Drought tolerance via manipulation of heterotrimeric g proteins

Abstract

The present disclosure relates to plants comprising a hypomorphic allele of an endogenous G protein alpha subunit gene that confers to the plant tolerance to drought conditions. Also disclosed are related methods of using the hypomorphic allele to increase drought tolerance of a plant and to improve yield and harvest index under both well-watered and drought conditions.

Description

Agent Ref. No. P14945WO00 TITLE: DROUGHT TOLERANCE VIA MANIPULATION OF HETEROTRIMERIC G PROTEINS CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to provisional application U.S. Serial No.63 / 692,588, filed September 9, 2024, which is incorporated herein by reference in its entirety. GOVERNMENT SUPPORT

[0002] This invention was made with government support under Grant No.2019-67013-29234 awarded by the United States Department of Agriculture / NIFA. The Government has certain rights in the invention. SEQUENCE LISTING XML

[0003] The instant application contains a sequence listing, which has been submitted in XML file format by electronic submission and is hereby incorporated by reference in its entirety. The XML file, created on September 8, 2025, is named P14945WO00.xml and is 267,364 bytes in size. TECHNICAL FIELD

[0004] The present disclosure relates to compositions and methods for identifying, selecting, and producing plants with increased drought tolerance. BACKGROUND

[0005] Rice is a major crop in regions of the southern US and California. Globally, rice is the staple food for about half the world’s population. Drought is a major factor affecting rice yields worldwide. One estimate is that more than 3000 liters of water are needed to produce one kilogram of rice seed, approximately double the needs of other crops. Rice is grown in diverse environments, with about 39% of the growing area solely rainfed and so particularly drought susceptible. Drought reduces rice yield by adversely affecting rice development at both vegetative and reproductive stages, influencing meiosis, pollen development, and grain filling, causing reduced fertility and smaller seeds. As drought becomes more frequent and intense due to changing climate patterns and rising temperatures, sustainability of rice production will require cultivars with increased drought tolerance and decreased demand for water. Globally, crop productivity needs to increase by 60% by 2050 to feed the world, while anthropogenicAgent Ref. No. P14945WO00 demand for water will increase by 55% over the same timeframe. The demand for rice is projected to increase by 25% by 2030, emphasizing the need for increased yield. SUMMARY

[0006] RICE G PROTEIN ALPHA 1 (RGA1), a canonical Gα subunit, is essential for regulating plant architecture and mediating responses to diverse environmental stresses. The null mutant of RGA1, known as the d1 mutant, exhibits desirable traits such as dwarf stature and erect leaves that contribute to drought tolerance. However, the d1 mutant also exhibits undesirable traits like reduced and compact panicles that lead to yield penalties. The present disclosure is based at least in part on the discovery that hypomorphic alleles of RGA1 yield better and have improved harvest index under both well-watered and drought conditions.

[0007] Rice plants having in their genome an introgressed genetic locus comprising a hypomorphic allele of the endogenous RGA1 gene conferring drought tolerance are provided. Progeny plants, plant parts, plant cells, seeds, and asexual propagates of the rice plants of the disclosure are also provided.

[0008] Methods of introgressing a genetic locus conferring drought tolerance to a rice plant are provided. In certain embodiments, the methods comprise providing a first rice plant with the genetic locus, wherein the genetic locus comprises a hypomorphic allele of the endogenous RGA1 gene; providing a second rice plant; crossing the first rice plant with the second rice plant to produce a population of progeny rice plants; and selecting from the population at least one progeny rice plant having the genetic locus.

[0009] Modified plants having drought tolerance comprising a hypomorphic allele of an endogenous G protein alpha subunit (Gα) gene are provided. Progeny plants, plant parts, plant cells, seeds, and asexual propagates of the modified plants of the disclosure are provided. Methods for producing a plant having drought tolerance comprising modifying the plant to comprise a hypomorphic allele of an endogenous Gα gene are also provided.

[0010] Crops comprising a plurality of the plants of the disclosure planted together in an agricultural field are provided. Methods of producing a plant part from a crop comprising cultivating a plurality of the plants of the disclosure as a crop and harvesting the plant part from the plants are also provided. In certain embodiments, the plant part is a fruit, tuber, leaf, stalk, root, or seed.

[0011] Methods of producing seeds from a crop comprising cultivating a plurality of the plants of the disclosure as a crop and harvesting seeds from the crop are also provided.

[0012] Commodity plant products prepared from the aforementioned plants, plant parts, and plant cells are provided. Methods for producing a commodity plant product comprisingAgent Ref. No. P14945WO00 processing the aforementioned plants or plant parts thereof to obtain the product are also provided.

[0013] Methods of identifying or selecting a plant comprising a drought tolerance locus are provided. In certain embodiments, the methods comprise genotyping at least one plant for the presence of a hypomorphic allele of an endogenous Gα gene or a marker in linkage disequilibrium therewith. Kits for detecting the presence or absence of a hypomorphic allele of the endogenous Gα gene are also provided.

[0014] While multiple embodiments are disclosed, still other embodiments of the present disclosure will become apparent based on the detailed description, which shows and describes illustrative embodiments of the disclosure. Accordingly, the figures and detailed description are to be regarded as illustrative in nature and not restrictive. BRIEF DESCRIPTION OF THE FIGURES

[0015] The following drawings form part of the specification and are included to further demonstrate certain embodiments. In some instances, embodiments can be best understood by referring to the accompanying figures in combination with the detailed description presented herein. The description and accompanying figures may highlight a certain specific example, or a certain embodiment. However, one skilled in the art will understand that portions of the example or embodiment may be used in combination with other examples or embodiments.

[0016] FIG.1A-B shows RGA1 gene structure and allele distribution. FIG.1A shows the structure of the RGA1 gene and the positions of the single nucleotide polymorphisms (SNPs) for the major and minor RGA1 alleles are illustrated. The figure shows for each SNP the change going from the unfavorable to the favorable variant. Key features include arrow – promoter; light grey boxes – UTRs; dark grey boxes – exons; black lines – introns. FIG.1B shows the distribution of RGA1 alleles across the rice 3K diversity panel.

[0017] FIG.2A-O shows phenotypic comparisons of RGA1 allele cultivars under well-watered conditions. FIG.2A is an image displaying RGA1 allele cultivars under well-watered conditions. FIG.2B-O shows phenotypic comparisons between cultivars of RGA1 major and RGA1 minor alleles. Statistical significance levels (Student’s t-test and chi-square test) are indicated as follows: *, p < 0.05; **, p < 0.01; ***, p < 0.001, ****, p< 0.0001.

[0018] FIG.3A-F shows grain traits and field performance parameters of RGA1 allele cultivars under well-watered conditions. FIG.3A shows grain length. FIG.3B shows grain width. FIG. 3C shows sphericity index. FIG.3D shows yield. FIG.3E shows dry shoot biomass. FIG.3F shows harvest index. Statistical significance levels (Student’s t-test) are indicated as follows: *, p < 0.05; **, p < 0.01; ***, p < 0.001, ****, p < 0.0001.Agent Ref. No. P14945WO00

[0019] FIG.4A-K shows phenotypic comparisons of RGA1 allele cultivars under drought- stressed conditions. FIG.4A is an image displaying RGA1 allele cultivars under drought- stressed conditions. FIG.4B-K shows phenotypic comparisons between cultivars of RGA1 alleles. Statistical significance levels (Student’s t-test) are indicated as follows: *, p < 0.05; **, p < 0.01; ***, p < 0.001, ****, p < 0.0001.

[0020] FIG.5A-F shows grain traits and field performance parameters of RGA1 allele cultivars under drought-stressed conditions. FIG.5A shows grain length. FIG.5B shows grain width. FIG.5C shows sphericity index. FIG.5D shows yield. FIG.5E shows dry shoot biomass. FIG. 5F shows harvest index. Statistical significance levels (Student’s t-test) are indicated as follows: *, p < 0.05; **, p < 0.01; ***, p < 0.001, ****, p < 0.0001.

[0021] FIG.6 shows RGA1 expression analysis of RGA1 allele cultivars under well-watered conditions. Transcript abundance (fold change) of RGA1 allele cultivars determined by quantitative reverse transcription polymerase chain reaction (qRT-PCR). Data are presented as mean values ± standard error of the mean from three technical replicates and three biological replicates from ten representative cultivars of RGA1 major and eight representative cultivars of RGA1 minor alleles. Statistical significance levels (Student’s t-test) are indicated as follows: *, p < 0.05; **, p < 0.01; ***, p < 0.001, ****, p < 0.0001. DETAILED DESCRIPTION

[0022] So that the present disclosure may be more readily understood, certain terms are first defined. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which embodiments of the disclosure pertain. Many methods and materials similar, modified, or equivalent to those described herein can be used in the practice of the embodiments of the present disclosure without undue experimentation, the preferred materials and methods are described herein. In describing and claiming the embodiments of the present disclosure, the following terminology will be used in accordance with the definitions set out below.

[0023] It is to be understood that all terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting in any manner or scope. For example, as used in this specification and the appended claims, the singular forms "a," "an" and "the" can include plural referents unless the content clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicates otherwise. The word “or” means any one member of a particular list and also includes any combination of members of that list. Further, all units, prefixes, and symbols may be denoted in its SI accepted form.Agent Ref. No. P14945WO00

[0024] Numeric ranges recited within the specification are inclusive of the numbers defining the range and include each integer within the defined range. Throughout this disclosure, various embodiments of this disclosure are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges, fractions, and individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6, and decimals and fractions, for example, 1.2, 3.8, 1½, and 4¾. This applies regardless of the breadth of the range.

[0025] As used herein, the term “allele” refers to one of two or more different nucleotides or nucleotide sequences that occur at a specific locus.

[0026] A marker is “associated with” a trait when it is linked to it and when the presence of the marker is an indicator of whether and / or to what extent the desired trait or trait form will occur in a plant / germplasm comprising the marker. Similarly, a marker is “associated with” an allele when it is linked to it and when the presence of the marker is an indicator of whether the allele is present in a plant / germplasm comprising the marker. For example, “a marker associated with drought tolerance” refers to a marker whose presence or absence can be used to predict whether and / or to what extent a plant will display a drought tolerance phenotype.

[0027] As used herein, the terms “backcross” and “backcrossing” refer to the process whereby a progeny plant is repeatedly crossed back to one of its parents. In a backcrossing scheme, the “donor” parent refers to the parental plant with the desired gene or locus to be introgressed. The “recipient” parent (used one or more times) or “recurrent” parent (used two or more times) refers to the parental plant into which the gene or locus is being introgressed. For example, see Ragot, M. et al. Marker-assisted Backcrossing: A Practical Example, in TECHNIQUES ET UTILISATIONS DES MARQUEURS MOLECULAIRES LES COLLOQUES, Vol.72, pp.45- 56 (1995); and Openshaw et al., Marker-assisted Selection in Backcross Breeding, in PROCEEDINGS OF THE SYMPOSIUM “ANALYSIS OF MOLECULAR MARKER DATA,” pp.41-53 (1994). The initial cross gives rise to the F1 generation. The term “BC1” refers to the second use of the recurrent parent, “BC2” refers to the third use of the recurrent parent, and so on.

[0028] As used herein, the phrase “biological sample” refers to either intact or non-intact (e.g., milled seed or plant tissue, chopped plant tissue, lyophilized tissue) plant tissue. It may also be an extract comprising intact or non-intact seed or plant tissue. The biological sample canAgent Ref. No. P14945WO00 comprise flour, meal, flakes, syrup, oil, starch, and cereals manufactured in whole or in part to contain crop plant by-products. In certain embodiments, the biological sample is “non- regenerable” (i.e., incapable of being regenerated into a plant or plant part).

[0029] As used herein, the terms “correspond,” “corresponding,” and the like, when used in the context of a nucleotide position, mutation, and / or substitution in any given polynucleotide with respect to the reference polynucleotide sequence (e.g., SEQ ID NO: 1) all refer to the position of the nucleotide in the given sequence that has identity to the nucleotide in the reference nucleotide sequence when the given polynucleotide is aligned to the reference polynucleotide sequence using a pairwise alignment algorithm (e.g., CLUSTAL O 1.2.4 with default parameters).

[0030] A centimorgan (“cM”) is a unit of measure of recombination frequency. One cM is equal to a 1% chance that a marker at one genetic locus will be separated from a marker at a second locus due to crossing over in a single generation.

[0031] As used herein, the terms “cross” or “crossed” refer to the fusion of gametes via pollination to produce progeny (e.g., cells, seeds or plants). The term encompasses both sexual crosses (the pollination of one plant by another) and selfing (self-pollination, e.g., when the pollen and ovule are from the same plant). The term “crossing” refers to the act of fusing gametes via pollination to produce progeny.

[0032] As used herein, the terms “desired allele”, “favorable allele” and “allele of interest” are used interchangeably to refer to an allele associated with a desired trait (e.g., increased drought tolerance).

[0033] As used herein “drought conditions” refers to a period of dryness (acute or chronic / prolonged) that results in water deficit and subjects plants to stress and / or damage to plant tissues and / or negatively affects grain / crop yield.

[0034] An “elite line” or “elite strain” is an agronomically superior line that has resulted from many cycles of breeding and selection for superior agronomic performance. Numerous elite lines are available and known to those of skill in the art of plant breeding. An “elite population” is an assortment of elite individuals or lines that can be used to represent the state of the art in terms of agronomically superior genotypes of a given crop species, such as rice. Similarly, an “elite germplasm” or elite strain of germplasm is an agronomically superior germplasm, typically derived from and / or capable of giving rise to a plant with superior agronomic performance, such as an existing or newly developed elite line of rice. An “elite” plant is any plant from an elite line, such that an elite plant is a representative plant from an elite variety.

[0035] As used herein, the phrase “endogenous gene” refers to the native form of a gene unit in its natural location in the genome of an organism.Agent Ref. No. P14945WO00

[0036] The term “expression”, as used herein, generally refers to the production of a functional end-product e.g., an mRNA or a protein (precursor or mature).

[0037] As used herein, “gene” includes a nucleic acid fragment that expresses a functional molecule such as, but not limited to, a specific protein coding sequence and regulatory elements, such as those preceding (5’ non-coding sequences) and following (3’ non-coding sequences) the coding sequence.

