RNA aptamer bindable to triamterene or triamterene derivative

Abstract

An RNA aptamer that is bindable to triamterene or its derivative is provided. The RNA aptamer comprises an RNA fragment F1 comprising a sequence X1-Y1-X3, and an RNA fragment F2 comprising a sequence X4-Y2-X2, wherein Y1 is a first core sequence and has the sequence PQRCCS, P, Q and S are independently selected from A, C, G and U, and R selected from A, C and U, Y2 is a second core sequence and has the sequence VWAU, V is selected from A and G, and W selected from A and U, X1 is a first stem region sequence, X2 is substantially complementary to X1, X3 is a second stem region sequence, X4 is substantially complementary to X3, and wherein X1 and X3 complementarily bind to X2, and X4, respectively, and form a first double-stranded stem structure S1 and a second double-stranded stem structure S2.

Description

RNA APTAMER BINDABLE TO TRIAMTERENE OR TRIAMTERENE DERIVATIVE

[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application is based on, and claims priority from, Japanese application serial number 2024-154290, filed September 6, 2024, the entire content of which is hereby incorporated by reference.

[0002] The present disclosure is related to an RNA aptamer that is bindable to triamterene or a triamterene derivative.Background

[0003] An RNA aptamer is an RNA sequence that folds into a well-defined structure and specifically interacts with a ligand. The ligand can be a small molecule, a protein, a virus, or a cell.

[0004] Recently, a gene expression regulation mechanism based on a riboswitch including an aptamer has been studied. When a certain ligand, for example, a small molecule, is recognized through the aptamer of the riboswitch, gene expression associated with another region of an RNA is regulated. Thus, synthetic riboswitches have been developed for various potential applications in many fields, including gene / cell therapy, regenerative medicine, vaccines, and manufacturing of biologics. There have, however, been few reports of small molecules and their cognate aptamers that have been demonstrated to function in mammalian cells.

[0005] Patent Literature (PTL) 1 proposes an RNA aptamer bindable to ASP7967 or an analogue thereof, such as ASP2905. ASP2905 is a molecule developed for the treatment of neurological diseases. The aptamer suggested in PTL 1 has been reported to function in mammalian cells to control gene expression at as low as 5 μM in a cell culture medium.

[0006] PTL 1: WO2024 / 075841Summary

[0007] The ligand for the aptamer suggested in PTL 1, ASP2905, is a drug candidate molecule that has undergone a Phase I clinical trial. However, it has not undergone full regulatory testing for clinical applications. Consequently, there is still an urgent need for aptamer-small molecule pairs that function in mammalian cells, especially those with potential for clinical applications. Accordingly, an object of the present disclosure is to provide an aptamer that can bind to a molecule well examined for its clinical use. (Solution to Problem)

[0008] To solve the above-mentioned problem, an RNA aptamer that is bindable to a triamterene or a triamterene derivative was selected. In one embodiment, RNA sequences that bind to triamterene were selected using SELEX, and the most abundant sequence in the selected sequences was identified. Further, to identify the nucleotides in the sequence that are essential for triamterene binding, the sequence was mutated and analyzed for binding, which lead to the discovery of the core binding motif.

[0009] Accordingly the present disclosure relates to the following:

[0010] [1] An RNA aptamer that is bindable to triamterene or a triamterene derivative, comprising an RNA fragment F1comprising a sequence X1-Y1-X3and an RNA fragment F2comprising a sequence X4-Y2-X2, wherein Y1is a first core sequence and has the sequence PQRCCS, P, Q and S are independently selected from A, C, G and U, and R is selected from A, C and U, Y2is a second core sequence and has the sequence VWAU, V is selected from A and G, and W is selected from A and U, X1is a first stem region sequence, X2is a sequence that is substantially complementary to X1, X3is a second stem region sequence, X4is a sequence that is substantially complementary to X3, and wherein X1and X3complementarily bind to X2, and X4, respectively, and form a first double-stranded stem structure S1and a second double-stranded stem structure S2.

[0011] [2] The RNA aptamer according to [1], wherein R or S is C .

[0012] [3] The RNA aptamer according to any one of [1] to [2], wherein X1is 2 base pairs or more and 50 base pairs or fewer in length, and X3is 2 base pairs or more and 50 base pairs or fewer in length.

[0013] [4] The RNA aptamer according to any one of [1] to [3], wherein the RNA aptamer consists of 18 bases or more and 100 bases or fewer.

[0014] [5] The RNA aptamer according to any one of [1] to [4], wherein the RNA aptamer has a dissociation constant for triamterene or a triamterene derivative of 10 μM or less.

[0015] [6] The RNA aptamer according to any one of [1] to [5], wherein the RNA aptamer has a dissociation constant for triamterene or a triamterene derivative of 10 pM or more.

[0016] [7] The RNA aptamer according to any one of [1] to [6], wherein the RNA aptamer is bindable to a triamterene derivative that is a compound having a monovalent substituent at the 6-position of triamterene.

[0017] [8] One or more RNA fragments that are able to form at least a part of the RNA aptamer according to any one of [1] to [7].

[0018] [9] A vector comprising the RNA aptamer according to any one of [1] to [7], or a DNA sequence corresponding to the RNA aptamer according to any one of [1] to [7].

[0019]

[0010] A vector comprising the one or more RNA fragments according to [8], or one or more DNA sequences corresponding to the one or more RNA fragments according to [8].

[0020]

[0011] An mRNA comprising the RNA aptamer according to any one of [1] to [7].

[0021]

[0012] A riboswitch comprising the RNA aptamer according to any one of [1] to [7].

[0022]

[0013] A vector comprising the riboswitch according to

[0012] , or a DNA sequence corresponding to the riboswitch according to

[0012] .

[0023]

[0014] The riboswitch according to

[0012] , further comprising a ribozyme.

[0024]

[0015] The riboswitch according to

[0014] , wherein the ribozyme is a self-cleaving ribozyme.

[0025]

[0016] A polynucleotide comprising: a riboswitch comprising an RNA aptamer that is bindable to triamterene or a triamterene derivative, and a target sequence encoding a protein, wherein the riboswitch is operably linked to the target sequence such that expression of the protein is upregulated or downregulated in response to the binding of triamterene or a triamterene derivative to the RNA aptamer.

[0026]

[0017] The polynucleotide according to

[0016] , wherein the target sequence comprises a plurality of exons.

[0027]

[0018] The polynucleotide according to

[0016] or

[0017] , wherein the target sequence comprises an alternatively-spliced exon, flanked by a 5' intron and a 3' intron, wherein the normal function of the protein is inhibited when the alternatively-spliced exon is spliced into an mRNA of the protein.

[0028]

[0019] The polynucleotide according to

[0018] , wherein the riboswitch is comprised within the alternatively-spliced exon.

[0029]

[0020] A kit comprising the polynucleotide according to any one of

[0016] to

[0019] or a vector comprising the polynucleotide according to any one of

[0016] to

[0019] , and triamterene or a triamterene derivative.

[0030]

[0021] Use of the kit according to

[0020] to regulate expression of a protein.

[0031]

[0022] Use of the kit according to

[0020] for gene editing.

[0032]

[0023] Use of the kit according to any one of

[0020] to

[0022] in a vaccine.

[0033]

[0024] Use of the kit according to any one of

[0020] to

[0022] in a gene therapy drug.

[0034]

[0025] A method for using the polynucleotide according to any one of

[0016] to

[0019] , comprising introducing the polynucleotide or a vector comprising the polynucleotide into a cell, and bringing triamterene or a triamterene derivative into contact with the polynucleotide or the vector.

[0035]

[0026] The method according to

[0025] , wherein the concentration of triamterene or a triamterene derivative in a cell culture medium is 100 μM or less.

[0036]

[0027] The method according to

[0025] or

[0026] , wherein the method is a method for cell therapy.

[0037]

[0028] The method according to

[0027] , wherein the method for cell therapy comprises administering triamterene or a triamterene derivative to a subject who has received a gene therapy to introduce the polynucleotide according to any one of

[0016] to

[0019] .

[0038]

[0029] The method according to any one of

[0025] to

[0028] , wherein the method is a method for inducing cell differentiation.

[0039]

[0030] The method according to any one of

[0025] to

[0029] , wherein the method is a method for producing biologics.

[0040]

[0031] The method according to any one of

[0025] to

[0030] , wherein the method is a method for regulating expression of a protein.

[0041]

[0032] The method for regulating expression of a protein according to

[0031] , wherein an ON / OFF ratio of the expression of the protein is more than 2.

[0042]

[0033] Use of the kit according to

[0020] , the aptamer according to any one of [1] to [7] or the polynucleotide according to any one of

[0016] to

[0019] in a topical medicine.

[0043]

[0034] Use of the kit, the aptamer or the polynucleotide according to

[0033] , wherein the topical medicine is an ophthalmic medicine or an otolaryngological medicine.

[0044]

[0035] The RNA aptamer according to any one of [1] to [7], wherein the aptamer comprises a sequence (in DNA, 5’ to 3’) selected from below. GGAGGCGCCAACTGAATGAAGCTGGCCCTCCCCTTACTAAGACATGTATTGCTTCGGCAGTGAAGGTGCCGCTGCCGAGGTACAACCTGTGTCTCAGTCAGGCCATCT (SEQ ID NO 6) ggccaTGTATTGCTTCgaaaGAGGTACAACCTGtggcc (SEQ ID NO 7) ggacgaCAACCTGTGgTCgaaaGAcCATGTATtcgtcc (SEQ ID NO 8) ggacggCAACCTGTGgTCgaaaGAcCATGTATccgtcc (SEQ ID NO 9) ggacggAAACCTGTGgTCgaaaGAcCATGTATccgtcc (SEQ ID NO 10) ggacggGAACCTGTGgTCgaaaGAcCATGTATccgtcc (SEQ ID NO 11) ggacggTAACCTGTGgTCgaaaGAcCATGTATccgtcc (SEQ ID NO 12) ggacggCCACCTGTGgTCgaaaGAcCATGTATccgtcc (SEQ ID NO 13) ggacggCGACCTGTGgTCgaaaGAcCATGTATccgtcc (SEQ ID NO 14) ggacggCTACCTGTGgTCgaaaGAcCATGTATccgtcc (SEQ ID NO 15) ggacggCACCCTGTGgTCgaaaGAcCATGTATccgtcc (SEQ ID NO 16) ggacggCATCCTGTGgTCgaaaGAcCATGTATccgtcc (SEQ ID NO 18) ggacggCAACCAGTGgTCgaaaGAcCATGTATccgtcc (SEQ ID NO 25) ggacggCAACCGGTGgTCgaaaGAcCATGTATccgtcc (SEQ ID NO 26) ggacggCAACCCGTGgTCgaaaGAcCATGTATccgtcc (SEQ ID NO 27) ggacggCAACCTATGgTCgaaaGAcCATGTATccgtcc (SEQ ID NO 28) ggacggCAACCTGTGgTCgaaaGAcCACGTATccgtcc (SEQ ID NO 29) ggacggCAACCTGTGgTCgaaaGAcCATATATccgtcc (SEQ ID NO 30) ggacggCAACCTGTGgTCgaaaGAcCATGAATccgtcc (SEQ ID NO 33)

[0045]

[0036] Use of triamterene or a triamterene derivative in the regulation of protein expression.

[0046]

[0037] A composition for regulating expression of a protein, the composition comprising triamterene or a triamterene derivative.

[0047]

[0038] A method for gene therapy, comprising (i) administering in a patient the polynucleotide according to any one of

[0016] to

[0019] or a vector comprising the polynucleotide according to any one of

[0016] to

[0019] , and (ii) administering in the patient triamterene or a triamterene derivative.

[0048]

[0039] A method for regulating gene expression in vivo, comprising (i) administering to a subject the polynucleotide according to any one of

[0016] to

[0019] or a vector comprising the polynucleotide according to any one of

[0016] to

[0019] , and (ii) administering to the subject triamterene or a triamterene derivative. (Advantageous Effect)

[0049] The RNA aptamer according to the present disclosure has sufficient binding affinity for triamterene or triamterene derivatives to induce structural changes in the RNA aptamer or the linked polynucleotides, if any. Therefore, for example, the RNA aptamer according to the present disclosure is very useful for designing a riboswitch capable of sensitively responding to the presence of triamterene or a triamterene derivative.

