editing” is used interchangeably with “modifying” and "modification" and includes but is not limited to cleaving, nicking, deleting, knocking in, knocking out, and the like.

[0073] By “cleavage” it is meant the breakage of the covalent backbone of a target nucleic acid molecule (e.g., RNA, DNA). Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single- stranded cleavage and double-stranded cleavage are possible, and double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events.

[0074] The term “knock-out” refers to the elimination of a gene or the expression of a gene. For example, a gene can be knocked out by either a deletion or an addition of a nucleotide sequence that leads to a disruption of the reading frame. As another example, a gene may be knocked out by replacing a part of the gene with an irrelevant sequence. The term "knock-down" as used herein refers to reduction in the expression of a gene or its gene product(s). As a result of a gene knock-down, the protein activity or function may be attenuated or the protein levels may be reduced or eliminated.

[0075] As used herein, “homology-directed repair” (HDR) refers to the form of DNA repair that takes place during repair of double-strand breaks in cells. This process requires nucleotideAttorney Docket No. SCRB-057 / 01WO 333322-2504 sequence homology, and uses a donor template to repair or knock-out a target DNA, and leads to the transfer of genetic information from the donor to the target. Homology-directed repair can result in an alteration of the sequence of the target sequence by insertion, deletion, or mutation if the donor template differs from the target DNA sequence and part or all of the sequence of the donor template is incorporated into the target DNA.

[0076] As used herein, “non-homologous end joining’ (NHEJ) refers to the repair of double- strand breaks in DNA by direct ligation of the break ends to one another without the need for a homologous template (in contrast to homology-directed repair, which requires a homologous sequence to guide repair). NHEJ often results in the insertion or loss (deletion) of nucleotide sequence near the site of the double-strand break.

[0077] As used herein “micro-homology mediated end joining” (MMEJ) refers to a mutagenic DSB repair mechanism, which always associates with deletions flanking the break sites without the need for a homologous template (in contrast to homology-directed repair, which requires a homologous sequence to guide repair). MMEJ often results in the loss (deletion) of nucleotide sequence near the site of the double- strand break.

[0078] A polynucleotide or polypeptide has a certain percent “sequence similarity” or "sequence identity" to another polynucleotide or polypeptide, meaning that, when aligned, that percentage of bases or amino acids are the same, and in the same relative position, when comparing the two sequences. Sequence similarity (sometimes referred to as percent similarity, percent identity, or homology) can be determined in a number of different manners. To determine sequence similarity, sequences can be aligned using the methods and computer programs that are known in the art, including BLAST, available over the world wide web at ncbi.nlm.nih.gov / BLAST. Percent complementarity between particular stretches of nucleic acid sequences within nucleic acids can be determined using any convenient method. Example methods include BLAST programs (basic local alignment search tools) and PowerBLAST programs (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656) or by using the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), e.g., using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489).

[0079] The terms “polypeptide,” and “protein” are used interchangeably herein, and refer to a polymeric form of amino acids of any length, which can include coded and non-coded aminoAttorney Docket No. SCRB-057 / 01WO 333322-2504 acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones. The term includes fusion proteins, including, but not limited to, fusion proteins with a heterologous amino acid sequence.

[0080] A “vector” or “expression vector” is a replicon, such as plasmid, phage, virus, or cosmid, to which another DNA segment, i.e., an expression cassette, may be attached so as to bring about the replication or expression of the attached segment in a cell.

[0081] The term “naturally-occurring” or “unmodified” or “wild type” as used herein as applied to a nucleic acid, a polypeptide, a cell, or an organism, refers to a nucleic acid, polypeptide, cell, or organism that is found in nature.

[0082] As used herein, a “mutation” refers to an insertion, deletion, substitution, duplication, or inversion of one or more amino acids or nucleotides as compared to a wild-type or reference amino acid sequence or to a wild-type or reference nucleotide sequence.

[0083] As used herein the term “isolated” is meant to describe a polynucleotide, a polypeptide, or a cell that is in an environment different from that in which the polynucleotide, the polypeptide, or the cell naturally occurs. An isolated genetically modified host cell may be present in a mixed population of genetically modified host cells.

[0084] A “host cell,” as used herein, denotes a eukaryotic cell, a prokaryotic cell, or a cell from a multicellular organism (e.g., a cell line) cultured as a unicellular entity, which eukaryotic or prokaryotic cells are used as recipients for a nucleic acid (e.g., an mRNA), and include the progeny of the original cell which has been genetically modified by the nucleic acid. It is understood that the progeny of a single cell may not necessarily be completely identical in morphology or in genomic or total DNA complement as the original parent, due to natural, accidental, or deliberate mutation. A “recombinant host cell” (also referred to as a “genetically modified host cell”) is a host cell into which has been introduced a heterologous nucleic acid.

[0085] The term “conservative amino acid substitution” refers to the interchangeability in proteins of amino acid residues having similar side chains. For example, a group of amino acids having aliphatic side chains consists of glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains consists of serine and threonine; a group of amino acids having amide-containing side chains consists of asparagine and glutamine; a group of amino acids having aromatic side chains consists of phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains consists of lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains consists of cysteine and methionine.Attorney Docket No. SCRB-057 / 01WO 333322-2504 Exemplary conservative amino acid substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine.

[0086] As used herein, “administering” means a method of giving a dosage of a compound (e.g., a composition of the disclosure) or a composition (e.g., a pharmaceutical composition).

[0087] A “subject” is a mammal. Mammals include, but are not limited to, domesticated animals, non-human primates, humans, dogs, rabbits, mice, rats and other rodents.

[0088] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. I. General Methods

[0089] The practice of the present invention employs, unless otherwise indicated, conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA, which can be found in such standard textbooks as Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001); Short Protocols in Molecular Biology, 4thEd. (Ausubel et al. eds., John Wiley & Sons 1999); Protein Methods (Bollag et al., John Wiley & Sons 1996); Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999); Viral Vectors (Kaplift & Loewy eds., Academic Press 1995); Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997); and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998), the disclosures of which are incorporated herein by reference.

[0090] Where a range of values is provided, it is understood that endpoints are included and that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included.

[0091] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited.Attorney Docket No. SCRB-057 / 01WO 333322-2504

[0092] It will be appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. In other cases, various features of the disclosure, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. It is intended that all combinations of the embodiments pertaining to the disclosure are specifically embraced by the present disclosure and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub- combinations of the various embodiments and elements thereof are also specifically embraced by the present disclosure and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein. II. Systems for Genetic Editing of CD38 Genes

[0093] In a first aspect, the present disclosure provides systems comprising a CasX variant protein and one or more guide ribonucleic acids (gRNA), as well as nucleic acids encoding the CasX variant protein and gRNAs, for use in modifying a CD38 gene target nucleic acid sequence, inclusive of target nucleic acid sequences in coding and non-coding regions of the CD38 gene. As used herein, a "system", used interchangeably with "composition", can comprise a CasX variant protein and a gRNA of the disclosure as gene editing pairs, a gRNA and an mRNA encoding the CasX variant protein as a gene editing pair, as well as vectors or particles comprising the gRNA and CasX variant protein or mRNA encoding the CasX variant protein. Each of these components and their use in the editing of the CD38 gene is described herein, below. a. CD38

[0094] CD38 is a Type II glycosylated 45 kilodalton (kDa) membrane protein that was identified as a lymphocyte marker. CD38 has a role in leukocyte homeostasis through modulation of hematopoietic cell survival and differentiation (Richards JO, et al., Mol Cancer Ther.2008; 7(8):2517-27). CD38 functions as a receptor binding to CD3l and is involved in cell adhesion and signal transduction. The function of CD38 in signal transduction appears to be versatile depending on the cell lineage, the differentiation stage, and, possibly, the association with different co-receptors (Richards JO, et al., 2008). CD38 is also an ectoenzyme catalyzing the synthesis and hydrolysis of cyclic adenosine-diphosphate-ribose (cADPR) from nicotinamide adenine dinucleotide (NAD+) to ADP-ribose (DiLillo DJ, Ravetch JV., Cell.2015; 161(5):1035-Attorney Docket No. SCRB-057 / 01WO 333322-2504 45). These reaction products are implicated in calcium mobilization and intracellular signaling (Derer S, et al., MAbs.2014; 6(2):409-21).

[0095] CD38 is known variously as cluster of differentiation 38 (CD38), ADP-ribosyl cyclase / cyclic ADP-ribose hydrolase 1, cyclic ADP ribose hydrolase, ADPRC1, or cADPR1.

[0096] The CD38 gene encompasses the sequence that spans a region from 15778328 basepairs (bp) to 15853232 bp on chromosome 4 of the human genome (GRCh38 / hg38). The human CD38 gene is described in part in the NCBI database (ncbi.nlm.nih.gov) as NCBI Reference Sequence: NC_000004.12, which is incorporated by reference herein. The human CD38 gene has eight exons, produces an mRNA 5620 bases in length, and encodes a CD38 protein 300 amino acids in length.

[0097] The human CD38 gene (HGNC: 1667; NCBI Gene ID: 952) encodes a protein (Uniprot accession no. P28907) having the sequence: 1 MANCEFSPVS GDKPCCRLSR RAQLCLGVSI LVLILVVVLA VVVPRWRQQW SGPGTTKRFP 61 ETVLARCVKY TEIHPEMRHV DCQSVWDAFK GAFISKHPCN ITEEDYQPLM KLGTQTVPCN 121 KILLWSRIKD LAHQFTQVQR DMFTLEDTLL GYLADDLTWC GEFNTSKINY QSCPDWRKDC 181 SNNPVSVFWK TVSRRFAEAA CDVVHVMLNG SRSKIFDKNS TFGSVEVHNL QPEKVQTLEA 241 WVIHGGREDS RDLCQDPTIK ELESIISKRN IQFSCKNIYR PDKFLQCVKN PEDSSCTSEI (SEQ ID NO: 8).

[0098] The expression of CD38 in healthy humans can be detected on NK cells, monocytes, dendritic cells, macrophages, granulocytes, T and B cells, and plasma cells. Furthermore, several hematological malignancies express CD38, such as plasma cell dyscrasias (e.g., multiple myeloma (MM), amyloidosis) and other cancers of hematopoietic origin including, including for example, Waldenström’s disease, non-Hodgkin's lymphoma (NHL), acute lymphocytic leukemia (ALL), and acute myelogenous leukemia (AML). The expression of CD38 is especially notable in MM as >98% of patients are positive for this protein (Reinherz EL, et al., Proc Natl Acad Sci USA 1980; 77(3):1588-92, Lin P, et al., Am J Clin Pathol.2004; 121(4):482-8).

[0099] In some embodiments, the disclosure provides systems specifically designed to modify the CD38 gene in a population of cells having CD38 expressed on the surface of the cells. In some embodiments, the cells are selected from the group consisting of NK cells, monocytes, dendritic cells, macrophages, granulocytes, T and B cells, and plasma cells. In some embodiments, the disclosure provides systems specifically designed to modify (e.g., knock- down or knock-out) the CD38 gene in a population of cells in an ex vivo method. In some embodiments, the modified cells can be administered to a subject in a method of treatment of a disease, such as a hematological malignancy. Generally, any portion of the CD38 gene can beAttorney Docket No. SCRB-057 / 01WO 333322-2504 targeted using the programable compositions and methods provided herein, described more fully, herein.

[0100] Each of these components and their use in the editing of the CD38 gene is described herein, below. III. CasX Proteins for Modifying a Target Nucleic Acid of a CD38 Gene

[0100] The present disclosure provides CasX variant nuclease proteins that have utility in the modification of a target nucleic acid of a CD38 gene in eukaryotic cells, described more fully, below. The term “CasX protein”, as used herein, refers to a family of proteins, and encompasses all naturally-occurring CasX proteins (“reference CasX”), as well as CasX proteins engineered with sequence modifications (referred to herein as “CasX variants”) possessing one or more improved characteristics relative to a naturally occurring CasX protein, described more fully, below.

[0101] The CasX variant proteins employed in the genome modifying systems are Class 2, Type V nucleases. Although members of Class 2, Type V CRISPR‐Cas systems have differences, they share some common characteristics that distinguish them from the Cas9 systems. Firstly, the Class 2, Type V nucleases possess a single RNA-guided RuvC domain- containing effector but no HNH domain, and they recognize a TC motif protospacer adjacent motif (PAM) 5′ upstream to the target region on the non‐targeted strand, which is different from Cas9 systems which rely on G‐rich PAM at 3′ side of target sequences. Type V nucleases generate staggered double-stranded breaks distal to the PAM sequence, unlike Cas9, which generates a blunt end in the proximal site close to the PAM. In addition, Type V nucleases degrade single-stranded DNA (ssDNA) in trans when activated by target double-stranded DNA (dsDNA) or ssDNA binding in cis. In some embodiments, the CasX variant proteins of the embodiments recognize a 5′-TC PAM motif and produce staggered ends cleaved solely by the RuvC domain.

[0102] The present disclosure provides highly-modified CasX variant proteins having mutations relative to one or more reference CasX proteins, wherein the mutation results in an improved characteristic relative to the reference CasX protein, retains the ability to form an RNP with a gRNA, and retains nuclease activity.

[0103] CasX variant proteins of the disclosure comprise the following domains: a non-target strand binding (NTSB) domain, a target strand loading (TSL) domain, a helical I domain, a helical II domain, an oligonucleotide binding domain (OBD), and a RuvC DNA cleavageAttorney Docket No. SCRB-057 / 01WO 333322-2504 domain, and, in some cases, domains can be further divided into subdomains, as listed in Tables 2 and 3.

[0104] In some embodiments, a CasX variant protein can bind and / or modify (e.g., catalyze a double strand break) a target nucleic acid at a specific sequence targeted by an associated gRNA, which hybridizes to a sequence within the target nucleic acid sequence. In some embodiments, the CasX variant proteins comprise a nuclease domain having double-stranded cleavage activity that generates a double-stranded break within 18-26 nucleotides 5' of a PAM site on the target strand and 10-18 nucleotides 3' on the non-target strand, resulting in overhangs that can facilitate a higher degree of editing efficiency or insertion of a donor template nucleic acid by HDR or HITI repair mechanisms of the host cell, compared to other CRISPR systems. a. Reference CasX Proteins

[0105] The disclosure provides naturally-occurring CasX proteins (referred to herein as a "reference CasX protein"), which were subsequently modified to create the CasX variants of the disclosure. For example, reference CasX proteins can be isolated from naturally occurring prokaryotes, such as Deltaproteobacteria, Planctomycetes, or Candidatus Sungbacteria species. A reference CasX protein (interchangeably referred to herein as a reference CasX polypeptide) is a Class 2, Type V CRISPR / Cas endonuclease belonging to the CasX (interchangeably referred to as Cas12e) family of proteins that interacts with a guide RNA to form a ribonucleoprotein (RNP) complex.

[0106] In some cases, a reference CasX protein is isolated or derived from Deltaproteobacteria and comprises a sequence of SEQ ID NO: 1.

[0107] In some cases, a reference CasX protein is isolated or derived from Planctomycetes and comprises a sequence of SEQ ID NO: 2

[0108] In some cases, a reference CasX protein is isolated or derived from Candidatus Sungbacteria and comprises a sequence of SEQ ID NO: 3. b. CasX Variant Proteins

[0109] The present disclosure provides CasX variant proteins derived from one or more reference CasX proteins for use in the systems, wherein the CasX variant comprises at least one modification in at least one domain of the reference CasX protein, including the sequences of SEQ ID NOS:1-3. Any change in amino acid sequence of a reference CasX protein that leads to an improved characteristic of the CasX variant protein and that retains the ability to complex with the gRNA and modify the target nucleic acid is considered a CasX variant protein of theAttorney Docket No. SCRB-057 / 01WO 333322-2504 disclosure. Mutations can be introduced in any one or more domains or subdomains of the reference CasX protein or in a CasX variant to result in a CasX variant, and may include, for example, one or more amino acid substitutions, deletions, or insertions in any domain or subdomain of the reference CasX protein or the CasX variant from which it was derived.

[0110] The CasX variant of the disclosure have one or more improved characteristics compared to a reference CasX from which it was derived. Exemplary improved characteristics of the CasX variants, relative to a reference CasX include, but are not limited to improved ability to utilize a greater spectrum of PAM sequences in the editing and / or binding of target nucleic acid, increased nuclease activity, improved editing efficiency, improved editing specificity for the target nucleic acid, decreased off-target effects, increased percentage of a eukaryotic genome that can be efficiently edited, increased activity of the nuclease, improved ability to form cleavage-competent ribonucleoprotein (RNP) complexes with gRNA, and improved ribonucleoprotein (RNP) complex stability. In particular, the CasX variant proteins of the disclosure have an enhanced ability to efficiently edit and / or bind target DNA, when complexed with a guide RNA scaffold as an RNP, utilizing a TC PAM motif, compared to an RNP of a reference CasX protein and a reference gRNA. In the foregoing, the PAM sequence is located at least 1 nucleotide 5’ to the non-target strand of the protospacer having identity with the targeting sequence of the gRNA in an assay system compared to the editing efficiency and / or binding of an RNP comprising the reference CasX protein and reference gRNA in a comparable assay system. In the foregoing embodiments, the one or more of the improved characteristics of the CasX variant is at least about 1.1 to about 100,000-fold improved relative to the reference CasX protein of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, when assayed in a comparable fashion. In other embodiments, the improvement is at least about 1.1-fold, at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 50-fold, at least about 100-fold, at least about 500-fold, at least about 1000-fold, at least about 5000-fold, at least about 10,000-fold, or at least about 100,000-fold compared to the reference CasX protein of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

[0111] In some embodiments, a CasX variant protein comprises a sequence of SEQ ID NOS: 4-7, as set forth in Table 1. In some embodiments, a CasX variant protein consists of a sequence of SEQ ID NOS: 4-7 as set forth in Table 1. In other embodiments, a CasX variant protein comprises a sequence at least 70% identical, at least 75% identical, at least 80% identical, at least 81% identical, at least 82% identical, at least 83% identical, at least 84% identical, at leastAttorney Docket No. SCRB-057 / 01WO 333322-2504 85% identical, at least 86% identical, at least 86% identical, at least 87% identical, at least 88% identical, at least 89% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or at least 99.5% identical to a sequence set forth in Table 1, wherein the CasX variant protein retains the functional properties of the ability to form an RNP with a gRNA and retains nuclease activity. In a particular embodiment, the CasX variant of the systems comprises the sequence of SEQ ID NO: 4, or a sequence at least 70% identical, at least 75% identical, at least 80% identical, at least 81% identical, at least 82% identical, at least 83% identical, at least 84% identical, at least 85% identical, at least 86% identical, at least 86% identical, at least 87% identical, at least 88% identical, at least 89% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or at least 99.5% identical thereto. In another particular embodiment, the CasX variant of the systems comprises the sequence of SEQ ID NO: 5, or a sequence at least 70% identical, at least 75% identical, at least 80% identical, at least 81% identical, at least 82% identical, at least 83% identical, at least 84% identical, at least 85% identical, at least 86% identical, at least 86% identical, at least 87% identical, at least 88% identical, at least 89% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or at least 99.5% identical thereto. In another particular embodiment, the CasX variant of the systems comprises the sequence of SEQ ID NO: 6, or a sequence at least 70% identical, at least 75% identical, at least 80% identical, at least 81% identical, at least 82% identical, at least 83% identical, at least 84% identical, at least 85% identical, at least 86% identical, at least 86% identical, at least 87% identical, at least 88% identical, at least 89% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or at least 99.5% identical thereto. In another particular embodiment, the CasX variant of the systems comprises the sequence of SEQ ID NO: 7, or a sequence at least 70% identical, at least 75% identical, at least 80% identical, at least 81% identical, at least 82% identical, at least 83% identical, at least 84% identical, at least 85% identical, at least 86% identical, at least 86% identical, at least 87% identical, at least 88%Attorney Docket No. SCRB-057 / 01WO 333322-2504 identical, at least 89% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or at least 99.5% identical thereto.

[0112] In some embodiments, the variant CasX protein comprises a sequence of SEQ ID NOS: 4-7, or a sequence having no more than 1, 2, 3, 4, or 5 amino acid insertions, substitutions or deletions relative thereto. In some embodiments, the acid insertion, substitution or deletion is a single amino acid insertion, substitution or deletion. Table 1: Engineered CasX Variant Protein SequencesAttorney Docket No. SCRB-057 / 01WO 333322-2504

[0113] Further CasX variants contemplated for use in the systems of the disclosure are described in International Publication Nos. WO2020247882 and WO2022120095, which are hereby incorporated by reference in their entirety. c. Chimeric CasX Proteins

[0114] In some embodiment, the CasX variant proteins of the disclosure are chimeric CasX proteins. As used herein, a “chimeric CasX” or "chimeric CasX variant protein" refers to both a CasX protein containing at least two domains from different CasX sources (e.g., from twoAttorney Docket No. SCRB-057 / 01WO 333322-2504 different CasX reference proteins), as well a CasX variant protein containing at least one domain that itself is chimeric (e.g., part of a domain comprises a substitution from a different CasX protein).

[0115] In some embodiments, the disclosure provides chimeric CasX variants in which the helical I-II domain derived from SEQ ID NO: 2 is replaced with the corresponding helical I-II sequence from SEQ ID NO: 1, resulting in a chimeric CasX variant protein. In some embodiments, disclosure provides chimeric CasX variants in which the helical I-II domain and NTSB domain of the CasX variant derived from SEQ ID NO: 2 is replaced with the corresponding helical I-II and NTSB sequences from SEQ ID NO: 1, resulting in a chimeric CasX variant protein. In some embodiments, the at least one chimeric domain can be any of the NTSB, TSL, helical I, helical II, OBD or RuvC domains as described herein. In the case of split or non-contiguous domains such as helical I, RuvC and OBD, a portion of the non-contiguous domain can be replaced with the corresponding portion from any other source.