[0038] As used herein, a “genetic map” is a description of genetic linkage relationships among loci on one or more chromosomes within a given species, generally depicted in a diagrammatic or tabular form. For each genetic map, distances between loci are measured by the recombination frequencies between them. Recombination events between loci can be detected using a variety of markers. A genetic map is a product of the mapping population, types of markers used, and the polymorphic potential of each marker between different populations. The order and genetic distances between loci can differ from one genetic map to another.

[0039] A “genetic locus” as used herein generally refers to the location on a chromosome of the plant where a gene, such as a polynucleotide encoding a G protein alpha subunit is found.

[0040] As used herein, the term “genotype” refers to the genetic constitution of an individual (or group of individuals) at one or more genetic loci, as contrasted with the observable and / or detectable and / or manifested trait (the phenotype). Genotype is defined by the allele(s) of one or more known loci that the individual has inherited from its parents. The term genotype can be used to refer to an individual's genetic constitution at a single locus, at multiple loci, or more generally, the term genotype can be used to refer to an individual's genetic make-up for all the genes in its genome. Genotypes can be indirectly characterized, e.g., using markers and / or directly characterized by nucleic acid sequencing.

[0041] As used herein, the term “germplasm” refers to genetic material of or from an individual (e.g., a plant), a group of individuals (e.g., a plant line, variety or family), or a clone derived from a line, variety, species, or culture. The germplasm can be part of an organism or cell, or can be separate from the organism or cell. In general, germplasm provides genetic material with a specific molecular makeup that provides a physical foundation for some or all of the hereditary qualities of an organism or cell culture. As used herein, germplasm may refer to seeds, cells (including protoplasts and calli) or tissues from which new plants may be grown, as well as plant parts that can be cultured into a whole plant (e.g., stems, buds, roots, leaves, etc.).

[0042] As used herein, “heterologous” in reference to a sequence is a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and / or genomic locus by deliberate human intervention. For example, a promoter operably linked to a heterologous polynucleotide is from a species different from theAgent Ref. No. P14945WO00 species from which the polynucleotide was derived, or, if from the same / analogous species, one or both are substantially modified from their original form and / or genomic locus, or the promoter is not the native promoter for the operably linked polynucleotide.

[0043] As used herein, the term “hybrid” refers to a seed and / or plant produced when at least two genetically dissimilar parents are crossed.

[0044] As used herein, a “hypomorphic allele” refers to an allele that results in a partial loss of gene function, but not a complete loss of function (i.e., it is not a null allele). A partial loss of gene function may occur through, for example, reduced gene expression, increased mRNA degradation, altered splicing, reduced translation, decreased protein abundance or stability, mislocalization, or reduced activity.

[0045] As used herein, the term “inbred” refers to a substantially homozygous plant or variety. The term may refer to a plant or variety that is substantially homozygous throughout the entire genome or that is substantially homozygous with respect to a portion of the genome that is of particular interest.

[0046] As used herein, the terms “include,” “includes,” and “including” are to be construed as at least having the features to which they refer while not excluding any additional unspecified features.

[0047] As used herein, the terms “introduced” and “introducing” mean providing a nucleic acid or protein into a cell. Introduced includes reference to the incorporation of a nucleic acid into a eukaryotic or prokaryotic cell where the nucleic acid may be incorporated into the genome of the cell and includes reference to the transient provision of a nucleic acid or protein to the cell. Introduced includes reference to stable or transient transformation methods.

[0048] As used herein, the terms “introgression,” “introgressing” and “introgressed” refer to both the natural and artificial transmission of a desired allele or combination of desired alleles of a genetic locus or genetic loci from one genetic background to another. For example, a desired allele at a specified locus can be transmitted to at least one progeny via a sexual cross between two parents of the same species, where at least one of the parents has the desired allele in its genome. Alternatively, for example, transmission of an allele can occur by recombination between two donor genomes, e.g., in a fused protoplast, where at least one of the donor protoplasts has the desired allele in its genome. The desired allele may be a selected allele of a marker, a QTL, a transgene, or the like. Offspring comprising the desired allele can be repeatedly backcrossed to a line having a desired genetic background and selected for the desired allele, with the result being that the desired allele becomes fixed in the desired genetic background.Agent Ref. No. P14945WO00

[0049] As used herein, an “isolated” nucleic acid molecule is substantially separated away from other nucleic acid sequences with which the nucleic acid is normally associated, such as, from the chromosomal or extrachromosomal DNA or transcriptome of a cell in which the nucleic acid naturally occurs. The term also embraces nucleic acids (e.g., DNA or RNA) that are biochemically purified so as to substantially remove contaminating nucleic acids and other cellular components.

[0050] As used herein, a “landrace” refers to a local variety of a domesticated plant species which has developed largely by natural processes, by adaptation to the natural and cultural environment in which it lives. The development of a landrace may also involve some selection by humans but it differs from a formal breed, which has been selectively bred deliberately to conform to a particular formal, purebred standard of traits.

[0051] The phrase “marker-assisted selection”, as used herein, refers to the diagnostic process of identifying, optionally followed by selecting a plant from a group of plants using the presence of a molecular marker as the diagnostic characteristic or selection criterion. The process usually involves detecting the presence of a certain nucleic acid sequence or polymorphism in the genome of a plant.

[0052] The phrase “molecular marker”, as used herein, refers to an indicator that is used in methods for visualizing differences in characteristics of nucleic acid sequences. Examples of such indicators are restriction fragment length polymorphism (RFLP) markers, amplified fragment length polymorphism (AFLP) markers, single nucleotide polymorphisms (SNPs), microsatellite markers (e.g. SSRs), sequence-characterized amplified region (SCAR) markers, Next Generation Sequencing (NGS) of a molecular marker, cleaved amplified polymorphic sequence (CAPS) markers or isozyme markers or combinations of the markers described herein which defines a specific genetic and chromosomal location.

[0053] As used herein, “modified”, in the context of plants, seeds, plant components, plant cells, and plant genomes, refers to a state containing changes or variations from their natural or native state. For instance, a “native transcript” of a gene refers to an RNA transcript that is generated from an unmodified gene. Typically, a native transcript is a sense transcript. Modified plants or seeds contain molecular changes in their genetic materials, including either genetic or epigenetic modifications. Typically, modified plants or seeds, or a parental or progenitor line thereof, have been subjected to mutagenesis, genome editing (e.g., without being limiting, via methods using site-specific nucleases), genetic transformation (e.g., without being limiting, via methods of Agrobacterium transformation or microprojectile bombardment), or a combination thereof. In certain embodiments, a modified plant provided herein comprises no non-plant genetic materialAgent Ref. No. P14945WO00 or sequences. In certain embodiments, a modified plant provided herein comprises no interspecies genetic material or sequences.

[0054] A “non-naturally occurring variety” is any variety that does not naturally exist in nature. A “non-naturally occurring variety” may be produced by any method known in the art, including, but not limited to, transforming a plant or germplasm, transfecting a plant or germplasm and crossing a naturally occurring variety with a non-naturally occurring variety. In certain embodiments, a “non-naturally occurring variety” may comprise one or more heterologous nucleotide sequences. In certain embodiments, a “non-naturally occurring variety” may comprise one or more non-naturally occurring copies of a naturally occurring nucleotide sequence (i.e., extraneous copies of a gene that naturally occurs in the plant). In certain embodiments, a “non-naturally occurring variety” may comprise a non-natural combination of two or more naturally occurring nucleotide sequences (i.e., two or more naturally occurring genes that do not naturally occur in the same plant).

[0055] As used herein, the terms “nucleic acid,” “nucleic acid molecule,” “nucleotide sequence” and “polynucleotide” can be used interchangeably and encompass both RNA and DNA, including cDNA, genomic DNA, mRNA, synthetic (e.g., chemically synthesized) DNA or RNA and chimeras of RNA and DNA. The term polynucleotide, nucleotide sequence, or nucleic acid refers to a chain of nucleotides without regard to length of the chain. The nucleic acid can be double-stranded or single-stranded. Where single-stranded, the nucleic acid can be a sense strand or an antisense strand. The nucleic acid can be synthesized using oligonucleotide analogs or derivatives (e.g., inosine or phosphorothioate nucleotides). Such oligonucleotides can be used, for example, to prepare nucleic acids that have altered base-pairing abilities or increased resistance to nucleases. The present disclosure further provides a nucleic acid that is the complement (which can be either a full complement or a partial complement) of a nucleic acid, nucleotide sequence, or polynucleotide.

[0056] By “operably linked” or “operably associated,” it is meant that the indicated elements are functionally related to each other, and are also generally physically related. Thus, the term “operably linked” or “operably associated” as used herein, refers to nucleotide sequences on a single nucleic acid molecule that are functionally associated. Therefore, a first nucleotide sequence that is operably linked to a second nucleotide sequence means a situation when the first nucleotide sequence is placed in a functional relationship with the second nucleotide sequence. For instance, a promoter is operably associated with a nucleotide sequence if the promoter effects the transcription or expression of the nucleotide sequence. Those skilled in the art will appreciate that the control sequences (e.g., promoter) need not be contiguous with the nucleotide sequence to which it is operably associated, as long as the control sequences functionAgent Ref. No. P14945WO00 to direct the expression thereof. Thus, for example, intervening untranslated, yet transcribed, sequences can be present between a promoter and a nucleotide sequence, and the promoter can still be considered “operably linked” to the nucleotide sequence.

[0057] As used herein, “plant” refers to a whole plant, any part thereof, or a cell or tissue culture derived from a plant, comprising any of: whole plants, plant components or organs (e.g., leaves, stems, roots, etc.), plant tissues, seeds, plant cells, and / or progeny of the same. A progeny plant can be from any filial generation, e.g., F1, F2, F3, F4, F5, F6, F7, etc. A plant cell is a biological cell of a plant, taken from a plant or derived through culture from a cell taken from a plant.

[0058] The term “primer” as used herein encompasses any nucleic acid that is capable of priming the synthesis of a nascent nucleic acid in a template-dependent process, such as PCR. Typically, primers are oligonucleotides from 10 to 30 nucleotides in length, but longer sequences may be used. Primers may be provided in single or double-stranded form. Probes may be used as primers, but are designed to bind to the target DNA or RNA and need not be used in an amplification process.

[0059] As used herein, the terms “progeny” and “progeny plant” refer to a plant generated from a vegetative or sexual reproduction from one or more parent plants. A progeny plant may be obtained by cloning or selfing a single parent plant, or by crossing two parental plants.

[0060] A “promoter” is an untranslated DNA sequence upstream of a coding region that contains the binding site for RNA polymerase and initiates transcription of the DNA. A “promoter region” can also include other elements that act as regulators of gene expression. Promoters can include, for example, constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-preferred and tissue-specific promoters for use in the preparation of recombinant nucleic acid molecules.

[0061] The terms “polypeptide,” “peptide” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.

[0062] “Regulatory elements” refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory elements may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences. Regulatory elements present on a recombinant DNA construct that is introduced into a cell can be endogenous to the cell, or they can be heterologous with respect to the cell. The terms "regulatory element" and "regulatory sequence" are used interchangeably herein.Agent Ref. No. P14945WO00

[0063] The terms “selfed,” “selfing,” and “self,” as used herein, refer to any process used to obtain progeny from the same plant or plant line as well as to plants resulting from the process. As used herein, the terms thus include any fertilization process wherein both the ovule and pollen are from the same plant or plant line and plants resulting therefrom. Typically, the terms refer to self-pollination processes and progeny plants resulting from self-pollination.

[0064] The term “selecting”, as used herein, refers to a process of picking out a certain individual plant from a group of individuals, usually based on a certain identity, trait, characteristic, and / or molecular marker of that individual. G Protein Alpha Subunit (Gα) Genes

[0065] Heterotrimeric G proteins, known as G proteins, are composed of three core subunits, Gα, Gβ, and Gγ, and are essential for transmitting extracellular signals to downstream effectors. Gα genes are provided that are associated with increased drought tolerance and improved yield (e.g., seed yield) of plants. Such Gα sequences include the amino acid sequences set forth in SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, and 48. Also provided are polynucleotide sequences encoding such amino acid sequences, including SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, and 47. In certain embodiments, the Gα gene is RICE G PROTEIN ALPHA 1 (RGA1).

[0066] Examples of Gα genes of the disclosure are summarized in Table 1.

[0067] TABLE 1 Crop GeneGenomicAmino Acid SequenceSequenceAgent Ref. No. P14945WO00 Potato (Solanum tuberosum)PGSC0003DMT400033821 SEQ ID NO: 33 SEQ ID NO: 34Tomato (SolanumPA1 l 122 21 E ID N E ID N 6mino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% sequence identity to the full length or a fragment of the amino acid sequence of SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, or 48. In certain embodiments, the Gα gene comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% sequence identity to the full length or a fragment of the nucleotide sequence of SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, or 47.

[0069] Sequence alignments and percent identity calculations may be determined using a variety of comparison methods designed to detect similar or identical sequences including, but not limited to, the Megalign®program of the LASERGENE®bioinformatics computing suite (DNASTAR®Inc., Madison, Wis.). For example, multiple alignment of the sequences may be performed using the Clustal V method of alignment (Higgins and Sharp (1989) CABIOS.5:151- 153) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments and calculation of percent identity of protein sequences using the Clustal V method are KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. For nucleic acids these parameters are KTUPLE=2, GAP PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4. After alignment of the sequences, using the Clustal V program, it is possible to obtain “percent identity” and “divergence” values by viewing the “sequence distances” table on the same program; unless stated otherwise, percent identities and divergences provided and claimed herein were calculated in this manner.

[0070] Alternatively, the Clustal W method of alignment may be used. The Clustal W method of alignment (described by Higgins and Sharp, CABIOS.5:151-153 (1989); Higgins, D. G. et al., Comput. Appl. Biosci.8:189-191 (1992)) can be found in the MegAlign™ v6.1 program of theAgent Ref. No. P14945WO00 LASERGENE®bioinformatics computing suite (DNASTAR®Inc., Madison, Wis.). Default parameters for multiple alignment correspond to GAP PENALTY=10, GAP LENGTH PENALTY=0.2, Delay Divergent Sequences=30%, DNA Transition Weight=0.5, Protein Weight Matrix=Gonnet Series, DNA Weight Matrix=IUB. Foralignments the default parameters are Alignment=Slow-Accurate, Gap Penalty=10.0, Gap Length=0.10, Protein Weight Matrix=Gonnet 250 and DNA Weight Matrix=IUB. After alignment of the sequences using the Clustal W program, it is possible to obtain “percent identity” and “divergence” values by viewing the “sequence distances” table in the same program. In certain embodiments, the % sequence identity is determined over the entire length of the molecule (nucleotide or amino acid).