[0050] In the accompanying drawings: FIG. 1 is an illustration of the structure of triamterene. FIG. 2 is an illustration of the structure of an ethynyl derivative of triamterene. FIG. 3 is an illustration of the original aptamer (Trm1) discovered by SELEX. The structure of Trm 1 was based on the prediction by NUPACK. The DNA sequence of Trm1 (5’ to 3’) is shown below. FIG. 4 is a schematic illustration of a first core sequence and a second core sequence that were extracted from the predicted structure of Trm1, and were found to be sufficient for binding triamterene and triamterene derivatives. FIG. 5 is a schematic illustration of an exemplary RNA aptamer according to the present disclosure. FIG. 6 shows mutants of the aptamer Trm1. Trm1 was first reduced to Trm1y1 by preserving the core sequences while shortening the stem region sequences. Trm1y1 was circularly permuted to yield Trm1y5x. The putative A-U pair, shown in lower case, “a” and “u”, in Trm1y5x that is connected to the core sequences was replaced with a stronger G-C pair, shown in lower case, “g” and “c”, to yield Trm1y10x. The dissociation constants (KD) for triamterene shown are measured by SPR (Surface Plasmon Resonance). The DNA sequences of Trm1 mutants (5’ to 3’) are shown below. FIG.7 shows results of SPR sensorgrams of Trm1 mutants interacting with triamterene. These measurements were used to obtain the KDvalues shown in FIG. 6. The KDvalues are the mean of three independent experiments. FIG. 8 shows results of mutational analysis of Trm1y10x. Dissociation constants (KD) of Trm1y10x mutants for triamterene were analyzed by SPR. NB means no binding with triamterene was observed. The DNA sequences of Trm1y10x mutants (5’ to 3’) are shown below. FIGS. 9A to 9E show results of SPR sensorgrams of Trm1y10x mutants interacting with triamterene. These measurements were used to obtain the KDvalues shown in FIG. 8. The KDvalues are the mean of three independent experiments. FIG. 10 is a schematic illustration of a first core sequence and a second core sequence that encompasses variations of the core sequences that retain affinity to triamterene. The mutational variations shown in the figure were elucidated by the mutational analysis of FIG. 8. FIG. 11 is a schematic illustration of the mechanism of a mammalian aptazyme-based riboswitch. Trm1y10x aptamer is embedded within the circularly-permuted pistol (CPP) ribozyme along with an anti-ribozyme (anti-Rz) sequence that competes with the P1 stem of the CPP ribozyme. The aptazyme is embedded within the 3’ UTR of the mRNA encoding EGFP. In the absence of triamterene, CPP is active and self-cleaves, resulting in mRNA degradation and low EGFP expression. In the presence of triamterene, aptamer-ligand binding disrupts the CPP structure via the anti-Rz, resulting in inhibition of self-cleavage and activation of EGFP expression. FIG. 12 shows induction of gene expression by the riboswitches depicted in FIG. 11, in the presence (10 μM) and absence of triamterene in HEK293 cells. The variants with different sizes of the anti-Rz sequence were examined. Empty: no-aptazyme control. The data are averages of three replicate wells with the error bars representing S.D. FIG. 13 is a schematic illustration of the exon-skipping riboswitch mechanism. An alternatively-spliced exon (Alt-exon) containing a stop codon flanked by two intron sequences is inserted in EGFP gene. Trm1y10x aptamer is inserted downstream of the alternative exon whose inclusion in the mature mRNA induces premature translation termination of the EGFP gene. Skipping of the Alt-exon (thus production of the mature EGFP mRNA) is induced when the aptamer binds triamterene, resulting in blockage of the 5’ splice site (5’ss) immediately downstream of the alternative exon. This allows the desired protein (EGFP) to be expressed. FIG. 14 is a close-up view of the sequence near the Trm1y10x aptamer in pEGFP-ex169-Trm1y10x-a8i+1. Partial riboswitch sequences (in DNA, 5’ to 3’) near the 5’ splice site and Trm1y10x aptamer are shown below. FIG. 15 shows regulation of EGFP expression by the exon-skipping riboswitches depicted in FIG. 13 at different concentrations of triamterene in HEK293 cells. Empty: no-riboswitch control. The data are averages of three replicate wells with the error bars representing S.D. ON / OFF ratios shown in the figure represents triamterene 20 μM versus 0 μM. FIG. 16 is a schematic illustration of the exon-skipping riboswitch mechanism, wherein a Trm1y10x aptamer is positioned within an alternatively-spliced exon (Alt-exon). An Alt-exon containing a stop codon flanked by two intron sequences is inserted in EGFP gene. Trm1y10x aptamer is inserted into the Alt-exon, whose inclusion in the mature mRNA induces premature translation termination or frameshift of EGFP. Skipping of the Alt-exon (thus production of the mature EGFP mRNA) is induced when the aptamer binds triamterene, resulting in blockage of the 3’ end of the alternative exon and the 5’ splice site (5’ ss). This allows the desired protein (EGFP) to be expressed. FIG. 17 is a close-up view of the sequence near the Trm1y10x aptamer-containing Alt-exon in pEGFP-ex-Trm1y10x-5ss11. Partial riboswitch sequences (in DNA, 5’ to 3’) near the 5’ splice site and Trm1y10x aptamer are shown below. FIG. 18 shows regulation of EGFP expression by the exon-skipping riboswitches depicted in FIG. 16 at different concentrations of triamterene in HEK293 cells. Empty: no-aptazyme control. The data are averages of three replicate wells with the error bars representing S.D. ON / OFF ratios shown in the figure represents triamterene 10 μM versus 0 μM FIG. 19 shows affinities of triamterene derivatives to Trm1y10x. Dissociation constants (KD) were measured using SPR. FIG. 20 shows sequence information on exon-skipping riboswitches shown in Fig 13 and 16 (in DNA, 5’ to 3’). Each exon-skipping riboswitch construct is a fusion of EGFP1-169, Intron-1, a riboswitch, Intron-2, and EGFP 170-239. The rest of the sequence in the respective plasmids are the same as that of the parent (“Empty”) vector pEGFP-BsaI-Amp described in Fukunaga et al.1 FIG. 21 shows sequence information on aptazyme-based riboswitches shown in Fig 11 (in DNA, 5’ to 3’). These sequences replace “gagacccagacatcagtggtctc” in the parent (“Empty”) vector pEGFP-BsaI-Amp described in Fukunaga et al.1 FIG. 22 is a map of the plasmid pEGFP-BsaI-Amp. FIG. 23 shows the sequence of the plasmid pEGFP-BsaI-Amp. Riboswitch sequence shown in FIG. 21 replaces the sequence shown in underlined bold in the corresponding riboswitch plasmid. A CMV promoter is shown in the dashed line box. The Egfp gene is shown in the solid line box. Bla gene (AmpR) is shown in the dash-dotted line box.DETAILED DESCRIPTION

[0051] In the specification, the term “aptamer” refers to an oligonucleotide or peptide molecule that has high specificity and affinity for a specific substance. The term “aptamer” encompasses DNA aptamers, RNA aptamers, XNA aptamers and peptide aptamers. An aptamer that consists of RNA is referred to as an “RNA aptamer.”

[0052] In the specification, the term “stem” represents a structure formed by base pairs. A “stem” can be formed when the sequences of two regions of the same nucleotide strand are at least partially complementary, when they are substantially complementary, when they form wobble base pairs, etc. The term “loop” represents a region of unpaired (i.e., non-complementary) nucleotides that connect the respective nucleotide strands of a stem and can cap the stem.

[0053] In the present specification, the phrase “substantially complementary” includes not only cases that one sequence is completely complementary to another sequence but also cases that there are one to several mismatches (including a bulge) which does not interfere with the stem structure formation. In other words, not less than 60%, preferably not less than 80%, more preferably not less than 90% of the sequences are complementary with each other. In the stem structure, even when base pairs are not formed in a part thereof, the above binding activity to triamterene or a triamterene derivative is maintained as long as the aptamer structure is constituted as a whole. In the present disclosure, a wobble base pair (e.g., G=U base pairs) is also included in “complementary base pair”.

[0054] In the specification, the technical features described in different embodiments can be combined with each other unless otherwise stated.

[0055] <Aptamer> The RNA aptamer according to the present disclosure is, as mentioned above, an RNA aptamer that is bindable to triamterene or a triamterene derivative, comprising an RNA fragment F1comprising a sequence X1- Y1-X3and an RNA fragment F2comprising a sequence X4- Y2-X2, wherein Y1is a first core sequence and has the sequence PQRCCS, P, Q and S are independently selected from A, C, G and U, and R is selected from A, C and U, Y2is a second core sequence and has the sequence VWAU, V is selected from A and G, and W is selected from A and U, X1is a first stem region sequence, X2is a sequence that is substantially complementary to X1, X3is a second stem region sequence, X4is a sequence that is substantially complementary to X3, and wherein X1and X3complementarily bind to X2, and X4, respectively, and form a first double-stranded stem structure S1and a second double-stranded stem structure S2.

[0056] In the present disclosure, R or S is preferably C.

[0057] In the present disclosure, X2is substantially complementary to X1and X4is substantially complementary to X3. X1and X3complementarily bind to X2, and X4, respectively, and form a first double-stranded stem structure S1and a second double-stranded stem structure S2.

[0058] In the present disclosure, X1and X3are 2 base pairs or more and 50 base pairs or fewer in length, and preferably 4 base pairs or more and 25 base pairs or fewer in length, and more preferably 6 base pairs or more and 20 base pairs or fewer in length.

[0059] The RNA aptamer according to the present disclosure can be of any length, e.g., from about 18 nucleotides to about 100 nucleotides, preferably from about 20 nucleotides to about 80 nucleotides, and more preferably from about 25 nucleotides to about 50 nucleotides.

[0060] In some embodiments, the first stem region sequence X1may include one of the sequences shown below. 5’-GAGGUA-3’ 5’-GGACGA-3’ 5’-GGACGG-3’

[0061] In some embodiments, the second stem region sequence X3may include one of the sequences shown below. 5’-GUGGCC-3’ 5’-GUGGUC-3’ 5’-AUGGUC-3’

[0062] In the present disclosure, the binding affinity of the RNA aptamer to a substance is represented, for example, by a dissociation constant (Kd) of the RNA aptamer with the substance. The dissociation constant of the RNA aptamer according to the present disclosure for triamterene or a triamterene derivative is preferably 10 μM or less, more preferably 5μM or less, and further preferably 1μM or less. The dissociation constant of the RNA aptamer according to the present disclosure for triamterene or a triamterene derivative may be, for example, 10 pM or more, 100 pM or more, or 1,000 pM or more.

[0063] In the present disclosure, the RNA aptamer can specifically bind to triamterene or a triamterene derivative. Here, the term “specific” or “specifically” in the present specification refers to a selective binding of an RNA aptamer according to the present disclosure to triamterene or a triamterene derivative. The binding specificity of an RNA aptamer can be examined by comparing the binding of the RNA aptamer to triamterene or a triamterene derivative (the binding affinity to triamterene or a triamterene derivative) to the binding of the RNA aptamer to an irrelevant substance (the binding affinity to an irrelevant substance), under a predetermined condition.

[0064] The RNA aptamer according to the present disclosure may be linked to other polynucleotides.

[0065] (Structure of the RNA aptamer) In some embodiments, the RNA aptamer according to the present disclosure comprises: a first double-stranded stem structure S1connected via complementary base pairing, a loop structure L, wherein the loop structure L is linked to the first double-stranded stem structure S1via a two-base pair B1and B2, a second double-stranded stem structure S2connected via complementary base pairing, which is linked to the loop structure L via a two-base pair B3and B4, and either one of a second loop structure L2that is linked to the end of the second double-stranded stem structure S2and a third loop structure L3that is linked to the end of the first double-stranded stem structure S1, wherein each of the first double-stranded stem structure S1and the second double-stranded stem structure S2may include at least one tweaking loop (see, e.g., FIG. 5). L2or L3may include or may be linked to the same structure as all or part of the RNA aptamer disclosed in the present application. The phrase “the same structure as all or part of the RNA aptamer disclosed in the present application” may refer, for example, to a structure of X1-Y1-X3-L2-X4-Y2- X2or X3- Y1- X1-L3- X2-Y2-X4as described in the <Aptamer> section, or to a structure of Y1-X3-L2-X4-Y2or Y1- X1- L3-X2-Y2. It should be noted that X1, Y1, X3, X4, Y2, and X2as used in the above explanation regarding L2or L3indicate structural similarity to all or part of the RNA aptamer disclosed in the present application, and do not necessarily have the same sequences as the X1, Y1, X3, X4, Y2, and X2comprised in portions of the RNA aptamer other than L2or L3.