[0116] Domain sequences from reference CasX proteins, and their coordinates, are shown in Table 2. The CasX variants 491, 515, 676, and 812 have a NTSB and a portion of the helical I-II domain derived from the reference CasX sequence of SEQ ID NO: 1, while the other domains are derived from the reference CasX sequence of SEQ ID NO: 2, it being understood that the variants have additional amino acid changes at select locations (relative to the reference sequence), and the resulting chimeric CasX variant proteins were determined to have improved characteristics relative to the reference CasX proteins. In a particular embodiment, the chimeric helical I domain of the chimeric CasX variant proteins comprises amino acids 59-102 of SEQ ID NO: 2, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 99% sequence identity thereto (helical I-I), and comprises amino acids 192-332 of SEQ ID NO: 1, or at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 99% sequence identity thereto (helical I-II). The skilled artisan will understand that the domain boundaries indicated in Table 2 below are approximate, and that protein fragments whose boundaries differ from those given in the table below by 1, 2, or 3 amino acids may have the same activity as the domains described below. Table 2: Domain coordinates in Reference CasX ProteinsAttorney Docket No. SCRB-057 / 01WO 333322-2504Table 3: Exemplary Domain Sequences in Reference CasX ProteinsAttorney Docket No. SCRB-057 / 01WO 333322-2504d. CasX Fusion Proteins

[0117] Also contemplated within the scope of the disclosure are CasX variant proteins comprising a heterologous protein fused to the CasX variant for use in the systems of the disclosure. This includes CasX variant proteins comprising N-terminal or C-terminal fusions of the CasX variant to a heterologous protein or domain thereof. In some embodiments, the CasX variant protein is fused to one or more proteins or domains thereof that has a different activity of interest, resulting in a fusion protein.

[0118] In some cases, a heterologous polypeptide (a fusion partner) for use with a CasX variant in the systems of the disclosure provides for subcellular localization, i.e., the heterologous polypeptide contains a subcellular localization sequence (e.g., a nuclear localization signal (NLS) for targeting to the nucleus. In other cases, the CasX variant comprises a sequence to keep the fusion protein out of the nucleus, e.g., a nuclear export sequence (NES) to escort the CasX variant through the nuclear pore complex.

[0119] The disclosure contemplates assembly of multiple NLS in various configurations for linkage to the CasX variant protein utilized in the embodiments described herein. In some embodiments, a single NLS is linked at or near the N-terminus of the CasX variant protein. InAttorney Docket No. SCRB-057 / 01WO 333322-2504 some embodiments, a single NLS is linked at or near the N-terminus and at or near the C- terminus of the CasX variant protein. In some embodiments, the N-terminal NLS comprises one or more c-MYC NLS. In some embodiments, the C-terminal NLS comprises one or more c- MYC NLS. In some embodiments, 2, 3, 4 or more NLS are linked by linker peptides at or near the C-terminus and / or the N-terminus of the CasX variant protein. The person of ordinary skill in the art will understand that an NLS at or near the N- or C-terminus of a protein can be within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 amino acids of the N- or C- terminus. In some embodiments, the NLS linked to the N-terminus of the CasX variant protein are identical to the NLS linked to the C-terminus. In other embodiments, the NLS linked to the N-terminus of the CasX variant protein are different to the NLS linked to the C-terminus. In some cases, non-limiting examples of NLSs suitable for use with a CasX variant in the systems of the disclosure include sequences that are identical to sequences derived from: the NLS of the SV40 virus large T-antigen, having the amino acid sequence PKKKRKV (SEQ ID NO: 27); the NLS from nucleoplasmin (e.g., the nucleoplasmin bipartite NLS with the sequence KRPAATKKAGQAKKKK (SEQ ID NO: 28); the c-MYC NLS having the amino acid sequence PAAKRVKLD (SEQ ID NO: 29) or RQRRNELKRSP (SEQ ID NO: 30), or sequences having 1, 2, or 3 substitutions, insertions or deletions in the foregoing sequences. In some embodiments, the NLS linked to the N-terminus of the CasX variant protein is selected from the group consisting of the N-terminal sequences as set forth in Table 4, comprising NLS and linker sequences. In some embodiments, the NLS linked to the C-terminus of the CasX variant protein is selected from the group consisting of the C-terminal sequences as set forth in Table 5, comprising NLS and linker sequences. In some embodiments, NLSs suitable for use with a CasX variant in the systems of the disclosure include sequences having at least about 80%, at least about 90%, or at least about 95% identity or are identical to one or more sequences of Table 5. The person of ordinary skill in the art will understand that the NLSs described in Tables 4 and 5 are described as N terminal and C terminal for illustrative purposes only, and that any of the NLS in either table can be used at either the N or C terminus. Table 4: N-terminal NLS Amino Acid SequencesAttorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504*Residues in bold are NLS residues, while unbolded residues are linkers. Table 5: C-terminal NLS Amino Acid SequencesAttorney Docket No. SCRB-057 / 01WO 333322-2504

[0120] In some embodiments, the one or more NLSs are linked to the CasX variant protein or to adjacent NLS with a linker peptide wherein the linker peptide is selected from the group consisting of SR, GS, VGS, (G)n (SEQ ID NO: 95), (GS)n (SEQ ID NO: 96), (GSGGS)n (SEQ ID NO: 97), (GGSGGS)n (SEQ ID NO: 98), (GGGS)n (SEQ ID NO: 99), GGSG (SEQ ID NO: 100), GGSGG (SEQ ID NO: 101), GSGSG (SEQ ID NO: 102), GSGGG (SEQ ID NO: 103), GGGSG (SEQ ID NO: 104), GSSSG (SEQ ID NO: 105), GPGP (SEQ ID NO: 106), GGP, PPP, PPAPPA (SEQ ID NO: 107), PPPG (SEQ ID NO: 108), PPPGPPP (SEQ ID NO: 109), PPP(GGGS)n (SEQ ID NO: 110), (GGGS)nPPP (SEQ ID NO: 111), AEAAAKEAAAKEAAAKA (SEQ ID NO: 112), TPPKTKRKVEFE (SEQ ID NO: 113), GGSGGGS (SEQ ID NO: 114), GSGSGGG (SEQ ID NO: 115), and SSGNSNANSRGPSFSSGLVPLSLRGSH (SEQ ID NO: 116), where n is 1 to 5.

[0121] In general, NLS (or multiple NLSs) are of sufficient strength to drive accumulation of a CasX variant fusion protein in the nucleus of a eukaryotic cell. Detection of accumulation in the nucleus may be performed by any suitable technique. For example, a detectable marker may be fused to a CasX variant fusion protein such that location within a cell may be visualized. Cell nuclei may also be isolated from cells, the contents of which may then be analyzed by any suitable process for detecting protein, such as immunohistochemistry, Western blot, or enzyme activity assay. Accumulation in the nucleus may also be determined indirectly. e. mRNA compositions encoding CasX variant proteins

[0122] In another aspect, the disclosure relates to messenger RNA (mRNA) compositions comprising sequences that encode CasX variant proteins of the disclosure.

[0123] Modifications to an mRNA sequence can affect mRNA stability, protein translation and expression levels, and immunogenicity, and therefore have a significant impact on the efficacy of mRNA-based delivery. Optimization of coding sequences and untranslated regions (UTRs) may be particularly critical when delivering an mRNA encoding a protein of interest, asAttorney Docket No. SCRB-057 / 01WO 333322-2504 opposed to a DNA template that would be transcribed into an mRNA. DNA templates are long- lived, can replicate, and can produce many RNA transcripts over their lifetimes. For DNA templates, efficiency of transcription and pre-mRNA processing are major determinants of protein expression levels. In contrast, mRNAs generally have a much shorter half-life, on the order of hours, as they are vulnerable to degradation in the cytoplasm, and cannot produce more copies of themselves. As such, mRNA stability and translation efficiency are key determinants of protein expression levels for mRNA-based delivery, and the specific sequences of UTRs and coding sequences that dictate mRNA stability and translation efficiency can therefore be optimized to improve the efficacy of mRNA-based delivery.

[0124] In some embodiments, the modified mRNA sequences of the disclosure are codon optimized based using one or more parameters. Non-limiting examples of such parameters include the codon usage in human host cells (e.g., utilizing the codon adaptation index (CAI)) or codon-usage tables derived from biologics intended for use as therapeutics.

[0125] In some embodiments, a vector is created for the transcription of the CasX variant gene and expression and recovery of the resulting encoding mRNA. In some embodiments, the mRNA is generated by in vitro transcription (IVT) using a PCR product or linearized plasmid DNA template and a T7 RNA polymerase, wherein the plasmid contains a T7 promoter. If using a PCR product, in some embodiments DNA sequences encoding candidate mRNAs will be cloned into a plasmid containing a T7 promoter, wherein the plasmid DNA template will be linearized and then used to perform IVT reactions for expression of the mRNA. Exemplary methods for the generation of such vectors and the production and recovery of the mRNA utilize standard methods known in art, or those provided described more fully, below.

[0126] In some embodiments, the disclosure provides an mRNA sequence encoding CasX 515 (SEQ ID NO: 5), or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or having at least about 99% sequence identity thereto. In some embodiments, the mRNA sequence encoding CasX 515 comprises the nucleic acid sequence of SEQ ID NO: 167, or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity thereto. In some embodiments, the disclosure provides an mRNA sequence encoding CasX 812 (SEQ ID NO: 7), or a sequence having at least about 70%, at least about 80%, at least aboutAttorney Docket No. SCRB-057 / 01WO 333322-2504 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity thereto. In some embodiments, the mRNA sequence encoding CasX 812 comprises the nucleic acid sequence of SEQ ID NO: 169, or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity thereto. In some embodiments, the disclosure provides an mRNA sequence encoding CasX 491 (SEQ ID NO: 4), or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, orat least about 99.5% sequence identity thereto. In some embodiments, the mRNA sequence encoding CasX 491 comprises the nucleic acid sequence of SEQ ID NO: 166, or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity thereto. In some embodiments, the disclosure provides an mRNA sequence encoding CasX 676 (SEQ ID NO: 6), or a sequence having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity thereto. In some embodiments, the mRNA sequence encoding CasX 676 comprises the nucleic acid sequence of SEQ ID NO: 168, or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity thereto. Exemplary mRNA sequences encoding CasX are provided in SEQ ID NOS: 166-169 of Table 6. It will be understood that in those embodiments comprising a DNA sequence encoding an RNA, thymine (T) bases can be substituted for the uracil (U) bases of any of the RNA sequence embodiments described herein. Table 6: RNA sequences encoding CasX variant proteinsAttorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504

[0127] Various naturally-occurring or modified nucleosides may be used to produce mRNA according to the present disclosure. In some embodiments, an mRNA is or comprises natural nucleosides (e.g., adenosine, guanosine, cytidine, uridine); nucleoside analogs (e.g., 2- aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5- methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5- bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8- oxoguanosine, O(6)-methylguanine, pseudouridine, (e.g., N-1-methyl-pseudouridine), 2- thiouridine, and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2′-fluororibose, ribose, 2′- deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioates and 5′-N-phosphoramidite linkages). In some embodiments, the mRNA comprises one or more nonstandard nucleotide residues. The nonstandard nucleotide residues may include, e.g., 5- methyl-cytidine (“5 mC”), pseudouridine (“ψU”), and / or 2-thio-uridine (“2sU”). In a particular embodiment, one or more of the uridine residues of the mRNA of the disclosure are replaced with 1-methyl-pseudouridine. See, e.g., U.S. Pat. No.8,278,036 or WO2011012316, incorporated by reference herein, for a discussion of such residues and their incorporation into mRNA. In some embodiments, the mRNA encoding the CasX variant has N1- methylpseudouridine nucleosides replacing one or more, or all uridines in the sequence, represented by mψ herein. Exemplary mRNA sequences encoding CasX variants having N1- methylpseudouridine nucleosides are provided in Table 7. In some embodiments, the mRNA encoding CasX 515 with N1-methypseudouridine nucleosides comprises the nucleic acid sequence of SEQ ID NO: 171, or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto. In some embodiments, the mRNA encoding CasX 491 with N1- methypseudouridine nucleosides comprises the nucleic acid sequence of SEQ ID NO: 170, or aAttorney Docket No. SCRB-057 / 01WO 333322-2504 sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto. In some embodiments, the mRNA encoding CasX 676 with N1-methypseudouridine nucleosides comprises the nucleic acid sequence of SEQ ID NO: 172, or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto. In some embodiments, the mRNA encoding CasX 812 with N1- methypseudouridine nucleosides comprises the nucleic acid sequence of SEQ ID NO: 173, or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto. Table 7: Chemically modified RNA sequences encoding CasX variant proteinsAttorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504f. 5' cap

[0128] In some embodiments of the mRNA of the disclosure, the mRNA comprises a 5’ cap linked 5’ to the 5’ UTR of the mRNA sequence of any of the embodiments described herein. In some embodiments, the 5’ cap is a 7-methylguanylate cap. In some embodiments, the 5’ cap has the sequence m7G(5’)ppp(5’)mAGG. In other embodiments, the 5' cap has the sequence m7G(5′)ppp (5′(A,G(5′)ppp(5′)A and G(5′)ppp(5′)G. g. 5’ untranslated region (UTR)

[0129] The 5’ UTR of an mRNA molecule can be a key determinant of both the stability of the mRNA and how efficiently it is translated into protein. Specifically, the 5’ UTR, in conjunction with the 5’ cap structure, serves as a binding site and recruitment platform for the translation pre-initiation complex as well as additional regulatory proteins that may positively or negatively affect translation. Structures within the 5’ UTR can enhance translation by recruiting initiation factors or other protein or RNA factors, reduce translation by physically blocking ribosome binding and scanning, and contribute to the stability of the mRNA by affecting both hydrolysis and nuclease digestion.

[0130] An exemplary 5’ UTR sequence for use in the mRNA of the disclosure is provided in Table 8. Table 8 lists the RNA sequence, RNA sequence with N1-methylpseudouridine substituted in place of uridine, and DNA sequence of the 5’ UTR. Table 8: 5’ UTR sequencesAttorney Docket No. SCRB-057 / 01WO 333322-2504= N1-methyl-pseudouridine

[0131] In some embodiments, the 5’ UTR for use in the mRNA of the disclosure comprises the sequence of SEQ ID NO: 218 or SEQ ID NO: 194, or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% identity thereto. In some embodiments, the 5’ UTR comprises the sequence of SEQ ID NO: 218 or SEQ ID NO: 194. In some embodiments, the 5’ UTR consists of the sequence of SEQ ID NO: 218 or SEQ ID NO: 194. In some embodiments, the 5’ UTR comprises the sequence of SEQ ID NO: 219 or SEQ ID NO: 917, or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95%, identity thereto. In some embodiments, the 5’ UTR comprises the sequence of SEQ ID NO: 219 or UCUAG. In some embodiments, the 5’ UTR consists of the sequence of SEQ ID NO: 219 or UCUAG.

[0132] In some embodiments, the mRNA of the disclosure comprises a Kozak sequence. In some embodiments, the mRNA comprises the sequence GCCACC. In some embodiments, the mRNA comprises the sequence GCCACC between the 5’ UTR and the sequence encoding the CasX variant. h. 3’ UTR

[0133] 3’ UTR sequences can have a significant impact on mRNA stability and translation efficiency and can determine both subcellular localization and tissue-specific expression. Factors influencing these properties include microRNA binding sites, AU-rich elements that recruit an array of RNA-binding proteins, Pumilio binding elements, and other binding sites for RNA- binding proteins. While many of these interactions with the 3’ UTR are known to negatively impact stability or expression, some can enhance translation. The effects of a 3’ UTR sequence can be highly cell-type specific due to differential expression of microRNAs and RNA binding proteins, which provides opportunities for engineering tissue-specific expression into a therapeutic mRNA.Attorney Docket No. SCRB-057 / 01WO 333322-2504

[0134] An exemplary 3’ UTR sequence for use in the mRNA of the disclosure is provided in Table 9. Table 9 lists the RNA sequence, RNA sequence with N1-methylpseudouridine substituted in place of uridine, and DNA sequence of the 3’ UTR. Table 9: 3’ UTR sequences

[0135] In some embodiments, the 3’ UTR for use in the mRNA of the disclosure is a mouse 3’ UTR. In some embodiments, the 3’ UTR is a mouse HBA gene 3’ UTR.

[0136] In some embodiments, the 3’ UTR for use in the mRNA of the disclosure comprises the sequence of SEQ ID NO: 220 or SEQ ID NO: 195, or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 99% identity thereto. In some embodiments, the 3’ UTR comprises the sequence of SEQ ID NO: 220 or SEQ ID NO: 195. In some embodiments, the 3’ UTR consists of the sequence of SEQ ID NO: 220. In some embodiments, the 3’ UTR comprises the sequence of SEQ ID NO: 221, or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 99% identity thereto. In some embodiments, the 3’ UTR comprises the sequence of SEQ ID NO: 221 or SEQAttorney Docket No. SCRB-057 / 01WO 333322-2504 ID NO: 919. In some embodiments, the 3’ UTR consists of the sequence of SEQ ID NO: 221 or SEQ ID NO: 919. i. Poly(A) sequence

[0137] The 3’ poly(A) tail contributes to mRNA stability and translation efficiency. Generally, longer poly(A) tails are associated with increased mRNA stability, thereby allowing their translation and promoting high protein expression.

[0138] In some embodiments, the mRNAs of the disclosure comprise a poly(A) sequence. In some embodiments, the poly(A) sequence comprises at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 185, or at least about 190 adenine nucleotides. In some embodiments, the poly(A) sequence comprises about 40-190 adenine nucleotides. In some embodiments, the poly(A) sequence comprises about 50-150 adenine nucleotides. In some embodiments, the poly(A) sequence comprises about 70-90 adenine nucleotides. In some embodiments, the poly(A) sequence comprises about 78-82 adenine nucleotides. In some embodiments, the poly(A) sequence comprises 80 adenine nucleotides. In some embodiments, the poly(A) sequence comprises the sequence of AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 191). In some embodiments, the poly(A) sequence comprises 79 adenine nucleotides. In some embodiments, the poly(A) sequence comprises the sequence of AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 200). j. mRNA sequences

[0139] In some embodiments, the mRNA comprises the following components in 5’ to 3’ orientation: a 5’ cap; a 5' UTR; an NLS; a sequence encoding a CasX variant protein; an NLS; a 3' UTR; and a poly(A) sequence. In some embodiments, the mRNA comprises the following components in 5’ to 3’ orientation: a 5’ cap; a 5' UTR; an NLS; a sequence encoding a CasX variant protein; a 3' UTR; and a poly(A) sequence. In some embodiments, the mRNA comprises the following components in 5’ to 3’ orientation: a 5’ cap; a 5' UTR; a sequence encoding a CasX variant protein; an NLS; a 3' UTR; and a poly(A) sequence. In some embodiments, theAttorney Docket No. SCRB-057 / 01WO 333322-2504 mRNA comprises the following components in 5’ to 3’ orientation: a 5’ cap; a 5' UTR; a sequence encoding a CasX variant protein; a 3' UTR; and a poly(A) sequence.

[0140] In some embodiments, the mRNA comprises from 5’ to 3’, 5’ UTR, a start codon, a sequence encoding a CasX variant protein, an NLS, a stop codon, and a 3’ UTR. In some embodiments, the mRNA comprises from 5’ to 3’, 5’ UTR, a start codon, a sequence encoding a CasX variant protein, an NLS, a stop codon, and a 3’ UTR. In some embodiments, the mRNA further comprises a sequence encoding an NLS between the start codon and the sequence encoding CasX. In some embodiments, the mRNA comprises a sequence selected from the group consisting of SEQ ID NOS: 152-155, or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto. In some embodiments, the mRNA sequence comprises a sequence selected from the group consisting of SEQ ID NOS: 152-155.

[0141] In some embodiments, the mRNA further comprises a poly(A) tail located 3’ to the 3’ UTR. In some embodiments, the mRNA sequence further comprises one or more modifications in the sequence encoding the CasX variant protein. In some embodiments, the disclosure provides an mRNA comprising a sequence selected from the group consisting of SEQ ID NOS: 156-159, or a sequence having at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto. In some embodiments, the mRNA sequence comprises the of SEQ ID NOS: 156-159.