[0071] Sequences that are homologous, i.e., that share significant sequence identity or similarity, to those provided herein are also part of the present disclosure. Homologous sequences can be derived from any plant including monocots and dicots and in particular agriculturally important plant species. In addition, homologous sequences may be derived from plants that are evolutionarily related to crop plants, but which may not have yet been used as crop plants.

[0072] Homologous sequences can comprise orthologous, paralogous, or homeologous sequences. Several different methods are known by those of skill in the art for identifying and defining these functionally homologous sequences. An ortholog, paralog, or homeolog may be identified by one or more of the methods described below. Orthologs, paralogs, and homeologs are evolutionarily related genes that have similar sequence and similar functions. Orthologs are structurally related genes in different species that are derived by a speciation event. Paralogs are structurally related genes within a single species that are derived by a duplication event. Homeologs are genes within a polyploid species that originated by speciation and were brought back together in the same genome by allopolyploidization.

[0073] Within a single plant species, gene duplication may result in two copies of a particular gene, giving rise to two or more genes with similar sequence and often similar function known as paralogs. A paralog is therefore a similar gene formed by duplication within the same species. Paralogs typically cluster together or in the same clade (a group of similar genes) when a gene family phylogeny is analyzed using programs such as CLUSTAL (Thompson et al. (1994) Nucleic Acids Res.22: 4673-4680; Higgins et al. (1996) Methods Enzymol.266: 383-402). Groups of similar genes can also be identified with pair-wise BLAST analysis (Feng and Doolittle (1987) J. Mol. Evol.25: 351-360).

[0074] Analysis of groups of similar genes with similar function that fall within one clade can yield sub-sequences that are particular to the clade. These sub-sequences, known as consensusAgent Ref. No. P14945WO00 sequences, can not only be used to define the sequences within each clade, but define the functions of these genes; genes within a clade may contain paralogous sequences, or orthologous sequences that share the same function (see also, for example, Mount (2001), in Bioinformatics: Sequence and Genome Analysis Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., page 543.)

[0075] Speciation, the production of new species from a parental species, can also give rise to two or more genes with similar sequence and similar function. These genes, termed orthologs, often have an identical function within their host plants and are often interchangeable between species without losing function. Because plants have common ancestors, many genes in any plant species will have a corresponding orthologous gene in another plant species. Once a phylogenic tree for a gene family of one species has been constructed using a program such as CLUSTAL (Thompson et al. (1994) Nucleic Acids Res.22: 4673-4680; Higgins et al. (1996) supra) potential orthologous sequences can be placed into the phylogenetic tree and their relationship to genes from the species of interest can be determined. Orthologous sequences can also be identified by a reciprocal BLAST strategy. Once an orthologous sequence has been identified, the function of the ortholog can be deduced from the identified function of the reference sequence.

[0076] Orthologous genes from different organisms have highly conserved functions, and very often essentially identical functions (Lee et al. (2002) Genome Res.12: 493-502; Remm et al. (2001) J. Mol. Biol.314: 1041-1052). Paralogous genes, which have diverged through gene duplication, may retain similar functions of the encoded proteins. In such cases, paralogs can be used interchangeably with respect to certain embodiments of the present disclosure (for example, transgenic expression of a coding sequence).

[0077] Those skilled in the art may also find further candidate Gα genes based on genome synteny and sequence similarity. In certain embodiments, additional gene candidates can be obtained by hybridization or PCR using sequences based on the Gα nucleotide or amino acid sequences disclosed herein.

[0078] In a PCR approach, oligonucleotide primers can be designed for use in PCR reactions to amplify corresponding DNA sequences from cDNA or genomic DNA extracted from any plant of interest. Methods for designing PCR primers and PCR cloning are generally known in the art. See, for example, Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.). See also Innis et al., eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies (Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR Methods Manual (Academic Press, New York).Agent Ref. No. P14945WO00

[0079] In hybridization techniques, all or part of a known polynucleotide is used as a probe that selectively hybridizes to other corresponding polynucleotides present in a population of cloned genomic DNA fragments or cDNA fragments (i.e., genomic or cDNA libraries) from a chosen organism. The hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labeled with a detectable group such as32P, or any other detectable marker. Methods for preparation of probes for hybridization and for construction of cDNA and genomic libraries are generally known in the art and are disclosed in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.).

[0080] By “hybridizing to” or “hybridizing specifically to” refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA. “Bind(s) substantially” refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target nucleic acid sequence.

[0081] “Stringent hybridization conditions” and “stringent hybridization wash conditions” in the context of nucleic acid hybridization experiments such as Southern and Northern hybridizations are sequence dependent, and are different under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes part I chapter 2 “Overview of principles of hybridization and the strategy of nucleic acid probe assays” Elsevier, New York. Generally, highly stringent hybridization and wash conditions are selected to be about 5 °C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. Typically, under “stringent conditions” a probe will hybridize to its target subsequence, but to no other sequences.

[0082] The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Very stringent conditions are selected to be equal to the Tm for a particular probe. An example of stringent hybridization conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or northern blot is 50% formamide with 1 mg of heparin at 42 °C, with the hybridization being carried out overnight. An example of highly stringent wash conditions is 0.15M NaCl at 72 °C for about 15 minutes. An example of stringent wash conditions is a 0.2×SSC wash at 65 °C for 15 minutes (see, Sambrook, infra, for a description ofAgent Ref. No. P14945WO00 SSC buffer). Often, a high stringency wash is preceded by a low stringency wash to remove background probe signal. An example medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is 1×SSC at 45 °C for 15 minutes. An example low stringency wash for a duplex of, e.g., more than 100 nucleotides, is 4-6×SSC at 40 °C for 15 minutes. For short probes (e.g., about 10 to 50 nucleotides), stringent conditions typically involve salt concentrations of less than about 1.0 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 30 °C Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. In general, a signal to noise ratio of 2× (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins that they encode are substantially identical. This occurs, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.

[0083] The following are examples of sets of hybridization / wash conditions that may be used to clone nucleotide sequences that are homologues of reference nucleotide sequences: a reference nucleotide sequence preferably hybridizes to the reference nucleotide sequence in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50 °C with washing in 2×SSC, 0.1% SDS at 50 °C, more desirably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50 °C with washing in 1×SSC, 0.1% SDS at 50 °C, more desirably still in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50 °C with washing in 0.5×SSC, 0.1% SDS at 50 °C, preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50 °C with washing in 0.1×SSC, 0.1% SDS at 50 °C, more preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50 °C with washing in 0.1×SSC, 0.1% SDS at 65 °C. Plants with Drought Tolerance

[0084] Several embodiments of the disclosure relate to hypomorphic alleles of an endogenous Gα gene (e.g., RGA1) that confer drought tolerance in a plant. In certain embodiments, the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, an A at position 4668, or any combination thereof, wherein the position numbering corresponds to SEQ ID NO: 1. In certain embodiments, the hypomorphic allele comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 nucleotide polymorphisms selected from a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334,Agent Ref. No. P14945WO00 an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, an A at position 4668, or any combination thereof, wherein the position numbering corresponds to SEQ ID NO: 1.

[0085] The minor, favorable and major, unfavorable alleles of the RGA1 gene and the nucleotide polymorphism positions therein are summarized in Table 2. It will be understood that in homologous Gα genes (e.g., orthologs and paralogs including SEQ ID NOs: 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, and 47) positions corresponding to those numbered with respect to SEQ ID NO: 1 can be identified by sequence alignment to SEQ ID NO: 1, and polymorphisms at such corresponding positions are encompassed within the scope of the present disclosure.

[0086] TABLE 2 Position Relative to SEQ RGA1 ID NO: 1 (Minor, Minor, Major, (Chromosome favorable allele) or SEQ Favorable Unfavorable

[0087] In certain embodiments, the hypomorphic allele reduces expression of the endogenous Gα gene relative to a wild-type or control plant lacking the hypomorphic allele. In certain embodiments, the hypomorphic allele reduces expression of the gene by at least 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% relative to aAgent Ref. No. P14945WO00 wild-type or control plant lacking the hypomorphic allele. In certain embodiments, the hypomorphic allele reduces expression of the gene by about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, or 49% to about 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% relative to a wild-type or control plant lacking the hypomorphic allele.

[0088] In certain embodiments, the drought tolerance of a plant comprising a hypomorphic allele of an endogenous Gα gene is increased in comparison to the drought tolerance of a wild- type or control plant lacking the hypomorphic allele. “Drought tolerance” refers to the degree to which a plant is adapted to drought conditions. The physiological responses of plants to a deficit of water include leaf wilting, a reduction in leaf area, leaf abscission, and the stimulation of root growth by directing nutrients to the underground parts of the plants. As used herein “increased drought tolerance” refers to the ability of plants to grow, develop, or yield normally, or to grow, develop, or yield faster or better than normal when subjected to reduced amounts of available / applied water and / or under conditions of acute or chronic drought.

[0089] In certain embodiments, the yield of a plant comprising a hypomorphic allele of the endogenous Gα gene is increased in comparison to the yield of a wild-type or control plant lacking the hypomorphic allele. In certain embodiments, the yield is increased by at least about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12%, 15%, 18%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or 100% in comparison to the yield of the corresponding wild-type or control plant lacking the hypomorphic allele. In certain embodiments, the yield is increased when the plant comprising a hypomorphic allele of the endogenous Gα gene is grown under drought conditions in comparison to yield for a wild-type or control plant lacking the hypomorphic allele grown under drought conditions. In certain embodiments, the yield is increased when the plant comprising a hypomorphic allele of the endogenous Gα gene is grown under well-watered conditions in comparison to yield for a wild-type or control plant lacking the hypomorphic allele grown under well-watered conditions.

[0090] Several embodiments relate to plant cells, plant tissues, plants, and seeds having drought tolerance. Plants may be monocots or dicots, and may include, for example, rice, wheat, barley, oats, rye, sorghum, maize, grape, tomato, potato, lettuce, broccoli, cucumber, peanut, melon, pepper, carrot, squash, onion, soybean, alfalfa, sunflower, cotton, canola, sugarcane, and sugar beet plants.Agent Ref. No. P14945WO00

[0091] Plants that are useful in the methods of the present disclosure include all plants which belong to the superfamily Viridiplantae, in particular monocotyledonous and dicotyledonous plants including fodder or forage legumes, ornamental plants, food crops, trees or shrubs selected from the list comprising Acer spp., Actinidia spp., Abelmoschus spp., Agave sisalana, Agropyron spp., Agrostis stolonifera, Allium spp., Amaranthus spp., Ammophila arenaria, Ananas comosus, Annona spp., Apium graveolens, Arachis spp, Artocarpus spp., Asparagus officinalis, Avena spp. (e.g. Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. sativa, Avena hybrida), Averrhoa carambola, Bambusa sp., Benincasa hispida, Bertholletia excelsea, Beta vulgaris, Brassica spp. (e.g. Brassica napus, Brassica rapa [canola, oilseed rape, turnip rape]), Cadaba farinosa, Camellia sinensis, Canna indica, Cannabis sativa, Capsicum spp., Carex elata, Carica papaya, Carissa macrocarpa, Carya spp., Carthamus tinctorius, Castanea spp., Ceiba pentandra, Cichorium endivia, Cinnamomum spp., Citrullus lanatus, Citrus spp., Cocos spp., Coffea spp., Colocasia esculenta, Cola spp., Corchorus sp., Coriandrum sativum, Corylus spp., Crataegus spp., Crocus sativus, Cucurbita spp., Cucumis spp., Cynara spp., Daucus carota, Desmodium spp., Dimocarpus longan, Dioscorea spp., Diospyros spp., Echinochloa spp., Elaeis (e.g. Elaeis guineensis, Elaeis oleifera), Eleusine coracana, Eragrostis tef, Erianthus sp., Eriobotrya japonica, Eucalyptus sp., Eugenia uniflora, Fagopyrum spp., Fagus spp., Festuca arundinacea, Ficus carica, Fortunella spp., Fragaria spp., Ginkgo biloba, Glycine spp. (e.g. Glycine max, Soja hispida or Soja max), Gossypium hirsutum, Helianthus spp. (e.g. Helianthus annuus), Hemerocallis fulva, Hibiscus spp., Hordeum spp. (e.g. Hordeum vulgare), Ipomoea batatas, Juglans spp., Lactuca sativa, Lathyrus spp., Lens culinaris, Linum usitatissimum, Litchi chinensis, Lotus spp., Luffa acutangula, Lupinus spp., Luzula sylvatica, Lycopersicon spp. (e.g. Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme), Macrotyloma spp., Malus spp., Malpighia emarginata, Mammea americana, Mangifera indica, Manihot spp., Manilkara zapota, Medicago sativa, Melilotus spp., Mentha spp., Miscanthus sinensis, Momordica spp., Morus nigra, Musa spp., Nicotiana spp., Olea spp., Opuntia spp., Ornithopus spp., Oryza spp. (e.g. Oryza sativa, Oryza latifolia), Panicum miliaceum, Panicum virgatum, Passiflora edulis, Pastinaca sativa, Pennisetum sp., Persea spp., Petroselinum crispum, Phalaris arundinacea, Phaseolus spp., Phleum pratense, Phoenix spp., Phragmites australis, Physalis spp., Pinus spp., Pistacia vera, Pisum spp., Poa spp., Populus spp., Prosopis spp., Prunus spp., Psidium spp., Punica granatum, Pyrus communis, Quercus spp., Raphanus sativus, Rheum rhabarbarum, Ribes spp., Ricinus communis, Rubus spp., Saccharum spp., Salix sp., Sambucus spp., Secale cereale, Sesamum spp., Sinapis sp., Solanum spp. (e.g. Solanum tuberosum, Solanum integrifolium or Solanum lycopersicum), Sorghum bicolor, Spinacia spp., Syzygium spp., Tagetes spp., Tamarindus indica, Theobroma cacao,Agent Ref. No. P14945WO00 Trifolium spp., Tripsacum dactyloides, Triticosecale rimpaui, Triticum spp. (e.g. Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum, Triticum monococcum or Triticum vulgare), Tropaeolum minus, Tropaeolum majus, Vaccinium spp., Vicia spp., Vigna spp., Viola odorata, Vitis spp., Zea mays, Zizania palustris, Ziziphus spp., amaranth, artichoke, asparagus, broccoli, Brussels sprouts, cabbage, canola, carrot, cauliflower, celery, collard greens, flax, kale, lentil, oilseed rape, okra, onion, potato, rice, soybean, strawberry, sugar beet, sugar cane, sunflower, tomato, squash, tea and algae, amongst others. In certain embodiments, the plant is a crop plant. In certain embodiments, the plant is a rice, maize, sorghum, soybean, cotton, wheat, canola, potato, tomato, barley, or sugarcane plant. In certain embodiments, the plant is a rice plant. In certain embodiments, the rice plant is of a varietal group selected from indica, japonica, circum-aus (cAus), and circum- basmati (cBasmati). In certain embodiments, the rice plant is an elite rice plant, an improved rice plant, or a landrace. In certain embodiments, the rice plant is a wild rice species in the genus Oryza. Examples of wild rice species include, but are not limited to, O. rufipogon, O. nivara, O. longistaminata, O. barthii, O. glumaepatula, O. meridionalis, O. punctata, O. officinalis, and O. australiensis.