[0066] In the present disclosure, it is preferable that at least either one of the two-base pair B1and B2and the two-base pair B3and B4is an A-U pair or a G-C pair.

[0067] In the present disclosure, the loop structure L preferably includes 10 bases or more and 18 bases or fewer. The loop structure L may comprise one or more complementary base pairs formed by bases included in the loop structure L.

[0068] In the present disclosure, the first double-stranded stem structure S1and the second double-stranded stem structure S2are preferably 2 base pairs or more and 50 base pairs or fewer in length, more preferably 4 base pairs or more and 25 base pairs or fewer in length, and more preferably 6 base pairs or more and 20 base pairs or fewer in length.

[0069] The number of bases included in the second loop structure L2and the third loop structure L3is preferably, but not limited to, 3 bases or more and 20 bases or fewer.

[0070] In the present disclosure, the first double-stranded stem structure S1may comprise a first stem region sequence X1and a sequence X2that is substantially complementary to X1, the second double-stranded stem structure S2may comprise a second stem region sequence X3and a sequence X4that is substantially complementary to X3, and the loop structure L may comprise a first core sequence Y1and a second core sequence Y2.

[0071] (Triamterene) Triamterene is a compound represented by the following formula (I).

[0072]

[0073] (Triamterene derivatives) In some embodiments, the RNA aptamer according to the present disclosure may be bindable to a triamterene derivative that is a compound having a monovalent substituent at the 6-position of triamterene. In other words, the RNA aptamer according to the present disclosure may bind to a compound represented by the following formula (II), wherein R represents a monovalent substituent.

[0074]

[0075] The monovalent substituent is selected from a group including an alkyl group, a substituted alkyl group, a cycloalkyl group, a substituted cycloalkyl group, an aryl group, a substituted aryl group, a heteroaryl group, a substituted heteroaryl group, an alkenyl group, a substituted alkenyl group, an alkynyl group, a substituted alkynyl group, an amine group, a substituted amine group, an ether group, a substituted ether group, an ester group, and a substituted ester group. The carbon number of the alkyl group is preferably 1 or more, preferably 15 or less, preferably 10 or less, preferably 6 or less. The alkyl group is preferably selected from a group including a methyl group, an ethyl group, a propyl group, an isopropyl group, an n-butyl group, isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an isopentyl group, a neopentyl group, a tert-pentyl group, an n-hexyl group, and an isohexyl group.

[0076] The carbon number of the cycloalkyl group is preferably 3 or more, preferably 4 or more, preferably 5 or more, preferably 15 or less, preferably 10 or less, and preferably 7 or less. The cycloalkyl group is preferably selected from a group including a cyclopentyl group, a cyclohexyl group, and a cycloheptyl group.

[0077] The carbon number of the aryl group is preferably 6 or more, preferably 14 or less, preferably 10 or less. The aryl group is preferably selected from a group including a phenyl group, a biphenyl group, and a naphthyl group. The aryl group may also be substituted, typically at the para position, or unsubstituted.

[0078] The carbon number of the heteroaryl group is preferably 3 or more, preferably 4 or more, preferably 15 or less, preferably 10 or less. The heteroaryl group can exist as a single aromatic ring or as part of a fused ring system. Fused heteroaryl rings are those in which two or more rings share two or more atoms, typically two, resulting in an extended conjugated system. The heteroaryl group may also be substituted, typically at the para position, or unsubstituted. The heteroaryl group is preferably selected from a group including a pyridyl group, a diazinyl group, a triazinyl group, a thienyl group, and a furyl group.

[0079] The carbon number of the alkenyl group is preferably 2 or more, preferably 15 or less, preferably 10 or less, preferably 6 or less. The alkenyl group is preferably selected from a group including an ethenyl group, a propenyl group, an isopropenyl group, a 1-butenyl group, a 2-butenyl group, an isobutenyl group, a 1-pentenyl group, a 2-pentenyl group, an isopentenyl group, a 1-hexenyl group, a 2-hexenyl group, and an isohexenyl group.

[0080] The carbon number of the alkynyl group is preferably 2 or more, preferably 15 or less, preferably 10 or less, preferably 6 or less. The alkynyl group is preferably selected from a group including an ethynyl group, a propynyl group, a 1-butynyl group, a 2-butynyl group, an isobutynyl group, a 1-pentynyl group, a 2-pentynyl group, an isopentynyl group, a 1-hexynyl group, a 2-hexynyl group, and an isohexynyl group.

[0081] The amine group is a primary, secondary, or tertiary amine. The secondary or tertiary amine may be substituted with an alkyl group, a substituted alkyl group, a cycloalkyl group, substituted cycloalkyl group, an aryl group, a substituted aryl group, a heteroaryl group, a substituted heteroaryl group. The definitions and examples of these substituent groups are as described above.

[0082] The ether group and the ester group may be linked to an alkyl group, a substituted alkyl group, a cycloalkyl group, a substituted cycloalkyl group, an aryl group, a substituted aryl group, a heteroaryl group, or a substituted heteroaryl group. The definitions and examples of these linked groups are as described above.

[0083] The above-mentioned monovalent substituents can be substituted by one or more substituents. Such substituents are not limit to a specific moiety but, for example, may be selected from a group including any organic groups such as an amino group (such as primary, secondary, or tertiary amines), a trifluoromethyl group, a hydroxy group, a hydroxymethyl group, 2-hydroxyethyl group, a 2-hydroxyethylamino group, and a bis(2-hydroxyethyl)amino group, and halogen atoms, in particular, fluorine atoms. Other examples of substituents include alkyl groups (such as methyl, ethyl, propyl), alkenyl groups (such as vinyl, allyl), alkynyl groups (such as ethynyl, propargyl), alkoxy groups (such as methoxy, ethoxy), nitro groups, aryl groups, heteroaryl groups, acyl groups, cyano groups, and sulfonyl groups.

[0084] Examples of preferred triamterene derivatives include, but are not limited to, the following triamterene derivatives.

[0085]

[0086] <RNA fragments> The RNA fragments according to the present disclosure are able to form at least a part of the RNA aptamer according to the present disclosure. In some embodiments, the RNA fragments according to the present disclosure may compose a split aptamer. A split aptamer is an aptamer that consists of two or more fragments derived from the parent aptamer, obtained by cleaving the parent aptamer sequence, for example, at a loop sequence, which can bind the target substance by forming substantially the same structure as the parent aptamer when used. With reference to split aptamers disclosed in previous studies (Debiais et al., Stojanovic et al., Kolpashchikov, Alam et al., and Kikuchi et al.,)2-6, it would be readily understood by those skilled in the art that the split aptamers can be used, like the parent aptamer, for riboswitches and other applications. Furthermore, as readily understood by those skilled in the art, by combining RNA fragments, a structure may be formed in which a plurality of RNA aptamers are arranged in succession. For example, in the RNA aptamer described in the <Aptamer> section, in addition to an RNA fragment F1and an RNA fragment F2, an RNA fragment F1-2and an RNA fragment F2-2may be employed, thereby providing a structure in which an RNA aptamer comprising the RNA fragment F1and the RNA fragment F2and a second RNA aptamer comprising the RNA fragment F1-2and the RNA fragment F2-2are arranged in succession. Thereby, for example, an effect of increasing the ON / OFF ratio may be provided. Here, an RNA fragment F1-2refers to an RNA fragment having the same structure as F1(X1-Y1-X3) described in the <Aptamer> section, and an RNA fragment F2-2refers to an RNA fragment having the same structure as F2(X4- Y2-X2) described in the <Aptamer> section. The sequences of F1-1and F1-2are not necessarily the same as those of F1and F2, respectively. The RNA fragments F1, F1-2, F2, and F2-2may all be included within the same RNA fragment, or they may be separated into a plurality of RNA fragments. Likewise, each sequence of the RNA fragments may be contained within a single RNA fragment, or may be distributed over a plurality of RNA fragments. It is not necessarily required that all of the sequences be included in the RNA fragments, and any RNA fragment that produces the intended effects of the present disclosure may be included in the RNA aptamer of the present disclosure.

[0087] The RNA fragments according to the present disclosure can be of any length, e.g., from about 4 nucleotides to about 100 nucleotides, preferably 6 nucleotides or more and 80 nucleotides or fewer in length, and more preferably 10 nucleotides or more and 50 nucleotides or fewer in length.

[0088] <Vector> The present disclosure is also related to a vector comprising the RNA aptamer according to the present disclosure or a DNA sequence corresponding to the RNA aptamer according to the present disclosure. In the present specification, the term “vector” encompasses RNA vectors and DNA vectors. A vector that consists of RNA is referred to as “RNA vector,” and a vector that consists of DNA is referred to as “DNA vector.” An RNA vector comprises, for example, the RNA aptamer according to the present disclosure. A DNA vector comprises, for example, a DNA sequence that corresponds to the RNA aptamer according to the present disclosure. In the present specification, a DNA sequence that corresponds to an RNA sequence is, for example, a DNA sequence that is capable of being transcribed into the RNA sequence.

[0089] The present disclosure is also related to a vector comprising the one or more RNA fragments according to the present disclosure or one or more DNA fragments corresponding to the one or more RNA fragments according to the present disclosure. An RNA vector comprises, for example, the RNA fragments according to the present disclosure. A DNA vector comprises, for example, DNA fragments that correspond to the RNA fragments according to the present disclosure.

[0090] The present disclosure is also related to a vector comprising the riboswitch according to the present disclosure, which is described later in the present specification, or a DNA sequence that corresponds to the riboswitch according to the present disclosure. An RNA vector comprises, for example, the riboswitch according to the present disclosure. A DNA vector comprises, for example, a DNA sequence that corresponds to the riboswitch according to the present disclosure.

[0091] The present disclosure is also related to a vector comprising the polynucleotide according to the present disclosure, which is described later in the present specification. An RNA vector comprises, for example, the polynucleotide according to the present disclosure. A DNA vector comprises, for example, a DNA sequence that corresponds to the polynucleotide according to the present disclosure.

[0092] In the present disclosure, examples of vectors include, but are not limited to, plasmids, viral vectors, cosmids, artificial chromosomes, and phagemids. The vector may be one which is able to replicate in a host cell, and which may be further characterized by one or more endonuclease restriction sites at which the vector can be cut and into which a desired nucleic acid sequence may be inserted. The vectors may comprise one or more marker sequences suitable for use in the identification and / or selection of cells which have or have not been transformed or genomically modified with the vector.

[0093] In the present disclosure, the vector may further comprise additional nucleic acid elements including nucleic acid regions or segments that provide for the replication of the vector in a cell and expression of the aptamer, the riboswitch, or the polynucleotide according to the present disclosure in that cell at appropriate levels. The ordinarily skilled artisan appreciates that expression control sequences (promoters, enhancers, and the like) are selected based on their ability to promote expression of them in the cell.

[0094] In the present disclosure, viral vectors can be used preferably. Examples of viral vectors include, but are not limited to, adenoviral (AV) vectors, adeno-associated virus (AAV) vectors, retroviral and lentiviral vectors, Herpes simplex type 1 (HSV1) vectors, and Vesicular stomatitis virus (VSV) vectors.

[0095] In the present disclosure, a polynucleotide and a vector can be introduced into a cell by a viral vector system or nonviral vector system. In the nonviral vector system, for example, cationic lipids, polymers, or both, can be used as carriers. Conjugated poly-L-lysine (PLL) polymer and polyethylenimine (PEI) polymer systems can also be used to deliver the polynucleotide or vector to cells. Other methods for delivering the polynucleotide or vector to cells include hydrodynamic injection and electroporation and use of ultrasound. For a review of viral and non-viral delivery systems for gene delivery see Nayerossadat et al.7

[0096] <mRNA> The present disclosure is also related to an mRNA comprising the RNA aptamer according to the present disclosure. The mRNA comprising the RNA aptamer can be any mRNA, as long as the function of the RNA aptamer to bind to triamterene or a triamterene derivative is maintained. The mRNA according to the present disclosure may include one or more target sequences that encode a target protein, whose expression is regulated by the RNA aptamer according to the present disclosure in presence or absence of triamterene or a triamterene derivative.