[0142] Exemplary full-length mRNA sequences encoding CasX variants are provided in Table 10. Table 10 lists the RNA sequences, RNA sequences with N1-methylpseudouridine substituted in place of uridine, and DNA sequences encoding the mRNAs. The sequences in Table 10 include, from 5’ to 3’, AGG nucleotides 5’ of the 5’ UTR, a 5’ UTR, GCCACC nucleotides, a start codon, a sequence encoding a c-MYC NLS, a sequence encoding a linker, a sequence encoding CasX, a sequence encoding a linker, a sequence encoding a c-MYC NLS, a stop codon, a 3’ UTR, and a sequence corresponding to a partial XbaI restriction site (UCUAG; mψCmψAG; or TCTAG for RNA, N1-methylpseudouridine substituted RNA, and DNA sequences, respectively). In some embodiments, the mRNA sequences of Table 10 further comprise a 5' cap sequence of m7G(5')ppp(5')(2'OMeA)pG, m7(3'OMeG)(5')ppp(5')(2'OMeA)pG, or m7(3’OMeG)(5’)ppp(‘5)m6(2’OMeA)pG, it beingAttorney Docket No. SCRB-057 / 01WO 333322-2504 understood that the last two bases of the cap replace the first two bases of the respective mRNA sequence of the Table. Table 10: Exemplary full-length mRNA sequences encoding CasX variantsAttorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504*‘mψ’ = N1-methyl-pseudouridine

[0143] Various naturally-occurring or modified nucleosides may be used to produce mRNA according to the present disclosure. In some embodiments, an mRNA comprises natural nucleosides (e.g., adenosine, guanosine, cytidine, uridine); nucleoside analogs (e.g., 2- aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5- methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5- bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8- oxoguanosine, O(6)-methylguanine, pseudouridine, (e.g., N-1-methyl-pseudouridine), 2- thiouridine, and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2′-fluororibose, ribose, 2′- deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioates and 5′-N-phosphoramidite linkages). In some embodiments, the mRNA comprises one or more nonstandard nucleotide residues. The nonstandard nucleotide residues may include, e.g., 5- methyl-cytidine (“5 mC”), pseudouridine (“ψU”), and / or 2-thio-uridine (“2sU”). In a particularAttorney Docket No. SCRB-057 / 01WO 333322-2504 embodiment, one or more of the uridine residues of the mRNA of the disclosure are replaced with N1-methyl-pseudouridine. In some embodiments, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%, or 100% of uridine nucleosides of the mRNA are replaced with N1- methylpseudouridine. In some embodiments, at least 10%-100% of uridine nucleosides of the mRNA are replaced with N1-methylpseudouridine. In some embodiments, at least 40%-80% of uridine nucleosides of the mRNA are replaced with N1-methylpseudouridine. In some embodiments, at least 50%-70% of uridine nucleosides of the mRNA are replaced with N1- methylpseudouridine. In some embodiments, all of uridine nucleosides of the mRNA are replaced with N1-methylpseudouridine. See, e.g., U.S. Pat. No.8,278,036 or WO2011012316, incorporated by reference herein, for a discussion of such residues and their incorporation into mRNA. IV. Guide Nucleic Acids of the Systems for Genetic Editing of Target Nucleic Acid

[0144] In another aspect, the present disclosure provides systems comprising a guide ribonucleic acid (gRNA) together with a messenger RNA (mRNA) sequence encoding a CasX variant protein for use in modifying CD38 target nucleic acids in a cell. As used herein, the term "gRNA” covers naturally-occurring molecules and gRNA variants, including chimeric gRNA variants comprising domains from different gRNA. gRNAs of the disclosure comprise a scaffold and a targeting sequence complementary to the CD38 target nucleic acid of a cell. As used herein, a "system", used interchangeably with "composition", can comprise a gRNA and an mRNA encoding a CasX variant protein of any of the embodiments disclosed herein, which can be utilized as gene editing pairs.

[0145] In some embodiments, the disclosure provides systems comprising a gRNA and an mRNA encoding a CasX variant protein as a CasX:gRNA system designed, upon expression of the CasX variant protein in a transfected cell, to form a ribonucleoprotein (RNP) complex with the gRNA, and to target and edit specific locations in the CD38 target nucleic acid sequence of the cell. The gRNA provides target specificity to the complex by including a targeting sequence (or “spacer”) having a nucleotide sequence that is complementary to a sequence of the CD38 target nucleic acid sequence while the CasX variant protein of the system provides the site- specific activity, such as cleavage of the target sequence, that is guided to a target site (e.g., stabilized at a target site) within a target nucleic acid sequence by virtue of its association with the gRNA. Both single-stranded cleavage and double-stranded cleavage are possible, and double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events byAttorney Docket No. SCRB-057 / 01WO 333322-2504 the CasX variant protein. In some embodiments, indels are introduced in the target nucleic acid by the CasX:gRNA systems of the embodiments described herein and cellular repair systems that can disrupt the protein reading frame of the targeted CD38 gene.

[0146] Embodiments of gRNAs, CasX variants, and mRNAs for use in the editing of target nucleic acids are described herein, below. a. Reference gRNA and gRNA variants

[0147] As used herein, a “reference gRNA" refers to a CRISPR guide ribonucleic acid comprising a wild-type sequence of a naturally-occurring CRISPR gRNA. In some embodiments, a gRNA scaffold of the disclosure may be subjected to one or more mutagenesis methods, such as the mutagenesis methods described in WO2022120095A1 and WO2020247882A1, incorporated by reference herein, which may include Deep Mutational Evolution (DME), deep mutational scanning (DMS), error prone PCR, cassette mutagenesis, random mutagenesis, staggered extension PCR, gene shuffling, domain swapping, or chemical modification to generate one or more gRNA variants with enhanced or varied properties relative to the gRNA scaffold that was modified. The activity of the gRNA scaffold from which a gRNA variant was derived may be used as a benchmark against which the activity of the gRNA variant is compared, thereby measuring improvements in function or other characteristics of the gRNA scaffold.

[0148] Table 11 provides the sequences of reference gRNA tracr and scaffold sequences. In some embodiments, the disclosure provides gRNA sequences wherein the gRNA has a scaffold comprising a sequence having one or more nucleotide modifications relative to a reference gRNA sequence of any one of SEQ ID NOS: 229-241 of Table 11. Table 11: Reference gRNA tracr and scaffold sequencesAttorney Docket No. SCRB-057 / 01WO 333322-2504b. gRNA Domains and their Function

[0149] The gRNAs of the systems of the disclosure comprise two segments: a targeting sequence and a protein-binding segment. The targeting segment of a gRNA includes a nucleotide sequence (referred to interchangeably as a guide sequence, a spacer, a targeter, or a targeting sequence) that is complementary to (and therefore hybridizes with) a specific sequence (a target site) within the target nucleic acid sequence (e.g., a strand of a double stranded target DNA, a target ssRNA, a target ssDNA, etc.), including, in the context of the present disclosure, a coding sequence, a complement of a coding sequence, a non-coding sequence, and to accessory elements. The protein-binding segment (or “activator” or “protein-binding sequence”) interacts with (e.g., binds to) a CasX protein as a complex, forming an RNP (described more fully, below). The protein-binding segment is alternatively referred to herein as a “scaffold”, which is comprised of several regions, described more fully, below. The properties and characteristics of CasX gRNA, both wild-type and variants, are described in WO2020247882A1, US20230124880A1, and WO2022120095A1, incorporated by reference herein.

[0150] In the case of a reference gRNA, the gRNA occurs naturally as a dual guide RNA (dgRNA), wherein the targeter and the activator portions each have a duplex-forming segment that have complementarity with one another and hybridize to one another to form a double stranded duplex (dsRNA duplex for a gRNA). The term “targeter” or “targeter RNA” is used herein to refer to a crRNA-like molecule (crRNA: "CRISPR RNA") of a CasX dual guide RNA (and therefore of a CasX single guide RNA when the “activator" and the "targeter” are linked together, e.g., by intervening nucleotides). The crRNA has a 5' region that anneals with the tracrRNA followed by the nucleotides of the targeting sequence. In the case of the gRNA for use in the systems of the disclosure, the scaffolds are designed such that the activator and targeter portions are covalently linked to one another (rather than hybridizing to one another) andAttorney Docket No. SCRB-057 / 01WO 333322-2504 comprise a single molecule, and can be referred to as a “single-molecule gRNA,” “single guide RNA”, a “single-molecule guide RNA,” a “one-molecule guide RNA”, or a “sgRNA”.

[0151] Collectively, the assembled gRNAs of the disclosure comprise distinct structured regions, or domains: the RNA triplex, the scaffold stem loop, the extended stem loop, the pseudoknot (see FIGS.13A-13C), and the targeting sequence that, in the embodiments of the disclosure is specific for a target nucleic acid and is located on the 3’ end of the gRNA. The RNA triplex, the scaffold stem loop, the pseudoknot and the extended stem loop, together with the unstructured triplex loop that bridges portions of the triplex, together, are referred to as the “scaffold” of the gRNA. Thus, the scaffold is constituted by all the gRNA domains except the targeting sequence. In some cases, the scaffold stem further comprises a bubble. In other cases, the scaffold further comprises a triplex loop region. In still other cases, the scaffold further comprises a 5’ unstructured region. In some embodiments, the gRNA scaffolds of the disclosure comprise a scaffold stem loop having the sequence of CCAGCGACUAUGUCGUAGUGG (SEQ ID NO: 120) or a sequence having 1, 2, 3, 4, or 5 mismatches thereto.

[0152] Each of the structured domains contribute to establishing the global RNA fold of the guide and retain functionality of the guide; particularly the ability to properly complex with the CasX protein. For example, the guide scaffold stem interacts with the helical I domain of CasX protein, while residues within the triplex, triplex loop, and pseudoknot stem interact with the OBD of the CasX protein. Together, these interactions confer the ability of the guide to bind and form an RNP with the CasX that retains stability, while the spacer (or targeting sequence) directs and defines the specificity of the RNP for binding a specific sequence of DNA. c. gRNA Modifications

[0153] In another aspect, the disclosure relates to gRNA for use in the gene-editing systems of the disclosure, which comprise one or more modifications relative to a reference gRNA scaffold from which it was derived. In some embodiments, a gRNA variant for use in the systems of the disclosure comprises one or more nucleotide substitutions, insertions, deletions, or swapped or replaced domains that improve a characteristic relative to the reference gRNA. Exemplary regions for modifications and swapped regions or domains include the RNA triplex, the pseudoknot, the scaffold stem loop, and the extended stem loop. In some embodiments, the gRNA variant of the disclosure comprises at least a first swapped region from a different gRNA, resulting in a chimeric gRNA. A representative example of such a chimeric gRNA is guide 316 (SEQ ID NO: 119), in which the extended step of gRNA scaffold 235 (SEQ ID NO: 118) isAttorney Docket No. SCRB-057 / 01WO 333322-2504 replaced with the extended stem of gRNA scaffold 174 (SEQ ID NO: 117), wherein the resulting 316 variant retains the ability to form an RNP with a CasX variant protein and exhibits an improved functional characteristic compared to the parent 235, when assessed in an in vitro or in vivo assay under comparable conditions.

[0154] All gRNAs that have one or more improved functions, characteristics, or add one or more new functions when the gRNA scaffold variant is compared to a gRNA scaffold from which it was derived, while retaining the functional properties of being able to complex with the CasX and guide the CasX ribonucleoprotein holo complex to the target nucleic acid are envisaged as within the scope of the disclosure. In some embodiments, the gRNA has an improved characteristic selected from the group consisting of increased editing activity, increased pseudoknot stem stability, increased triplex region stability, increased scaffold stem stability, extended stem stability, reduced folding intermediates, and increased binding affinity to a CasX variant protein, or any combination thereof. In some cases of the foregoing, the improved characteristic is assessed in an in vitro assay, including the assays of the Examples. In other cases of the foregoing, the improved characteristic is assessed in vivo.

[0155] Table 12 provides exemplary gRNA variant scaffold sequences of the disclosure that are utilized as gRNA scaffolds or for the generation of the gRNAs for use in the CasX:gRNA systems of the disclosure. In some embodiments, the gRNA variant scaffold for use in the systems comprises any one of the sequences listed in Table 12, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity thereto, wherein the gRNA variant retains the ability to form an RNP with a CasX of the disclosure. It will be understood that in those embodiments wherein a vector comprises a DNA encoding a sequence for a gRNA, that thymine (T) bases can be substituted for the uracil (U) bases of any of the gRNA sequence embodiments described herein. Table 12: Exemplary gRNA Scaffold SequencesAttorney Docket No. SCRB-057 / 01WO 333322-2504

[0156] Further gRNA variants for use in the systems of the disclosure are described in International Publication Nos. WO2020247882 and WO2022120095, which are hereby incorporated by reference in their entirety. d. gRNA Scaffold 316

[0157] In other embodiments, the gRNA variant scaffold has improved manufacturability compared to the gRNA scaffold from which it was derived. Guide scaffolds can be made by several methods, including recombinantly or by solid-phase RNA synthesis. However, the length of the scaffold can affect the manufacturability when using solid-phase RNA synthesis, with longer lengths resulting in increased manufacturing costs, decreased purity and yield, and higher rates of synthesis failures. For use in lipid nanoparticle (LNP) formulations, solid-phase RNA synthesis of the scaffold is preferred to generate the quantities needed for commercial development. While previous experiments had identified gRNA scaffold 235 as having enhanced properties relative to gRNA scaffold 174, its increased length (in nucleotides) may result in more difficult manufacturing. Accordingly, alternative sequences were sought. In some embodiments, the disclosure provides a gRNA wherein the gRNA scaffold and linked targeting sequence has a sequence less than about 115 nucleotides, less than about 110 nucleotides, or less than about 100 nucleotides. In some embodiments, the disclosure provides a gRNA wherein the gRNA scaffold and linked targeting sequence has a sequence between 100-115 nucleotides, or any integer in between.

[0158] In one embodiment, a gRNA scaffold was designed wherein the scaffold 235 sequence was modified by a domain swap in which the extended stem loop of scaffold 174 replaced the extended stem loop of the 235 scaffold, resulting in the chimeric gRNA scaffold 316, having the sequence ACUGGCGCUUCUAUCUGAUUACUCUGAGCGCCAUCACCAGCGACUAUGUCGUAGU GGGUAAAGCUCCCUCUUCGGAGGGAGCAUCAGAG (SEQ ID NO: 119). In some embodiments, the shorter sequence length of the gRNA 316 scaffold confers the improvements of a higher fidelity in the ability to create the guide synthetically with the correct and complete sequence, as well as an enhanced ability to be successfully incorporated into an LNP. TheAttorney Docket No. SCRB-057 / 01WO 333322-2504 resulting 316 scaffold had the further advantage in that the extended stem loop does not contain CpG motifs; an enhanced property conferring reduced potential to elicit an immune response. In addition to improvements in manufacturability, the 316 scaffold promotes enhance editing than gRNA variant 174 in editing assays. In some embodiments, the disclosure provides gRNA 316 variants that are chemically-modified, as described below. e. Chemically-modified gRNAs

[0159] In some embodiments, the gRNAs disclosed herein have one or more chemical modifications. In some embodiments, the chemical modification is the addition of a 2’O-methyl group to one or more nucleotides of the sequence. In some embodiments, one or more nucleotides on each terminal end of the gRNA are modified by an addition of a 2’O-methyl group. In some embodiments, one or more nucleotides located 1, 2, 3, or 4 nucleotides from the 5’ terminal end, the 3’ terminal, or both terminal ends of the gRNA are modified by an addition of a 2’O-methyl group.

[0160] In some embodiments, the chemical modification is substitution of a phosphorothioate bond between two or more nucleotides of the sequence. In some embodiments, the chemical modification is a substitution of phosphorothioate bonds between two or more nucleotides on each terminal end of the gRNA. In some embodiments, the gRNA comprises a substitution of phosphorothioate bonds between two or more nucleotides located 1, 2, 3 or 4 nucleotides the from the 5’ terminal end (e.g., A, C, and U in the case of gRNA 174, 235, and 316), the 3’ terminal, or both terminal ends of the gRNA.

[0161] In some embodiments, the gRNA comprises an addition of a 2’O-methyl group to one or more nucleotides of the gRNA. In some embodiments, one or more nucleotides located 1, 2, 3, or 4 nucleotides from the 5’ terminal end, the 3’ terminal, or both terminal ends of the gRNA are modified by an addition of a 2’O-methyl group. In some embodiments, the first 1, 2, or 3 nucleotides of the 5’ end of the scaffold are modified by the addition of a 2’O-methyl group and each of the modified nucleotides is linked to the adjoining nucleotide by a phosphorothioate bond. Similarly, the last 1, 2, or 3 nucleotides of the 3’ end of the targeting sequence linked to the 3’ end of the scaffold are similarly modified to produce an end-protected variant (collectively, the construct with the foregoing modifications termed "v1"). In other embodiments, the 5' and 3' ends, as well as nucleotides in select interior regions are similarly modified by the addition of a 2’O-methyl group. In another embodiment, gRNA and linked targeting sequence were designed in which a 3’UUU tail was added, in addition to the v1Attorney Docket No. SCRB-057 / 01WO 333322-2504 modifications, to the construct to mimic the termination sequence used in cellular transcription systems and to move the modified nucleotides of the v1 outside of the region of the targeting sequence involved in target recognition (termed "v2"). In another embodiment, gRNA were designed in which, in addition to the v1 end-protection modifications, additional 2’OMe modifications were made at nucleotides identified to be potentially modifiable, based on structural analysis of the scaffold (termed "v3"). In another embodiment, gRNA were designed in which the 2’OMe modifications of the v3 version in the triplex region of the scaffold were removed to reduce perturbation of the RNA helical structure and maintain backbone flexibility of the resulting scaffold (termed "v4). In another embodiment, gRNA were designed in which the modifications included the end-protected modifications of the v1 version and 2’OMe modifications were introduced in the scaffold stem and extended stem regions of the scaffold (termed "v5"). In another embodiment, gRNA were designed in which the modifications included the end-protected modifications of the v1 version and 2’OMe modifications were introduced only in the extended stem region of the scaffold (termed "v6"). Schematics of the configurations are show in FIGS.10A, 10B, 12, 18A and 18B. In some embodiments, the disclosure provides gRNA of the v1, v2, v3, v4, v5, v6, v7, v8, or v9 configurations having a sequence selected from the group consisting of the sequences set forth in Table 8A (SEQ ID NOS: 122-130, 132-140, and 142-150) of Example 8 (it being understood that for utilization in the systems of the disclosure, the non-targeting 20 nucleotides at the 3' end are replaced with a targeting sequence complementary to the CD38 target nucleic acid to be modified, and / or which can have 18, 19, 20, 21, or 22 nucleotides). In some embodiments, the modified gRNA is a v1 configuration and comprises a sequence selected from the group consisting of SEQ ID NOS: 692-917, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto. In some embodiments, the modified gRNA is a v1 configuration and comprises a sequence selected from the group consisting of SEQ ID NOS: 692-743, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto. In a particular embodiment, the modified gRNA is a v1 configuration and comprises a sequence selected from the group consisting of SEQ ID NOS: 694-696, 702, 710, and 730, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 95%, at least about 96%, at least aboutAttorney Docket No. SCRB-057 / 01WO 333322-2504 97%, at least about 98%, or at least about 99% sequence identity thereto. In a particular embodiment, the modified gRNA is a v1 configuration and consists of a sequence selected from the group consisting of SEQ ID NOS: 694-696, 702, 710, and 730. In the foregoing embodiments, the gRNA retains the ability for form an RNP complex with a CasX variant of the disclosure. In some embodiments, the gRNA and linked targeting sequence of the chemically modified configurations exhibit reduced susceptibility of the gRNA to degradation by cellular RNase compared to an unmodified gRNA. In some embodiments, the chemically-modified gRNA exhibit at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60% less susceptibility to degradation by cellular RNase compared to an unmodified gRNA. f. Targeting Sequences

[0162] Site-specific binding and / or cleavage of a target nucleic acid sequence (e.g., genomic DNA) by the CasX variant protein can occur at one or more locations (e.g., a sequence of a target nucleic acid) determined by base-pairing complementarity between the targeting sequence of the gRNA and the target nucleic acid sequence. Thus, for example, the gRNA of the disclosure have sequences complementarity to and therefore can hybridize with the CD38 target nucleic acid that is adjacent to a sequence complementary to a TC protospacer adjacent motif (PAM) motif or a PAM sequence, such as ATC, CTC, GTC, or TTC. In some embodiments, the PAM sequence recognized by the gRNA of the disclosure is TTC. Because the targeting sequence of a guide sequence hybridizes with a sequence of a target nucleic acid sequence, a targeting sequence can be modified by a user to hybridize with a specific target nucleic acid sequence, so long as the location of the PAM sequence is considered. By selection of the targeting sequences of the gRNA, defined regions of the CD38 target nucleic acid sequence or sequences bracketing a particular location within the CD38 target nucleic acid can be modified or edited using the CasX:gRNA systems described herein. In some embodiments, the targeting sequence of the gRNA has between 15 and 20 consecutive nucleotides. In some embodiments, the targeting sequence has 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides. In some embodiments, the targeting sequence consists of 22 consecutive nucleotides. In some embodiments, the targeting sequence consists of 21 consecutive nucleotides. In some embodiments, the targeting sequence consists of 20 consecutive nucleotides. In some embodiments, the targeting sequence consists of 19 consecutive nucleotides. In some embodiments, the targeting sequence consists of 18 consecutive nucleotides. In someAttorney Docket No. SCRB-057 / 01WO 333322-2504 embodiments, the targeting sequence consists of 17 consecutive nucleotides. In some embodiments, the targeting sequence consists of 16 consecutive nucleotides. In some embodiments, the targeting sequence consists of 15 consecutive nucleotides.

[0163] In some embodiments, the targeting sequence of the gRNA is complementary to an exon of the CD38 gene. In some embodiments, the targeting sequence of the gRNA is complementary to a sequence of a CD38 exon selected from the group consisting of exon 1, exon 2, exon 3, exon 5, exon 6, exon 7, and exon 8. In some embodiments, the targeting sequence of the gRNA is complementary to a sequence of CD38 exon 1. In some embodiments, the targeting sequence for use in the systems of the disclosure is complementary to an intron of the CD38 gene. In some embodiments, the targeting sequence of the gRNA is complementary to a sequence of a CD38 intron-exon junction. In some embodiments, the targeting sequence of the gRNA is complementary to a sequence encoding an untranslated region (UTR) of the CD38 gene. In some embodiments, the targeting sequence of the gRNA is complementary to a sequence encoding an UTR-exon junction of the CD38 gene. In some embodiments, the targeting sequence is complementary to a cis-regulatory element of the CD38 gene.