[0092] Certain embodiments encompass a progeny or a descendant of a plant with drought tolerance as well as seeds derived from the plants with drought tolerance and cells derived from the plants with drought tolerance as described herein.

[0093] In certain embodiments, plant cells of the present disclosure are capable of regenerating a plant or plant part. In certain embodiments, plant cells are not capable of regenerating a plant or plant part. Examples of cells not capable of regenerating a plant include, but are not limited to, endosperm, seed coat (testa and pericarp), and root cap.

[0094] Several embodiments provide a commodity plant product prepared from the plants with drought tolerance. In certain embodiments, examples of plant products include, without limitation, grain, oil, and meal. In certain embodiments, a commodity plant product is plant grain (e.g., grain suitable for use as feed or for processing), plant oil (e.g., oil suitable for use as food or biodiesel), or plant meal (e.g., meal suitable for use as feed). A preferred commodity plant product is fodder, seed meal, oil, or seed-treatment-coated seeds.

[0095] The product may be produced at the site where the plant has been grown, the plants and / or parts thereof may be removed from the site where the plants have been grown to produce the product. Typically, the plant is grown, the desired harvestable parts are removed from the plant, if feasible in repeated cycles, and the product made from the harvestable parts of the plant. The step of growing the plant may be performed only once each time the method is performed, while allowing repeated times the steps of product production e.g. by repeated removal ofAgent Ref. No. P14945WO00 harvestable parts of the plants of the disclosure and if necessary further processing of these parts to arrive at the product. It is also possible that the step of growing the plants is repeated and plants or harvestable parts are stored until the production of the product is then performed once for the accumulated plants or plant parts. Also, the steps of growing the plants and producing the product may be performed with an overlap in time, even simultaneously to a large extent or sequentially. Generally, the plants are grown for some time before the product is produced.

[0096] In certain embodiments, the plant is a non-naturally occurring variety. In certain embodiments, the plant is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identical to that of an elite variety of plant (e.g., an elite variety of rice).

[0097] The plants of the disclosure may be used in a plant breeding program. The goal of plant breeding is to combine, in a single variety or hybrid, various desirable traits. For field crops, these traits may include, for example, resistance to diseases and insects, tolerance to heat and drought, tolerance to chilling or freezing, reduced time to crop maturity, greater yield and better agronomic quality. With mechanical harvesting of many crops, uniformity of plant characteristics such as germination and stand establishment, growth rate, maturity, and plant height is desirable. Traditional plant breeding is an important tool in developing new and improved commercial crops. This disclosure encompasses methods for producing a plant by crossing a first parent plant with a second parent plant wherein one or both of the parent plants is a plant displaying a phenotype as described herein.

[0098] Plant breeding techniques known in the art and used in a plant breeding program include, but are not limited to, recurrent selection, bulk selection, mass selection, backcrossing, pedigree breeding, open pollination breeding, restriction fragment length polymorphism enhanced selection, genetic marker enhanced selection, doubled haploids and transformation. Often combinations of these techniques are used.

[0099] The development of hybrids in a plant breeding program requires, in general, the development of homozygous inbred lines, the crossing of these lines and the evaluation of the crosses. There are many analytical methods available to evaluate the result of a cross. The oldest and most traditional method of analysis is the observation of phenotypic traits. Alternatively, the genotype of a plant can be examined.

[0100] A genetic trait which has been engineered into a particular plant using transformation techniques can be moved into another line using traditional breeding techniques that are well known in the plant breeding arts. For example, a backcrossing approach is commonly used to move a transgene from a transformed plant to an elite inbred line and the resulting progeny would then comprise the transgene(s). Also, if an inbred line was used for the transformation,Agent Ref. No. P14945WO00 then the transgenic plants could be crossed to a different inbred in order to produce a transgenic hybrid plant. As used herein, "crossing" can refer to a simple X by Y cross or the process of backcrossing, depending on the context.

[0101] The development of a hybrid in a plant breeding program involves three steps: (1) the selection of plants from various germplasm pools for initial breeding crosses; (2) the selfing of the selected plants from the breeding crosses for several generations to produce a series of inbred lines, which, while different from each other, breed true and are highly homozygous and (3) crossing the selected inbred lines with different inbred lines to produce the hybrids. During the inbreeding process, the vigor of the lines decreases. Vigor is restored when two different inbred lines are crossed to produce the hybrid. An important consequence of the homozygosity and homogeneity of the inbred lines is that the hybrid created by crossing a defined pair of inbreds will always be the same. Once the inbreds that give a superior hybrid have been identified, the hybrid seed can be reproduced indefinitely as long as the homogeneity of the inbred parents is maintained.

[0102] Plants of the present disclosure may be used to produce, e.g., a single cross hybrid, a three-way hybrid or a double cross hybrid. A single cross hybrid is produced when two inbred lines are crossed to produce the F1 progeny. A double cross hybrid is produced from four inbred lines crossed in pairs (A x B and C x D) and then the two F1 hybrids are crossed again (A x B) times (C x D). A three-way cross hybrid is produced from three inbred lines where two of the inbred lines are crossed (A x B) and then the resulting F1 hybrid is crossed with the third inbred (A x B) x C. Much of the hybrid vigor and uniformity exhibited by F1 hybrids is lost in the next generation (F2). Consequently, seed produced by hybrids is consumed rather than planted. Genome Editing

[0103] In certain embodiments, the target Gα gene (e.g., RGA1) is modified using genome editing technology. Targeted modification of plant genomes through the use of genome editing methods can be used to alter (e.g., reduce) expression or activity of a Gα gene through modification of plant genomic DNA. Genome editing methods can enable targeted insertion of one or more nucleic acids of interest into a plant genome. Genome editing uses engineered nucleases such as RNA guided DNA endonucleases or nucleases composed of sequence specific DNA binding domains fused to a non-specific DNA cleavage module. These engineered nucleases enable efficient and precise genetic modifications by inducing targeted DNA double stranded breaks that stimulate the cell’s endogenous cellular DNA repair mechanisms to repair the induced break. Such mechanisms include, for example, error prone non-homologous end joining (NHEJ) and homology directed repair (HDR).Agent Ref. No. P14945WO00

[0104] “Targeted DNA modification” can be used synonymously with targeted DNA mutation and refers to the introduction of a site specification modification that alters or changes the nucleotide sequence at a specific genomic locus of the plant (e.g., rice).

[0105] The targeted DNA modification described herein may be any modification known in the art such as, for example, insertion, deletion, single nucleotide polymorphism (SNP), and or a polynucleotide modification. Additionally, the targeted DNA modification in the genomic locus may be located anywhere in the genomic locus, such as, for example, a coding region of the encoded polypeptide (e.g., exon), a non-coding region (e.g., intron), a regulatory element, or untranslated region.

[0106] The type and location of the targeted DNA modification of the polynucleotide is not particularly limited so long as the targeted DNA modification results in a hypomorphic allele. In certain embodiments, the targeted DNA modification is a substitution of one or more nucleotides of the genomic locus. In certain embodiments, the targeted DNA modification at a genomic locus of a plant results in one or more of the following: (a) reduced expression of the polynucleotide; (b) reduced transcriptional activity of the protein encoded by the polynucleotide; (c) generation of one or more alternatively spliced transcripts of the polynucleotide; (d) frameshift mutation in one or more exons of the polynucleotide; (e) deletion of a portion of the polynucleotide of the open reading frame of the polynucleotide; (f) repression of an enhancer motif present within a regulatory region encoding the polynucleotide; or (g) modification of one or more nucleotides or deletion of a regulatory element operably linked to the expression of the polynucleotide wherein the regulatory element is present within a promoter, intron, 5′UTR, 3′UTR, terminator, or a combination thereof.

[0107] In certain embodiments, the genomic locus has more than one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more) targeted DNA modifications. For example, an intron and a regulatory element of a genomic locus may each comprise a targeted DNA modification.

[0108] The targeted DNA modification of the genomic locus may be done using any genome modification technique known in the art. In certain embodiments the targeted DNA modification is through a genome modification technique selected from the group consisting of a polynucleotide-guided endonuclease, CRISPR-Cas endonucleases, base editing deaminases, zinc finger nuclease, a transcription activator-like effector nuclease (TALEN), engineered site- specific meganuclease, or Argonaute.

[0109] In certain embodiments, the genome modification may be facilitated through the induction of a double-stranded break (DSB) or single-strand break in a defined position in the genome near the desired alteration. DSBs can be induced using any DSB-inducing agent available, including, but not limited to, TALENs, meganucleases, zinc finger nucleases, Cas-Agent Ref. No. P14945WO00 gRNA systems, and the like. In certain embodiments, the introduction of a DSB can be combined with the introduction of a polynucleotide modification template.

[0110] A polynucleotide modification template can be introduced into a cell by any method known in the art, such as, but not limited to, transient introduction methods, transfection, electroporation, microinjection, particle mediated delivery, topical application, whiskers mediated delivery, delivery via cell-penetrating peptides, or mesoporous silica nanoparticle (MSN)-mediated direct delivery.

[0111] The polynucleotide modification template can be introduced into a cell as a single stranded polynucleotide molecule, a double stranded polynucleotide molecule, or as part of a circular DNA (vector DNA). The polynucleotide modification template can also be tethered to the guide RNA and / or the Cas endonuclease. Tethered DNAs can allow for co-localizing target and template DNA, useful in genome editing and targeted genome regulation, and can also be useful in targeting post-mitotic cells where function of endogenous HR machinery is expected to be highly diminished (Mali et al.2013 Nature Methods Vol.10: 957-963.) The polynucleotide modification template may be present transiently in the cell or it can be introduced via a viral replicon.

[0112] A “modified nucleotide” or “edited nucleotide” refers to a nucleotide sequence of interest that comprises at least one alteration when compared to its non-modified nucleotide sequence. Such “alterations” include, for example: (i) replacement of at least one nucleotide, (ii) a deletion of at least one nucleotide, (iii) an insertion of at least one nucleotide, or (iv) any combination of (i)-(iii).

[0113] The term “polynucleotide modification template” includes a polynucleotide that comprises at least one nucleotide modification when compared to the nucleotide sequence to be edited. A nucleotide modification can be at least one nucleotide substitution, addition or deletion. Optionally, the polynucleotide modification template can further comprise homologous nucleotide sequences flanking the at least one nucleotide modification, wherein the flanking homologous nucleotide sequences provide sufficient homology to the desired nucleotide sequence to be edited.

[0114] The process for editing a genomic sequence combining DSB and modification templates generally comprises: providing to a host cell, a DSB-inducing agent, or a nucleic acid encoding a DSB-inducing agent, that recognizes a target sequence in the chromosomal sequence and is able to induce a DSB in the genomic sequence, and at least one polynucleotide modification template comprising at least one nucleotide alteration when compared to the nucleotide sequence to be edited. The polynucleotide modification template can further compriseAgent Ref. No. P14945WO00 nucleotide sequences flanking the at least one nucleotide alteration, in which the flanking sequences are substantially homologous to the chromosomal region flanking the DSB.

[0115] The endonuclease can be provided to a cell by any method known in the art, for example, but not limited to, transient introduction methods, transfection, microinjection, and / or topical application or indirectly via recombination constructs. The endonuclease can be provided as a protein or as a guided polynucleotide complex directly to a cell or indirectly via recombination constructs. The endonuclease can be introduced into a cell transiently or can be incorporated into the genome of the host cell using any method known in the art. In the case of a CRISPR-Cas system, uptake of the endonuclease and / or the guided polynucleotide into the cell can be facilitated with a Cell Penetrating Peptide (CPP) as described in WO2016073433 published May 12, 2016.

[0116] As used herein, a “genomic region” is a segment of a chromosome in the genome of a cell that is present on either side of the target site or, alternatively, also comprises a portion of the target site. The genomic region can comprise at least 5-10, 5-15, 5-20, 5-25, 5-30, 5-35, 5- 40, 5-45, 5-50, 5-55, 5-60, 5-65, 5-70, 5-75, 5-80, 5-85, 5-90, 5-95, 5-100, 5-200, 5-300, 5-400, 5-500, 5-600, 5-700, 5-800, 5-900, 5-1000, 5-1100, 5-1200, 5-1300, 5-1400, 5-1500, 5-1600, 5- 1700, 5-1800, 5-1900, 5-2000, 5-2100, 5-2200, 5-2300, 5-2400, 5-2500, 5-2600, 5-2700, 5- 2800.5-2900, 5-3000, 5-3100 or more bases such that the genomic region has sufficient homology to undergo homologous recombination with the corresponding region of homology.

[0117] TAL effector nucleases (TALEN) are a class of sequence-specific nucleases that can be used to make double-strand breaks at specific target sequences in the genome of a plant or other organism. (Miller et al. (2011) Nature Biotechnology 29:143-148).

[0118] A TALEN comprises a TAL effector DNA binding domain and an endonuclease domain. TAL effectors are proteins of plant pathogenic bacteria that are injected by the pathogen into the plant cell, where they travel to the nucleus and function as transcription factors to turn on specific plant genes. The primary amino acid sequence of a TAL effector dictates the nucleotide sequence to which it binds. Thus, target sites can be predicted for TAL effectors, and TAL effectors can be engineered and generated for the purpose of binding to particular nucleotide sequences.