[0097] <Riboswitch> A riboswitch generally refers to a functional unit (region or segment) of an RNA polynucleotide for regulating activity of a target sequence such as a sequence encoding a protein, a non-protein coding RNA (such as siRNA, pre-miRNA), and the like, on the same RNA polynucleotide. A riboswitch typically comprises an aptamer as a sensor region that detects the presence of a ligand such as a small molecule and an effector region that is involved in the basic function. The riboswitch may comprise a plurality of sensor regions and a plurality of effector regions. The number of sensor regions and the number of effector regions may be the same or different. Such a configuration may provide effects including, but not limited to, an improvement in affinity for a ligand and an increase in specificity. Non-limiting basic functions of a riboswitch include the formation of hairpin structures that terminate transcription, blocking translation by repressing ribosome binding sites, self-cleavage, and regulation of selective splicing. A riboswitch undergoes a structural change through the structural change of the aptamer caused by binding to the ligand, resulting in enhancing or preventing activity of a target sequence on the same RNA polynucleotide. Here, triamterene and its derivatives are not cytotoxic, thus these molecules are excellent ligands for regulating the riboswitch function, especially in vivo.

[0098] The riboswitch according to the present disclosure comprises the RNA aptamer according to the present disclosure. The riboswitch according to the present disclosure can bind to triamterene or a triamterene derivative through the RNA aptamer and regulate activity of a target sequence on the same RNA polynucleotide.

[0099] In many embodiments, the riboswitch according to the present disclosure may be operably linked to a target sequence such that the structural change of the aptamer in response to the binding to triamterene or a triamterene derivative results in enhancing or preventing activity of a target sequence. In the specification, the phrase “operably linked to” refers to the linking of multiple nucleic acids into a single nucleic acid such that the function of one nucleic acid is acted upon by another. Further, the riboswitch according to the present disclosure may be indirectly linked to a target sequence with any base sequences between them as long as the riboswitch can regulate the activity of the target sequence. Also, the riboswitch according to the present disclosure may be positioned between a part of the target sequence and another part of the target sequences as long as the riboswitch can regulate the activity of the target sequence. In the present disclosure, the phrase “operably linked to” includes these cases. Further, in the present disclosure, a riboswitch sequence and a target sequence may share a part of sequence.

[0100] In the present disclosure, the target sequence may be a sequence encoding a protein or a non-protein coding RNA such as siRNA, pre-miRNA, pri-miRNA, sgRNA, lncRNA, RNA aptamer, ribozyme, tRNA, or rRNA. Here, the protein encoded by the target sequence may be any protein.

[0101] The riboswitch according to the present disclosure may further comprise a ribozyme. In the specification, the term “ribozyme” refers to a catalytic nucleic acid molecule that is RNA and that specifically recognizes and cleaves target nucleic acid sequences. The target may be the ribozyme itself or another nucleic acid molecule. In some embodiments, the ribozyme may be a self-cleaving ribozyme. In the present disclosure, the ribozyme may be selected from the group consisting of, but not limited to, a hammerhead ribozyme, a hairpin ribozyme, a hepatitis delta virus (HDV) ribozyme, a Varkud satellite (VS) ribozyme, a GlmS ribozyme, a twister ribozyme, a twister sister ribozyme, a pistol ribozyme, a hatchet ribozyme, a group I intron ribozyme, a group II intron ribozyme, and an RNase P ribozyme.

[0102] In the present disclosure, any riboswitch found in nature can be used as a platform for preparing the riboswitch according to the present disclosure. Any riboswitch found in nature can be engineered to comprise the aptamer according to the present disclosure instead of the original aptamer. Such a riboswitch may be further re-engineered as long as the riboswitch activity is maintained as a whole. Examples of the riboswitch found in nature as mentioned above include, but are not limited to, a thiamine pyrophosphate (TPP) riboswitch, an adenosine cobalamin (AdoCbl) riboswitch, an S-adenosyl methionine (SAM) riboswitch, an SAH riboswitch, a flavin mononucleotide (FMN) riboswitch, a tetrahydrofolate riboswitch, a lysine riboswitch, a glycine riboswitch, a purine riboswitch, a GlmS riboswitch, and a pre-queosine1(PreQ1) riboswitch.

[0103] <Polynucleotide> The polynucleotide according to the present disclosure comprises a riboswitch comprising an RNA aptamer that is bindable to triamterene or a triamterene derivative, and a target sequence encoding a protein, wherein the riboswitch is operably linked to the target sequence such that expression of the protein is upregulated or downregulated in response to the binding of triamterene or a triamterene derivative to the RNA aptamer.

[0104] In the present disclosure, the target sequence encoding a protein may comprise a plurality of exons. In some embodiments, the target sequence comprises, for example, an alternatively-spliced exon, flanked by a 5' intron and a 3' intron, wherein the normal function of the protein is inhibited when the alternatively-spliced exon is spliced into an mRNA of the protein. For example, the alternatively-spliced exon may comprise a stop codon that is in-frame with the protein when the alternatively-spliced exon is spliced into an mRNA of the protein. In one embodiment, for example, the aptamer may be positioned within the 3' intron of the alternatively-spliced exon. The aptamer comprises the 5' splice site (“5' ss”) sequence of the 3' intron (i.e., the intronic splice site sequence that is immediately 3' of the alternative exon) and sequence complementary to the 5' ss sequence of the 3' intron as an effector region. When the aptamer binds the ligand, the effector region forms a stem and thus prevents splicing to the splice donor site at the 3' end of the alternative exon, resulting in the expression of the protein of interest. Under certain conditions (for example, when the aptamer is not bound to its ligand), the effector region is in a context that provides access to the splice donor site at the 3' end of the alternative exon leading to inclusion of the alternative exon in the mRNA of the protein, resulting in the inhibited expression of the protein of interest (see, e.g., FIGS. 13 and 14). In this case, the total length of the stem the effector region is preferably between 6 to 12 base pairs, more preferably between 6 to 10 base pairs, especially preferably between 7 to 9 base pairs.

[0105] In other embodiments, the aptamer may be positioned within an alternatively-spliced exon. In this embodiment, for example, the alternatively-spliced exon may comprise a stop codon that is in-frame with the protein when the alternatively-spliced exon is spliced into an mRNA of the protein. The aptamer is positioned within the alternatively-spliced exon while a stem region sequence of the aptamer is designed to block the 5’ splice site downstream of the exon. The binding of triamterene or a triamterene derivative to the RNA aptamer causes a conformational change in the RNA aptamer, resulting in the splicing of the alternatively-spliced exon and the expression of the target protein. (see, e.g., FIGS. 16 and 17) In addition, a single target sequence may comprise a plurality of aptamers. The plurality of aptamers may all be located within introns adjacent to the alternatively-spliced exon, or they may all be located within the alternatively-spliced exon, or some of the plurality of aptamers may be located within the alternatively-spliced exon while others are located within introns adjacent to the alternatively-spliced exon. The alternatively-spliced exon may or may not comprise a stop codon. For example, different proteins (for example, one being an active form and the other being an inactive form) may be translated depending on whether the alternatively-spliced exon is present or absent.