[0164] In some embodiments, the targeting sequence of the gRNA for linkage to the gRNA scaffolds of the disclosure, e.g., gRNA 174, 235, or 316, comprises a sequence selected from the group consisting of SEQ ID NOS: 242-466, as set forth in Table 13, or a sequence having at least about 70%, at least about 75%, at least about 85%, or at least about 95% identity thereto. In some embodiments, the targeting sequence of the gRNA for linkage to the gRNA scaffolds of the disclosure, e.g., gRNA 174, 235, or 316, comprises a sequence selected from the group consisting of SEQ ID NOS: 242-466, as set forth in Table 13, or a sequence having at least 1, 2, 3, or 4 substitutions, insertions, or deletions relative thereto. In some embodiments, the targeting sequence of the gRNA for linkage to the gRNA scaffolds of the disclosure, e.g., gRNA 174, 235, or 316, consists of a sequence selected from the group consisting of SEQ ID NOS: 242-466, as set forth in Table 13. In some embodiments, the targeting sequence of the gRNA is selected from the group consisting of SEQ ID NOS: 242-466, optionally with 1, 2, 3, 4, or 5 nucleotide(s) removed from the 3’ end of the sequence. In some embodiments, the targeting sequence of the gRNA comprises a sequence selected from the group consisting of SEQ ID NOS: 244-246, 252, 260, and 280, optionally with 1, 2, 3, 4, or 5 nucleotide(s) removed from the 3’ end of the sequence. In some embodiments, the targeting sequence of the gRNA consists of a sequence selected from the group consisting of SEQ ID NOS: 244-246, 252, 260, and 280.Attorney Docket No. SCRB-057 / 01WO 333322-2504

[0165] In some embodiments, the sequence of the gRNA and linked targeting sequence is selected from the group consisting of SEQ ID NOS: 467-691, or a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, or at least 99% identical to SEQ ID NOS: 467-691, as set forth in Table 14. In some embodiments, the targeting sequence of the gRNA has 1, 2, 3, 4, or 5 nucleotide(s) removed from the 3’ end of the sequence. Table 13: RNA Sequences of Targeting Sequences Specific to Human CD38Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Table 14: gRNA Sequences Targeting Human CD38Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504

[0166] In some embodiments, the gRNA and linked targeting sequence used in a system of the disclosure exhibit a low degree of off-target effects to the DNA of a cell. As used herein, "off- target effects" refers to off-target effects of unintended cleavage which result in DNA mutations or structural DNA rearrangements at untargeted genomic sites showing a similar but not an identical sequence compared to the target site. In some embodiments, the off-target effects exhibited by a gRNA and linked targeting sequence in a system of the disclosure is less than about 5%, less than about 4%, less than 3%, less than about 2%, less than about 1%, less than about 0.5%, less than 0.1% allele frequency at the off-target genomic sites in cells, or below the limit of detection. In some embodiments the off-target effects are determined in silico. In some embodiments the off-target effects are determined in an in vitro cell-free assay. In some embodiments the off-target effects are determined in a cell-based assay. g. Chemically Modified gRNA

[0167] In some embodiments, the gRNAs have one or more chemical modifications. In some embodiments, the chemical modification is the addition of a 2’O-methyl group to one or more nucleotides of the sequence. In some embodiments, the chemical modification is substitution of a phosphorothioate bond between two or more nucleotides on each terminal end of the sequence. In some embodiments, the gRNA comprises a substitution of phosphorothioate bonds between two or more nucleotides located 1, 2, 3 or 4 nucleotides the from the 5’ terminal end, the 3’ terminal, or both terminal ends of the gRNA. In some embodiments, the gRNA comprises an addition of a 2’O-methyl group to one or more nucleotides of the gRNA. In some embodiments, one or more nucleotides located 1, 2, 3, or 4 nucleotides from the 5’ terminal end, the 3’ terminal, or both terminal ends of the gRNA are modified by an addition of a 2’O-methyl group. In some embodiments, the first 1, 2, or 3 nucleotides of the 5’ end of the scaffold (i.e., A, C, and U in the case of gRNA 174, 235, and 316) are modified by the addition of a 2’O-methyl group and each of the modified nucleotides is linked to the adjoining nucleotide by a phosphorothioateAttorney Docket No. SCRB-057 / 01WO 333322-2504 bond. Similarly, the last 1, 2, or 3 nucleotides of the 3’ end of the targeting sequence linked to the 3’ end of the scaffold are similarly modified. In some embodiments, the disclosure provides gRNA with chemical modifications selected from the group consisting of the sequences of SEQ ID NOS: 692-916, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto. In some embodiments, the disclosure provides gRNA with chemical modifications selected from the group consisting of the sequences of SEQ ID NOS: 692-916. In some embodiments, the disclosure provides gRNA with chemical modifications selected from the group consisting of the sequences of SEQ ID NOS: 694-696, 702, 710, and 730.

[0168] A schematic of the structure of gRNA variants 174, 235, and 316 are shown in FIGS. 13A-13C, respectively, and chemically-modified configurations v1-v9 are shown in FIGS.10A, 10B and 12. In some embodiments, a gRNA with chemical modifications exhibits improved stability compared to gRNA without chemical modifications, including resistance to ribonucleases. h. Complex Formation with CasX Variant Protein

[0169] Upon delivery or expression of the components of the system in a target cell, the gRNA is capable of complexing as an RNP with a CasX variant protein and binding to the target nucleic acid of the CD38 gene. In some embodiments, a gRNA variant has an improved ability to form an RNP complex with a CasX variant protein when compared to a reference gRNA or a gRNA variant from which it was derived. Improving ribonucleoprotein complex formation may, in some embodiments, improve the efficiency with which functional RNPs are assembled. In some embodiments, greater than 90%, greater than 93%, greater than 95%, greater than 96%, greater than 97%, greater than 98% or greater than 99% of RNPs comprising a gRNA variant and its targeting sequence are cleavage competent for gene editing or modification of a target nucleic acid. V. Polynucleotides, Vectors, and Particles

[0170] In another aspect, the present disclosure relates to polynucleotides encoding variant proteins (e.g., CasX) and gRNA of the embodiments described herein. Additionally, the disclosure provides vectors comprising polynucleotides encoding the CasX variant proteins and the gRNAs described herein. In some cases, the vectors are utilized for the expression and recovery of the CasX and gRNA components of the gene editing pair. In other cases, the vectorsAttorney Docket No. SCRB-057 / 01WO 333322-2504 are utilized for the delivery of the encoding polynucleotides to target cells for the editing of the target nucleic acid, as described more fully, below. In some embodiments, sequences encoding the CasX variant and a gRNA are templated on the same vector. In some embodiments, sequences encoding the CasX variant and a gRNA are templated on different vectors. In some embodiments, a vector encoding the CasX is used with a gRNA targeting the CD38 gene for delivery to the cell to be modified. Suitable vectors are described, for example, in WO2022120095A1 and WO2020247882A1, incorporated by reference herein. As described in WO2022120095A1 and WO2020247882A1, depending on the host / vector system utilized, any of a number of suitable transcription and translation control elements, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, etc. may be used in the expression vector.

[0171] In some embodiments, the disclosure provides polynucleotide sequences encoding any of the CasX variants described herein, including the CasX variant proteins of SEQ ID NOS: 4-7 as set forth in Table 1, or sequences having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto. In some embodiments, the disclosure provides polynucleotide sequences encoding any of the CasX variants described herein, including the CasX variant proteins of SEQ ID NOS: 4-7 as set forth in Table 1, or sequences having 1, 2, 3, 4, or 5 amino acid substitutions, insertions, or deletions. In some embodiments, the disclosure provides an isolated polynucleotide sequence encoding any of the gRNA variants described herein, including those described in the Examples. In some embodiments, the disclosure provides polynucleotides encoding a gRNA scaffold sequence of SEQ ID NOS: 117-119 as set forth in Table 12, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity thereto, wherein the expressed gRNA variant retains the ability to form an RNP with a CasX. In some embodiments, the disclosure provides polynucleotides encoding a gRNA scaffold sequence of SEQ ID NOS: 117-119 as set forth in Table 12, or a sequence having 1, 2, 3, 4, or 5 nucleotide substitutions, insertions, or deletions. In other embodiments, the disclosure provides polynucleotide sequences encoding gRNA comprising scaffolds of SEQ ID NOS: 117-119 and comprising targeting sequences of SEQ ID NOS: 242- 466, or sequences having at least about 70%, at least about 75%, at least about 85%, or at least about 95% identity thereto. In other embodiments, the disclosure provides a polynucleotideAttorney Docket No. SCRB-057 / 01WO 333322-2504 sequence encoding a gRNA scaffold of any one of SEQ ID NOS: 117-119 and encoding a targeting sequence of any one of SEQ ID NOS: 242-466.

[0172] In some embodiments, the disclosure relates to methods to produce polynucleotide sequences encoding the CasX variant or the gRNA described herein, including variants thereof, as well as methods to express the proteins expressed or RNA transcribed by the polynucleotide sequences. In general, the methods include producing a polynucleotide sequence coding for the CasX or the gRNA described herein and incorporating the encoding gene into an expression vector. In some embodiments, the vector is designed for transduction of cells for modification of the CD38 target nucleic acid. Such vectors can include a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, a herpes simplex virus (HSV) vector, a plasmid, a minicircle, a nanoplasmid, a DNA vector, and an RNA vector. In other embodiments, the expression vector is designed for production of CasX, mRNA encoding CasX, or gRNA in either a cell-free system or in a host cell. For production of the encoded CasX or the gRNA described herein in a host cell, the methods include transforming an appropriate host cell with an expression vector comprising the encoding polynucleotide, and culturing the host cell under conditions causing or permitting the resulting CasX or the gRNA described herein to be expressed or transcribed in the transformed host cell, thereby producing the CasX or the gRNA, which are recovered by standard purification methods known in the art. Standard recombinant techniques in molecular biology are used to make the polynucleotides and expression vectors of the present disclosure.

[0173] In accordance with the disclosure, nucleic acid sequences that encode the CasX variant or the gRNA described herein are used to generate recombinant DNA molecules that direct the expression in appropriate host cells. Several cloning strategies are suitable for performing the present disclosure, many of which are used to generate a construct that comprises a gene coding for a composition of the present disclosure, or its complement. In some embodiments, the cloning strategy is used to create a gene that encodes a construct that comprises nucleotides encoding the CasX variant or the gRNA that is used to transform a host cell for expression of the composition.

[0174] In one approach, a construct is first prepared containing the DNA sequence encoding a CasX variant or a gRNA. The construct is then used to create an expression vector suitable for transforming a host cell, such as a prokaryotic or eukaryotic host cell for the expression and recovery of the protein construct, in the case of the CasX, or the gRNA. Where desired, the hostAttorney Docket No. SCRB-057 / 01WO 333322-2504 cell is an E. coli. In other embodiments, the host cell is a eukaryotic cell. The eukaryotic host cell can be selected from Baby Hamster Kidney fibroblast (BHK) cells, human embryonic kidney 293 (HEK293), human embryonic kidney 293T (HEK293T), NS0 cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells, hybridoma cells, NIH3T3 cells, CV-1 (simian) in Origin with SV40 genetic material (COS), HeLa, Chinese hamster ovary (CHO), yeast cells, or other eukaryotic cells known in the art suitable for the production of recombinant products. Exemplary methods for the creation of expression vectors, the transformation of host cells and the expression and recovery of the CasX variant or the gRNA are described in the Examples.

[0175] The gene encoding the CasX variant or the gRNA construct can be made in one or more steps, either fully synthetically or by synthesis combined with enzymatic processes, such as restriction enzyme-mediated cloning, PCR and overlap extension, including methods more fully described in the Examples. The methods disclosed herein can be used, for example, to ligate sequences of polynucleotides encoding the various components into a gene of a desired sequence. Genes encoding polypeptide compositions are assembled from oligonucleotides using standard techniques of gene synthesis.

[0176] In some embodiments, a nucleotide sequence encoding a gRNA is operably linked to a control element, e.g., a transcriptional control element, such as a promoter. In some embodiments, a nucleotide sequence encoding a CasX variant protein is operably linked to a control element, e.g., a transcriptional control element, such as a promoter. In some cases, the promoter is a constitutively active promoter. In some cases, the promoter is a regulatable promoter. In some cases, the promoter is an inducible promoter. In some cases, the promoter is a tissue-specific promoter. In some cases, the promoter is a cell type-specific promoter. In some cases, the transcriptional control element (e.g., the promoter) is functional in a targeted cell type or targeted cell population intended for modification of the CD38 gene.

[0177] Non-limiting examples of Pol II promoters operably linked to the polynucleotide encoding the CasX variant of the disclosure include, but are not limited to EF-1alpha, EF-1alpha core promoter, Jens Tornoe (JeT), promoters from cytomegalovirus (CMV), CMV immediate early (CMVIE), CMV enhancer, herpes simplex virus (HSV) thymidine kinase, early and late simian virus 40 (SV40), the SV40 enhancer, long terminal repeats (LTRs) from retrovirus, mouse metallothionein-I, adenovirus major late promoter (Ad MLP), CMV promoter full-length promoter, the minimal CMV promoter, the chicken β-actin promoter (CBA), CBA hybrid (CBh),Attorney Docket No. SCRB-057 / 01WO 333322-2504 chicken β-actin promoter with cytomegalovirus enhancer (CB7), chicken beta-Actin promoter and rabbit beta-Globin splice acceptor site fusion (CAG), the rous sarcoma virus (RSV) promoter, the HIV-Ltr promoter, the hPGK promoter, the HSV TK promoter, a 7SK promoter, the Mini-TK promoter, the human synapsin I (SYN) promoter which confers neuron-specific expression, beta-actin promoter, super core promoter 1 (SCP1), the Mecp2 promoter for selective expression in neurons, the minimal IL-2 promoter, the Rous sarcoma virus enhancer / promoter (single), the spleen focus-forming virus long terminal repeat (LTR) promoter, the TBG promoter, promoter from the human thyroxine-binding globulin gene (Liver specific), , the PGK promoter, the human ubiquitin C promoter (UBC), the UCOE promoter (Promoter of HNRPA2B1-CBX3), the synthetic CAG promoter, the Histone H2 promoter, the Histone H3 promoter, the U1a1 small nuclear RNA promoter (226 nt), the U1a1 small nuclear RNA promoter (226 nt), the U1b2 small nuclear RNA promoter (246 nt) 26, the GUSB promoter, the CBh promoter, rhodopsin (Rho) promoter, silencing-prone spleen focus forming virus (SFFV) promoter, a human H1 promoter (H1), a POL1 promoter, the TTR minimal enhancer / promoter, the b-kinesin promoter, mouse mammary tumor virus long terminal repeat (LTR) promoter, the human eukaryotic initiation factor 4A (EIF4A1) promoter, the ROSA26 promoter, the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) promoter, tRNA promoters, and truncated versions and sequence variants of the foregoing. In a particular embodiment, the Pol II promoter is EF-1alpha, wherein the promoter enhances transfection efficiency, the transgene transcription or expression of the CasX variant protein, the proportion of expression- positive clones and the copy number of the episomal vector in long-term culture.

[0178] Non-limiting examples of Pol III promoters operably linked to the polynucleotide encoding the gRNA variants of the disclosure include, but are not limited to U6, mini U6, U6 truncated promoters,7SK, and H1 variants, BiH1 (Bidrectional H1 promoter), BiU6, Bi7SK, BiH1 (Bidirectional U6, 7SK, and H1 promoters), gorilla U6, rhesus U6, human 7SK, human H1 promoters, and truncated versions and sequence variants thereof. In the foregoing embodiment, the pol III promoter enhances the transcription of the gRNA. In a particular embodiment, the Pol III promoter is U6, wherein the promoter enhances expression of the CRISPR gRNA. In another particular embodiment, the promoter linked to the gene encoding the tropism factor is CMV promoter. Experimental details and data for the use of such promoters are provided in the Examples.Attorney Docket No. SCRB-057 / 01WO 333322-2504

[0179] Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art, as it related to controlling expression. The expression vector may also contain a ribosome binding site for translation initiation, and a transcription terminator. The expression vector may also include appropriate sequences for amplifying expression. The expression vector may also include nucleotide sequences encoding protein tags (e.g., 6xHis tag, hemagglutinin tag, fluorescent protein, etc.) that can be fused to the CasX variant protein, thus resulting in a CasX variant protein that are used for purification or detection.

[0180] Recombinant expression vectors of the disclosure can also comprise elements that facilitate robust expression of the proteins and the gRNAs of the disclosure. For example, recombinant expression vectors can include one or more of a polyadenylation signal (poly(A)), an intronic sequence or a post-transcriptional regulatory element such as a woodchuck hepatitis post-transcriptional regulatory element (WPRE). Exemplary poly(A) sequences include hGH poly(A) signal (short), HSV TK poly(A) signal, synthetic polyadenylation signals, SV40 poly(A) signal, β-globin poly(A) signal and the like. A person of ordinary skill in the art will be able to select suitable elements to include in the recombinant expression vectors described herein.

[0181] The polynucleotides encoding the CasX variant or the gRNA sequences can be individually cloned into an expression vector. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art, as it relates to controlling expression, e.g., for modifying expression of the CasX variant protein. The expression vector may also contain a ribosome binding site for translation initiation and a transcription terminator. The expression vector may also include appropriate sequences for amplifying expression. The expression vector may also include nucleotide sequences encoding protein tags (e.g., 6xHis tag, hemagglutinin tag, FLAG tag, fluorescent protein, etc.) that can be fused to the CasX protein, thus resulting in a fusion CasX variant protein that are used for purification or detection.

[0182] In some embodiments, the nucleotide sequence encoding a CasX variant protein is codon optimized. This type of optimization can entail a mutation of an encoding nucleotide sequence to mimic the codon preferences of the intended host organism or cell while encoding the same protein. Thus, the codons can be changed, but the encoded protein remains unchanged. For example, if the intended target cell of the CasX variant protein was a human cell, a human codon-optimized CasX-encoding nucleotide sequence could be used. As another non-limiting example, if the intended host cell were a mouse cell, then a mouse codon-optimized CasX-Attorney Docket No. SCRB-057 / 01WO 333322-2504 encoding nucleotide sequence could be generated. The gene design can be performed using algorithms that optimize codon usage and amino acid composition appropriate for the host cell utilized in the production of the CasX variant or the gRNA. In one method of the disclosure, a library of polynucleotides encoding the components of the constructs is created and then assembled, as described above. The resulting genes are then assembled and the resulting genes used to transform a host cell and produce and recover the CasX variant or the gRNA compositions for evaluation of its properties or for use in the modification of the CD38 gene, as described herein.

[0183] The nucleic acid sequence is inserted into the vector by a variety of procedures. In general, DNA is inserted into an appropriate restriction endonuclease site(s) using techniques known in the art. Vector components generally include, but are not limited to, one or more of a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence. Construction of suitable vectors containing one or more of these components employs standard ligation techniques which are known to the skilled artisan. Such techniques are well known in the art and well described in the scientific and patent literature. Various vectors are publicly available. The vector may, for example, be in the form of a plasmid, cosmid, viral particle, or phage that may conveniently be subjected to recombinant DNA procedures, and the choice of vector will often depend on the host cell into which it is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e., a vector, which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated.

[0184] In some embodiments, the nucleic acid sequence is encapsidated in a lipid nanoparticle (LNP). In some embodiments, the LNP encapsidates a gRNA described herein. In some embodiments, the LNP encapsidates an mRNA encoding a CasX variant described herein. In some embodiments, the LNP encapsidates a gRNA and the mRNA described herein. In some embodiments, the LNP comprises one or more components selected from the group consisting of an ionizable lipid, a helper phospholipid, a polyethylene glycol (PEG)-modified lipid, and cholesterol or a derivative thereof. In some embodiments, the LNP comprises an ionizable lipid, a helper phospholipid, a polyethylene glycol (PEG)-modified lipid, and cholesterol or aAttorney Docket No. SCRB-057 / 01WO 333322-2504 derivative thereof. In some embodiments, the LNP comprises a cationic lipid comprising a pKa of 5 to 8.

[0185] Once introduced into a suitable host cell, expression of the CasX can be determined using any nucleic acid or protein assay known in the art. For example, the presence of transcribed mRNA of the CasX variant can be detected and / or quantified by conventional hybridization assays (e.g., Northern blot analysis), amplification procedures (e.g. RT-PCR), SAGE (U.S. Pat. No.5,695,937), and array-based technologies (see e.g., U.S. Pat. Nos. 5,405,783, 5,412,087 and 5,445,934), using probes complementary to any region of CasX polynucleotide. VI. Modified Cells

[0186] Also provided herein are populations of cells modified by the systems having a knock- down or knock-out of the CD38 gene of the cell. In some embodiments, the cell is an immune cell, a hematopoietic cell, a natural killer (NK) cell, a monocyte, a dendritic cell, a macrophage, a granulocyte, a T cell, a B cell, or a plasma cell.

[0187] In some embodiments, the disclosure provides a population of cells in which the expression of CD38 has been reduced, compared to the unmodified cell, by at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%. In some embodiments, the disclosure provides a population of cells in which CD38 cannot be detected on the cells. VII. Systems and Methods for Modification of CD38 Target Nucleic Acids

[0188] The systems encoding or comprising CasX variant proteins of the disclosure can be used in the modification or editing of a CD38 target nucleic acid in a population of cells, when used with a guide ribonucleic acid having a targeting sequence complementary to the CD38 target nucleic acid to be modified. Such systems are useful for various applications, including as therapeutics, diagnostics, and for research. To effect the methods of the disclosure, resulting in modification of the CD38 gene, provided herein are programmable CasX:gRNA systems. The programmable nature of the systems provided herein allows for the precise targeting to achieve the desired modification at one or more regions of predetermined interest in the CD38 gene target nucleic acid in a population of eukaryotic cells. In some embodiments, it may be desirable to knock-down or knock-out expression of the CD38 gene in the cells of the population. In some embodiments, the disclosure provides systems and methods to modify the CD38 gene in the cellsAttorney Docket No. SCRB-057 / 01WO 333322-2504 of the population such that expression of CD38 is reduced by at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%. In some embodiments, the disclosure provides systems and methods to modify the CD38 gene in the cells of the population such that CD38 is undetectable in at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the cells of the population.

[0189] A variety of strategies and methods can be employed to modify the target nucleic acid sequence in a cell using the systems provided herein. As used herein "modifying" includes, but is not limited to, cleaving, nicking, editing, deleting, knocking out, knocking down, mutating, exon-skipping and the like. Depending on the system components utilized, the editing event may be a cleavage event followed by introducing random insertions or deletions (indels) or other mutations (e.g., a substitution, duplication, or inversion of one or more nucleotides), for example by utilizing the imprecise non-homologous DNA end joining (NHEJ) repair pathway. In some embodiments of the method, the modification comprises introducing an in-frame mutation in the target nucleic acid. In some embodiments of the method, the modification comprises introducing a frame-shifting mutation in the target nucleic acid. In some embodiments of the method, the modification comprises introducing a premature stop codon in the coding sequence in the target nucleic acid. In some embodiments of the method, the modification results in expression of a non-functional CD38 protein (e.g., cannot serve as effective cell marker for binding or is incapable of signal transduction) in the modified cells of the population.