[0119] Fused to the TAL effector-encoding nucleic acid sequences are sequences encoding a nuclease or a portion of a nuclease, typically a nonspecific cleavage domain from a type II restriction endonuclease such as FokI (Kim et al., 1996). Other useful endonucleases may include, for example, HhaI, HindIII, Nod, BbvCI, EcoRI, BglI, and AhvI. The fact that some endonucleases (e.g., FokI) only function as dimers can be capitalized upon to enhance the target specificity of the TAL effector. For example, in some cases each FokI monomer can be fused toAgent Ref. No. P14945WO00 a TAL effector sequence that recognizes a different DNA target sequence, and only when the two recognition sites are in close proximity do the inactive monomers come together to create a functional enzyme. By requiring DNA binding to activate the nuclease, a highly site-specific restriction enzyme can be created.

[0120] Endonucleases are enzymes that cleave the phosphodiester bond within a polynucleotide chain. Endonucleases include restriction endonucleases, which cleave DNA at specific sites without damaging the bases, and meganucleases, also known as homing endonucleases (HEases), which like restriction endonucleases, bind and cut at a specific recognition site, however the recognition sites for meganucleases are typically longer, about 18 bp or more (patent application PCT / US12 / 30061, filed on Mar.22, 2012). Meganucleases have been classified into four families based on conserved sequence motifs, the families are the LAGLIDADG, GIY-YIG, H-N-H, and His-Cys box families. These motifs participate in the coordination of metal ions and hydrolysis of phosphodiester bonds. HEases are notable for their long recognition sites, and for tolerating some sequence polymorphisms in their DNA substrates. The naming convention for meganuclease is similar to the convention for other restriction endonuclease. Meganucleases are also characterized by prefix F-, I-, or Pl- for enzymes encoded by free-standing ORFs, introns, and inteins, respectively. One step in the recombination process involves polynucleotide cleavage at or near the recognition site. The cleaving activity can be used to produce a double-strand break. For reviews of site-specific recombinases and their recognition sites, see, Sauer (1994) Curr Op Biotechnol 5:521-7; and Sadowski (1993) FASEB 7:760-7. In some examples the recombinase is from the Integrase or Resolvase families.

[0121] Zinc finger nucleases (ZFNs) are engineered double-strand break inducing agents comprised of a zinc finger DNA binding domain and a double-strand-break-inducing agent domain. Recognition site specificity is conferred by the zinc finger domain, which typically comprising two, three, or four zinc fingers, for example having a C2H2 structure, however other zinc finger structures are known and have been engineered. Zinc finger domains are amenable for designing polypeptides which specifically bind a selected polynucleotide recognition sequence. ZFNs include an engineered DNA-binding zinc finger domain linked to a non-specific endonuclease domain, for example nuclease domain from a Type IIs endonuclease such as FokI. Additional functionalities can be fused to the zinc-finger binding domain, including transcriptional activator domains, transcription repressor domains, and methylases. In some examples, dimerization of nuclease domain is required for cleavage activity. Each zinc finger recognizes three consecutive base pairs in the target DNA. For example, a 3 finger domain recognizes a sequence of 9 contiguous nucleotides, with a dimerization requirement of the nuclease, two sets of zinc finger triplets are used to bind an 18 nucleotide recognition sequence.Agent Ref. No. P14945WO00

[0122] Genome editing using DSB-inducing agents, such as Cas9-gRNA complexes, has been described, for example in U.S. Patent Application US 2015-0082478 A1, WO2015 / 026886 A1, WO2016007347, and WO201625131, all of which are incorporated by reference herein.

[0123] The term “Cas gene” herein refers to a gene that is generally coupled, associated or close to, or in the vicinity of flanking CRISPR loci in bacterial systems. The terms “Cas gene”, “CRISPR-associated (Cas) gene” are used interchangeably herein. The term “Cas endonuclease” herein refers to a protein encoded by a Cas gene. A Cas endonuclease herein, when in complex with a suitable polynucleotide component, is capable of recognizing, binding to, and optionally nicking or cleaving all or part of a specific DNA target sequence. A Cas endonuclease described herein comprises one or more nuclease domains. Cas endonucleases of the disclosure includes those having a HNH or HNH-like nuclease domain and / or a RuvC or RuvC-like nuclease domain. A Cas endonuclease of the disclosure include, for example a Cas9 protein, a Cas12a protein, a Cas12b protein, or complexes of these.

[0124] As used herein, the terms “guide polynucleotide / Cas endonuclease complex”, “guide polynucleotide / Cas endonuclease system”, “guide polynucleotide / Cas complex”, “guide polynucleotide / Cas system”, “guided Cas system” are used interchangeably herein and refer to at least one guide polynucleotide and at least one Cas endonuclease that are capable of forming a complex, wherein the guide polynucleotide / Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double strand break) the DNA target site. A guide polynucleotide / Cas endonuclease complex herein can comprise Cas protein(s) and suitable polynucleotide component(s) of any of the four known CRISPR systems (Horvath and Barrangou, 2010, Science 327:167-170) such as a type I, II, or III CRISPR system. A Cas endonuclease unwinds the DNA duplex at the targetand optionally cleaves at least one DNA strand, as mediated by recognition of the target sequence by a polynucleotide (such as, but not limited to, a crRNA or guide RNA) that is in complex with the Cas protein. Such recognition and cutting of a target sequence by a Cas endonuclease typically occurs if the correct protospacer-adjacent motif (PAM) is located at or adjacent to the 3′ end of the DNA target sequence. Alternatively, a Cas protein herein may lack DNA cleavage or nicking activity, but can still specifically bind to a DNA target sequence when complexed with a suitable RNA component. (See also U.S. Patent Application US 2015-0082478 A1 and US 2015-0059010 A1, both are hereby incorporated in its entirety by reference).

[0125] A guide polynucleotide / Cas endonuclease complex can cleave one or both strands of a DNA target sequence. A guide polynucleotide / Cas endonuclease complex that can cleave both strands of a DNA target sequence typically comprises a Cas protein that has all of itsAgent Ref. No. P14945WO00 endonuclease domains in a functional state (e.g., wild type endonuclease domains or variants thereof retaining some or all activity in each endonuclease domain). Non-limiting examples of Cas9 nickases suitable for use herein are disclosed in U.S. Patent Appl. Publ. No. 2014 / 0189896, which is incorporated herein by reference.

[0126] Other Cas endonuclease systems have been described in PCT patent applications PCT / US16 / 32073, filed May 12, 2016 and PCT / US16 / 32028 filed May 12, 2016, both applications incorporated herein by reference.

[0127] “Cas9” (formerly referred to as Cas5, Csn1, or Csx12) herein refers to a Cas endonuclease of a type II CRISPR system that forms a complex with a crRNA and a tracrRNA, or with a single guide polynucleotide, for specifically recognizing and cleaving all or part of a DNA target sequence. Cas9 protein comprises a RuvC nuclease domain and an HNH (H-N-H) nuclease domain, each of which can cleave a single DNA strand at a target sequence (the concerted action of both domains leads to DNA double-strand cleavage, whereas activity of one domain leads to a nick). In general, the RuvC domain comprises subdomains I, II and III, where domain I is located near the N-terminus of Cas9 and subdomains II and III are located in the middle of the protein, flanking the HNH domain (Hsu et al, Cell 157:1262-1278). A type II CRISPR system includes a DNA cleavage system utilizing a Cas9 endonuclease in complex with at least one polynucleotide component. For example, a Cas9 can be in complex with a CRISPR RNA (crRNA) and a trans-activating CRISPR RNA (tracrRNA). In another example, a Cas9 can be in complex with a single guide RNA.

[0128] Any guided endonuclease can be used in the methods disclosed herein. Such endonucleases include, but are not limited to Cas9, Cas12a, and Cas12b endonucleases. Many endonucleases have been described to date that can recognize specific PAM sequences (see for example—Jinek et al. (2012) Science 337 p 816-821, PCT patent applications PCT / US16 / 32073, filed May 12, 2016 and PCT / US16 / 32028 filed May 12, 2016 and Zetsche B et al.2015. Cell 163, 1013) and cleave the target DNA at a specific position. It is understood that based on the methods and embodiments described herein utilizing a guided Cas system one can now tailor these methods such that they can utilize any guided endonuclease system.

[0129] The guide polynucleotide can also be a single molecule (also referred to as single guide polynucleotide) comprising a crRNA sequence linked to a tracrRNA sequence. The single guide polynucleotide comprises a first nucleotide sequence domain (referred to as Variable Targeting domain or VT domain) that can hybridize to a nucleotide sequence in a target DNA and a Cas endonuclease recognition domain (CER domain), that interacts with a Cas endonuclease polypeptide. By “domain” it is meant a contiguous stretch of nucleotides that can be RNA, DNA, and / or RNA-DNA-combination sequence. The VT domain and / or the CER domain of aAgent Ref. No. P14945WO00 single guide polynucleotide can comprise a RNA sequence, a DNA sequence, or a RNA-DNA- combination sequence. The single guide polynucleotide being comprised of sequences from the crRNA and the tracrRNA may be referred to as “single guide RNA” (when composed of a contiguous stretch of RNA nucleotides) or “single guide DNA” (when composed of a contiguous stretch of DNA nucleotides) or “single guide RNA-DNA” (when composed of a combination of RNA and DNA nucleotides). The single guide polynucleotide can form a complex with a Cas endonuclease, wherein the guide polynucleotide / Cas endonuclease complex (also referred to as a guide polynucleotide / Cas endonuclease system) can direct the Cas endonuclease to a genomic target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double strand break) the target site. (See also U.S. Patent Application US 2015-0082478 A1 and US 2015-0059010 A1, both are hereby incorporated in its entirety by reference.)

[0130] The term “variable targeting domain” or “VT domain” is used interchangeably herein a nucleotide sequence that can hybridize (is complementary) to one strand sequence) of a double strand DNA target site. In certain embodiments, the variable targeting domain comprises a contiguous stretch of 12 to 30 nucleotides. The variable targeting domain can be composed of a DNA sequence, an RNA sequence, a modified DNA sequence, a modified RNA sequence, or any combination thereof.

[0131] The terms “single guide RNA” and “sgRNA” are used interchangeably herein and relate to a synthetic fusion of two RNA molecules, a crRNA (CRISPR RNA) comprising a variable targeting domain (linked to a tracr mate sequence that hybridizes to a tracrRNA), fused to a tracrRNA (trans-activating CRISPR RNA). The single guide RNA can comprise a crRNA or crRNA fragment and a tracrRNA or tracrRNA fragment of the type II CRISPR / Cas system that can form a complex with a type II Cas endonuclease, wherein the guide RNA / Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double strand break) the DNA target site.

[0132] The terms “guide RNA / Cas endonuclease complex”, “guide RNA / Cas endonuclease system”, “guide RNA / Cas complex”, “guide RNA / Cas system”, “gRNA / Cas complex”, “gRNA / Cas system”, “RNA-guided endonuclease”, “RGEN” are used interchangeably herein and refer to at least one RNA component and at least one Cas endonuclease that are capable of forming a complex, wherein the guide RNA / Cas endonuclease complex can direct the Cas endonuclease to a DNA target site, enabling the Cas endonuclease to recognize, bind to, and optionally nick or cleave (introduce a single or double strand break) the DNA target site. A guide RNA / Cas endonuclease complex herein can comprise Cas protein(s) and suitable RNAAgent Ref. No. P14945WO00 component(s) of any of the four known CRISPR systems (Horvath and Barrangou, 2010, Science 327:167-170) such as a type I, II, or III CRISPR system. A guide RNA / Cas endonuclease complex can comprise a Type II Cas9 endonuclease and at least one RNA component (e.g., a crRNA and tracrRNA, or a gRNA). (See also U.S. Patent Application US 2015-0082478 A1 and US 2015-0059010 A1, both are hereby incorporated in its entirety by reference).

[0133] The guide polynucleotide of the methods and compositions described herein may be any polynucleotide sequence that targets the genomic loci of a plant cell comprising a polynucleotide that encodes an amino acid sequence that has at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, or 48. In certain embodiments, the guide polynucleotide is a guide RNA. The guide polynucleotide may also be present in a recombinant DNA construct.

[0134] The guide polynucleotide can be introduced into a cell transiently, as single stranded polynucleotide or a double stranded polynucleotide, using any method known in the art such as, but not limited to, particle bombardment, Agrobacterium transformation or topical applications. The guide polynucleotide can also be introduced indirectly into a cell by introducing a recombinant DNA molecule (via methods such as, but not limited to, particle bombardment or Agrobacterium transformation) comprising a heterologous nucleic acid fragment encoding a guide polynucleotide, operably linked to a specific promoter that is capable of transcribing the guide RNA in the cell. The specific promoter can be, but is not limited to, an RNA polymerase III promoter, which allows for transcription of RNA with precisely defined, unmodified, 5′- and 3′-ends (DiCarlo et al., Nucleic Acids Res.41: 4336-4343; Ma et al., Mol. Ther. Nucleic Acids 3:e161) as described in WO2016025131, incorporated herein in its entirety by reference.

[0135] The terms “target site”, “target sequence”, “target site sequence, “target DNA”, “target locus”, “genomic target site”, “genomic target sequence”, “genomic target locus” and “protospacer”, are used interchangeably herein and refer to a polynucleotide sequence such as, but not limited to, a nucleotide sequence on a chromosome, episome, or any other DNA molecule in the genome (including chromosomal, chloroplastic, mitochondrial DNA, plasmid DNA) of a cell, at which a guide polynucleotide / Cas endonuclease complex can recognize, bind to, and optionally nick or cleave. The target site can be an endogenous site in the genome of a cell, or alternatively, the target site can be heterologous to the cell and thereby not be naturally occurring in the genome of the cell, or the target site can be found in a heterologous genomic location compared to where it occurs in nature. As used herein, terms “endogenous target sequence” and “native target sequence” are used interchangeable herein to refer to a targetAgent Ref. No. P14945WO00 sequence that is endogenous or native to the genome of a cell and is at the endogenous or native position of that target sequence in the genome of the cell. Cells include, but are not limited to, human, non-human, animal, bacterial, fungal, insect, yeast, non-conventional yeast, and plant cells as well as plants and seeds produced by the methods described herein. An “artificial target site” or “artificial target sequence” are used interchangeably herein and refer to a target sequence that has been introduced into the genome of a cell. Such an artificial target sequence can be identical in sequence to an endogenous or native target sequence in the genome of a cell but be located in a different position (i.e., a non-endogenous or non-native position) in the genome of a cell.