[0106] In the present disclosure, the protein encoded by the target sequence may be any protein, for example, may be a protein to be used for a therapy. Furthermore, the therapeutic target of the present disclosure may be a disease associated with these proteins. The examples of the protein encoded by the target sequence include 4-1BB ligand, 5-helix, human C-C chemokine, human L105 chemokine, human L105 chemokine designated huL105_3., monokine induced by gamma-interferon (MIG), partial CXCR4B protein, platelet basic protein (PBP), alpha1-antitrypsin, ACRP-30 Homologue; Complement Component C1q C, Adenoid-expressed chemokine (ADEC), aFGF; FGF-1, AGF, AGF Protein, albumin, an etoposide, angiostatin, Anthrax vaccine, Antibodies specific for collapsin, antistasin, Anti-TGF beta family antibodies, antithrombin III, APM-1; ACRP-30; Famoxin, apo-lipoprotein species, Arylsulfatase B, b57 Protein, BCMA, Beta-thromboglobulin protein (beta-TG), bFGF; FGF2, Blood coagulation factors, BMP Processing Enzyme Furin, BMP-10, BMP-12, BMP-15, BMP-17, BMP-18, BMP-2B, BMP-4, BMP-5, BMP-6, BMP-9, Bone Morphogenic Protein-2, calcitonin, Calpain-10a, Calpain-10b, Calpain-10c, Cancer Vaccine, Carboxypeptidase, C-C chemokine, MCP2, CCR5 variant, CCR7, CCR7, CD11a Mab, CD137; 4-1BB Receptor Protein, CD20 Mab, CD27, CD27L, CD30, CD30 ligand, CD33 immunotoxin, CD40, CD40L, CD52 Mab, Cerebus Protein, Chemokine Eotaxin., Chemokine hIL-8, Chemokine hMCP1, Chemokine hMCP1a, Chemokine hMCP1b, Chemokine hMCP2, Chemokine hMCP3, Chemokine hSDF1b, Chemokine MCP-4, chemokine TECK and TECK variant, Chemokine-like protein IL-8M1 Full-Length and Mature, Chemokine-like protein IL-8M10 Full-Length and Mature, Chemokine-like protein IL-8M3, Chemokine-like protein IL-8M8 Full-Length and Mature, Chemokine-like protein IL-8M9 Full-Length and Mature, Chemokine-like protein PF4-414 Full-Length and Mature, Chemokine-like protein PF4-426 Full-Length and Mature, Chemokine-like protein PF4-M2 Full-Length and Mature, Cholera vaccine, Chondromodulin-like protein, c-kit ligand; SCF; Mast cell growth factor; MGF; Fibrosarcoma-derived stem cell factor, CNTF and fragment thereof, coagulation factors in both pre and active forms, collagens, Complement C5 Mab, Connective tissue activating protein-III, CTAA16.88 Mab, CTAP-III, CTLA4-Ig, CTLA-8, CXC3, CXC3, CXCR3; CXC chemokine receptor 3, cyanovirin-N, Darbepoetin, designated exodus, designated huL105_7., DIL-40, Dnase, EDAR, EGF Receptor Mab, ENA-78, Endostatin, Eotaxin, Epithelial neutrophil activating protein-78, EPO receptor; EPOR, erythropoietin (EPO) and EPO mimics, Eutropin, Exodus protein, Factor IX, Factor VII, Factor VIII, Factor X and Factor XIII, FAS Ligand Inhibitory Protein (DcR3), FasL, FasL, FasL, FGF, FGF-12; Fibroblast growth factor homologous factor-1, FGF-15, FGF-16, FGF-18, FGF-3; INT-2, FGF-4; gelonin, HST-1; HBGF-4, FGF-5, FGF-6; Heparin binding secreted transforming factor-2, FGF-8, FGF-9; Glia activating factor, fibrinogen, flt-1, flt-3 ligand, Follicle stimulating hormone Alpha subunit, Follicle stimulating hormone Beta subunit, Follitropin, Fractalkine, fragment. myofibrillar protein Troponin I, FSH, Galactosidase, Galectin-4, G-CSF, GDF-1, Glioma-derived growth factor, glucagon, glucagon-like peptides, Glucocerebrosidase, glucose oxidase, Glucosidase, Glycodelin-A; Progesterone-associated endometrial protein, GM-CSF, gonadotropin, Granulocyte chemotactic protein-2 (GCP-2), Granulocyte-macrophage colony stimulating factor, growth hormone, Growth related oncogene-alpha (GRO-alpha), Growth related oncogene-beta (GRO-beta), Growth related oncogene-gamma (GRO-gamma), hAPO-4; TROY, hCG, Hepatitus B surface Antigen, Hepatitus B Vaccine, HER2 Receptor Mab, hirudin, HIV gp120, HIV gp41, HIV Inhibitor Peptide, HIV Inhibitor Peptide, HIV Inhibitor Peptide, HIV protease inhibiting peptides, HIV-1 protease inhibitors, HPV vaccine, Human 6CKine protein, Human Act-2 protein, Human adipogenesis inhibitory factor, human B cell stimulating factor-2 receptor, Human beta-chemokine H1305 (MCP-2), Human C-C chemokine DGWCC, Human CC chemokine ELC protein, Human CC type chemokine interleukin C, Human CCC3 protein, Human CCF18 chemokine, Human CC-type chemokine protein designated SLC (secondary lymphoid chemokine), Human chemokine beta-8 short forms, Human chemokine C10, Human chemokine CC-2, Human chemokine CC-3, Human chemokine CCR-2, Human chemokine Ckbeta-7, Human chemokine ENA-78, Human chemokine eotaxin, Human chemokine GRO alpha, Human chemokine GROalpha, Human chemokine GRObeta, Human chemokine HCC-1, Human chemokine HCC-1, Human chemokine 1-309, Human chemokine IP-10, Human chemokine L105_3, Human chemokine L105_7, Human chemokine MIG, Human chemokine MIG-beta protein, Human chemokine MIP-1alpha, Human chemokine MIP1beta, Human chemokine MIP-3alpha, Human chemokine MIP-3beta, Human chemokine PF4, Human chemokine protein 331D5, Human chemokine protein 61164, Human chemokine receptor CXCR3, Human chemokine SDF1alpha, Human chemokine SDF1beta, Human chemokine ZSIG-35, Human Chr19Kine protein, Human CKbeta-9, Human CKbeta-9, Human CX3C 111 amino acid chemokine, Human DNAX interleukin-40, Human DVic-1 C-C chemokine, Human EDIRF I protein sequence, Human EDIRF II protein sequence, Human eosinocyte CC type chemokine eotaxin, Human eosinophil-expressed chemokine (EEC), Human fast twitch skeletal muscle troponin C, Human fast twitch skeletal muscle troponin I, Human fast twitch skeletal muscle Troponin subunit C, Human fast twitch skeletal muscle Troponin subunit I Protein, Human fast twitch skeletal muscle Troponin subunit T, Human fast twitch skeletal muscle troponin T, Human foetal spleen expressed chemokine, FSEC, Human GM-CSF receptor, Human gro-alpha chemokine, Human gro-beta chemokine, Human gro-gamma chemokine, Human IL-16 protein, Human IL-1RD10 protein sequence, Human IL-1RD9, Human IL-5 receptor alpha chain, Human IL-6 receptor, Human IL-8 receptor protein hIL8RA, Human IL-8 receptor protein hIL8RB, Human IL-9 receptor protein, Human IL-9 receptor protein variant #3, Human IL-9 receptor protein variant fragment, Human IL-9 receptor protein variant fragment#3, Human interleukin 1 delta, Human Interleukin 10, Human Interleukin 10, Human interleukin 18, Human interleukin 18 derivatives, Human interleukin-1 beta precursor, Human interleukin-1 beta precursor, Human interleukin-1 receptor accessory protein, Human interleukin-1 receptor antagonist beta, Human interleukin-1 type-3 receptor, Human Interleukin-10 (precursor), Human Interleukin-10 (precursor), Human interleukin-11 receptor, Human interleukin-12 40 kD subunit, Human interleukin-12 beta-1 receptor, Human interleukin-12 beta-2 receptor, Human Interleukin-12 p35 protein, Human Interleukin-12 p40 protein, Human interleukin-12 receptor, Human interleukin-13 alpha receptor, Human interleukin-13 beta receptor, Human interleukin-15, Human interleukin-15 receptor from clone P1, Human interleukin-17 receptor, Human interleukin-18 protein (IL-18), Human interleukin-3, human interleukin-3 receptor, Human interleukin-3 variant, Human interleukin-4 receptor, Human interleukin-5, Human interleukin-6, Human interleukin-7, Human interleukin-7, Human interleukin-8 (IL-8), Human intracellular IL-1 receptor antagonist, Human IP-10 and HIV-1 gp120 hypervariable region fusion protein, Human IP-10 and human Muc-1 core epitope (VNT) fusion protein, human liver and activation regulated chemokine (LARC), Human Lkn-1 Full-Length and Mature protein, Human mammary associated chemokine (MACK) protein Full-Length and Mature, Human mature chemokine Ckbeta-7, Human mature gro-alpha, Human mature gro-gamma polypeptide used to treat sepsis, Human MCP-3 and human Muc-1 core epitope (VNT) fusion protein, Human MI10 protein, Human MI1A protein, Human monocyte chemoattractant factor hMCP-1, Human monocyte chemoattractant factor hMCP-3, Human monocyte chemotactic proprotein (MCPP) sequence, Human neurotactin chemokine like domain, Human non-ELR CXC chemokine H174, Human non-ELR CXC chemokine IP10, Human non-ELR CXC chemokine Mig, Human PAI-1 mutants, Human protein with IL-16 activity, Human protein with IL-16 activity, Human secondary lymphoid chemokine (SLC), Human SISD protein, Human STCP-1, Human stromal cell-derived chemokine, SDF-1, Human T cell mixed lymphocyte reaction expressed chemokine (TMEC), Human thymus and activation regulated cytokine (TARC), Human thymus expressed, Human TNF-alpha, Human TNF-alpha, Human TNF-beta (LT-alpha), Human type CC chemokine eotaxin 3 protein sequence, Human type II interleukin-1 receptor, Human wild-type interleukin-4 (hIL-4) protein, Human ZCHEMO-8 protein, Humanized Anti-VEGF Antibodies, and fragments thereof, Humanized Anti-VEGF Antibodies, and fragments thereof, Hyaluronidase, ICE 10 kD subunit, ICE 20 kD subunit, ICE 22 kD subunit, Iduronate-2-sulfatase, Iduronidase, IL-1 alpha, IL-1 beta, IL-1 inhibitor (IL-1i), IL-1 mature, IL-10 receptor, IL-11, IL-11, IL-12 p40 subunit, IL-13, IL-14, IL-15, IL-15 receptor, IL-17, IL-17 receptor, II-17 receptor, II-17 receptor, IL-19, IL-1i fragments, IL1-receptor antagonist, IL-21 (TIF), IL-3 containing fusion protein, IL-3 mutant proteins, IL-3 variants, IL-3 variants, IL-4, IL-4 mutein, IL-4 mutein Y124G, IL-4 mutein Y124X, IL-4 muteins, II-5 receptor, IL-6, II-6 receptor, IL-7 receptor clone, IL-8 receptor, IL-9 mature protein variant (Met117 version), immunoglobulins or immunoglobulin-based molecules or fragment of either (e.g. a Small Modular ImmunoPharmaceuticalTM(“SMIP”) or dAb, Fab′ fragments, F(ab′)2, scAb, scFv or scFv fragment), including but not limited to plasminogen, Influenza Vaccine, Inhibin alpha, Inhibin beta, insulin, insulin-like growth factor, Integrin Mab, inter-alpha trypsin inhibitor, inter-alpha trypsin inhibitor, Interferon gamma-inducible protein (IP-10), interferons (such as interferon alpha species and sub-species, interferon beta species and sub-species, interferon gamma species and sub-species), interferons (such as interferon alpha species and sub-species, interferon beta species and sub-species, interferon gamma species and sub-species), Interleukin 6, Interleukin 8 (IL-8) receptor, Interl eukin 8 receptor B, Interleukin-1alpha, Interleukin-2 receptor associated protein p43, interleukin-3, interleukin-4 muteins, Interleukin-8 (IL-8) protein, interleukin-9, Interleukin-9 (IL-9) mature protein (Thr117 version), interleukins (such as IL0, IL11 and IL2), interleukins (such as IL0, IL11 and IL2), Japanese encephalitis vaccine, Kalikrein Inhibitor, Keratinocyte growth factor, Kunitz domain protein (such as aprotinin, amyloid precursor protein and those described in WO 03 / 066824, with or without albumin fusions), Kunitz domain protein, protinin, amyloid precursor protein with or without albumin fusions, LACI, lactoferrin, Latent TGF-beta binding protein II, leptin, Liver expressed chemokine-1 (LVEC-1), Liver expressed chemokine-2 (LVEC-2), LT-alpha, LT-beta, Luteinization Hormone, Lyme Vaccine, Lymphotactin, Macrophage derived chemokine analogue MDC (n+1), Macrophage derived chemokine analogue MDC-eyfy, Macrophage derived chemokine analogue MDC-yl, Macrophage derived chemokine, MDC, Macrophage-derived chemokine (MDC), Maspin; Protease Inhibitor 5, MCP-1 receptor, MCP-1a, MCP-1b, MCP-3, MCP-4 receptor, M-CSF, Melanoma inhibiting protein, Membrane-bound proteins, Met117 human interleukin 9, MIP-3 alpha, MIP-3 beta, MIP-Gamma, MIRAP, Modified Rantes, monoclonal antibody, MP52, Mutant Interleukin 6 S176R, myofibrillar contractile protein Troponin I, Natriuretic Peptide, Nerve Growth Factor-beta, Nerve Growth Factor-beta2, Neuropilin-1, Neuropilin-2, Neurotactin, Neurotrophin-3, Neurotrophin-4, Neurotrophin-4a, Neurotrophin-4b, Neurotrophin-4c, Neurotrophin-4d, Neutrophil activating peptide-2 (NAP-2), NOGO-66 Receptor, NOGO-A, NOGO-B, NOGO-C, Novel beta-chemokine designated PTEC, N-terminal modified chemokine GroHEK / hSDF-1alpha, N-terminal modified chemokine GroHEK / hSDF-1beta, N-terminal modified chemokine met-hSDF-1 alpha, N-terminal modified chemokine met-hSDF-1 beta, OPGL, Osteogenic Protein-1; OP-1; BMP-7, Osteogenic Protein-2, OX40; ACT-4, OX40L, Oxytocin (Neurophysin I), parathyroid hormone, Patched, Patched-2, PDGF-D, Pertussis toxoid, Pituitary expressed chemokine (PGEC), Placental Growth Factor, Placental Growth Factor-2, Plasminogen Activator Inhibitor-1; PAI-1, Plasminogen Activator Inhibitor-2; PAI-2, Plasminogen Activator Inhibitor-2; PAI-2, Platelet derived growth factor, Platelet derived growth factor Bv-sis, Platelet derived growth factor precursor A, Platelet derived growth factor precursor B, Platelet Mab, platelet-derived endothelial cell growth factor (PD-ECGF), Platelet-Derived Growth Factor A chain, Platelet-Derived Growth Factor B chain, polypeptide used to treat sepsis, Preproapolipoprotein “milano” variant, Preproapolipoprotein “paris” variant, pre-thrombin, Primate CC chemokine “ILINCK”, Primate CXC chemokine “IBICK”, proinsulin, Prolactin, Prolactin2, prosaptide, Protease inhibitor peptides, Protein C, Protein S, pro-thrombin, prourokinase, RANTES, RANTES 8-68, RANTES 9-68, RANTES peptide, RANTES receptor, Recombinant interleukin-16, Resistin, restrictocin, Retroviral protease inhibitors, ricin, Rotavirus Vaccine, RSV Mab, saporin, sarcin, Secreted and Transmembrane polypeptides, Secreted and Transmembrane polypeptides, serum cholinesterase, serum protein, blood clotting factor, Soluble BMP Receptor Kinase Protein-3, Soluble VEGF Receptor, Stem Cell Inhibitory Factor, Straphylococcus Vaccine, Stromal Derived Factor-1 alpha, Stromal Derived Factor-1 beta, Substance P (tachykinin), T1249 peptide, T20 peptide, T4 Endonuclease, TACI, Tarc, TGF-beta 1, TGF-beta 2, Thr117 human interleukin 9, thrombin, thrombopoietin, Thrombopoietin derivative1, Thrombopoietin derivative2, Thrombopoietin derivative3, Thrombopoietin derivative4, Thrombopoietin derivative5, Thrombopoietin derivative6, Thrombopoietin derivative7, Thymus expressed chemokine (TECK), Thyroid stimulating Hormone, tick anticoagulant peptide, Tim-1 protein, TNF-alpha precursor, TNF-R, TNF-RII; TNF p75 Receptor; Death Receptor, tPA, transferrin, transforming growth factor beta, Troponin peptides, Truncated monocyte chemotactic protein 2 (6-76), Truncated monocyte chemotactic protein 2 (6-76), Truncated RANTES protein (3-68), tumour necrosis factor, Urate Oxidase, urokinase, Vasopressin (Neurophysin II), VEGF R-3; flt-4, VEGF Receptor; KDR; flk-1, VEGF-110, VEGF-121, VEGF-138, VEGF-145, VEGF-162, VEGF-165, VEGF-182, VEGF-189, VEGF-206, VEGF-D, VEGF-E; VEGF-X, von Willebrand's factor, Wild type monocyte chemotactic protein 2, Wild type monocyte chemotactic protein 2, ZTGF-beta 9, beta(T87Q)-globin, SMN1, chimeric antigen receptors, RPE65, F8, HGF, LPL, p53, apoe2, Arylsulfatase A, NAGLU, SGSH , AADC, GAD, GDNF, NRTN, LCAT, GBA, FGF-1, FGF-2, ADA, CLN2, CLN6, CLN3, IDS, Huntingtin, TRAIL, dystrophin, GALGT2, accA, IDUA, GLB1, FS344, SGCA, DYSF, ABCD1, Gigaxonin and functional fragments thereof.