[0190] In some embodiments, the disclosure provides systems specifically designed for use in the methods to modify the target nucleic acid of a CD38 gene in eukaryotic cells; either in vitro, ex vivo, or in vivo in a subject. Generally, any portion of the CD38 gene can be targeted using the programmable systems and methods provided herein. In one embodiment, the disclosure provides a method of modifying a target nucleic acid sequence of a CD38 gene in a population of cells, the method comprising introducing into each cell of the population: i) an RNP comprising a CasX variant and a gRNA of any of the embodiments described herein; ii) a gRNA and an mRNA encoding the CasX variant of any of the embodiments described herein; iii) an LNP comprising a gRNA and an mRNA encoding the CasX variant of any of the embodimentsAttorney Docket No. SCRB-057 / 01WO 333322-2504 described herein; iv) nucleic acids encoding the CasX variant and gRNA of any of the embodiments described herein; v) a vector selected from the group consisting of a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, and a herpes simplex virus (HSV) vector, and comprising the nucleic acid of (iv), above; or vi) combinations of two or more of (i) to (v), wherein the target nucleic acid sequence of the cells targeted by the gRNA is modified by the CasX variant protein. The systems and methods described herein can be used to modify a population of cells in which expression of the CD38 gene is reduced; e.g., knocked-down or knocked-out. In some embodiments of the method, the modifying of the cells occurs in vitro. In some embodiments of the method, the modifying of the cells occurs ex vivo using a gRNA targeting a CD38 target nucleic acid and an mRNA encoding the CasX variant delivered to the population of cells.

[0191] In some embodiments of the method, the modified cells are eukaryotic cells. In some embodiments of the method, the modified cell is selected from the group consisting of a rodent cell, a mouse cell, a rat cell, a primate cell, and a non-human primate cell. In some embodiments of the method, the modified cell is a human cell. In some embodiments of the method, the modified cell may be an immune cell. In some embodiments, the modified cell is selected from the group consisting of a natural killer (NK) cell, a monocyte, a dendritic cell, a macrophage, a granulocyte, an activated T cell, an activated B cell, a plasma cell, a multiple myeloma cell, a non-Hodgkin's lymphoma (NHL) cell, an acute lymphocytic leukemia (ALL) cell, a chronic lymphocytic leukemia (CLL) cell, and an acute myelogenous leukemia (AML) cell.

[0192] In some embodiments, the systems provided herein for modification of the CD38 target nucleic acid comprise an mRNA encoding a CasX variant comprising a sequence selected from the group consisting of SEQ ID NOS: 166-169, or a sequence at least 70% identical, at least 80% identical, at least 81% identical, at least 82% identical, at least 83% identical, at least 84% identical, at least 85% identical, at least 86% identical, at least 86% identical, at least 87% identical, at least 88% identical, at least 89% identical, at least 89% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or at least 99.5% identical thereto. In some embodiments, the systems provided herein for modification of the CD38 target nucleic acid comprise a chemically modified mRNA encoding a CasX variant comprising a sequence selected from the group consisting of SEQ ID NOS: 170-173, or a sequence at least 70% identical, at least 80% identical,Attorney Docket No. SCRB-057 / 01WO 333322-2504 at least 81% identical, at least 82% identical, at least 83% identical, at least 84% identical, at least 85% identical, at least 86% identical, at least 86% identical, at least 87% identical, at least 88% identical, at least 89% identical, at least 89% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or at least 99.5% identical thereto. In some embodiments, the systems provided herein for modification of the CD38 target nucleic acid comprise a chemically modified mRNA encoding a CasX variant comprising a sequence of SEQ ID NO: 171, or a sequence at least 70% identical, at least 80% identical, at least 81% identical, at least 82% identical, at least 83% identical, at least 84% identical, at least 85% identical, at least 86% identical, at least 86% identical, at least 87% identical, at least 88% identical, at least 89% identical, at least 89% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or at least 99.5% identical thereto. In some embodiments, the systems provided herein for modification of the CD38 target nucleic acid comprise a chemically modified mRNA encoding a CasX variant consisting of a sequence of SEQ ID NO: 171.

[0193] In some embodiments, the systems provided herein for modification of the CD38 target nucleic acid comprise a gRNA selected from the group consisting of SEQ ID NOS: 692-917, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity thereto. In some embodiments, the systems provided herein for modification of the CD38 target nucleic acid comprise a gRNA selected from the group consisting of SEQ ID NOS: 692-743, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity thereto. In some embodiments, the systems provided herein for modification of the CD38 target nucleic acid comprise a gRNA selected from the group consisting of SEQ ID NOS: 694-696, 702, 710, and 730, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity thereto. In some embodiments, the systems provided herein for modification of the CD38 target nucleic acid comprises a gRNA selected from the group consisting of SEQ ID NOS: 694-696, 702, 710, and 730. In some embodiments,Attorney Docket No. SCRB-057 / 01WO 333322-2504 the systems provided herein for modification of the CD38 target nucleic acid consists of a gRNA selected from the group consisting of SEQ ID NOS: 694-696, 702, 710, and 730.

[0194] In the foregoing embodiments of the systems, upon introduction of the mRNA and the gRNA into the cells to be modified, the CasX variant is expressed and is able to form an RNP complex with the gRNA, whereupon the RNP is capable of binding to and modifying the CD38 target nucleic acid.

[0195] In some embodiments the disclosure provides a method of treatment, comprising administering a therapeutically effective dose of the modified cells to a subject for the treatment of a disease. In some embodiments, the disease is a hematological malignancy. In some embodiments, the subject is selected from the group consisting of a rodent, a mouse, a rat, and a non-human primate. In some embodiments, the subject is a human. In some embodiments of the method, the cells are administered by a route selected from the group consisting of intravenously, intraarterially, intraportal vein injection, and intraperitoneally. VIII. Kits and Articles of Manufacture

[0196] In other embodiments, provided herein are kits comprising a CasX variant protein and one or a plurality of gRNA of the disclosure comprising a targeting sequence specific for a CD38 gene and a suitable container (for example a tube, vial or plate). In exemplary embodiments, a kit of the disclosure comprises an mRNA encoding CasX variant of any one of SEQ ID NOS: 166-169.

[0197] In some embodiments, the kit comprises a gRNA or a vector encoding a gRNA, wherein the gRNA comprises a sequence selected from the group consisting of SEQ ID NOS: 467-691 and 692-916, wherein the targeting sequence is complementary to a CD38 target nucleic acid to be modified.

[0198] In certain embodiments, provided herein are kits comprising a gene editing pair comprising a chemically modified mRNA encoding a CasX variant selected from the group consisting of SEQ ID NOS: 170-173, and a chemically modified gRNA variant of SEQ ID NOS: 692-743 comprising a targeting sequence complementary to a CD38 target nucleic acid to be modified.

[0199] In some embodiments, the kit further comprises a buffer, a nuclease inhibitor, a protease inhibitor, a liposome, a therapeutic agent, a label, a label visualization reagent, or any combination of the foregoing. In some embodiments, the kit further comprises a pharmaceutically acceptable carrier, diluent or excipient.Attorney Docket No. SCRB-057 / 01WO 333322-2504

[0200] In some embodiments, the kit comprises appropriate control compositions for gene modification applications, and instructions for use.

[0201] In some embodiments, the kit comprises a vector comprising a sequence encoding a CasX variant protein of the disclosure and a CasX gRNA of the disclosure.

[0202] The following Examples are merely illustrative and are not meant to limit any aspects of the present disclosure in any way. EXAMPLES Example 1: The CasX:gRNA system can edit the CD38 locus to generate CD38- Jurkat T cells when delivered as RNPs in vitro

[0203] Experiments were performed to determine the ability of the CasX:gRNA system to edit the CD38 locus in human Jurkat T lymphocytes when delivered as RNPs in vitro. Materials and Methods:

[0204] CasX variant 491 (SEQ ID NO: 4) and a gRNA utilizing scaffold variant 174 (SEQ ID NO: 117) were used in these experiments. Sequences of an initial subset of spacers targeting the CD38 locus are listed in Table 1A. Table 1A: Sequences of a set of human CD38-targeting spacers assessed in a preliminary proof-of-concept study as described in this example.

[0205] In this experiment, CasX and gRNA containing a CD38-targeting spacer (Table 1A) were introduced into human Jurkat T lymphocytes using RNP delivery. CasX RNPs with in vitro transcribed gRNAs having spacers targeting the CD38 locus were assembled using standard methods. Determining CD38 cell surface expression upon treatment of CasX RNPs:Attorney Docket No. SCRB-057 / 01WO 333322-2504

[0206] ~7E5 Jurkat cells were used for each CasX RNP nucleofection, which was performed using the Lonza nucleofector kit and 4D-Nucleofector System following the manufacturer’s protocol and instructions. Three concentrations of each CasX RNP were tested: 100 pmol, 25 pmol, and 6.25 pmol. Cells were cultured in supplemented RPMI 1640 medium. Six days following nucleofection, cells were harvested and subjected to immunostaining for the CD38 cell surface marker using a fluorescently-labeled antibody against CD38. CD38 cell surface expression was detected by flow cytometry using the AttuneTMNxT flow cytometer and analyzed via FlowJo following the manufacturer’s instructions. For each CasX RNP condition, a single nucleofection was performed, which was subsequently split into three wells that served as measurement replicates. A “buffer only” electroporation condition was included as an experimental control. Determining editing levels at the CD38 locus upon treatment of CasX RNPs:

[0207] Jurkat cells were nucleofected with each condition of CasX RNPs following methods as described previously, using the same three concentrations of RNPs. Cells were harvested four days post-nucleofection for genomic DNA (gDNA) extraction for editing analysis by next generation sequencing (NGS). NGS processing and analysis:

[0208] gDNA from harvested cells were extracted using the Zymo Quick-DNATMMiniprep Plus kit following the manufacturer’s instructions. Target amplicons were formed by amplifying regions of interest from 50-100 ng of extracted gDNA with a set of primers targeting the human CD38 locus. These gene-specific primers contained an additional sequence at the 5′ ends to introduce Illumina reads 1 and 2 sequences. Further, they contained a 16-nucleotide random sequence that functioned as a unique molecular identifier (UMI). The quality and quantification of the amplicon was assessed using a Fragment Analyzer DNA analyzer kit (Agilent, dsDNA 35-1500 bp). Amplicons were sequenced on the Illumina MiSeq™ according to the manufacturer’s instructions. Raw fastq sequencing files were processed by trimming for quality and adapter sequences and merging read 1 and read 2 into a single insert sequence; insert sequences were then analyzed by the CRISPResso2 (v 2.0.29) program. The percentage of reads modified in a window around the 3' end of the spacer was determined. The activity of the CasX molecule was quantified as the total percent of reads that contain insertions, substitutions, and / or deletions anywhere within this window for each sample. Results:Attorney Docket No. SCRB-057 / 01WO 333322-2504

[0209] An initial screen testing 10 spacers targeting the human CD38 locus, and using CasX variant 491 and gRNA scaffold variant 174, which were delivered as RNPs, was performed in human Jurkat T lymphocytes. Quantification of the resulting loss of CD38 expression upon editing of the CD38 locus by CasX:gRNA system is illustrated in FIG.1. The data demonstrate that use of 9 out of 10 tested targeting spacers enabled some level of CD38-knockout in Jurkat cells at the highest dose of 100 pmol, with use of 6 spacers resulting in at least 80% of cells with loss of CD38 (CD38-) expression at the highest dose. Furthermore, of all the spacers tested, use of spacer TG-36-002 resulted in the highest level of knockout at all three doses, achieving ~97% of cells with loss of CD38 expression. In addition to TG-36-002, use of spacers TG-36-005 and TG-36-008 resulted in ~97% and ~92% of cells with loss of CD38 expression respectively (FIG. 1). These results also show that CasX, when paired with the appropriate targeting spacer, can edit the locus to knock out CD38 efficiently at low doses. In this experiment, use of the non- targeting spacer revealed that ~20% of total cells had no or low CD38 expression.

[0210] Quantification of the editing results at the CD38 locus is shown in the bar plot in FIG. 2. The data further show that editing of the CD38 locus in human Jurkat cells was able to occur in a dose-dependent manner for most spacers. Use of spacer TG-36-002 also resulted in the highest level of editing (~93-95% total indel rate) at all three doses, corroborating the findings from the CD38 expression analyses in FIG.1. In addition to TG-36-002, use of spacers TG-36- 005 and TG-36-008 achieved at least 90% total indel rate at the highest dose (FIG.2).

[0211] The results of the experiments demonstrate that CasX with the appropriate targeting spacer can edit on-target efficiently in a cell-based assay when assembled and delivered as RNPs. Example 2: Assessment of truncated spacer variants on editing at the CD38 locus

[0212] Experiments were performed to assess the effects of different spacer lengths on on- target activity at the CD38 locus. Here, CD38-targeting spacers were truncated to 18 nucleotides in length, and the resulting effects on editing and knockout efficiency were compared to that achieved when using a spacer with a conventional length of 20 nucleotides. Materials and Methods:

[0213] CasX variant 491 and a gRNA utilizing scaffold variant 174 were used in these experiments. CD38-targeting spacers TG-36-002, TG-36-005, and TG-36-008 (sequences in Table 1A) and their 18-nucleotide variants (sequences in Table 2A) were used in theseAttorney Docket No. SCRB-057 / 01WO 333322-2504 experiments, given their demonstrated high CD38-knockout efficiency as described in Example 1. The 18-nucleotide spacer variants were designed such that the two base-pair (bp) truncations occurred on the 3’ end of the targeting spacer.

[0214] CasX RNPs with gRNAs having CD38-targeting spacers that were either 18 nucleotides or 20 nucleotides in length were assembled using standard methods. After RNP assembly, CasX RNPs were nucleofected into Jurkat cells following similar methods as described in Example 1. Four concentrations of each CasX RNP were tested: 100 pmol, 25 pmol, 6.25 pmol, and 1.5625 pmol. Cells were harvested five days after nucleofection for CD38 immunostaining followed by flow cytometry to determine the percentage of cells with CD38- knockout. For each CasX RNP condition, a single nucleofection was performed, which was subsequently split into three wells that served as measurement replicates. Table 2A: 18-nucleotide variants of CD38-targeting spacers TG-36-002, TG-36-005, and TG-36-008 assessed in this example.Results:

[0215] An experiment was conducted to assess 18- and 20-nucleotide spacer variants of TG- 36-002, TG-36-005, and TG-008. CasX 491 RNPs with guide scaffold 174 and the 18- nucleotide and 20-nucleotide spacer variants were delivered into Jurkat T cells. Quantification of the resulting loss of CD38 expression upon editing of the CD38 locus by CasX:gRNA system is illustrated in FIG.3. The data demonstrate that use of the truncated spacer variants resulted in variable effects on editing efficiency, i.e., truncating spacer TG-36-002 reduced editing, but truncating spacer TG-36-005 improved editing, while truncating spacer TG-36-008 appeared not to affect editing (FIG.3).

[0216] The results of the experiments demonstrate that gRNA spacer truncations appeared to have either negligible effects or spacer-dependent effects on the editing efficiency of the CasX:gRNA system. In summary, these spacer variants were able to achieve on-target editing to induce the intended loss of CD38 expression in a cell-based assay.Attorney Docket No. SCRB-057 / 01WO 333322-2504 Example 3: CasX:gRNA system can edit the CD38 locus to generate CD38- Jurkat T cells when delivered as mRNA co-transfected with a targeting gRNA in vitro

[0217] Experiments were performed to demonstrate the ability of CasX and targeting gRNAs to edit the human CD38 locus to generate CD38- Jurkat T cells when delivered as mRNA co- transfected with a targeting gRNA in vitro. These experiments also aimed to demonstrate that chemical modifications of the targeting gRNA enhance the editing efficiency of the CasX:gRNA system when delivered in vitro in conjunction with the CasX mRNA. Materials and Methods: Generation and IVT of CasX mRNA:

[0218] CasX 515 mRNA was generated by in vitro transcription (IVT). Briefly, constructs encoding for a 5’UTR derived from the human hemoglobin gene, a codon-optimized CasX 515 with flanking c-MYC NLSes, and a 3’UTR also derived from the human hemoglobin gene were cloned into a plasmid containing a T7 promoter with a split poly(A) tail. The coding sequence for CasX 515 was optimized for improved protein expression. The resulting plasmid was linearized prior to use for IVT reactions, which were carried out with CleanCap® AG and N1- methyl-pseudouridine (as described later in Example 8). The DNA sequences encoding the CasX 515 mRNA molecule are listed in Table 3A, with the corresponding mRNA sequences with the chemical modifications listed in Table 3B. Table 3A: Encoding sequences of CasX 515 mRNA used in this example*Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504*Components are listed in a 5’ to 3’ order within the constructs Table 3B: Full-length RNA sequences of CasX 515 mRNA used in this example*Attorney Docket No. SCRB-057 / 01WO 333322-2504*The CleanCap® AG 5’ cap is not shown in the table. Modification ‘mψ’ = N1-methyl- pseudouridine Synthesis of gRNAs:Attorney Docket No. SCRB-057 / 01WO 333322-2504

[0219] gRNAs targeting the human CD38 locus were designed using gRNA scaffold 316 (SEQ ID NO: 119), and they were either produced via IVT as an unmodified gRNA or chemically synthesized with the ‘v1’ modification profile (described in Example 5, below). The sequences of the unmodified and chemically modified CD38-targeting gRNAs are listed in Table 3C. A schematic of the sites of chemical modifications for a ‘v1’ profile of the gRNA scaffold variant 316 is shown in FIG.18A. Table 3C: Sequences of unmodified and chemically modified gRNAs targeting the human CD38 locus assayed in this example.

[0220] CasX 515 mRNA and CD38-targeting gRNAs (unmodified or chemically modified) were electroporated into Jurkat cells following similar methods as described in Example 1. A dose titration study was performed: when the doses of CasX mRNA were titrated, the dose of the gRNA remained constant at 2µg; similarly, when the doses of the gRNA were titrated, the dose of the CasX mRNA remained constant at 2µg. In addition, a co-titration study was performed, such that both the CasX mRNA and the gRNA were co-titrated in a 1:1 ratio. The following titrating doses were tested in these experiments: 0.5µg, 1.0µg, 2µg, and 4µg. Cells were harvested seven days after nucleofection for CD38 immunostaining followed by flow cytometry to determine the percentage of cells with CD38-knockout. Total cell count was also performed to determine cell viability in each treated condition; here, a well of untreated cells was cultured, and cell viability was determined by dividing the total cell count for each treated condition by the total cell count of the untreated condition. Three biological replicates of this experiment were performed. Results:

[0221] Human Jurkat cells were electroporated with CasX 515 mRNA and either an unmodified or chemically modified CD38-targeting gRNA at various titrating doses andAttorney Docket No. SCRB-057 / 01WO 333322-2504 conditions to assess effects on editing at the CD38 locus and loss of CD38 expression. The plots in FIGS.4A-4C show the quantification of the percentage of cells with loss of CD38 expression for each indicated titration condition, and the plots in FIGS.4D-4F illustrate the corresponding quantification of cell viability. The data demonstrate that in all three titration studies, the CasX:gRNA system was able to edit the CD38 locus efficiently to induce CD38-knockout in Jurkat cells at the indicated doses, eventually reaching at least 80% of cells with CD38-knockout at the highest dose in each titration experiment (FIGS.4A-4C). In addition, the results show that chemical modifications of the targeting gRNA improved the editing efficiency of the CasX:gRNA system when compared to use of an unmodified gRNA (FIGS.4A and 4C). Interestingly, in the gRNA titration experiment, use of the chemically modified gRNA resulted in lower cell viability compared to that of the unmodified gRNA, although the effects on viability were comparable in the co-titration study (FIGS.4A and 4C). The relatively flat curves observed in the gRNA titration experiment indicates that the CasX mRNA was the limiting factor in driving on-target editing (FIG.4A). However, in the co-titration experiment, use of the chemically modified gRNA with a low dose of CasX mRNA was still able to achieve maximum levels of >80% CD38-knockout cells, suggesting that additional studies may be warranted to determine which RNA component is the limiting factor.