[0136] An “altered target site”, “altered target sequence”, “modified target site”, “modified target sequence” are used interchangeably herein and refer to a target sequence as disclosed herein that comprises at least one alteration when compared to non-altered target sequence. Such “alterations” include, for example: (i) replacement of at least one nucleotide, (ii) a deletion of at least one nucleotide, (iii) an insertion of at least one nucleotide, or (iv) any combination of (i)- (iii).

[0137] Methods for “modifying a target site” and “altering a target site” are used interchangeably herein and refer to methods for producing an altered target site.

[0138] The length of the target DNA sequence (target site) can vary, and includes, for example, target sites that are at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides in length. It is further possible that the target site can be palindromic, that is, the sequence on one strand reads the same in the opposite direction on the complementary strand. The nick / cleavage site can be within the target sequence or the nick / cleavage site could be outside of the target sequence. In another variation, the cleavage could occur at nucleotide positions immediately opposite each other to produce a blunt end cut or, in other cases, the incisions could be staggered to produce single-stranded overhangs, also called “sticky ends”, which can be either 5′ overhangs, or 3′ overhangs. Active variants of genomic target sites can also be used. Such active variants can comprise at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the given target site, wherein the active variants retain biological activity and hence are capable of being recognized and cleaved by a Cas endonuclease. Assays to measure the single or double-strand break of a target site by an endonuclease are known in the art and generally measure the overall activity and specificity of the agent on DNA substrates containing recognition sites.

[0139] A “protospacer adjacent motif” (PAM) herein refers to a short nucleotide sequence adjacent to a target sequence (protospacer) that is recognized (targeted) by a guide polynucleotide / Cas endonuclease system described herein. The Cas endonuclease may notAgent Ref. No. P14945WO00 successfully recognize a target DNA sequence if the target DNA sequence is not followed by a PAM sequence. The sequence and length of a PAM herein can differ depending on the Cas protein or Cas protein complex used.

[0140] The terms “targeting”, “gene targeting” and “DNA targeting” are used interchangeably herein. DNA targeting herein may be the specific introduction of a knock-out, edit, or knock-in at a particular DNA sequence, such as in a chromosome or plasmid of a cell. In general, DNA targeting can be performed herein by cleaving one or both strands at a specific DNA sequence in a cell with an endonuclease associated with a suitable polynucleotide component. Such DNA cleavage, if a double-strand break (DSB), can prompt NHEJ or HDR processes which can lead to modifications at the target site.

[0141] A targeting method herein can be performed in such a way that two or more DNA target sites are targeted in the method, for example. Such a method can optionally be characterized as a multiplex method. Two, three, four, five, six, seven, eight, nine, ten, or more target sites can be targeted at the same time in certain embodiments. A multiplex method is typically performed by a targeting method herein in which multiple different RNA components are provided, each designed to direct a guide polynucleotide / Cas endonuclease complex to a unique DNA target site.

[0142] The guide polynucleotide / Cas endonuclease system can be used in combination with a co-delivered polynucleotide modification template to allow for editing (modification) of a genomic nucleotide sequence of interest. (See also U.S. Patent Application US 2015-0082478 A1 and WO2015 / 026886 A1, both are hereby incorporated in its entirety by reference.)

[0143] Various methods and compositions can be employed to obtain a cell or organism having a polynucleotide of interest inserted in a target site. Such methods can employ homologous recombination to provide integration of the polynucleotide of Interest at the target site. In one method provided, a polynucleotide of interest is provided to the organism cell in a donor DNA construct. As used herein, “donor DNA” is a DNA construct that comprises a polynucleotide of Interest to be inserted into the target site. The donor DNA construct further comprises a first and a second region of homology that flank the polynucleotide of interest. The first and second regions of homology of the donor DNA share homology to a first and a second genomic region, respectively, present in or flanking the target site of the cell or organism genome. By “homology” is meant DNA sequences that are similar. For example, a “region of homology to a genomic region” that is found on the donor DNA is a region of DNA that has a similar sequence to a given “genomic region” in the cell or organism genome. A region of homology can be of any length that is sufficient to promote homologous recombination at the cleaved target site. For example, the region of homology can comprise at least 5-10, 5-15, 5-20, 5-25, 5-30, 5-35, 5-40,Agent Ref. No. P14945WO00 5-45, 5-50, 5-55, 5-60, 5-65, 5-70, 5-75, 5-80, 5-85, 5-90, 5-95, 5-100, 5-200, 5-300, 5-400, 5- 500, 5-600, 5-700, 5-800, 5-900, 5-1000, 5-1100, 5-1200, 5-1300, 5-1400, 5-1500, 5-1600, 5- 1700, 5-1800, 5-1900, 5-2000, 5-2100, 5-2200, 5-2300, 5-2400, 5-2500, 5-2600, 5-2700, 5- 2800, 5-2900, 5-3000, 5-3100 or more bases in length such that the region of homology has sufficient homology to undergo homologous recombination with the corresponding genomic region. “Sufficient homology” indicates that two polynucleotide sequences have sufficient structural similarity to act as substrates for a homologous recombination reaction. The structural similarity includes overall length of each polynucleotide fragment, as well as the sequence similarity of the polynucleotides. Sequence similarity can be described by the percent sequence identity over the whole length of the sequences, and / or by conserved regions comprising localized similarities such as contiguous nucleotides having 100% sequence identity, and percent sequence identity over a portion of the length of the sequences.

[0144] The amount of sequence identity shared by a target and a donor polynucleotide can vary and includes total lengths and / or regions having unit integral values in the ranges of about 1-20 bp, 20-50 bp, 50-100 bp, 75-150 bp, 100-250 bp, 150-300 bp, 200-400 bp, 250-500 bp, 300-600 bp, 350-750 bp, 400-800 bp, 450-900 bp, 500-1000 bp, 600-1250 bp, 700-1500 bp, 800-1750 bp, 900-2000 bp, 1-2.5 kb, 1.5-3 kb, 2-4 kb, 2.5-5 kb, 3-6 kb, 3.5-7 kb, 4-8 kb, 5-10 kb, or up to and including the total length of the target site. These ranges include every integer within the range, for example, the range of 1-20 bp includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 bps. The amount of homology can also be described by percent sequence identity over the full aligned length of the two polynucleotides which includes percent sequence identity of about at least 50%, 55%, 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. Sufficient homology includes any combination of polynucleotide length, global percent sequence identity, and optionally conserved regions of contiguous nucleotides or local percent sequence identity, for example sufficient homology can be described as a region of 75-150 bp having at least 80% sequence identity to a region of the target locus. Sufficient homology can also be described by the predicted ability of two polynucleotides to specifically hybridize under high stringency conditions, see, for example, Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, NY); Current Protocols in Molecular Biology, Ausubel et al., Eds (1994) Current Protocols, (Greene Publishing Associates, Inc. and John Wiley & Sons, Inc.); and, Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes, (Elsevier, New York).Agent Ref. No. P14945WO00

[0145] The structural similarity between a given genomic region and the corresponding region of homology found on the donor DNA can be any degree of sequence identity that allows for homologous recombination to occur. For example, the amount of homology or sequence identity shared by the “region of homology” of the donor DNA and the “genomic region” of the organism genome can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, such that the sequences undergo homologous recombination.

[0146] The region of homology on the donor DNA can have homology to any sequence flanking the target site. While in certain embodiments the regions of homology share significant sequence homology to the genomic sequence immediately flanking the target site, it is recognized that the regions of homology can be designed to have sufficient homology to regions that may be further 5′ or 3′ to the target site. In still other embodiments, the regions of homology can also have homology with a fragment of the target site along with downstream genomic regions. In certain embodiments, the first region of homology further comprises a first fragment of the target site and the second region of homology comprises a second fragment of the target site, wherein the first and second fragments are dissimilar.

[0147] As used herein, “homologous recombination” includes the exchange of DNA fragments between two DNA molecules at the sites of homology.

[0148] Further uses for guide RNA / Cas endonuclease systems have been described (See U.S. Patent Application US 2015-0082478 A1, WO2015 / 026886 A1, US 2015-0059010 A1, U.S. application 62 / 023,246, and U.S. application 62 / 036,652, all of which are incorporated by reference herein) and include but are not limited to modifying or replacing nucleotide sequences of interest (such as a regulatory elements), insertion of polynucleotides of interest, gene knock- out, gene-knock in, modification of splicing sites and / or introducing alternate splicing sites, modifications of nucleotide sequences encoding a protein of interest, amino acid and / or protein fusions, and gene silencing by expressing an inverted repeat into a gene of interest. Transformation Methods

[0149] Several embodiments relate to plant cells, plant tissues, plants, and seeds that comprise a recombinant DNA (e.g., a genome editing molecule) as described herein. Suitable methods for transformation of host plant cells include virtually any method by which DNA or RNA can be introduced into a cell (for example, where a recombinant DNA construct is stably integrated into a plant chromosome or where a recombinant DNA construct or an RNA is transiently provided to a plant cell) and are well known in the art. Two effective methods for cell transformation are Agrobacterium-mediated transformation and microprojectile bombardment-mediatedAgent Ref. No. P14945WO00 transformation. Microprojectile bombardment methods are illustrated, for example, in U.S. Pat. Nos.5,550,318; 5,538,880; 6,160,208; and 6,399,861. Agrobacterium-mediated transformation methods are described, for example in U.S. Pat. No.5,591,616, which is incorporated herein by reference in its entirety. Transformation of plant material is practiced in tissue culture on nutrient media, for example a mixture of nutrients that allow cells to grow in vitro. Recipient cell targets include, but are not limited to, meristem cells, shoot tips, hypocotyls, calli, immature or mature embryos, and gametic cells such as microspores and pollen. Callus can be initiated from tissue sources including, but not limited to, immature or mature embryos, hypocotyls, seedling apical meristems, microspores and the like. Cells containing a transgenic nucleus are grown into transgenic plants.

[0150] In transformation, DNA is typically introduced into only a small percentage of target plant cells in any one transformation experiment. Marker genes are used to provide an efficient system for identification of those cells that are stably transformed by receiving and integrating a recombinant DNA molecule into their genomes. Preferred marker genes provide selective markers which confer resistance to a selective agent, such as an antibiotic or an herbicide. Potentially transformed cells are exposed to the selective agent. In the population of surviving cells are those cells where, generally, the resistance-conferring gene is integrated and expressed at sufficient levels to permit cell survival. Cells can be tested further to confirm stable integration of the exogenous DNA. Commonly used selective marker genes include those conferring resistance to antibiotics such as kanamycin and paromomycin (nptII), hygromycin B (aph IV), spectinomycin (aadA) and gentamycin (aac3 and aacC4) or resistance to herbicides such as glufosinate (bar or pat), dicamba (DMO) and glyphosate (aroA or EPSPS). Examples of such selectable markers are illustrated in U.S. Pat. Nos.5,550,318; 5,633,435; 5,780,708 and 6,118,047. Markers which provide an ability to visually screen transformants can also be employed, for example, a gene expressing a colored or fluorescent protein such as a luciferase or green fluorescent protein (GFP) or a gene expressing a beta-glucuronidase or uidA gene (GUS) for which various chromogenic substrates are known.

[0151] Transformation of a cell may be stable or transient. Thus, in certain embodiments, a plant cell is stably transformed with a nucleic acid molecule. In other embodiments, a plant is transiently transformed with a nucleic acid molecule. “Transient transformation” in the context of a polynucleotide means that a polynucleotide is introduced into the cell and does not integrate into the genome of the cell. By “stably introducing” or “stably introduced” in the context of a polynucleotide introduced into a cell is intended the introduced polynucleotide is stably incorporated into the genome of the cell, and thus the cell is stably transformed with the polynucleotide.Agent Ref. No. P14945WO00

[0152] “Stable transformation” or “stably transformed” as used herein means that a nucleic acid is introduced into a cell and integrates into the genome of the cell. As such, the integrated nucleic acid is capable of being inherited by the progeny thereof, more particularly, by the progeny of multiple successive generations. “Genome” as used herein also includes the nuclear and the plastid genome, and therefore includes integration of the nucleic acid into, for example, the chloroplast genome. Stable transformation as used herein can also refer to a transgene that is maintained extrachromosomally, for example, as a minichromosome.

[0153] Transient transformation may be detected by, for example, an enzyme-linked immunosorbent assay (ELISA) or Western blot, which can detect the presence of a peptide or polypeptide encoded by one or more transgene introduced into an organism. Stable transformation of a cell can be detected by, for example, a Southern blot hybridization assay of genomic DNA of the cell with nucleic acid sequences which specifically hybridize with a nucleotide sequence of a transgene introduced into an organism (e.g., a plant). Stable transformation of a cell can be detected by, for example, a Northern blot hybridization assay of RNA of the cell with nucleic acid sequences which specifically hybridize with a nucleotide sequence of a transgene introduced into a plant or other organism. Stable transformation of a cell can also be detected by, e.g., a polymerase chain reaction (PCR) or other amplification reactions as are well known in the art, employing specific primer sequences that hybridize with target sequence(s) of a transgene, resulting in amplification of the transgene sequence, which can be detected according to standard methods Transformation can also be detected by direct sequencing and / or hybridization protocols well known in the art.

[0154] In certain embodiments, transformation of a cell comprises nuclear transformation. In other embodiments, transformation of a cell comprises plastid transformation (e.g., chloroplast transformation).

[0155] Procedures for transforming plants are well known and routine in the art and are described throughout the literature. Non-limiting examples of methods for transformation of plants include transformation via bacterial-mediated nucleic acid delivery (e.g., via Agrobacteria), viral-mediated nucleic acid delivery, silicon carbide or nucleic acid whisker- mediated nucleic acid delivery, liposome mediated nucleic acid delivery, microinjection, microparticle bombardment, calcium-phosphate-mediated transformation, cyclodextrin- mediated transformation, electroporation, nanoparticle-mediated transformation, sonication, infiltration, PEG-mediated nucleic acid uptake, as well as any other electrical, chemical, physical (mechanical) and / or biological mechanism that results in the introduction of nucleic acid into the plant cell, including any combination thereof. General guides to various plant transformation methods known in the art include Miki et al. (“Procedures for IntroducingAgent Ref. No. P14945WO00 Foreign DNA into Plants” in Methods in Plant Molecular Biology and Biotechnology, Glick, B. R. and Thompson, J. E., Eds. (CRC Press, Inc., Boca Raton, 1993), pages 67-88) and Rakowoczy-Trojanowska (Cell. Mol. Biol. Lett.7:849-858 (2002)).