[0107] The aptamers or polynucleotides of the present disclosure may be identified herein in the form of DNA or RNA. Unless otherwise specified, those skilled in the art will appreciate that an aptamer or a polynucleotide of the present disclosure may generally be synthesized in various forms of nucleic acid. The nucleic acids of the aptamers or polynucleotides of the present disclosure may also carry various chemical modifications. The modifications may include without limitation a chemical substitution at a sugar position; a chemical substitution at a phosphate position; and a chemical substitution at a base position of the nucleic acid. The aptamers or nucleotides carrying the modification remain within the scope of the aptamers or polynucleotides of the present disclosure. For example, the aptamer or polynucleotide according to the present disclosure may be one wherein a sugar residue (e.g., ribose) of each nucleotide has been modified (a modification to RNA will be described here, but description is appropriately read as a description for a modification to DNA). As examples of the modification in a sugar residue, substitution of hydroxyl group at the 2′-position, the 3′-position and / or 4′-position of the sugar residue with another atom, and the like can be mentioned. As the kind of the modification, fluorination, alkoxylation (e.g., methoxylation, ethoxylation), O-arylation, S-alkylation (e.g., S-methylation, S-ethylation), S-arylation, and amination (e.g., -NH2) can be mentioned. Such alterations in the sugar residue can be performed by known methods (see, for example, Sproat et al., Cotton et al., and Hobbs et al.)8-10. For example, the aptamers or polynucleotides may contain one or more nucleotides modified with 2′-amino (2′-NH2), 2′-fluoro (2′-F), 2′-methoxyethyl (2′-MOE) and / or 2′-O-methyl (2′-OMe) substituents, wherein such aptamers or nucleotides are more stable against degradation in vivo.

[0108] The sugar residue may also be BNA: Bridged nucleic acid (LNA: Linked nucleic acid, also known as “Locked Nucleic Acid”), wherein a crosslinking structure is formed at the 2′-position and the 4′-position. Such alteration of the sugar residue can also be performed by known methods (e.g., Obika et al., Hari et al., Rahman et al., and the like)11-13.

[0109] The polynucleotide according to the present disclosure may also have a nucleic acid base (e.g., purine or pyrimidine) altered (e.g., chemical substitution). As examples of such alterations, pyrimidine alteration at 5-position, purine alteration at 6- and / or 8-position(s), alteration with an extracyclic amine, substitution with 4-thiouridine, and substitution with 5-bromo or 5-iodo-uracil can be mentioned. Examples of altered (or modified) nucleotides include, e.g., 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-( carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-substituted adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthioN6- isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2- thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5- oxyacetic acid methylester, 3-(3-amino-3-N-2-carboxypropyl) uracil, and 2,6-diaminopurine. Another example of altered (or modified) nucleotides is a nucleotide based on morpholino nucleic acid having heterocyclic bases attached to the morpholino ring.

[0110] In addition, the phosphate group contained in the polynucleotide according to the present disclosure may be altered to confer resistance to nuclease and hydrolysis. For example, the P(O)O group as a phosphoric acid group may be substituted by P(O)S (thioate), P(S)S (dithioate), P(O)NR2(amidate), P(O)R, R(O)OR′, CO or CH2(formacetal) or 3′-amine (-NH-CH2-CH2-) [wherein each unit of R or R′ is independently H or a substituted or unsubstituted alkyl (e.g., methyl, ethyl)].

[0111] <Kit> The kit according to the present disclosure comprises the polynucleotide according to the present disclosure or a vector comprising the polynucleotide according to the present disclosure, and triamterene or a triamterene derivative. The polynucleotide according to the present disclosure can be used for regulating the activity of the target sequence in response to triamterene or a triamterene derivative.

[0112] The kit according to the present disclosure can be used to regulate any process in which RNA is involved. For example, in some embodiments, the kit according to the present disclosure is used to regulate expression of a protein. In some embodiments, the kit according to the present disclosure is used for gene editing. The kit according to the present disclosure can be used in any form, as long as the riboswitch can regulate the activity of the target sequence. In some embodiments, the kit according to the present disclosure may be used as a vaccine. In some embodiments, the kit according to the present disclosure may be used as a gene therapy drug.

[0113] In the present disclosure, the target sequence may encode a protein to be used for a therapy. In this case, the kit according to the present disclosure can be used for treating any diseases which the protein encoded by the target sequence would have a therapeutic effect on. Examples of such a protein encoded by the target sequence are mentioned above in the section describing the polynucleotide according to the present disclosure.

[0114] The kit according to the present disclosure may further comprise any components other than the polynucleotide according to the present disclosure or a vector comprising the polynucleotide according to the present disclosure, and triamterene or a triamterene derivative, if necessary.

[0115] <Use of kit or polynucleotide or aptamer> The kit, the polynucleotide and the aptamer according to the present disclosure can be used in a topical medicine. Such topical medicine can be selected from a group including an eye drop, a nasal drop, an ear drop, a plaster, a liniment (an ointment, a cream, a lotion, and the like), a suppository, an inhalant, and an oral medicine. Preferably, the topical medicine is either an ophthalmic medicine or an otolaryngological medicine.

[0116] <Method for using polynucleotide> The method for using the polynucleotide according to the present disclosure comprises (1) introducing the polynucleotide or a vector comprising the polynucleotide into a cell, and (2) bringing triamterene or a triamterene derivative into contact with the polynucleotide or the vector. The present method can regulate the activity of the target sequence on the polynucleotide according to the present disclosure in a cell such that the activity is regulated only when the polynucleotide or the vector is in contact with triamterene or a triamterene derivative.

[0117] In the method for using the polynucleotide according to the present disclosure, the concentration of triamterene or a triamterene derivative in a cell culture medium is preferably 100μM or less, more preferably 50μM or less, and further preferably 10μM or less.

[0118] The method for using the polynucleotide according to the present disclosure may be used to regulate any process in which RNA is involved, and thus may be used for various purposes. For example, in some embodiments, the method according to the present disclosure may be a method for cell therapy. In some embodiments, the method according to the present disclosure may be a method for inducing cell differentiation. In some embodiments, the method according to the present disclosure may be a method for producing biologics.

[0119] In a case where the method according to the present disclosure is a method for cell therapy, the method according to the present disclosure may comprise (2’) administering triamterene or a triamterene derivative to a subject who has received a gene therapy to introduce the polynucleotide according to the present disclosure. Since the present method is applied to a subject who has received a gene therapy to introduce the polynucleotide according to the present disclosure, the step of (1) introducing the polynucleotide or a vector comprising the polynucleotide into a subject is optional.

[0120] In the method according to the present disclosure, the polynucleotide according to the present disclosure or a vector comprising the polynucleotide according to the present disclosure are introduced into a subject, for example, into a cell of specific tissues or organs of the subject by using a known method in the art, for example, by using a known viral vector system or a nonviral vector system. The known introduction methods of polynucleotides or vectors can be used for the present method. The cell specificity may be controlled, for example, by promoter or other elements within a vector.

[0121] The delivery of the polynucleotide or vector comprising the polynucleotide and the delivery of the ligand, i.e., triamterene or a triamterene derivative, generally are separated in time. The delivery of the ligand will control the timing of the regulation of the target sequence, as well as the level of the activity of the target sequence. The ligand may be delivered by a number of routes including, but not limited to, oral, intramuscular (IM), intravenous (IV), intraocular, or topically.

[0122] The method according to the present disclosure may also be a method for regulating expression of a protein. In the present disclosure, expression of proteins encoded by the target sequence can be upregulated or downregulated in response to the presence or absence of triamterene or a triamterene derivative. Examples of such a protein encoded by the target sequence are mentioned above in the section of the polynucleotide according to the present disclosure.

[0123] In the method for regulating expression of a protein according to the present disclosure, an ON / OFF ratio of the expression of the protein is preferably more than 2, more preferably more than 5, and further preferably more than 10.

[0124] The method according to the present disclosure may further comprise any additional process, if necessary.

[0125] In the gene therapy of the present disclosure, the disease to be treated may be selected from the group consisting of, but not limited to, severe combined immunodeficiency (SCID), β-thalassemia, sickle cell disease, hemophilia A, hemophilia B, Duchenne muscular dystrophy, cystic fibrosis, Leber congenital amaurosis, retinitis pigmentosa, Stargardt disease, choroideremia, age-related macular degeneration, glaucoma, spinal muscular atrophy, Huntington’s disease, Parkinson’s disease, Alzheimer’s disease, amyotrophic lateral sclerosis, HIV / AIDS, various cancers including leukemia, lymphoma, and glioblastoma, and other monogenic or acquired disorders amenable to correction by gene transfer or editing.

[0126] <Use of triamterene or a triamterene derivative> Use of triamterene or a triamterene derivative according to the present disclosure is use of triamterene or a triamterene derivative in the regulation of protein expression. The expression of a protein may be regulated with a composition comprising triamterene or a triamterene derivative. The composition comprising triamterene or a triamterene derivative may be in the form of an oral solid dosage form such as a tablet, a capsule or a powder or in the form of an ocular formulation such as an implant, an injection, a solution, a suspension or an ointment. The composition may be administered systemically. The composition may be in the form of topical medicine and may be administered at the site where the RNA aptamer, vector, or polypeptide according to the present disclosure has been administered previously.Examples

[0127] <Materials and methods> 1. Aptamer selection (SELEX) 1.1 Oligonucleotides, molecular biology and buffer reagents Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB) and Q5 High-Fidelity 2× Master Mix (NEB) were used for PCR in SELEX rounds and NGS sequencing library preparation, respectively. Reverse transcription reactions were performed using Maxima H Minus Reverse Transcriptase (Thermo Scientific) with N26-hp-N26_iD4_Rv (Table 1). HiScribe T7 High Yield RNA Synthesis Kit (NEB) and ScriptMAX(R) Thermo T7 Transcription Kit (TOYOBO) were used for in vitro transcription of the initial RNA pool (300 μl scale) and the SELEX rounds (1st-3rdround; 100 μl scale, 4th-10thround; 60 μl scale), respectively. SELEX buffer contained 10 mM HEPES-KOH (pH 7.5), 140 mM KCl, 10 mM NaCl, 1 mM MgCl2,5% (v / v) DMSO, and 0.01 % (v / v) Tween 20. Only in the case of elution, the buffer was supplemented with 1 mM triamterene.

[0128] a and bN indicates mixture of A, C, G and T (25% each).c and dUsed for PCR during SELEX rounds.dUsed for reverse transcription.

[0129] 1.2 Immobilization of triamterene on agarose beads An ethynyl-modified triamterene derivative (FIG. 2) was provided by Astellas Inc. DMSO (2.92 ml), H2O (1.8 ml), 50 mM compound 2 in DMSO (80 μl, 4 μmol), 200 mM phosphate buffer (pH 7.4, 0.6 ml), freshly prepared 1 mM CuSO4 / 5 mM Tris(benzyltriazolylmethyl)amine (THPTA) solution (0.3 ml), and 100 mM sodium ascorbate solution (0.3 ml) were mixed in a test tube. To the solution, 2 ml of Azide-Agarose (Kerafast) that was pre-equilibrated with H2O was added and incubated at room temperature for 1 h in the dark. The agarose beads were washed with water, and the solution containing the following components were added to mask the unreacted azide groups: H2O (3.88 ml), 17.2 M propargyl alcohol (17.4 μl, 300 μmol), 200 mM phosphate buffer (pH 7.4, 1.5 ml), 1 mM CuSO4 / 5 mM THPTA solution (0.3 ml), 100 mM sodium ascorbate solution (0.3 ml). The agarose beads were incubated for 1 h in the dark, rinsed with H2O and 50% ethanol. The triamterene-immobilized beads were stored in 50% ethanol at -20 °C.