[0222] The results from these experiments demonstrate that delivery of CasX mRNA and a CD38-targeting gRNA induced efficacious editing at the endogenous human CD38 locus in a cell-based assay, which resulted in the generation of CD38-knockout cells. Furthermore, the data show that chemically modifications of the targeting gRNA were able to improve the editing efficiency of the CasX:gRNA system. Example 4: Comprehensive evaluation of CD38-targeting spacers with TTC PAMs in achieving editing of the CD38 locus and removing CD38 cell surface expression in vitro

[0223] Experiments were performed to carry out a comprehensive evaluation of CD38- targeting spacers with the TTC recognition motif. Briefly, computational methods and criteria were employed to define a filtered set of TTC spacers. This filtered set of TTC spacers was then subjected to in vitro experiments to assess and identify targeting spacers that lead to significant editing of the human CD38 locus and consequent removal of CD38 cell surface expression. A preliminary assessment of off-target editing of CasX proteins 515 and 812 and gRNAs withAttorney Docket No. SCRB-057 / 01WO 333322-2504 candidate spacers targeting the CD38 locus was also performed via CSI-seq (cut site incorporation and sequencing) in cell assays. Materials and Methods:

[0224] To identify potential spacers throughout the human CD38 locus, a target search region used to determine all potential spacers was defined as starting at 4KB upstream of the transcription start site (TSS) through 1KB downstream of the transcription stop site. Spacers were determined based on the availability of NTC PAMs; consequently, a total of 9,630 NTC spacers, which are 20 nucleotides in length, were identified throughout the target CD38 locus. Of the identified 9,630 NTC spacers, 3,272 spacers utilized the TTC PAM motif, and these spacers were then functionally annotated by overlaying key genomic features based on their positioning, e.g., determining whether the putative spacer targeted an exon, an intron, within the promoter region, and / or overlapped with a common site of genetic variation (e.g., SNPs). To narrow down and determine an initial group of spacers for experimental screening, the extracted spacers were subjected to a set of filtering criteria. Firstly, 222 TTC spacers targeting the exons of CD38 were identified; subsequently, non-specific spacers were excluded by removing spacers with off-target sites that contain up to one base pair mismatch with the on-target site. Furthermore, spacers that overlapped with a SNP having a minor allele frequency (MAF) of >1%, if any, were excluded. Subsequently, from this filtered set, spacers that were functionally annotated to target the coding sequence or 5’ untranslated region of the human CD38 locus were selected for inclusion. As a result, a total of 48 TTC spacers were identified, and the sequences are listed in Table 4A. FIG.5 illustrates a schematic of the relative locations (denoted as megabase position on chromosome 4) in the human CD38 gene that these 48 spacers target. Table 4A: Sequences of the 48 TTC spacers targeting the human CD38 locusAttorney Docket No. SCRB-057 / 01WO 333322-2504Assessment of editing activity and loss of CD38 cell surface expression for CD38-targeting spacers:

[0225] Lentiviral plasmid constructs comprising sequences coding for CasX protein 515 (SEQ ID NO: 5), guide scaffold variant 235 (SEQ ID NO: 118), and CD38-targeting spacers (TableAttorney Docket No. SCRB-057 / 01WO 333322-2504 4A) were generated and cloned upstream of a P2A-mScarlet coding region on a lentiviral plasmid using standard molecular cloning techniques. Cloned and sequence-validated constructs were subjected to quality assessment prior to transfection into HEK293T cells for lentiviral production following standard methods. Briefly, lentivirus was produced in a 96-well plate by co-transfecting HEK293T cells with CasX plasmids containing CD38-targeting spacers, the lentiviral packaging plasmid, and the VSV-G envelope plasmids. Virus was harvested 48 hours post-transfection and functional titers were determined by transducing HEK293T cells and measuring relative mScarlet fluorescence.

[0226] ~30,000 human Jurkat cells were seeded per well of a 96-well plate. The next day, the seeded cells were transduced with lentiviral particles at an MOI of ~1, using DEAE-Dextran to increase transduction efficiency.72 hours post-transduction, transduced cells were harvested for editing analysis at the CD38 locus by NGS following methods as described in Example 1. Three biological replicates of this spacer screen to assess editing activity of candidate targeting spacers were performed. The following three spacers served as experimental controls: spacer 7.37 targeting the B2M locus (GGCCGAGAUGUCUCGCUCCG; SEQ ID NO: 226), spacer 31.63 targeting the AAVS1 locus (CAAGAGGAGAAGCAGUUUGG; SEQ ID NO: 227), and a non- targeting spacer (AACGACUAGUUAGGCGUGUA; SEQ ID NO: 228).

[0227] In addition, a phenotypic assay was performed to determine the functional effects of editing at the CD38 locus.72 hours following treatment of Jurkat cells with lentiviral particles as described above, cells were harvested for flow cytometry to assess expression of the CD38 surface marker using a FITC-conjugated monoclonal antibody. mScarlet fluorescence was used to identify cells transduced with lentivirus. Flow cytometry was performed using the Attune NxT Flow Cytometer, and subsequent analysis was performed via FlowJo, following the manufacturer’s instructions. During analyses, mScarlet+ cells were gated to determine the percentage of cells that were CD38-knockout. Assessment of CD38-targeting spacers via CSI-seq to induce off-target editing:

[0228] A preliminary assessment of off-target editing for a small subset of candidate CD38- targeting spacers was performed using CSI-seq. The CSI-seq assay involves introducing a plasmid encoding a CasX variant and gRNA scaffold with a CD38-targeting spacer, along with a double-stranded oligodeoxynucleotide (dsODN) donor, to identify sites of double-strand breaks (DSBs) that would occur as a result of CasX:gRNA activity. These sites would be identified using unidirectional sequencing of the dsODN sequence.Attorney Docket No. SCRB-057 / 01WO 333322-2504

[0229] Briefly, HEK293 cells were nucleofected with plasmid DNA encoding either CasX variant 515 or 812 and a gRNA with a CD38-targeting spacer and dsODN. Here, three CD38- targeting spacers were assessed in the CSI-seq experiment: TG-36-002, TG-36-005, and TG-36- 008 (sequences listed in Table 4A). Nucleofected cells were then plated and grown for five days, after which they were harvested for gDNA extraction. Briefly, for CSI-seq library preparation, gDNA was randomly fragmented and ligated with adaptors using the Tn5 transposase, followed by PCR amplification via nested PCR1 and PCR2 reactions. For PCR1, an adaptor-specific primer and a primer binding to the dsODN in the forward or reverse direction with a read 1 primer binding site were used; for PCR2, the same adaptor-specific primer and a primer to the read 1 primer binding site were used. Samples were normalized and sequenced on an Illumina NextSeq. Samples were then analyzed using a CSI-seq analysis pipeline algorithm to identify off-target editing events. Briefly, reads were filtered for presence of the full dsODN sequence to eliminate off-target priming sites from analysis. Genomic sites with multiple mapped reads were required to have aligned reads in both orientations to further reduce false positives. Sites with a nearby sequence containing seven or fewer mismatches or RNA / DNA bulges away from the search spacer were identified as potential off-target sites. The number of reads at each site relative to the number of reads at the on-target site was expected to be roughly proportional to the relative amount of off-target editing at that site. Two biological replicates of the CSI-seq experiment were performed. Results:

[0230] The 48 TTC spacers of Table 4A were tested in a spacer screen to assess their effects on editing activity at the human CD38 locus in Jurkat cells transduced with lentiviral particles containing CasX 515 and a CD38-targeting gRNA using scaffold variant 235. The editing results are shown in Table 4B below depicted as indel rate, demonstrating that use of the 48 spacers listed in Table 4A resulted in variable levels of editing at the CD38 locus. Of the 48 spacers tested, use of spacer TG-36-058 resulted in the highest level of editing activity, achieving an indel rate of ~64%. Spacer TG-36-002 also achieved a relatively high indel rate of ~56%, nearly two-fold higher than the ~31% editing rate achieved by the next best spacer TG-36-012. As expected, use of a non-targeting spacer did not result in editing activity at the CD38 locus (Table 4B).Attorney Docket No. SCRB-057 / 01WO 333322-2504 Table 4B. Results of an editing assay evaluating the editing activity at the CD38 locus for the 48 CD38-targeting spacers. Genomic annotations for these spacers are also shown, where “CDS” denotes coding sequence of the CD38 locusAttorney Docket No. SCRB-057 / 01WO 333322-2504

[0231] The 48 candidate CD38-targeting spacers were evaluated for their effects on expression of the CD38 cell surface protein in Jurkat cells, which was measured via CD38 immunostaining followed by flow cytometry. The data, which are depicted as the percentage of mScarlet+ cells that did not express CD38 (CD38-), are shown in Table 4C. The results demonstrate that use of the 48 spacers listed in Table 4A resulted in variable levels of CD38- cells upon editing at the CD38 locus. Corroborating the editing assessment findings in Table 4B, use of spacer TG-36- 002 resulted in the highest percentage of CD38- cells, achieving a knockout rate of ~61%, the highest level of CD38- cells among the spacers tested (Table 4C). Further analyses were conducted to assess the relationship between editing rate (measured as indel rate) and effects on CD38 expression (measured as percentage of cells with CD38-), and the correlation is depicted in FIG.6. The Pearson correlation coefficient (r) between the editing rate and the percentage of CD38- cells was calculated to be 0.67 (p < 0.0001), indicating that editing at the CD38 locus generally translates into a phenotypic effect, with certain spacers performing better or worse than anticipated. These differences may be explained by the following: 1) variability in editing kinetics of the CasX:gRNA system for each spacer tested or 2) differences in the resulting indel profile at the individual spacer target site, where some indels may or may not result in aAttorney Docket No. SCRB-057 / 01WO 333322-2504 phenotypic outcome. As expected, use of spacer 7.37, spacer 31.63, and the non-targeting spacer did not significantly affect CD38 expression (Table 4C). Table 4C. Results showing the average percentage of CD38- cells as detected by flow cytometry at 72 hours post-treatment of Jurkat cells with lentiviral particles containing a transgene encoding for CasX 515 with a CD38-targeting gRNAAttorney Docket No. SCRB-057 / 01WO 333322-2504

[0232] Spacers TG-36-002, TG-36-005, and TG-36-008 were subjected to a preliminary CSI- seq experiment to assess their off-target profiles. The CSI-seq results, which are presented as the percentage of total off-target reads divided by the total of on-target reads for that targeting spacer, are presented in Table 4D. The preliminary data show that the calculated percentage of total off-target reads over total on-target reads was less than 0.2% for spacers TG-36-002 and TG36-008 when paired with CasX 515. When paired with CasX 812 (SEQ ID NO: 7), this percentage of total off-target reads over total on-target reads was further decreased to 0% for TG-36-002, although intriguingly, this percentage appeared to increase to nearly 1% for TG-36- 008 (Table 4D). The detection of off-target reads was higher for TG-36-005 when paired with CasX 515, although this detection was noticeably reduced when the spacer was paired with CasX 812 (Table 4D). Table 4D. Results of the CSI-seq assay evaluating the off-target effects of the three CD38- targeting spacers when paired with CasX 515 or CasX 812Attorney Docket No. SCRB-057 / 01WO 333322-2504

[0233] The results from these experiments show that CasX 515 was able to edit the CD38 locus with gRNAs with a variety of spacer sequences. Leading candidate CD38-targeting spacers were identified, based on their ability to induce effective editing of the human CD38 locus and achieve substantial knockout of CD38 expression. The data from a preliminary experiment also revealed leader targeting spacers with a relatively low off-target profile. Example 5: Delivery of CasX mRNA and targeting gRNA via LNPs to achieve editing of the CD38 locus

[0234] Experiments are performed to demonstrate delivery of lipid nanoparticles (LNPs) encapsulating CasX mRNA and targeting gRNA induces on-target editing at the target CD38 locus in a cell-based assay. Materials and Methods:

[0235] mRNA encoding CasX molecules are generated by IVT, as described earlier in Example 3. Examples of DNA sequences encoding CasX mRNA are listed in Table 7A, with the corresponding mRNA sequences listed in Table 7B.

[0236] Targeting gRNAs (e.g., targeting the endogenous CD38 locus) are chemically synthesized as described above in Example 3.

[0237] LNP formulations are generated as described in Example 7.

[0238] Delivery of LNPs encapsulating CasX mRNA and CD38-targeting gRNAs into human Jurkat cells:

[0239] Human Jurkat cells are seeded in a 96-well plate. The next day, seeded cells are treated with varying concentrations of LNPs, which are prepared in six 4-fold serial dilutions starting at ~1000 ng total RNA. These LNPs are formulated to encapsulate a CasX mRNA and a CD38- targeting gRNA. Following media change after LNP treatment, cells are cultured before beingAttorney Docket No. SCRB-057 / 01WO 333322-2504 harvested at ~5-7 days post treatment for gDNA extraction for editing assessment at the CD38 locus by NGS and for evaluating the loss of CD38 expression by flow cytometry, as described in Example 1.

[0240] The results from this experiment are expected to show that CasX mRNA and targeting gRNA can be co-encapsulated within LNPs to be delivered to target cells to induce on-target editing of a target endogenous locus, such as CD38. Example 6: Demonstration that altering the UTR sequences of the engineered CasX mRNA can affect CasX-mediated editing

[0241] 5’ and 3’ UTRs can be required for efficient translation of mRNA. Here, experiments were performed to demonstrate that altering the 5’ and 3’ UTR sequences of the engineered CasX mRNA affects CasX-mediated editing at a target locus when CasX mRNA and targeting gRNAs were delivered in vitro via transfection. Materials and Methods: In vitro transcription (IVT) of CasX mRNA:

[0242] CasX 676 (SEQ ID NO: 6) mRNA was generated by IVT. Briefly, constructs encoding for a 5’UTR region, a codon-optimized CasX 676 with flanking c-MYC NLSes, and a 3’UTR region were cloned into a plasmid containing a T7 promoter and 80-nucleotide poly(A) tail. The resulting plasmid was linearized prior to use for IVT reactions, which were carried out with CleanCap® AG and N1-methyl-pseudouridine. For the 5’ cap, the CleanCap® AG contains a m7G(5')ppp(5')mAG structure, where “m7G” denotes N7-methylguanosine, “mA” denotes 2’O- methyladenosine, and (5’)ppp(5’) denotes a 5’ to 5’ triphosphate bridge. An extra guanine nucleotide was incorporated following the CleanCap® AG to enhance transcription initiation, resulting in the incorporation of m7G(5’)ppp(5’)mAGG as the full 5’ cap structure. Meanwhile, the substitution of the uridine ribonucleoside to N1-methyl-pseudouridine improves mRNA performance and reduces mRNA immunogenicity.

[0243] IVT reactions were subsequently subjected to DNase digestion to remove template DNA and purification using an oligo-dT column. In this example, two mRNAs encoding CasX 676 with different pairs of 5’ and 3’ UTRs were generated for assessment in vitro. The encoding sequences of the two CasX mRNA configurations are detailed in Table 6A. Full-length RNA sequences encoding the CasX mRNA with the chemical modifications are listed in Table 6B.Attorney Docket No. SCRB-057 / 01WO 333322-2504 Table 6A: Encoding sequences of the two CasX mRNA molecules assessed in this example*Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504*Components are listed in a 5’ to 3’ order within the constructs Table 6B: Full-length RNA sequences of CasX mRNA molecules assessed in this example*Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504* The 5’ cap (m7G(5’)ppp(5’)mAG), discussed in the example herein, is not shown in the table. Modification = N1-methyl-pseudouridine Synthesis of gRNAs:

[0244] In this example, gRNAs targeting an endogenous locus were designed using gRNA scaffold 174 with a v1 modification profile (see Example 8) and chemically synthesized. Transfection of CasX mRNA and gRNA into mouse Hepa1-6 cells in vitro:

[0245] Editing at an endogenous locus was assessed by delivering in vitro transcribed CasX mRNA (CasX mRNA #1 or CasX mRNA #2; see Table 6A) and synthesized targeting gRNAs into Hepa1-6 cells via transfection. Briefly, each well of 20,000 Hepa1-6 cells were lipofected with in vitro transcribed mRNA coding for CasX 676 and a targeting gRNA. After a media change, transfected cells were harvested at 20 hours post-transfection for editing assessment at the target locus by NGS, as described in Example 1. As experimental controls, individual transfections of CasX mRNA #1 and CasX mRNA #2 without gRNAs were performed. Results:

[0246] CasX-mediated editing at the endogenous locus was used to evaluate the effects of incorporating different 5’ and 3’ UTRs into the engineered CasX mRNA. The plot in FIG.7 shows the quantification of percent editing measured as indel rate at the target locus in mouse Hepa1-6 cells transfected with CasX 676 mRNA #1 or CasX 676 mRNA #2 with the indicated targeting gRNAs. The data demonstrate that for all targeting spacers tested in this experiment, CasX mRNA #2, the mRNA with a synthetic 5’ UTR and a mouse HBA 3’ UTR, consistently exhibited higher editing levels at the target locus compared to editing levels achieved by CasXAttorney Docket No. SCRB-057 / 01WO 333322-2504 mRNA #1, the mRNA with human HBA 5’ and 3’ UTRs. Specifically, the highest level of editing rate achieved was with spacer 6, where use of CasX mRNA #2 resulted in ~35% editing efficiency compared to ~20% editing level by CasX mRNA #1 (FIG.7).

[0247] The results demonstrate that altering the 5’UTR and 3’UTR sequences of the CasX mRNA can affect the editing activity of CasX at a target locus in a cell-based assay, and that the combination of a synthetic 5’ UTR and mouse HBA 3’ UTR was particularly effective for generating an mRNA encoding CasX that produced a high level of editing. Example 7: CasX mRNA and targeting gRNA can be delivered via LNPs to achieve editing at a target locus in vitro

[0248] Experiments were performed to demonstrate that delivery of LNPs encapsulating CasX mRNA and a targeting gRNA can induce editing at the endogenous target locus in primary human hepatocytes. Here, CasX 515 was selected for assessment given its improvement in specificity while maintaining activity compared to the earlier prototype CasX 491, and CasX 812 was selected given its increased specificity. Materials and Methods:

[0249] Generation of CasX mRNAs encoding for CasX 515 (SEQ ID NO: 5) and CasX 812 (SEQ ID NO: 7) was performed by IVT, following similar methods described earlier in Example 6. Briefly, constructs encoding for a synthetic 5’UTR, a codon-optimized CasX 515 or CasX 812 with flanking c-MYC NLSes, and a 3’UTR derived from the mouse hemoglobin alpha (mHBA) were cloned into a plasmid containing a T7 promoter and 79-nucleotide poly(A) tail. The resulting plasmid was linearized prior to use for IVT reactions, which were carried out with CleanCap® AG and N1-methyl-pseudouridine (as described in Example 6). The DNA sequences encoding the CasX 515 or CasX 812 mRNA molecules are listed in Table 7A, with the corresponding mRNA sequences with the chemical modifications listed in Table 7B. The protein sequences for CasX 515 and CasX 812 resulting from expression of the IVT mRNA molecules are listed in Table 7C. Table 7A: Encoding sequences of the two CasX mRNA molecules assessed in this example*Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504*Components are listed in a 5’ to 3’ order within the constructs Table 7B: Full-length RNA sequences of CasX mRNA molecules assessed in this example*Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504* The CleanCap® AG 5’ cap is not shown in the table. Modification ‘mψ’ = N1-methyl- pseudouridine Table 7C: Full-length protein sequences of CasX molecules assessed in this exampleAttorney Docket No. SCRB-057 / 01WO 333322-2504Synthesis of gRNAs:

[0250] In this example, gRNAs targeting an endogenous locus were designed using gRNA scaffold 316 (SEQ ID NO: 119) and chemically synthesized. A schematic of the sites ofAttorney Docket No. SCRB-057 / 01WO 333322-2504 chemical modifications for a ‘v1’ profile of the gRNA scaffold variant 316 is shown in FIG. 18A. Formulation of lipid nanoparticles (LNPs):

[0251] CasX mRNA and gRNA were encapsulated into LNPs using GenVoy-ILMTMlipids on the Precision NanoSystems Inc. (PNI) IgniteTMBenchtop System and following the manufacturer’s guidelines. GenVoy-ILMTMlipids are manufactured by PNI, with a proprietary composition of ionizable lipid:DSPC:cholesterol:stabilizer at 50:10:37.5:2.5 mol%.

[0252] Briefly, to formulate LNPs, equal mass ratios of CasX mRNA and gRNA were diluted in PNI Formulation Buffer, pH 4.0. GenVoy-ILMTMwas diluted 1:1 in anhydrous ethanol. mRNA / gRNA co-formulations were performed using a 6:1 N / P ratio. The RNA and lipids were run through a PNI laminar flow cartridge at a predetermined flow rate ratio (RNA:Genvoy- ILMTM) on the PNI IgniteTMBenchtop System. After formulation, the LNPs were diluted in PBS, pH 7.4, to decrease the ethanol concentration and increase the pH, which increases the stability of the particles. Buffer exchange of the mRNA / sgRNA-LNPs was achieved by overnight dialysis into PBS, pH 7.4, at 4°C using 10k Slide-A-LyzerTMDialysis Cassettes (Thermo ScientificTM). Following dialysis, the mRNA / gRNA-LNPs were concentrated to > 0.5 mg / mL using 100 kDa Amicon®-Ultra Centrifugal Filters (Millipore) and then filter-sterilized. Formulated LNPs were analyzed on a Stunner (Unchained Labs) to determine their diameter and polydispersity index (PDI). Encapsulation efficiency and RNA concentration was determined by RiboGreenTMassay using Invitrogen's Quant-iTTMRibogreenTMRNA assay kit. LNPs were used in various experiments as described herein to deliver CasX mRNA and gRNA to target cells and tissue. Delivery of LNPs encapsulating CasX mRNA and targeting gRNA into primary human hepatocytes:

[0253] Two lots (lot #31 and lot #51) of primary human hepatocytes derived from two different donors (Lonza Biologics), were used in these experiments to assess CasX:gRNA- mediated editing at the target locus when delivered by LNPs. For each lot, ~50,000 cells, cultured in Williams’ E media supplemented with FBS, PenStrep, L-glutamine, ITS (insulin, transferrin, sodium selenite), dexamethasone, and Z-VAD-FMK, were seeded per well in a 96- well plate. The next day, seeded cells were treated with varying concentrations of LNPs, which were prepared in five 3-fold serial dilutions starting at 1,200 ng. These LNPs were formulated to encapsulate CasX 515 or CasX 812 mRNA and a targeting gRNA incorporating scaffold variantAttorney Docket No. SCRB-057 / 01WO 333322-2504 316v1 with either spacer 1 or 2 (SEQ ID NOS: 933 and 934, respectively). Media was changed two days after LNP treatment, and cells were cultured for three additional days prior to harvesting 1) the media supernatant to measure target protein secretion levels and 2) treated cells for gDNA extraction for editing assessment at the target locus by NGS. Briefly, for editing assessment, amplicons were amplified from 200 ng of extracted gDNA with primers targeting the endogenous locus and processed as described in Example 1. Target protein secretion levels were measured by ELISA using the BioLegend® ELISA MAXTMkit following the manufacturer’s instructions. Treatment with LNPs co-encapsulating a non-targeting gRNA with CasX 515 mRNA served as an experimental control. Results:

[0254] Two lots of primary human hepatocytes were treated with LNPs, which co- encapsulated either CasX 515 or CasX 812 mRNA and a targeting gRNA, at various doses and harvested five days post-treatment to assess effects on secretion of the target protein (FIGS.8A- 8D) and editing at the target locus (FIGS.9A-9C). The results in FIGS.8A-8D demonstrated that the effects from treatment with LNPs to deliver either CasX 515 or CasX 812 mRNA were comparable, such that both CasX 515 and CasX 812 reduced protein secretion by up to 95% in primary human hepatocytes in a dose-dependent manner. Furthermore, the data in FIGS.9A-9C show that use of either CasX 515 or CasX 812 mRNA resulted editing rates up to 70% at the target locus in primary human hepatocytes in a dose-dependent manner, corroborating the findings observed in the experimental data portrayed in FIGS.8A-8D.