[0156] Agrobacterium-mediated transformation is a commonly used method for transforming plants, in particular, dicot plants, because of its high efficiency of transformation and because of its broad utility with many different species. Agrobacterium-mediated transformation typically involves transfer of the binary vector carrying the foreign DNA of interest to an appropriate Agrobacterium strain that may depend on the complement of vir genes carried by the host Agrobacterium strain either on a co-resident Ti plasmid or chromosomally (Uknes et al. (1993) Plant Cell 5:159-169). The transfer of the recombinant binary vector to Agrobacterium can be accomplished by a triparental mating procedure using Escherichia coli carrying the recombinant binary vector, a helper E. coli strain that carries a plasmid that is able to mobilize the recombinant binary vector to the target Agrobacterium strain. Alternatively, the recombinant binary vector can be transferred to Agrobacterium by nucleic acid transformation (Höfgen & Willmitzer (1988) Nucleic Acids Res.16:9877).

[0157] Transformation of a plant by recombinant Agrobacterium usually involves co-cultivation of the Agrobacterium with explants from the plant and follows methods well known in the art. Transformed tissue is regenerated on selection medium carrying an antibiotic or herbicide resistance marker between the binary plasmid T-DNA borders.

[0158] Another method for transforming plants, plant parts and / or plant cells involves propelling inert or biologically active particles at plant tissues and cells. See, e.g., U.S. Pat. Nos. 4,945,050; 5,036,006 and 5,100,792. Generally, this method involves propelling inert or biologically active particles at the plant cells under conditions effective to penetrate the outer surface of the cell and afford incorporation within the interior thereof. When inert particles are utilized, the vector can be introduced into the cell by coating the particles with the vector containing the nucleic acid of interest. Alternatively, a cell or cells can be surrounded by the vector so that the vector is carried into the cell by the wake of the particle. Biologically active particles (e.g., dried yeast cells, dried bacterium or a bacteriophage, each containing one or more nucleic acids sought to be introduced) also can be propelled into plant tissue.

[0159] Thus, in particular embodiments, a plant cell can be transformed by any method known in the art and as described herein and intact plants can be regenerated from these transformed cells using any of a variety of known techniques. Plant regeneration from plant cells, plant tissue culture and / or cultured protoplasts is described, for example, in Evans et al. (Handbook of Plant Cell Cultures, Vol.1, MacMilan Publishing Co. New York (1983)); and Vasil I. R. (ed.) (Cell Culture and Somatic Cell Genetics of Plants, Acad. Press, Orlando, Vol. I (1984), and Vol. IIAgent Ref. No. P14945WO00 (1986)). Methods of selecting for transformed transgenic plants, plant cells and / or plant tissue culture are routine in the art and can be employed in the methods provided herein.

[0160] Likewise, the genetic properties engineered into the seeds and plants, plant parts, and / or plant cells described above can be passed on by sexual reproduction or vegetative growth and therefore can be maintained and propagated in progeny plants. Generally, maintenance and propagation make use of known agricultural methods developed to fit specific purposes such as harvesting, sowing or tilling.

[0161] A nucleotide sequence therefore can be introduced into the plant, plant part and / or plant cell in any number of ways that are well known in the art. The methods do not depend on a particular method for introducing one or more nucleotide sequences into a plant, only that they gain access to the interior of at least one cell of the plant. Where more than one nucleotide sequence is to be introduced, they can be assembled as part of a single nucleic acid construct, or as separate nucleic acid constructs, and can be located on the same or different nucleic acid constructs. Accordingly, the nucleotide sequences can be introduced into the cell of interest in a single transformation event, in separate transformation events, or, for example, in plants, as part of a breeding protocol. Genetic Mapping, Markers, Linkage Relationships, and Marker Assisted Selection

[0162] It has been recognized for quite some time that specific genetic loci correlating with particular traits can be mapped in an organism’s genome. The plant breeder can advantageously use molecular markers to identify desired individuals by detecting marker alleles that show a statistically significant probability of co-segregation with a desired phenotype, manifested as linkage disequilibrium. By identifying a molecular marker or clusters of molecular markers that co-segregate with a trait of interest, the breeder is able to rapidly select a desired phenotype by selecting for the proper molecular marker allele (a process called marker-assisted selection).

[0163] A variety of methods well known in the art are available for detecting molecular markers or clusters of molecular markers that co-segregate with a trait of interest, such as drought tolerance in rice. The basic idea underlying these methods is the detection of markers, for which alternative genotypes (or alleles) have significantly different average phenotypes. Thus, one makes a comparison among marker loci of the magnitude of difference among alternative genotypes (or alleles) or the level of significance of that difference. Trait genes are inferred to be located nearest the marker(s) that have the greatest associated genotypic difference. Two such methods used to detect trait loci of interest are: 1) Population-based association analysis and 2) Traditional linkage analysis.Agent Ref. No. P14945WO00

[0164] In a population-based association analysis, lines are obtained from pre-existing populations with multiple founders, e.g. elite breeding lines. Population-based association analyses rely on linkage disequilibrium (LD) and the idea that in an unstructured population, only correlations between genes controlling a trait of interest and markers closely linked to those genes will remain after so many generations of random mating. In reality, most pre-existing populations have population substructure. Thus, the use of a structured association approach helps to control population structure by allocating individuals to populations using data obtained from markers randomly distributed across the genome, thereby minimizing disequilibrium due to population structure within the individual populations (also called subpopulations). The phenotypic values are compared to the genotypes (alleles) at each marker locus for each line in the subpopulation. A significant marker-trait association indicates the close proximity between the marker locus and one or more genetic loci that are involved in the expression of that trait.

[0165] The same principles underlie traditional linkage analysis; however, linkage disequilibrium is generated by creating a population from a small number of founders. The founders are selected to maximize the level of polymorphism within the constructed population, and polymorphic sites are assessed for their level of cosegregation with a given phenotype. A number of statistical methods have been used to identify significant marker-trait associations. One such method is an interval mapping approach (Lander and Botstein, Genetics 121:185-199 (1989), in which each of many positions along a genetic map (say at 1 cM intervals) is tested for the likelihood that a gene controlling a trait of interest is located at that position. The genotype / phenotype data are used to calculate for each test position a LOD score (log of likelihood ratio). When the LOD score exceeds a threshold value, there is significant evidence for the location of a gene controlling the trait of interest at that position on the genetic map (which will fall between two particular marker loci).

[0166] The present disclosure provides one or more marker loci that demonstrate co-segregation with drought tolerance. Detection of these loci or additional linked loci can be used in marker assisted breeding programs to produce plants with drought tolerance.

[0167] A common measure of linkage is the frequency with which traits cosegregate. This can be expressed as a percentage of cosegregation (recombination frequency) or in centiMorgans (cM). The cM is a unit of measure of genetic recombination frequency. One cM is equal to a 1% chance that a trait at one genetic locus will be separated from a trait at another locus due to crossing over in a single generation (meaning the traits segregate together 99% of the time). Because chromosomal distance is approximately proportional to the frequency of crossing over events between traits, there is an approximate physical distance that correlates with recombination frequency.Agent Ref. No. P14945WO00

[0168] Marker loci are themselves traits and can be assessed according to standard linkage analysis by tracking the marker loci during segregation. Thus, one cM is equal to a 1% chance that a marker locus will be separated from another locus, due to crossing over in a single generation.

[0169] The closer a marker is to a gene controlling a trait of interest, the more effective and advantageous that marker is as an indicator for the desired trait. Closely linked loci display an inter-locus cross-over frequency of about 10% or less, preferably about 9% or less, still more preferably about 8% or less, yet more preferably about 7% or less, still more preferably about 6% or less, yet more preferably about 5% or less, still more preferably about 4% or less, yet more preferably about 3% or less, and still more preferably about 2% or less. In highly preferred embodiments, the relevant loci (e.g., a marker locus and a target locus) display a recombination frequency of about 1% or less, e.g., about 0.75% or less, more preferably about 0.5% or less, or yet more preferably about 0.25% or less. Thus, the loci are about 10 cM, 9 cM, 8 cM, 7 cM, 6 cM, 5 cM, 4 cM, 3 cM, 2 cM, 1 cM, 0.75 cM, 0.5 cM or 0.25 cM or less apart. Put another way, two loci that are localized to the same chromosome, and at such a distance that recombination between the two loci occurs at a frequency of less than 10% (e.g., about 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%, 0.25%, or less) are said to be “proximal to” each other.

[0170] Although particular marker alleles can co-segregate with drought tolerance, it is important to note that the marker locus is not necessarily responsible for the expression of the phenotype. For example, it is not a requirement that the marker polynucleotide sequence be part of a gene that is responsible for the phenotype (for example, is part of the gene open reading frame). The association between a specific marker allele and a trait is due to the original “coupling” linkage phase between the marker allele and the allele in the ancestral rice line from which the allele originated. Eventually, with repeated recombination, crossing over events between the marker and genetic locus can change this orientation. For this reason, the favorable marker allele may change depending on the linkage phase that exists within the parent having the favorable trait that is used to create segregating populations. This does not change the fact that the marker can be used to monitor segregation of the phenotype. It only changes which marker allele is considered favorable in a given segregating population.

[0171] Methods presented herein include detecting the presence of one or more marker alleles associated with drought tolerance in a rice plant and then identifying or selecting rice plants that have favorable alleles at those marker loci, or detecting the presence of a marker allele associated with decreased drought tolerance and then identifying or counterselecting rice plants that have unfavorable alleles. Markers have been identified herein as being associated with drought tolerance in rice and hence can be used to identify and select rice plants having droughtAgent Ref. No. P14945WO00 tolerance. Any marker within 20 cM, 15 cM, 10 cM, 9 cM, 8 cM, 7 cM, 6 cM, 5 cM, 4 cM, 3 cM, 2 cM, 1 cM, 0.9 cM, 0.8 cM, 0.7 cM, 0.6 cM, 0.5 cM, 0.4 cM, 0.3 cM, 0.2 cM, 0.1 cM or less of the endogenous RGA1 gene or any of the markers identified herein could also be used to identify and select rice plants with drought tolerance. Any marker allele linked to and associated with the favorable alleles of the markers listed herein can be used for detection purposes in the identification and / or selection of plants with drought tolerance.

[0172] The present disclosure provides SNP markers or combinations of SNP markers that can be used in various aspects of the present disclosure as set forth herein. The SNP markers provided herein can be used for detecting the presence of an allele associated with drought tolerance in a rice plant or germplasm, and can therefore be used in methods involving marker- assisted breeding and selection of drought tolerance rice plants having an allele associated with drought tolerance.

[0173] In certain embodiments, a marker of this disclosure can include any marker linked to the markers disclosed herein. Linked markers may be determined, for example, by using resources available on the world wide web internet site snp-seek.irri.org or ricebase.org.

[0174] Molecular markers can be used in a variety of plant breeding applications (e.g. see Staub et al. (1996) Hortscience 31: 729-741; Tanksley (1983) Plant Molecular Biology Reporter.1: 3- 8). One of the main areas of interest is to increase the efficiency of backcrossing and introgressing genes using marker-assisted selection. A molecular marker that demonstrates linkage with a locus affecting a desired phenotypic trait provides a useful tool for the selection of the trait in a plant population. This is particularly true where the phenotype is hard to assay. Since DNA marker assays are less laborious and take up less physical space than field phenotyping, much larger populations can be assayed, increasing the chances of finding a recombinant with the target segment from the donor line moved to the recipient line. The closer the linkage, the more useful the marker, as recombination is less likely to occur between the marker and the gene causing the trait, which can result in false positives. Having flanking markers decreases the chances that false positive selection will occur as a double recombination event would be needed. The ideal situation is to have a marker in the gene itself, so that recombination cannot occur between the marker and the gene. Such a marker is called a ‘perfect marker’.

[0175] When a gene is introgressed by marker assisted selection, it is not only the gene that is introduced but also the flanking regions (Gepts. (2002). Crop Sci; 42: 1780-1790). This is referred to as “linkage drag.” In the case where the donor plant is highly unrelated to the recipient plant, these flanking regions carry additional genes that may code for agronomically undesirable traits. This “linkage drag” may also result in reduced yield or other negativeAgent Ref. No. P14945WO00 agronomic characteristics even after multiple cycles of backcrossing into the elite rice line. This is also sometimes referred to as “yield drag.” The size of the flanking region can be decreased by additional backcrossing, although this is not always successful, as breeders do not have control over the size of the region or the recombination breakpoints (Young et al. (1998) Genetics 120:579-585). In classical breeding it is usually only by chance that recombination events are selected that contribute to a reduction in the size of the donor segment (Tanksley et al. (1989). Biotechnology 7: 257-264). Even after 20 backcrosses in backcrosses of this type, one may expect to find a sizeable piece of the donor chromosome still linked to the gene being selected. With markers however, it is possible to select those rare individuals that have experienced recombination near the gene of interest. In 150 backcross plants, there is a 95% chance that at least one plant will have experienced a crossover within 1 cM of the gene. Markers will allow unequivocal identification of those individuals. With one additional backcross of 300 plants, there would be a 95% chance of a crossover within 1 cM of the other side of the gene, generating a segment around the target gene of less than 2 cM. This can be accomplished in two generations with markers, while it would have required on average 100 generations without markers (See Tanksley et al., supra). When the exact location of a gene is known, flanking markers surrounding the gene can be utilized to select for recombination events in different population sizes. For example, in smaller population sizes, recombination events may be expected further away from the gene, so more distal flanking markers would be required to detect the recombination.

[0176] The key components to the implementation of marker assisted selection are: (i) defining the population within which the marker-trait association will be determined, which can be a segregating population, or a random or structured population; (ii) monitoring the segregation or association of polymorphic markers relative to the trait, and determining linkage or association using statistical methods; (iii) defining a set of desirable markers based on the results of the statistical analysis, and (iv) the use and / or extrapolation of this information to the current set of breeding germ plasm to enable marker-based selection decisions to be made. The markers described in this disclosure, as well as other marker types such as SSRs and FLPs, can be used in marker assisted selection protocols.