[0130] 1.3 Aptamer selection (SELEX) Overlap extensions of N26-hp-N26-lib_iD1_Fw (2 nmol) and N26-hp-N26-lib_iD4_Rv (2 nmol; ~ 1.2×1015unique sequences) (Table 1) were performed in 400 μl volume with Q5 High-Fidelity 2× Master Mix (NEB) for 30 s at 98 ℃, [10 s at 98 ℃, 20 s at 64 ℃, 10 s at 72 ℃]×3, and 2 min at 72 ℃. Subsequently, the dsDNA was recovered by ethanol precipitation. The dsDNA containing a T7 promoter (233 μg, ~ 2.95 nmol) was in vitro transcribed in 300 μl volume for 4 h at 37°C using HiScribe T7 High Yield RNA Synthesis Kit (NEB). The solution was treated with 34 μl of 10× TURBO DNase buffer, 3 μl of TURBO DNase (6 U, Invitrogen), and 3 μl of Exonuclease I (60 U, NEB) for 30 min at 37°C. The RNA pool was recovered by RNA Clean & Concentrator kit-25 (ZYMO RESEARCH) to be used as the initial RNA pool for SELEX (sequence of the RNA library is shown in Table 1).

[0131] The initial RNA pool (173.7 μg, ~ 5 nmol) was folded in 2.5ml SELEX buffer (10 mM HEPES-KOH pH 7.5, 140 mM KCl, 10 mM NaCl, 1 mM MgCl2,5% (v / v) DMSO, 0.01 % (v / v) Tween 20) by incubating at 80 °C for 3 min followed by cooling on ice. The annealed RNA library pool was incubated with 200 μl of the ligand-coupled Azide Agarose (Kerafast) sepharose matrix in a column (PD-10, Cyriva) for 45 min at 25 °C (Table 2). Subsequently, the unbound RNAs were removed from the column by gravity. The matrix was washed with SELEX buffer twice (1 + 0.4 ml), and the bound RNA sequences were recovered by adding 0.2 ml SELEX buffer supplemented with Triamterene (1 mM) for 30 min at 25℃. The elution was repeated one more time. The eluted RNAs were ethanol precipitated using Quick-Precip Plus Solution (EdgeBio). The amount of recovered RNAs after each round was measured by UV absorbance using NanoDrop One. However, the measured amounts never exceeded 1% of the input RNA which were too dilute to be accurately quantified. The RNA pool then was then reverse transcribed with N26-hp-N26_iD4_Rv (Table 1) using Maxima H Minus Reverse Transcriptase (Thermo Scientific) and amplified by PCR with N26-hp-N26_iD1_Fw and N26-hp-N26_iD4_Rv (Table 1) using Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB). The PCR product purified by DNA Clean & Concentrator kit-25 was used as a template for in vitro transcription using ScriptMAX(R) Thermo T7 Transcription Kit (TOYOBO), treated with TURBO DNase (Invitrogen) and Exonuclease I (NEB), and purified by RNA Clean & Concentrator kit-25 (ZYMO RESEARCH) to produce the RNA pool for the next round of SELEX. In the subsequent rounds of SELEX, various parameters such as the amount of input RNA pool, temperature, volume of washing buffer, elution time, etc. were altered to adjust the stringency of selection (Table 2). From the 3rd round, negative selection was performed by incubating the input RNA pool with acetyl-capped matrix (60-200 μl) prior to incubation with the ligand-immobilized matrix to select against sequences that have affinity to the gel matrix (Table 2). The temperature (during incubation, washing, and elution) was raised to 37 °C during the rounds 7 through 10. The volume of washing buffer (1.4-4.8 ml) and washing time (10 min to 80 min) were also increased (Table 2). The RNA pools generated after the rounds 10 were used to prepare libraries for deep sequencing analysis. The RNAs from the 10th round were reverse transcribed PCR (with adapter sequences) amplified to prepare sequencing template which were analyzed using MiSeq Reagent Micro Kit v2 (Illumina). As a result, Trm1 [5’-GGAGGCGCCAACTGAATGAAGCTGGCCCTCCCCTTACTAAGACATGTATTGCTTCGGCAGTGAAGGTGCCGCTGCCGAGGTACAACCTGTGTCTCAGTCAGGCCATCT -3’] (in DNA) (SEQ ID NO 6) (see FIG. 3) was selected for further analysis due to its strong affinity to triamterene.

[0132]

[0133] 2. SPR measurements SPR affinity measurements were performed as described previously in Fukunaga et al1. Briefly, the RNA aptamers with a 24×A tail were synthesized by in vitro transcription from synthetic oligonucleotide templates. The 24×A-tailed aptamer was captured on a Biacore chip with immobilized 24×T oligo DNA. Triamterene or its analog was applied as an analyte to measure the binding and dissociation kinetics using Biacore T200 (Cytiva). Sequences of aptamer and its mutants analyze by SPR are shown in Table 3.

[0134]

[0135] 3. Riboswitch plasmid design and construction Aptazyme sequences shown in Fig 21 were cloned into the 3’ UTR of the EGFP mRNA encoded in pEGFP-BsaI-Amp (FIG. 23). The sequences of aptazyme-based riboswitches are presented in Table 4. An exon-skipping riboswitch cassette was inserted between the 169th and 170th codons in the EGFP coding sequence in pEGFP-BsaI-Amp. The sequences of exon-skipping riboswitches are listed in Table 5. pEGFP-BsaI-Amp was used as an “empty vector” control in the transfection experiments.

[0136]

[0137]

[0138] 4. Riboswitch assay in HEK293 cells HEK293 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% heat-inactivated FBS (Gibco) containing 2 mM L-glutamine and 100 units ml-1of penicillin-streptomycin (DMEM-FBS). Cells were kept in a 37 °C incubator with 5% CO2and passaged regularly upon reaching 90% confluency. Approximately 20 h prior to transfection, the cells were trypsinized, diluted to ~2.7 × 105cells ml-1and 100 μl per well were seeded onto a 96-well plate. Cells in each well were cotransfected with 100 ng of the EGFP-aptazyme plasmid and 20 ng of pmCherry-BsaI-Amp (transfection control) using 0.3 μl of TransIT-293 Transfection Reagent (Mirus) according to the manufacturer’s instructions. Five hours after transfection, the medium in each well was replaced with fresh medium with (up to 20 μM) or without triamterene. Triamterene was dissolved at 1000× concentration in DMSO. Forty-eight hours after transfection, the medium in each well was replaced with 100 μl of phosphate buffered saline (PBS), and fluorescence intensity was measured by Infinite M1000 PRO microplate reader (Tecan). Fluorescence intensity was measured at 484 nm excitation / 510 nm emission / 5 nm bandwidth for EGFP, and at 587 nm excitation / 610 nm emission / 10 nm bandwidth for mCherry. Background fluorescence measured using untransfected cells was subtracted from the EGFP and mCherry fluorescence values. Then, EGFP fluorescence was normalized by mCherry fluorescence to account for variations in transfection efficiency and cell counts. All reported values are averages of three replicate wells.

[0139] <Results> 1. Aptamer selection (SELEX) RNA aptamers that bind to triamterene were discovered by SELEX. To immobilize triamterene on agarose beads, an ethynyl derivative of triamterene was synthesized by Astellas, Inc (FIG. 2). The compound was coupled to azide-modified agarose beads via Cu-catalyzed click chemistry. Standard SELEX using an RNA library containing 52 randomized nucleotides were executed as detailed in Methods. After 10 rounds of selection, the enriched sequences were analyzed by high-throughput sequencing, and Trm1 was found to be the most abundant sequence in the selected RNA sequences (FIG. 3).

[0140] 2. Aptamer characterization and minimization Trm1 was synthesized by in vitro transcription using a synthetic DNA template. Binding of Trm1 to triamterene was first confirmed by isothermal titration calorimetry (ITC) which showed a dissociation constant (KD) of 56 nM. After secondary structure prediction by NUPACK (see Zadeh et al.14), focus was turned to a potential core binding motif within Trm1 as depicted in FIG. 3. Based on this hypothesis, a shorter aptamer Trm1y1 (FIG. 6) was designed, which showed a KDof 27.6 nM as measured by surface plasmon resonance (SPR). A circularly-permuted variant Trm1y5x (FIG. 6) yielded a KDof 23.5 nM. Therefore, these results confirm the hypothesis of the core binding motif. Upon further exploration, it was found that the replacement of an A-U pair with a G-C pair (Trm1y10x) results in a modest improvement in KD(10.4 nM) (FIG. 6). The above KDvalues for triamterene were obtained through SPR. In FIG. 7, the vertical axis stands for resonance unit (RU) while the horizontal axis stands for time in seconds. As shown in the legends on the right of the graphs, samples diluted in seven concentrations are tested. In the graphs, data plots and corresponding approximation curves are shown. Based on such data set, the KDvalues were obtained.

[0141] 3. Mutational analysis of Trm1y10x To identify the nucleotides in Trm1y10x that are essential for triamterene binding, some of the sequences were mutated and analyzed for binding (FIG. 8). Mutations of A18G, G6C, G6U, U7C, U7G, and mutations of C19, C20, A8 and U9 to any other bases resulted in complete loss of binding. Other mutants (C16A, C16G, C16U, A17C, A17G, A17U, A18C, A18U, U21A, U21G, U21C, G22A, U5C, G6A, and U7A) showed decreased or similar binding affinities compared to Trm1y10x. Collectively, these results lead to the core binding motif depicted in FIG. 10. The KDvalues for triamterene shown in FIG. 8 were obtained through SPR. In FIGS. 9A to 9E, the vertical axis stands for resonance unit (RU) while the horizontal axis stands for time in seconds. As shown in the legends on the right of the graphs, samples diluted in six concentrations are tested. In the graphs, data plots and corresponding approximation curves are shown. Based on such data set, the KDvalues were obtained.

[0142] 4. Aptazyme-based riboswitches To demonstrate that Trm1y10x can bind triamterene in mammalian cells, the aptamer was inserted into a circularly-permuted pistol (CPP) ribozyme as shown in FIG. 11. This ribozyme was previously used to construct riboswitches that respond to guanine, tetracycline, and ASP2905 / ASP7967 by inserting the cognate aptamer (Fukunaga et al., and Mustafina et al.)1, 15. Trm1y10x-CPP aptazymes were designed following the same strategy by fusing the aptamer along with an “anti-Rz” sequence that is designed to interfere with the ribozyme structure upon ligand binding (FIG. 11). The aptazyme was inserted into the 3’ UTR of an EGFP expression plasmid (pEGFP-BsaI-Amp). Consequently, in the absence of triamterene, ribozyme is active, mRNA is cleaved, and EGFP expression is suppressed. In the presence of triamterene, ribozyme cleavage is inhibited, mRNA is more stable, and EGFP expression is activated.

[0143] Two of the optimized riboswitches (pEGFP-a8-Trm1y10x-CPP and pEGFP-a8s4-Trm1y10x-CPP) were cotransfected with a control plasmid that expresses mCherry (pmCherry-BsaI-Amp) into HEK293 cells. The cells were cultured in the presence (10 μM) or absence (0 μM) of triamterene and incubated for about 48 h. Cellular fluorescence (EGFP and mCherry) were measured. EGFP fluorescence was normalized to that of mCherry to calculate riboswitch performance. As expected, both switches showed activation of EGFP expression in the presence of triamterene (3.8- and 6.0-fold, FIG. 12). On the other hand, the “Empty” plasmid (pEGFP-BsaI-Amp) which does not contain Trm1y10x did not respond to triamterene.

[0144] 5. Exon-skipping riboswitches To demonstrate Trm1y10x function in additional contexts, riboswitches that control exon skipping by triamterene were designed. As described in Boyne et al. and Fukunaga et al.16, 1, Trm1y10x aptamer was placed immediately downstream of the suicide exon that contains a premature stop codon (FIG. 13). In the absence of triamterene, the suicide exon is included and EGFP expression is suppressed. Aptamer-triamterene binding sequesters the 5’ splice site of the second intron which induces skipping of the suicide exon and results in EGFP expression (FIG. 13).