[0255] Altogether, the results from these experiments demonstrate that delivery of LNPs encapsulating an mRNA encoding CasX and a targeting gRNA was able to induce efficacious editing at the endogenous locus in primary human hepatocytes, which resulted in substantial reduction in secreted levels of the target protein. Example 8: Design and assessment of modified gRNAs in improving editing when delivered together with CasX mRNA in vitro and in vivo

[0256] Experiments were performed to identify new gRNA variant sequences and demonstrate that chemical modifications of these gRNA variants enhance the editing efficiency of the CasX:gRNA system when delivered in vitro in conjunction with CasX mRNA.Attorney Docket No. SCRB-057 / 01WO 333322-2504 Materials and Methods: Synthesis of gRNAs:

[0257] All gRNAs tested in this example were chemically synthesized and were derived from gRNA scaffolds 174, 235, and 316. The sequences of gRNA scaffolds 174, 235, and 316 and their chemical modification profiles are listed in Table 8A. The sequences of the resulting gRNAs, including spacers targeting B2M or ROSA26, and their chemical modification profiles assayed in this example are listed in Table 8B. A schematic of the structure of gRNA scaffold variants 174, 235, and 316 are shown in FIGS.13A-13C, and the sites of chemical modifications of the gRNA variants are shown schematically in FIGS.10A, 10B, 12, 18A, and 18B. Table 8A: Sequences of gRNA scaffolds with their different chemical modification profiles (denoted by version number), where “NNNNNNNNNNNNNNNNNNNN” is a spacer placeholder. Chemical modifications: * = phosphorothioate bond; m = 2’OMe modificationAttorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Table 8B: Sequences of gRNAs with their different chemical modification profiles (denoted by version number) assayed in this example. Chemical modifications: * = phosphorothioate bond; m = 2’OMe modificationAttorney Docket No. SCRB-057 / 01WO 333322-2504Note that gRNAs annotated with a v1’ design contain one less phosphorothioate bond on the 3’ end of the gRNA. gRNAs annotated with v1* contain one extra phosphorothioate bond on the 3’end of the gRNA. gRNAs annotated with a v9* contain an extra phosphorothioate bond on the 3’ end of the gRNA. Biochemical characterization of gRNA activity:

[0258] Target DNA oligonucleotides with fluorescent moieties on the 5’ ends were purchased commercially (sequences listed in Table 8C). Double-stranded DNA (dsDNA) targets were formed by mixing the oligos in a 1:1 ratio in 1x cleavage buffer (20 mM Tris HCl pH 7.5, 150 mM NaCl, 1 mM TCEP, 5% glycerol, 10 mM MgCl2), following by heating to 95°C for 10 minutes, and then allowing the solution to cool to room temperature. CasX ribonucleoproteins (RNPs) were reconstituted with CasX 491 and the indicated gRNAs at a final concentration of 1 µM with 1.2-fold excess of the indicated gRNA in 1x cleavage buffer. RNPs were allowed to form at 37°C for 10 minutes.

[0259] The effects of various structural and chemical modifications to the gRNA scaffold on the cleavage rate of CasX 491 RNPs were determined. Cleavage reactions were prepared with final RNP concentrations of 200 nM and final target concentrations of 10 nM, and reactions were carried out at 16°C and initiated by the addition of the labeled target DNA substrate (Table 8C). Aliquots of reactions were taken at 0.25, 0.5, 1, 2, 5, and 10 minutes and quenched by adding an equal volume of 95% formamide with 20 mM EDTA. Samples were denatured atAttorney Docket No. SCRB-057 / 01WO 333322-2504 95°C for 10 minutes and resolved on a 10% urea-PAGE gel. Gels were imaged on a TyphoonTMlaser-scanner platform and quantified using ImageQuantTMTL 8.2 image analysis software (CytivaTM). The apparent first-order rate constant of non-target strand cleavage (kcleave-) was determined for each CasX:gRNA combination.

[0260] To determine the competent fraction formed by each gRNA, cleavage reactions were prepared with final RNP concentrations of 100 nM and final target concentrations of 100 nM. Reactions were carried out at 37°C and initiated by the addition of the labeled target substrate (Table 8C). Aliquots were taken at 0.5, 1, 2, 5, 10, and 30 minutes and quenched by adding an equal volume of 95% formamide with 25 mM EDTA. Samples were denatured by heating at 95°C for 10 minutes and resolved on a 10% urea-PAGE gel. Gels were imaged and quantified as above. CasX was assumed to act as a single-turnover enzyme under the assayed conditions, as indicated by the observation that sub-stoichiometric amounts of enzyme would fail to cleave a greater-than-stoichiometric amount of target substrate even under extended time-scales, and instead would approach a plateau that scaled with the amount of enzyme present. Thus, the fraction of target substrate cleaved over long time-scales by an equimolar amount of RNP would be indicative of the fraction of RNP that was properly formed and active for cleavage. The cleavage traces were fitted with a biphasic rate model, as the cleavage reaction clearly deviated from monophasic under this concentration regime. The plateau of each fit was determined and reported as the active fraction for each RNP in Table 8F. Table 8C: Sequences of target DNA substrate oligonucleotides with fluorescent moieties on the 5’ ends used for biochemical characterization of gRNA activity. / 700 / = IRDye700; / 800 / = IRDye800In vitro transcription of CasX mRNA:

[0261] DNA templates encoding for CasX 491 (see Table 8D for encoding sequences) used for in vitro transcription were generated by PCR using forward primers containing a T7Attorney Docket No. SCRB-057 / 01WO 333322-2504 promoter, followed by agarose gel extraction of the appropriately sized DNA.25 ng / µL final concentration of template DNA was used in each in vitro transcription reaction that was carried out following the manufacturer's recommended protocol with slight modifications. Following in vitro transcription reaction incubation for 2-3 hours at 37℃, which were carried out with CleanCap® AG and N1-methyl-pseudouridine, DNAse digestion of template DNA and column- based purification using the Zymo RNA miniprep kit were performed. The poly(A) tail was added using E. coli PolyA Polymerase following the manufacturer's protocol, followed by column-based purification as stated above. Poly(A) tailed in vitro transcribed RNA was eluted in RNAse free water, analyzed on an Agilent TapeStation for integrity, and flash frozen prior to storage at -80oC. Table 8D: Encoding sequences of the CasX mRNA molecules assessed in this example*Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504*Components are listed in a 5’ to 3’ order within the constructs In vitro delivery of gRNA and CasX mRNA via transfection:

[0262] Editing at a target locus and consequential effects on the secreted levels of target protein were assessed for conditions using CasX 491 mRNA co-delivered with a targeting gRNA with scaffold variant 174 compared to conditions where a targeting gRNA with scaffold variant 316 was used.100 ng of in vitro transcribed mRNA coding for CasX 491 with a P2A and mScarlet fluorescent protein was transfected into HepG2 cells with version 1 (v1) of gRNAs scaffold 174-spacer A, scaffold 174-spacer B, scaffold 316-spacer A, and scaffold 316- spacer B using lipofectamine. After a media change, the following were harvested at 28 hours post- transfection: 1) transfected cells were harvested for editing assessment at the target locus by NGS; 2) media supernatant was harvested to measure secreted levels of the target protein by ELISA. For editing analysis by NGS, amplicons were amplified from 200 ng of extracted gDNA with a set of primers to amplify the target locus and processed as described earlier in Example 1. Secreted levels of the target protein in the media supernatant were also analyzed using a fluorescence resonance energy transfer-based immunoassay from CISBio following the manufacturer’s instructions. Here, a gRNA using scaffold 174 with spacer 7.37 (v0; see Table 8B), which targeted the endogenous B2M (beta-2-microglobulin) locus, served as the non- targeting control. These results are shown in FIG.14.

[0263] To compare the editing potency of version 0 (v0) and version 1 (v1) of B2M-targeting gRNAs, ~6E4 HepG2 hepatocytes were seeded per well of a 96-well plate.24 hours later, seeded cells were co-transfected using lipofectamine with 100 ng of in vitro transcribed mRNA coding for CasX 491 and different doses (1, 5, or 50 ng) of either v0 or v1 of the B2M-targeting gRNA containing scaffold variant 174 and spacer 7.37 (see Table 8B). Six days post- transfection, cells were harvested for B2M protein expression analysis via immunostaining of the B2M-dependent HLA protein, followed by flow cytometry using the AttuneTMNxT flow cytometer. These results are shown in FIG.11.Attorney Docket No. SCRB-057 / 01WO 333322-2504

[0264] V1 through v6 variants of chemically-modified targeting gRNAs (Table 8A) using scaffold 235 were assessed for their effects on editing potency and consequential effects on secreted levels of the target protein in vitro. Briefly, 100 ng of in vitro transcribed mRNA coding for CasX variant 491 and a P2A and mScarlet fluorescent protein was transfected into HepG2 cells with 50 ng of the indicated chemically-modified gRNA using lipofectamine. After a media change, the following were harvested at 28 hours post-transfection: 1) transfected cells for editing assessment at the target locus by NGS as described above; 2) media supernatant to measure secreted protein levels by ELISA, as described above. Here, a B2M-targeting gRNA was used as a non-targeting control. These results are shown in Table 8G.

[0265] LNP co-formulations were generated as described in Example 7. Delivery of LNPs encapsulating CasX mRNA and targeting gRNAs in vitro:

[0266] ~50,000 HepG2 cells, cultured in DMEM / F-12 media containing 10% FBS and 1% PenStrep, were seeded per well in a 96-well plate. The next day, seeded cells were treated with varying concentrations of LNPs, which were prepared in six 2-fold serial dilutions starting at 250 ng. These LNPs were formulated to encapsulate CasX 491 mRNA and a B2M-targeting gRNA incorporating either scaffold variant 174 or 316 with spacer 7.9 (v1; see Table 8B). Media was changed 24 hours after LNP treatment, and cells were cultured for six additional days prior to harvesting for gDNA extraction for editing assessment at the B2M locus by NGS and B2M protein expression analysis via HLA immunostaining, followed by flow cytometry using the Attune NxT flow cytometer. Briefly, for editing assessment, amplicons were amplified from 200 ng of extracted gDNA with primers targeting the human B2M locus and processed as described in Example 1. The results of these assays are shown in FIGS.15A and 15B.

[0267] ~20,000 mouse Hepa1-6 hepatocytes were seeded per well in a 96-well plate. The following day, seeded cells were treated with varying concentrations of LNPs, which were prepared in eight 2-fold serial dilutions starting at 1000 ng. These LNPs were formulated to encapsulate CasX 676 mRNA #2 (see Table 8D) and a ROSA26-targeting gRNA incorporating scaffold variant 316 with spacer 35.2 (v1 or 5; see Table 8B). Media was changed 24 hours post- treatment with LNPs, and cells were cultured for seven additional days prior to harvesting for gDNA extraction for editing assessment at the ROSA26 locus by NGS. Briefly, amplicons were amplified from extracted gDNA with primers targeting the mouse ROSA26 locus and processed as described in Example 1. The results of this experiment are shown in FIG.16A. Delivery of LNPs encapsulating CasX mRNA and targeting gRNA in vivo:Attorney Docket No. SCRB-057 / 01WO 333322-2504

[0268] To assess the effects of using v1 and v5 of scaffold 316 in vivo, CasX 676 mRNA #2 (see Table 8D) and a ROSA26-targeting gRNA using scaffold 316 with spacer 35.2 (v1 or v5; see Table 8B) were encapsulated within the same LNP using a 1:1 mass ratio for mRNA:gRNA. LNP co-formulations were performed as described in Example 7. Formulated LNPs were buffer- exchanged to PBS for in vivo injection. LNPs were administered intravenously through the retro- orbital sinus into 4-week old C57BL / 6 mice. Mice were observed for five minutes after injection to ensure recovery from anesthesia before being placed into their home cage. Naïve, uninjected animals served as experimental controls. Six days post-administration, mice were euthanized, and the liver tissue was harvested for gDNA extraction using the Zymo Research Quick DNA / RNA Miniprep kit following the manufacturer’s instructions. Target amplicons were then amplified from the extracted gDNA with a set of primers targeting the mouse ROSA26 locus and processed for editing assessment by NGS as described earlier in Example 1. The results of this experiment are shown in FIG.16B.

[0269] To compare the effects of using v7, v8, and v9 of scaffold 316 on editing at the target locus in vivo, CasX 676 mRNA #1 (see Table 8E for sequences) and a targeting gRNA using scaffold 316 with spacer C (v1, v7, v8, or v9; see Table 8A), were encapsulated within the same LNP using a 1:1 mass ratio for mRNA:gRNA for each gRNA. LNPs were administered retro- orbitally into 6-week old C57BL / 6 mice, as described above, and mice were euthanized seven days post-injection to harvest liver tissue for gDNA extraction for editing assessment by NGS at the target locus. The results of this experiment are shown in FIG.17. Table 8E: Encoding sequences of CasX 676 mRNA #1 moleculeAttorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Results: Assessing the effects of various chemical modifications on gRNA activity:

[0270] Several studies involving Cas9 have demonstrated that chemical modifications of the gRNA resulted in significantly improved editing activity when delivered with Cas9 mRNA. Following delivery of Cas9 mRNA and gRNA into target cells, unprotected gRNA is susceptible to degradation during the mRNA translation process. Addition of chemical modifications such as 2’O-methyl (2’OMe) groups and phosphorothioate bonds can reduce the susceptibility of the gRNA to cellular RNases, but also have the potential to disrupt folding of the gRNA and its interactions with the CRISPR-Cas protein. Given the lack of structural similarity between CasX and Cas9, as well as their respective gRNAs, appropriate chemical modification profiles must be designed and validated de novo. Six profiles of chemical modifications (denoted as versions) were designed for initial testing, and these six profiles are illustrated in FIGS.10A and 10B. The v1 profile was designed as a simple end-protected structure, where the first and last three nucleotides were modified with 2’OMe and phosphorothioate bonds. In the v2 profile, 3’UUU tail was added to mimic the termination sequence used in cellular transcription systems and to move the modified nucleotides outside of the region of the spacer involved in target recognition. The v3 profile included the end protection as in v1, as well as the addition of 2’OMe modifications at all nucleotides identified to be potentially modifiable based on structural analysis. The v4 profile was modeled based on v3, but with all the modifications in the triplex region removed, in part to be more sensitive to any perturbation of the RNA helical structure and backbone flexibility. The v5 profile maintained chemical modifications in the scaffold stem andAttorney Docket No. SCRB-057 / 01WO 333322-2504 extended stem regions, while the v6 profile harbored modifications only in the extended stem. The extended stem is a region that would become fully exposed to solvent in the RNP and is amenable to replacement by other hairpin structures, and therefore presumably relatively insensitive to chemical modifications.

[0271] The minimally modified v1 gRNA was initially assessed against an unmodified gRNA (v0) to determine the potential benefit of such chemical modifications on editing when the gRNA was co-delivered with CasX mRNA to target cells. Modified (v1) and unmodified (v0) B2M-targeting gRNAs with spacer 7.37 were co-transfected with CasX mRNA into HepG2 cells, and editing at the B2M locus was measured by loss of surface presentation of the B2M- dependent HLA complex, as detected by flow cytometry (FIG.11). The data demonstrate that use of the v1 gRNA resulted in substantially greater loss of B2M expression compared to the levels seen with v0 gRNA across the various doses, thereby demonstrating that end modifications of the gRNA increased CasX-mediated editing activity upon delivery of the CasX mRNA and gRNA.

[0272] The broader set of gRNA chemical modification profiles were assessed using a set of targeting gRNAs using scaffold variant 235 and spacers A and B to determine whether the additional chemical modifications would be able to support the formation of active RNPs. In vitro cleavage assays described above were performed to determine kcleaveand fraction competence for these engineered gRNAs harboring the various chemical modification profiles. The results from these in vitro cleavage assays are shown in Table 8F. The data demonstrate that gRNAs with the v3 profiles exhibited no activity, an indication that the addition of some chemical modifications significantly interfered with RNP formation or activity. Adding v4 chemical modifications resulted in a reasonable cleavage rate in the excess RNP condition, but exhibited very low fraction competence. The difference between v3 and v4 modifications confirmed that modifications in the triplex region prevented the formation of any active RNP, either due to the inability of the gRNA to fold properly or a disruption in the gRNA-protein interactions. The reduced fraction competence resulting from appending v4 modifications suggest that while the gRNA was able to successfully assemble with the CasX protein to form a cleavage-competent RNP, a large majority of the gRNA was misfolded, or that the appended chemical modifications reduced the affinity of the gRNA for the CasX protein and impeded the efficiency of RNP formation. Application of the v5 or v6 profiles resulted in competent fractions that were comparable to, but slightly lower than, those obtained for reactions using the v1 and v2Attorney Docket No. SCRB-057 / 01WO 333322-2504 modifications. While the kcleave values were relatively consistent between v5 and v6 gRNAs, both v5 and v6 gRNAs achieved nearly half of the kcleavevalues for v1 and v2 gRNAs. The reduced kcleave value for v6 gRNA was particularly surprising, given the lack of expected interaction between the gRNA and CasX protein in the modified extended stem. However, for both v5 and v6 gRNAs, it is possible that the reduced flexibility of the gRNA, resulting from the 2’OMe modifications, inhibited structural changes in the RNP required for efficient cleavage, or that the modified initial base-pairs of the hairpin involved in CasX protein interaction had been negatively impacted by the inclusion of the 2’OMe groups. Table 8F: Parameters of cleavage activity assessed for CasX RNPs with the various targeting gRNAs using scaffold 235 and harboring the indicated chemical modification profile, denoted by version number

[0273] The chemically-modified targeting gRNAs based on scaffold 235 were subsequently assessed for editing in a cell-based assay. CasX mRNA and chemically modified targeting gRNAs were co-transfected into HepG2 cells using lipofectamine. Editing levels were measuredAttorney Docket No. SCRB-057 / 01WO 333322-2504 by indel rate at the target locus by NGS and secreted levels of target protein by ELISA, and the data are displayed in Table 8G. The data demonstrate that use of v3 and v4 gRNAs resulted in minimal editing activity at the target locus, consistent with findings from the biochemical in vitro cleavage assays shown in Table 8F. Meanwhile, use of v5 and v6 gRNAs resulted in editing levels, measured by indel rate and secretion of the target protein, that were slightly lower than the levels attained with use of v1 and v2 gRNAs (Table 8G). Specifically, the results show that use of v1 and v2 gRNAs, which harbored end modifications, resulted in ~80-85% editing at the target locus, indicating that adding chemical modifications to the gRNA ends was sufficient to achieve efficient editing with CasX. While the data demonstrate that use of v5 and v6 gRNAs resulted in efficient editing in vitro, near-saturating levels of editing were observed with use of the v1 gRNA in this experiment where a single dose of the gRNA was transfected. As a result, the use of a single dose rendered it challenging to assess clearly the effects of the chemical modifications on editing under guide-limiting conditions. Therefore, profiles v1 and v5 were chosen for further testing, as v1 contains the simplest modification profile, and v5 is the most heavily modified profile whose application demonstrated robust activity in vitro (Tables 8F and 8G). Table 8G: Editing levels measured by indel rate at the target locus by NGS and secreted levels of the target protein by ELISA in HepG2 cells co-transfected with CasX 491 mRNA and various chemically-modified targeting gRNAs using scaffold 235 and either spacer A or BAttorney Docket No. SCRB-057 / 01WO 333322-2504

[0274] The v1 and v5 profiles were further tested in another cell-based assay to assess their effects on editing efficiency. LNPs were formulated to co-encapsulate CasX mRNA #2 and v1 and v5 chemically-modified ROSA26-targeting gRNAs using the newly-designed gRNA scaffold 316 (described further in the following sub-section). The “v5” profile was modified slightly for application to the 316 scaffold. Three 2’ OMe modifications in the non-base-paired region immediately 5’ of the extended stem were removed to restrict modifications to the two stemloop regions. Hepa1-6 hepatocytes were treated with the resulting LNPs at various doses and harvested eight days post-treatment to assess editing at the ROSA26 locus, measured as indel rate detected by NGS (FIG.16A). The data demonstrate that treatment with LNPs delivering the v5 ROSA26-targeting gRNA resulted in markedly lower editing levels across the range of doses compared to the levels achieved with the v1 counterpart (FIG.16A).

[0275] LNPs co-encapsulating the CasX mRNA #2 and v1 and v5 chemically-modified ROSA26-targeting gRNAs based on scaffold 316 were further tested in vivo. FIG.16B shows the results of the editing assay as percent editing measured as indel rate at the ROSA26 locus. The data demonstrate that use of the v5 gRNA resulted in ~5-fold lower editing compared to that achieved with use of the v1 gRNA, under the more relevant testing conditions of in vivo LNP delivery. These findings support the reduced cleavage rate observed biochemically for the v5Attorney Docket No. SCRB-057 / 01WO 333322-2504 gRNA in Table 8F, an indication that the v5 modifications have interfered with some aspect of CasX activity.