[0145] FIG. 14 shows the sequence and structure of the Trm1y10x aptamer and the splice site junction. FIG. 15 shows EGFP expression from the plasmids containing the riboswitches in response to triamterene (pEGFP-ex169-Trm1y10x-a8i+1 and pEGFP-ex169-Trm1y10x-a9p). As expected, the riboswitches activate gene expression (up to 138- and 416-fold) as the concentration of triamterene increases up to ~20 μM.

[0146] 6. Exon-skipping riboswitches: aptamer-in-exon design An RNA aptamer can also be embedded within the suicide exon to regulate exon skipping by a small molecule, as demonstrated by Finke et al. and Vogel et al.17, 18Trm1y10x was placed in the suicide exon while the basal stem of the aptamer was designed to block the 5’ splice site downstream of the exon (FIGS. 16 and 17). Riboswitch constructs pEGFP-ex-Trm1y10x-5ss11 and pEGFP-ex-Trm1y10x-5ss15 activate gene expression (up to 38.8- and 20.4-fold) in response to increased concentration of triamterene up to ~20 μM (FIG. 18).

[0147] 7. Trm1y10x binding to triamterene derivatives Trm1 was selected using the immobilized triamterene analog (FIG. 2) through a triazole linkage on the phenyl group. Since the immobilized part of the ligand is less accessible for the aptamer for binding during SELEX, it was examined whether this part of the molecule is essential for binding. Triamterene derivatives were synthesized (FIG. 19) with various substitutions at this position in triamterene. All these compounds exhibited detectable affinity although the KDvalues varied. Consequently, triamterene derivatives with alternative functional groups in place of the phenyl moiety can be potential ligands to Trm1y10x and can possibly function as inducers of the riboswitches based on Trm1y10x.

[0148] REFERENCES 1. Fukunaga, K., Dhamodharan V., Miyahira N., Nomura Y., Mustafina K., Oosumi Y.,Takayama K., Kanai A., and Yokobayashi Y. Small-Molecule Aptamer for Regulating RNA Functions in Mammalian Cells and Animals. Journal of the American Chemical Society 145, 7820-7828 (2023). https: / / doi.org / 10.1021 / jacs.2c12332. 2. Debiais M, Lelievre A, Smietana M, Muller S. Splitting aptamers and nucleic acid enzymes for the development of advanced biosensors. Nucleic Acids Res. 2020 Apr 17;48(7):3400-3422. doi: 10.1093 / nar / gkaa132. PMID: 32112111; PMCID: PMC7144939. 3. Stojanovic MN, de Prada P, Landry DW. Fluorescent Sensors Based on Aptamer Self-Assembly. J Am Chem Soc. 2000 Nov 22;122(46):11547-11548. doi: 10.1021 / ja0022223. PMID: 29048887. 4. Kolpashchikov DM. Binary malachite green aptamer for fluorescent detection of nucleic acids. J Am Chem Soc. 2005 Sep 14;127(36):12442-3. doi: 10.1021 / ja0529788. PMID: 16144363. 5. Alam KK, Tawiah KD, Lichte MF, Porciani D, Burke DH. A Fluorescent Split Aptamer for Visualizing RNA-RNA Assembly In Vivo. ACS Synth Biol. 2017 Sep 15;6(9):1710-1721. doi: 10.1021 / acssynbio.7b00059. Epub 2017 May 26. PMID: 28548488; PMCID: PMC5603824. 6. Kikuchi N, Kolpashchikov DM. Split Spinach Aptamer for Highly Selective Recognition of DNA and RNA at Ambient Temperatures. Chembiochem. 2016 Sep 2;17(17):1589-92. doi: 10.1002 / cbic.201600323. Epub 2016 Jul 15. PMID: 27305425; PMCID: PMC5198575. 7. Nayerossadat N., Maedeh T., Ali PA. Viral and nonviral delivery systems for gene delivery. Adv Biomed Res. 2012;1:27. doi: 10.4103 / 2277-9175.98152. Epub 2012 Jul 6. PMID: 23210086; PMCID: PMC3507026. 8. Sproat BS, Iribarre AM, Garcia RG, Beijer B., New synthetic routes to synthons suitable for 2′-O-allyloligoribonucleotide assembly, Nucleic Acids Research, 19(4) 733-738, Feb 25 1991, https: / / doi.org / 10.1093 / nar / 19.4.733 9. Cotten M., Oberhauser B., Brunar H., Holzner A., Issakides G., Noe CR, Schaffner G., Wagner E., Birnstiel ML, 2′-O-methyl, 2′-O-ethyl oligoribonucleotides and phosphorothioate oligodeoxyribonucleotides as inhibitors of the in vitro U7 snRNP-dependent mRNA processing event. Nucleic Acids Research, 19(10) 2629-2635, May 11 1991, https: / / doi.org / 10.1093 / nar / 19.10.2629. 10. Hobbs J., Sternbach H., Sprinzl M., Eckstein F., Polynucleotides containing 2'-amino-2'-deoxyribose and 2'-azido-2'-deoxyribose. Biochemistry 12(25) 5138-5145, Dec 1, 1973. https: / / doi.org / 10.1021 / bi00749a018. 11. Obika S., Nanbu D., Hari Y., Morio K., In Y, Ishida T., Imanishi T. Synthesis of 2′-O,4′-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C3, -endo sugar puckering. Tetrahedron Letters, 1997. 38(50) 8735-8738, https: / / doi.org / 10.1016 / S0040-4039(97)10322-7. 12. Hari Y., Obika S., Sekiguchi M., Imanishi T. Selective recognition of CG interruption by 2′,4′-BNA having 1-isoquinolone as a nucleobase in a pyrimidine motif triplex formation. Tetrahedron. 2003. 59(27) 5123-5128, https: / / doi.org / 10.1016 / S0040-4020(03)00728-2. 13. Rahman S. M. A., Seki S., Obika S., Yoshikawa H., Miyashita K., Imanishi T. Design, Synthesis, and Properties of 2’,4’-BNANC: A Bridged Nucleic Acid Analogue. J. Am. Chem. Soc., 130, 4886-4896 (2008) https: / / doi.org / 10.1021 / ja710342q 14. Zadeh JN, Steenberg CD, Bois JS, Wolfe BR, Pierce, MB, Khan AR, Dirks RM, Pierce NA. (2011). NUPACK: Analysis and design of nucleic acid systems. Journal of computational chemistry, 32(1), 170-173. 15. Mustafina, K., Nomura, Y., Rotrattanadumrong, R. & Yokobayashi, Y. Circularly-Permuted Pistol Ribozyme: A Synthetic Ribozyme Scaffold for Mammalian Riboswitches. ACS Synth Biol 10, 2040-2048 (2021). 16. Boyne, A.R., Danos, F.O., Volles, J.M. & Guo, X. Regulation of gene expression by aptamer-mediated modulation of alternative splicing. WO / 2016 / 126747 (2016). 17. Finke M., Brecht D., Stifel J., Gense K., Gamerdinger M., & Hartig JS. (2021). Efficient splicing-based RNA regulators for tetracycline-inducible gene expression in human cell culture and C. elegans. Nucleic Acids Research, 49(12), e71-e71. 18. Vogel M., Weigand JE, Kluge B, Grez M., & Suess B. (2018). A small, portable RNA device for the control of exon skipping in mammalian cells. Nucleic acids research, 46(8), e48-e48.

Claims

1. An RNA aptamer that is bindable to triamterene or a triamterene derivative, comprising an RNA fragment F1comprising a sequence X1-Y1-X3, and an RNA fragment F2comprising a sequence X4-Y2-X2, wherein Y1is a first core sequence and has the sequence PQRCCS, P, Q and S are independently selected from A, C, G and U, and R is selected from A, C and U, Y2is a second core sequence and has the sequence VWAU, V is selected from A and G, and W is selected from A and U, X1is a first stem region sequence, X2is a sequence that is substantially complementary to X1, X3is a second stem region sequence, X4is a sequence that is substantially complementary to X3, and wherein X1and X3complementarily bind to X2, and X4, respectively, and form a first double-stranded stem structure S1and a second double-stranded stem structure S2.

2. The RNA aptamer according to claim 1, wherein R or S is C.

3. The RNA aptamer according to claim 1 or 2, wherein X1is 2 base pairs or more and 50 base pairs or fewer in length, and X3is 2 base pairs or more and 50 base pairs or fewer in length.

4. The RNA aptamer according to any one of claims 1 to 3, wherein the RNA aptamer consists of 18 bases or more and 100 bases or fewer.

5. The RNA aptamer according to any one of claims 1 to 4, wherein the RNA aptamer has a dissociation constant for triamterene or a triamterene derivative of 10 μM or less.

6. The RNA aptamer according to any one of claims 1 to 5, wherein the RNA aptamer has a dissociation constant for triamterene or a triamterene derivative of 10 pM or more.

7. The RNA aptamer according to any one of claims 1 to 6, wherein the RNA aptamer is bindable to a triamterene derivative that is a compound having a monovalent substituent at the 6-position of triamterene.

8. One or more RNA fragments that are able to form at least a part of the RNA aptamer according to any one of claims 1 to 7.

9. A vector comprising the RNA aptamer according to any one of claims 1 to 7, or a DNA sequence corresponding to the RNA aptamer according to any one of claims 1 to 7.

10. A vector comprising the one or more RNA fragments according to claim 8, or one or more DNA sequences corresponding to the one or more RNA fragments according to claim 8.

11. An mRNA comprising the RNA aptamer according to any one of claims 1 to 7.

12. A riboswitch comprising the RNA aptamer according to any one of claims 1 to 7.

13. A vector comprising the riboswitch according to claim 12, or a DNA sequence corresponding to the riboswitch according to claim 12.

14. The riboswitch according to claim 12, further comprising a ribozyme.

15. The riboswitch according to claim 14, wherein the ribozyme is a self-cleaving ribozyme.

16. A polynucleotide comprising: a riboswitch comprising an RNA aptamer that is bindable to triamterene or a triamterene derivative, and a target sequence encoding a protein, wherein the riboswitch is operably linked to the target sequence such that expression of the protein is upregulated or downregulated in response to the binding of triamterene or a triamterene derivative to the RNA aptamer.

17. The polynucleotide according to claim 16, wherein the target sequence comprises a plurality of exons.

18. The polynucleotide according to claim 16 or 17, wherein the target sequence comprises an alternatively-spliced exon, flanked by a 5' intron and a 3' intron, wherein the normal function of the protein is inhibited when the alternatively-spliced exon is spliced into an mRNA of the protein.

19. The polynucleotide according to claim 18, wherein the riboswitch is comprised within the alternatively-spliced exon.

20. A kit comprising the polynucleotide according to any one of claims 16 to 19 or a vector comprising the polynucleotide according to any one of claims 16 to 19, and triamterene or a triamterene derivative.

21. Use of the kit according to claim 20 to regulate expression of a protein.

22. Use of the kit according to claim 20 for gene editing.

23. Use of the kit according to any one of claims 20 to 22 in a vaccine.

24. Use of the kit according to any one of claims 20 to 22 in a gene therapy drug.

25. A method for using the polynucleotide according to any one of claims 16 to 19, comprising introducing the polynucleotide or a vector comprising the polynucleotide into a cell, and bringing triamterene or a triamterene derivative into contact with the polynucleotide or the vector.

26. The method according to claim 25, wherein the concentration of triamterene or a triamterene derivative in a cell culture medium is 100 μM or less.

27. The method according to claim 25 or 26, wherein the method is a method for cell therapy.

28. The method according to claim 27, wherein the method for cell therapy comprises administering triamterene or a triamterene derivative to a subject who has received a gene therapy to introduce the polynucleotide according to any one of claims 16 to 19.

29. The method according to any one of claims 25 to 28, wherein the method is a method for inducing cell differentiation.

30. The method according to any one of claims 25 to 29, wherein the method is a method for producing biologics.

31. The method according to any one of claims 25 to 30, wherein the method is a method for regulating expression of a protein.

32. The method for regulating expression of a protein according to claim 31, wherein an ON / OFF ratio of the expression of the protein is more than 2.

Images