[0276] Additional modification profiles were designed with the goal of enhancing gRNA stability while mitigating the adverse effects on RNP cleavage activity. Using recently published structures of wild-type CasX from Planctomycetes (PDB codes 7WAY, 7WAZ, 7WB0, 7WB1), which has a higher homology to the engineered CasX variants being assessed, additional chemical modification profiles for gRNAs were designed and are illustrated in FIG.12. These profiles illustrate the addition of 2’OMe groups and phosphorothioate bonds to a newly-designed gRNA scaffold variant, which is described in the ensuing sub-section. These new gRNA chemical modification profiles were designed based on the initial data demonstrating sufficient editing activity observed in Table 8G with use of the v5 gRNA that suggested that modifications to the extended stem and scaffold stem regions would not negatively impact activity. The v7 profile was designed to include 2’OMe at residues likely to be modifiable throughout the gRNA structure, which excluded the triplex region, given the dramatic negative effects of adding such modifications observed earlier with the v3 profile. More conservative profiles, v8 and v9, were also designed, as illustrated in FIG.12. For the v8 construct, modifications were removed in the pseudoknot and triplex loop region, but were retained in the scaffold stem, extended stem, and their flanking single-stranded regions, in addition to the 5’ and 3’ termini. For the v9 profile, modifications were removed in the single-stranded regions flanking the stemloops, but were retained in the stemloops themselves, in addition to the pseudoknot, triplex loop, and 5’ and 3’ termini. The additional chemical modification profiles v7, v8, and v9 of the newly designed gRNA scaffold variant 316 (discussed further below) were assessed in vivo at the target locus. The results of the editing assay in vivo quantified as percent editing at the target locus measured as indel rate as detected NGS are illustrated in FIG.17. Despite the fact that low editing efficiency was detected overall, the data demonstrate that use of v7, v8, and v9 gRNAs resulted in lower editing levels at the target locus compared to the indel rate achieved with use of the v1 gRNA (FIG.17). Given the findings in FIGS.16A-16B showing inferior editing activity attained with the v5 gRNA, it is unsurprising that v7, v8, and v9 profiles similarly demonstrated comparatively lower editing activity. As illustrated in FIG.12, the v7, v8, and v9 profiles include modifications throughout the extended stem region, which might have interfered with RNP activity. Comparison of gRNA scaffold variant 174 and 316 using an in vitro cleavage assay:Attorney Docket No. SCRB-057 / 01WO 333322-2504

[0277] Previous work had established gRNA scaffold variant 235 as the top-performing scaffold variant across multiple delivery conditions. However, the longer length of scaffold 235 (119 bp, when using a 20 bp spacer) relative to gRNAs including scaffold 174 (109 bp, when using a 20 bp spacer) increased the difficulty of solid-phase RNA synthesis, which would result in increased manufacturing costs, decreased purity and yield, and higher rates of synthesis failures. To address these issues but retain the improved activity of using scaffold variant 235, a chimeric gRNA scaffold was designed primarily on the basis of the scaffold 235 sequence, but the extended stemloop of scaffold 235 was replaced with the shorter extended stemloop of scaffold variant 174 (FIGS.13A-13C). The resulting chimeric scaffold, named scaffold 316, was synthesized in parallel with scaffold 174 and targeting spacers A and B, and B2M-targeting spacer 7.9 harboring the v1 chemical modification profile, with 2’OMe and phosphorothioate bonds on the first and last three nucleotides of all gRNAs (see Table 8B). Scaffold variant 174 was chosen as the comparator rather than variant 235 because variant 174 was the best previously characterized scaffold with the same length as variant 316.

[0278] In vitro cleavage activity was assessed for gRNAs with scaffold 174 and 316 and spacers A and B. Cleavage assays were carried out with 20-fold excess RNP over a matching dsDNA target. Cleavage rates were quantified for all four guides, and the results are shown in Table 8H. The data demonstrate that in the context of spacer A, use of either scaffold 174 or 316 resulted in similar cleavage rates, with scaffold 316 resulting in marginally faster cleavage than that achieved with scaffold 174. In the context of spacer B, the difference in cleavage activity was more pronounced: CasX RNPs using scaffold 316 were able to cleave DNA nearly twice as quickly as CasX RNPs using scaffold 174 (Table 8H).

[0279] Assays were also performed with equimolar amounts of RNP and DNA target over a longer time course to assess the fraction of expected RNP active for cleavage. As the CasX RNP is essentially single-turnover over the tested timescale, and the concentrations used are expected to be substantially higher than the KDof the DNA-binding reaction, the amount of cleaved DNA should approximate the amount of active RNP. For either spacer A or B, the active fraction of CasX RNPs incorporating scaffold 316 was 25-30% higher than for CasX RNPs using scaffold 174 (Table 8H). These data suggest that a higher fraction of gRNA using scaffold 316 was properly folded for association with the CasX protein, or that the gRNA using scaffold 316 was able to associate more strongly with the CasX protein. Compared to scaffold 174, scaffold 316 harbors mutations expected to stabilize the pseudoknot and triplex structures required for properAttorney Docket No. SCRB-057 / 01WO 333322-2504 gRNA folding. The increased stability of these motifs in particular, which were more likely to misfold than the simple hairpins found elsewhere in the gRNA structure, might result in a slightly higher fraction of the gRNAs folding into an active conformation. Table 8H: Parameters of cleavage activity assessed for CasX RNPs with gRNAs containing scaffold variant 174 or 316 with the version 1 (v1) chemical modification profile.Comparison of gRNA scaffold variants 174 and 316 in a cell-based assay:

[0280] An editing assessment using gRNA scaffold variant 174 compared to variant 316 was performed in a cell-based assay. CasX 491 mRNA and the version 1 (v1) of targeting gRNAs using spacers A and B were lipofected into HepG2 cells. Treated cells were harvested 28 hours post-transfection for analysis of editing levels at the target locus by NGS and secreted levels of target protein by ELISA, and the data are presented in FIG.14. The data demonstrate that use of any of the targeting gRNA tested resulted in efficient editing at the target locus and substantial reduction in secretion of the target protein compared to the non-targeting control using the B2M- targeting gRNA. The results also show that use of scaffold 316 resulted in more effective editing at the target locus than that observed with use of scaffold 174 (~10 percentage point increase in editing rate achieved with scaffold 316 over scaffold 174). This finding is further supported by the ELISA results, such that use of scaffold 316 resulted in more effective reduction of secretion of the target protein compared to that achieved with use of scaffold 174.

[0281] Scaffold variants 174 and 316 were also assessed in an editing assay where LNPs were formulated to co-encapsulate CasX 491 mRNA and an exemplary B2M-targeting gRNA harboring either scaffold variant. HepG2 cells were treated with the resulting LNPs at various doses and harvested seven days post-treatment to assess editing at the B2M locus, measured as indel rate detected by NGS (FIG.15A) and loss of surface presentation of the B2M-dependent HLA complex, as detected by flow cytometry (FIG.15B). The results from both assaysAttorney Docket No. SCRB-057 / 01WO 333322-2504 demonstrate that treatment with LNPs to deliver the B2M-targeting gRNA using scaffold 316 resulted in higher editing potency at the B2M locus compared to LNPs delivering the gRNA using scaffold 174 at each dose (FIGS.15A and 15B). Specifically, at the highest dose of 250 ng, use of scaffold 316 resulted in an editing level that was nearly two-fold higher than the level attained with using scaffold 174. This substantial increase in editing efficacy when using scaffold 316 versus scaffold 174, compared to the comparatively modest difference in activity observed from the in vitro cleavage assays, might be attributed to the destabilization of gRNA structure and folding during LNP formulation. The low pH conditions and association of cationic lipids during LNP formulation could adversely affect parts of the gRNA structure and result in unfolding. Consequently, it would be necessary for the gRNA to refold quickly in the cytoplasm upon delivery, both to bind the CasX protein to form the RNP and to evade RNase degradation. The stability-increasing mutations in scaffold 316 compared to scaffold 174 might provide a substantial benefit in supporting proper gRNA refolding in the cytoplasm after LNP delivery, while the deliberate folding protocol carried out for the gRNA prior to biochemical experiments likely reduced the impact of these mutations. Example 9: Preliminary experiments to demonstrate that the CasX:gRNA system can edit the CD38 locus to generate CD38 Knockout (KO) NK cells when delivered in vitro

[0282] Experiments were performed to determine the ability of the CasX:gRNA system to edit the CD38 locus in primary human natural killer cells (NK cells) when delivered in vitro. Materials and Methods: Obtaining CD3 depleted peripheral blood mononuclear cells (CD3- PBMCs):

[0283] Universal donors were selected as described in published PCT application WO2021 / 051042. Briefly, PBMCs collected and depleted of CD3 expressing cells. The CD3 depleted PBMCs (CD3- PBMCs) were frozen until the next step. Thawing, Culturing, and Electroporation of CD3-pmbcs:

[0284] NK cell base media (NK MACs®, Miltenyi Biotec) was prepared with 5, 10 or 20 ng / mL IL-15 and warmed to 37◦C. Frozen CD3-PBMCs from 6 unique cell donors were thawed using a ThawStar® Controlled-Rate Cell Thawer. Slowly and dropwise, 1 mL of NK cell base media was added to cells, and carefully agitated with a 1 mL pipette. Total volume of the container was transferred to a 15 mL conical tube. Final volume was adjusted to 10 mL using NK complete media (NK MACs®, Miltenyi Biotec, 10% human AB serum) supplemented withAttorney Docket No. SCRB-057 / 01WO 333322-2504 IL-15 and cells were counted. Cells were centrifuged at 1000 rpm for 5 minutes (min) then resuspended in 3 mL NK cell base media.

[0285] One milliliter of NK cell base media was transferred to each of 3 wells of a GREX 6 well plate (Wilson Wolf), then 1 mL of the newly thawed cell suspension was added to each well. The media in each well was adjusted up to 35 mL using complete NK cell media with IL- 15. Cells were placed in an incubator at 37◦C and 5% CO2for seven days. Seven days after thaw, cells were carefully resuspended and counted. Each well was split 1:1 and leveled to 35 mL with fresh complete NK cell media supplemented with IL-15. Cells were placed in an incubator at 37◦C and 5% CO2for seven days. Fourteen days following thaw, cells were again counted and then harvested. Cells were centrifuged at 1000 rpm for 10 min and supernatant was removed. Cells were prepared for electroporation.

[0286] CasX mRNA (SEQ ID NO: 151) encoding SEQ ID NO: 6 was prepared as described in published PCT application WO2018157153A1.

[0287] All CasX gRNAs tested in this example were chemically synthesized and were derived from gRNA scaffold 316v1 (SEQ ID NO: 142). Table 9.1 shows the sequences of the gRNA with linked targeting sequences. Table 9.1: gRNA sequences with CD38 targeting sequencesAttorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504Attorney Docket No. SCRB-057 / 01WO 333322-2504

[0288] Five microliters of CasX mRNA were added to each well of a V-bottom plate. Subsequently, 1.08 mL of 100 uM the individual CasX gRNA of Table 9.1 were added to wells of a V-bottom plate. After the material plate was prepared, cells were centrifuged at 1000 rpm for 10 min and supernatant was removed. Cells were then resuspended to 25x106-50x106 / mL in P3 buffer (Lonza). Twenty microliters of cells were then added to each well of the material plate, and total well contents were next moved to a Lonza electroporation plate (Lonza). Positive controls were wells having 1: Cas9 mRNA and CD38 gRNA and 2: Cas9-CD38 RNP. Negative controls were mock wells. Cells were electroporated in the Lonza Shuttle® System using pulse code CM137 and immediately thereafter removed from the electroporation well and placed in 200 ^L of warm NK base media supplemented with 5, 10 or 20 ng / mL IL-15 in a 96 well plate. This process was repeated for a technical duplicate for each unique NK cell donor. Plates were placed in an incubator at 37◦C and 5% CO2 for 48 hours (h). At 48 h, plates were removed from incubator and cells were prepared for K562 feeder cell restimulation. Briefly, K562 feeder cells expressing membrane bound IL-21 and 41BBL were cultured for 21 days, then treated with mitomycin C to arrest cell division. Cells were then aliquoted and frozen until use. At the time ofAttorney Docket No. SCRB-057 / 01WO 333322-2504 restimulation, feeder cells were thawed and adjusted to add at a 1:1 Feeder:NK cell ratio in 20 ^L NK cell base media. Cells were placed in the incubator at 37◦C and 5% CO2and split 1:1 as needed until Day 7.

[0289] At Day 7 post-electroporation, cells were harvested for analysis by flow cytometry. Briefly, cells were pelleted by centrifugation at 1000 rpm for 5 min. A fluorescent antibody staining cocktail was prepared using fluorescently labeled anti-CD38 and anti-CD56 antibodies, as well as a viability dye. This cocktail was added to the pelleted NK cells for 20 min at room temperature. After 20 min, cells were washed with phosphate buffered saline (PBS), centrifuged at 1000 rpm for 5 min, supernatant discarded, and cells were resuspended in 50 ^L of PBS for analysis by flow cytometry. Data were analyzed in NovoExpress® or FlowJo™ and quantified in Tableau®. Results:

[0290] Samples were analyzed by flow cytometry. Cells were gated to include live, CD56 positive, singlet lymphocytes. As shown in Table 9.2, ~46 % of the fifty-two gRNA tested resulted in at least 50 % knock out of CD38. CD56+ cells per well were counted, and as shown by Table 9.2, gRNAs did not differently impact CD56+ cell number 7 days post-electroporation. CD56+ viable cells were also counted, and as shown by Table 9.2, gRNAs did not differently impact average cell viability seven days post-electroporation. Observed variability was determined to be donor-driven. In silico off-target analyses were also performed, and the sequences of SEQ ID NOS: 694-696, 702, 710, and 730 demonstrated the combination of high knock out of CD38 and low predicted off-target effects.

[0291] The results of the experiments demonstrate that CasX:gRNA with the appropriate targeting sequence can knockout CD38 in NK cells efficiently in a cell-based assay. Table 9.2: Average percent CD38 Knockout in CD56+ cellsAttorney Docket No. SCRB-057 / 01WO 333322-2504

Claims

Attorney Docket No. SCRB-057 / 01WO 333322-2504 CLAIMS What is claimed is:

1. A system for modifying a cluster of differentiation 38 (CD38) gene target nucleic acid sequence, comprising: a. a CasX variant protein; and b. a guide ribonucleic acid (gRNA), wherein the gRNA comprises a targeting sequence complementary to the CD38 gene target nucleic acid sequence.

2. The system of claim 1, wherein the gRNA is a single-molecule gRNA (sgRNA).

3. The system of claim 1 or claim 2, wherein the gRNA comprises a scaffold comprising a sequence selected from the group consisting of SEQ ID NOS: 117-119, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity thereto.

4. The system of any one of claims 1-3, wherein the gRNA comprises a scaffold comprising a sequence selected from the group consisting of SEQ ID NOS: 117-119.

5. The system of any one of claims 1-3, wherein the gRNA comprises a scaffold consisting of a sequence selected from the group consisting of SEQ ID NOS: 117-119.

6. The system of any one of claims 1-3, wherein the gRNA comprises a scaffold sequence comprising the sequence of SEQ ID NO:

119.

7. The system of any one of claims 1-6, wherein the targeting sequence comprises 15-22 nucleotides.

8. The system of any one of claims 1-7, wherein the targeting sequence of the gRNA comprises a sequence selected from the group consisting of the sequences of SEQ ID NOS: 242- 466, or a sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identity thereto.

9. The system of any one of claims 1-7, wherein the targeting sequence of the gRNA comprises a sequence selected from the group consisting of the sequences of SEQ ID NOs: 242- 293, or a sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identity thereto.

10. The system of any one of claims 1-7, wherein the targeting sequence of the gRNA comprises a sequence selected from the group consisting of SEQ ID NOS: 244-246, 252, 260, and 280, or a sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identity thereto.Attorney Docket No. SCRB-057 / 01WO 333322-2504 11. The system of any one of claims 1-7, wherein the targeting sequence of the gRNA comprises a sequence selected from the group consisting of SEQ ID NOS: 244-246, 252, 260, and 280.

12. The system of any one of claims 8-11, comprising a targeting sequence with 1, 2, 3, 4, or 5 nucleotide(s) removed from the 3’ end of the sequence.

13. The system of any one of claims 1-12, wherein the targeting sequence of the gRNA is complementary to a sequence of a CD38 exon.

14. The system of claim 13, wherein the targeting sequence of the gRNA is complementary to a sequence of a CD38 exon selected from the group consisting of exon 1, exon 2, exon 3, exon 4, exon 6, exon 7, and exon 8.

15. The system of any one of claims 1-12, wherein the targeting sequence of the gRNA is complementary to a sequence of CD38 exon-intron boundary.

16. The system of any one of claims 1-15, wherein the gRNA comprises a sequence selected from the group consisting of SEQ ID NOS: 467-691 or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity thereto.

17. The system of any one of claims 1-15, wherein the gRNA comprises a sequence selected from the group consisting of SEQ ID NOS: 469-471, 477, 485, and 505, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity thereto.

18. The system of claim 16 or claim 17, wherein the gRNA is chemically modified.

19. The system of claim 18, wherein the chemical modification to the gRNA is an addition of a 2’O-methyl group to one or more nucleotides of the gRNA.

20. The system of claim 19, wherein one or more nucleotides located 1, 2, 3, or 4 nucleotides from the 5’ terminal end, the 3’ terminal, or both terminal ends of the gRNA are modified by an addition of a 2’O-methyl group.

21. The system of any one of claims 18-20, wherein the chemical modification to the gRNA is a substitution of a phosphorothioate bond between two or more nucleotides of the gRNA.

22. The system of claim 21, wherein the chemical modification comprises a substitution of phosphorothioate bonds between two or more nucleotides located 1, 2, 3 or 4 nucleotides the from the 5’ terminal end, the 3’ terminal, or both terminal ends of the gRNA.Attorney Docket No. SCRB-057 / 01WO 333322-2504 23. The system of any one of claims 18-22, wherein the chemically modified gRNA comprises a sequence selected from the group consisting of SEQ ID NOS: 692-917, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity thereto.

24. The system of any one of claims 18-23, wherein the chemically modified gRNA comprises a sequence selected from the group consisting of SEQ ID NOS: 692-743, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity thereto.

25. The system of any one of claims 18-24, wherein the chemically modified gRNA comprises a sequence selected from the group consisting of SEQ ID NOS: 694-696, 702, 710, and 730, or a sequence having at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity thereto.

26. The system of any one of claims 18-24, wherein the chemically modified gRNA consists of a sequence selected from the group consisting of SEQ ID NOS: 694-696, 702, 710, and 730.

27. The system of any one of claims 1-26, wherein the gRNA is capable of forming a ribonucleoprotein (RNP) with the CasX variant protein.

28. The system of any one of claims 1-27, wherein the CasX variant protein comprises a sequence selected from the group consisting of SEQ ID NOS: 4-7, or a sequence having at least about 80%, at least about 90%, or at least about 95%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% sequence identity thereto.

29. The system of claim 28, wherein the CasX variant protein comprises a sequence selected from the group consisting of SEQ ID NOS: 4-7.

30. The system of claim 29, wherein the CasX variant protein comprises the sequence of SEQ ID NO:

5.

31. The system of claim 29, wherein the CasX variant protein consists of the sequence of SEQ ID NO:

5.

32. The system of any one of claims 1-30, wherein the CasX variant protein comprises one or more nuclear localization signals (NLS).Attorney Docket No. SCRB-057 / 01WO 333322-2504 33. The system of claim 31, wherein at least one of the one or more NLS comprises a simian virus 40 (SV40) NLS or a c-MYC NLS.

34. A nucleic acid comprising a sequence that encodes the gRNA of any one of claims 1-27.

35. A nucleic acid comprising a sequence that encodes the CasX variant protein of any one of claims 1-33.

36. The nucleic acid of claim 35, wherein the nucleic acid is a messenger RNA (mRNA).

37. The nucleic acid of claim 36, wherein the mRNA sequence is codon-optimized.

38. The nucleic acid of claim 37, wherein the mRNA sequence is codon-optimized for expression in a human cell.

39. A vector comprising the nucleic acid of any one of claims 34-38.

40. The vector of claim 39, wherein the vector is selected from the group consisting of a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, a herpes simplex virus (HSV) vector, a plasmid, a minicircle, a nanoplasmid, a DNA vector, a lipid nanoparticle, and an RNA vector.

41. A lipid nanoparticle (LNP) comprising: a. the nucleic acid of claim 34; b. the nucleic acid of any one of claims 35; or c. a combination of (a) and (b).

42. The LNP of claim 41, wherein the LNP comprises one or more components selected from the group consisting of one or more ionizable lipids, one or more helper phospholipids, one or more polyethylene glycol (PEG)-modified lipids, and cholesterol or a derivative thereof.

43. The LNP of claim 41 or claim 42, wherein the LNP comprises an ionizable lipid, a helper phospholipid, a polyethylene glycol (PEG)-modified lipid, and cholesterol or a derivative thereof.

44. The system of any one of claims 1-33, the nucleic acid of any one of claims 34-38, the vector of claim 39 or claim 40, the LNP of any one of claims 41-43, or combinations thereof, for use in modifying a CD38 target nucleic acid sequence in a population of cells, wherein the cells are selected from the group consisting of natural killer (NK) cells, monocytes, dendritic cells, macrophages, granulocytes, activated T cells, activated B cells, plasma cells, multiple myeloma cells, non-Hodgkin's lymphoma (NHL) cells, acute lymphocytic leukemia (ALL) cells, chronic lymphocytic leukemia (CLL) cells, and acute myelogenous leukemia (AML) cells.Attorney Docket No. SCRB-057 / 01WO 333322-2504 45. A kit comprising the system of any one of claims 1-33, the nucleic acid of any one of claims 34-38, the vector of claim 39 or claim 40, the LNP of any one of claims 41-43, or combinations thereof and a suitable container.

46. The kit of claim 45, comprising a buffer, an excipient, a nuclease inhibitor, a protease inhibitor, a liposome, a therapeutic agent, a label, a label visualization reagent, or any combination of the foregoing.

Images