[0177] SSRs can be defined as relatively short runs of tandemly repeated DNA with lengths of 6 bp or less (Tautz (1989) Nucleic Acid Research 17: 6463-6471; Wang et al. (1994) Theoretical and Applied Genetics, 88:1-6). Polymorphisms arise due to variation in the number of repeat units, probably caused by slippage during DNA replication (Levinson and Gutman (1987) Mol Biol Evol 4: 203-221). The variation in repeat length may be detected by designing PCR primers to the conserved non-repetitive flanking regions (Weber and May (1989) Am J Hum Genet.Agent Ref. No. P14945WO00 44:388-396). SSRs are highly suited to mapping and marker assisted selection as they are multi- allelic, codominant, reproducible and amenable to high throughput automation (Rafalski et al. (1996) Generating and using DNA markers in plants. In: Non-mammalian genomic analysis: a practical guide. Academic press. pp 75-135).

[0178] Various types of SSR markers can be generated, and SSR profiles can be obtained by gel electrophoresis of the amplification products. Scoring of marker genotype is based on the size of the amplified fragment. Various types of FLP markers can also be generated. Most commonly, amplification primers are used to generate fragment length polymorphisms. Such FLP markers are in many ways similar to SSR markers, except that the region amplified by the primers is not typically a highly repetitive region. Still, the amplified region, or amplicon, will have sufficient variability among germplasm, often due to insertions or deletions, such that the fragments generated by the amplification primers can be distinguished among polymorphic individuals.

[0179] SNP markers detect single base pair nucleotide substitutions. Of all the molecular marker types, SNPs are the most abundant, thus having the potential to provide the highest genetic map resolution (PLos One (2013).8 (11): e79192). SNPs can be assayed at an even higher level of throughput than SSRs, in a so-called ‘ultra-high-throughput’ fashion, as they do not require large amounts of DNA and automation of the assay may be straight-forward. SNPs also have the promise of being relatively low-cost systems. These three factors together make SNPs highly attractive for use in marker assisted selection. Several methods are available for SNP genotyping, including but not limited to, whole genome sequencing, hybridization, primer extension, oligonucleotide ligation, nuclease cleavage, minisequencing and coded spheres. Such methods have been reviewed in: Gut (2001) Hum Mutat 17 pp.475-492; Shi (2001) Clin Chem 47, pp.164-172; Kwok (2000) Pharmacogenomics 1, pp.95-100; and Bhattramakki and Rafalski (2001) Discovery and application of single nucleotide polymorphism markers in plants. In: R. J. Henry, Ed, Plant Genotyping: The DNA Fingerprinting of Plants, CABI Publishing, Wallingford. A wide range of commercially available technologies utilize these and other methods to interrogate SNPs including MASSCODE™ (Qiagen) cleavable mass spectrometry tags, INVADER®. (Third Wave Technologies) and INVADER PLUS® invasive cleavage- based signal amplification, SNAPSHOT®. (Applied Biosystems) primer extension assays, TAQMAN®. (Applied Biosystems) probe-based real-time PCR assays, and BEADARRAY® (Illumina) bead-based microarray technologies.

[0180] A number of SNPs together within a sequence, or across linked sequences, can be used to describe a haplotype for any particular genotype (Ching et al. (2002), BMC Genet.3:19 pp Gupta et al.2001, Rafalski (2002b), Plant Science 162:329-333). Haplotypes can be more informative than single SNPs and can be more descriptive of any particular genotype. Once aAgent Ref. No. P14945WO00 unique haplotype has been assigned to a donor chromosomal region, that haplotype can be used in that population or any subset thereof to determine whether an individual has a particular gene. See, for example, WO2003054229. Using automated high throughput marker detection platforms known to those of ordinary skill in the art makes this process highly efficient and effective.

[0181] In addition to SSRs, FLPs and SNPs, as described above, other types of molecular markers are also widely used, including but not limited to expressed sequence tags (ESTs), SSR markers derived from EST sequences, randomly amplified polymorphic DNA (RAPD), and other nucleic acid-based markers.

[0182] Isozyme profiles and linked morphological characteristics can, in some cases, also be indirectly used as markers. Even though they do not directly detect DNA differences, they are often influenced by specific genetic differences. However, markers that detect DNA variation are far more numerous and polymorphic than isozyme or morphological markers (Tanksley (1983) Plant Molecular Biology Reporter 1:3-8).

[0183] Sequence alignments or contigs may also be used to find sequences upstream or downstream of the specific markers listed herein. These new sequences, close to the markers described herein, are then used to discover and develop functionally equivalent markers. For example, different physical and / or genetic maps are aligned to locate equivalent markers not described within this disclosure but that are within similar regions. These maps may be within the rice species, or even across other species that have been genetically or physically aligned with rice, such as maize, soybean, wheat, or barley.

[0184] In general, marker assisted selection uses polymorphic markers that have been identified as having a significant likelihood of co-segregation with a phenotype, such as drought tolerance. Such markers map near the gene that confers drought tolerance in a plant, and are considered indicators for the desired trait, or markers. Plants are tested for the presence of a desired allele in the marker, and plants containing a desired genotype at one or more loci are expected to transfer the desired genotype, along with a desired phenotype, to their progeny. Thus, plants with increased drought tolerance can be selected for by detecting one or more marker alleles, and in addition, progeny plants derived from those plants can also be selected. Hence, a plant containing a desired genotype in a given chromosomal region is obtained and then crossed to another plant. The progeny of such a cross would then be evaluated genotypically using one or more markers and the progeny plants with the same genotype in a given chromosomal region would then be selected as exhibiting increased drought tolerance.

[0185] The SNPs identified herein could be used alone or in combination (i.e. a SNP haplotype) to select for plants having a favorable allele (i.e. associated with increased droughtAgent Ref. No. P14945WO00 tolerance).The skilled artisan would expect that there might be additional polymorphic sites at marker loci in and around the markers identified herein, wherein one or more polymorphic sites is in linkage disequilibrium with an allele at one or more of the polymorphic sites in the haplotype and thus could be used in a marker assisted selection program to introgress an allele of interest. Two particular alleles at different polymorphic sites are said to be in linkage disequilibrium if the presence of the allele at one of the sites tends to predict the presence of the allele at the other site on the same chromosome (Stevens, Mol. Diag.4:309-17 (1999)).

[0186] The skilled artisan would understand that allelic frequency (and hence, haplotype frequency) can differ from one germplasm pool to another. Germplasm pools vary due to maturity differences, heterotic groupings, geographical distribution, etc. As a result, SNPs and other polymorphisms may not be informative in some germplasm pools.

[0187] Breeding sources of the RGA1 minor, favorable allele include, but are not limited to, those provided in Table 3.

[0188] TABLE 3 Name ID M 102::IRGC 76307-1 IRIS 313-8502Agent Ref. No. P14945WO00 ARC 6044::IRGC 12190-1 IRIS 313-9201 KANU DAM::IRGC 29755-1 IRIS 313-9249Agent Ref. No. P14945WO00 FU LI HONG::IRGC 70250-1 IRIS 313-8387 RIKUTO NORIN MOCHI 20::IRGC 410-1 IRIS 313-8400Agent Ref. No. P14945WO00 CAPATAZ::GERVEX 521-C1 IRIS 313-8084 GIGANTE VERCELLI::GERVEX 1408-C1 IRIS 313-8154 LUSITO IRRADIADO 859852 GERVEX 1676Agent Ref. No. P14945WO00 NOINJO::IRGC 77669-1 IRIS 313-11973 GYEONGSAN 1::IRGC 79404-1 IRIS 313-12003Agent Ref. No. P14945WO00 80A97YR303-304-1-3 B053 YR196 B055Agent Ref. No. P14945WO00 C52 CX287 ZIDAO CX315Detection Tools

[0189] Several embodiments provide a method for identifying a plant with increased drought tolerance, or cells or tissues thereof. In certain embodiments, the method includes using primers or probes which specifically recognize a portion of the sequence of the Gα gene (e.g., RGA1) of the disclosure.

[0190] Probes and primers are provided which are of sufficient nucleotide length to bind specifically to the target DNA sequence under the reaction or hybridization conditions. Suitable probes and primers are at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length, and less than 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, or 12 nucleotides in length. Such probes and primers can hybridize specifically to a target sequence under high stringency hybridization conditions. InAgent Ref. No. P14945WO00 certain embodiments, probes and primers have complete or 100% DNA sequence similarity of contiguous nucleotides with the target sequence, although probes which differ from the target DNA sequence but retain the ability to hybridize to target DNA sequence may also be used. Reverse complements of the primers and probes disclosed herein are also provided and can be used in the methods and compositions described herein.

[0191] Several embodiments provide kits for identifying plants with drought tolerance, the kits comprising at least one oligonucleotide primer or probe that specifically recognizes the Gα gene (e.g., RGA1). In certain embodiments, at least one oligonucleotide comprises a detectable label. The kit may also include one or more positive or negative controls. Embodiments

[0192] The following numbered embodiments also form part of the present disclosure:

[0193] 1. An elite rice plant, or a progeny plant, a plant part, or a plant cell thereof, having in its genome an introgressed genetic locus comprising a hypomorphic allele of the endogenous RICE G PROTEIN ALPHA 1 (RGA1) gene, wherein the hypomorphic allele confers drought tolerance.

[0194] 2. The elite rice plant of embodiment 1, wherein the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, an A at position 4668, or a combination thereof, and wherein the position numbering corresponds to SEQ ID NO: 1.

[0195] 3. The elite rice plant of embodiment 1 or embodiment 2, wherein the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, and an A at position 4668, and wherein the position numbering corresponds to SEQ ID NO: 1.

[0196] 4. The elite rice plant of any one of embodiments 1-3, wherein the hypomorphic allele comprises a nucleotide sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1.

[0197] 5. The elite rice plant of any one of embodiments 1-4, wherein yield of the rice plant is increased relative to a control rice plant without the hypomorphic allele under drought conditions and under well-watered conditions.Agent Ref. No. P14945WO00

[0198] 6. The elite rice plant of any one of embodiments 1-5, wherein the hypomorphic allele confers semi-dwarf stature.

[0199] 7. The elite rice plant of any one of embodiments 1-6, wherein the introgressed genetic locus is derived from a genotype set forth in Table 3.

[0200] 8. The elite rice plant of any one of embodiments 1-7, wherein the rice plant is an elite rice plant; or wherein the rice plant is of a varietal group selected from indica, japonica, cAus, and cBasmati.

[0201] 9. A method of introgressing a genetic locus conferring drought tolerance to a rice plant, the method comprising: providing a first rice plant with the genetic locus, wherein the genetic locus comprises a hypomorphic allele of the endogenous RGA1 gene; providing a second rice plant; crossing the first rice plant with the second rice plant to produce a population of progeny rice plants; and selecting from the population at least one progeny rice plant having the genetic locus.

[0202] 10. The method of embodiment 9, wherein the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, an A at position 4668, or a combination thereof, and wherein the position numbering corresponds to SEQ ID NO: 1.

[0203] 11. The method of embodiment 9 or embodiment 10, wherein the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, and an A at position 4668, and wherein the position numbering corresponds to SEQ ID NO: 1.

[0204] 12. The method of any one of embodiments 9-11, wherein the hypomorphic allele comprises a nucleotide sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1.

[0205] 13. The method of any one of embodiments 9-12, wherein the first rice plant is selected from the genotypes set forth in Table 3.

[0206] 14. The method of any one of embodiments 9-13, wherein the second rice plant is ‘Avant’, ‘Cypress’, ‘Katy’, ‘Drew’, ‘Cocodrie’, ‘LaGrue’, ‘Kaybonnet’, ‘Lemont’, ‘Saber’, ‘Cybonnet’, ‘Jefferson’, ‘Carolina Gold’, ‘Starbonnet’, ‘Labelle’, or ‘Tebonnet’; or wherein the second rice plant is an elite rice plant.Agent Ref. No. P14945WO00

[0207] 15. The method of any one of embodiments 9-14, further comprising crossing the selected progeny rice plant with itself or another rice plant.

[0208] 16. The method of any one of embodiments 9-15, wherein the introgressing comprises marker assisted selection.

[0209] 17. A modified plant, or a progeny plant, a plant part, or a plant cell thereof, having drought tolerance, the modified plant comprising a hypomorphic allele of an endogenous G protein alpha subunit (Gα) gene.

[0210] 18. The modified plant of embodiment 17, wherein the hypomorphic allele comprises one or more nucleotide substitutions at a genomic locus comprising the endogenous Gα gene.

[0211] 19. The modified plant of embodiment 18, wherein the one or more nucleotide substitutions are present within the promoter or untranslated region of the endogenous Gα gene.

[0212] 20. The modified plant of any one of embodiments 17-19, wherein the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, an A at position 4668, or a combination thereof, and wherein the position numbering corresponds to SEQ ID NO: 1.

[0213] 21. The modified plant of any one of embodiments 17-20, wherein the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, and an A at position 4668, and wherein the position numbering corresponds to SEQ ID NO: 1.

[0214] 22. The modified plant of any one of embodiments 17-21, wherein the endogenous Gα gene comprises a nucleotide sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, or 47.

[0215] 23. The modified plant of any one of embodiments 17-22, wherein the endogenous Gα gene encodes a polypeptide having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, or 48.

[0216] 24. The modified plant of any one of embodiments 17-23, wherein the plant is a rice, maize, sorghum, soybean, cotton, wheat, canola, potato, tomato, barley, or sugarcane plant.

[0217] 25. A seed or an asexual propagate of the plant of any one of embodiments 1-24.Agent Ref. No. P14945WO00

[0218] 26. A method for producing a plant having drought tolerance, the method comprising: modifying the plant to comprise a hypomorphic allele of an endogenous Gα gene.

[0219] 27. The method of embodiment 26, wherein the hypomorphic allele comprises one or more nucleotide substitutions at a genomic locus comprising the endogenous Gα gene.

[0220] 28. The method of embodiment 27, wherein the one or more nucleotide substitutions are within the promoter or untranslated region of the endogenous Gα gene.

[0221] 29. The method of any one of embodiments 26-28, wherein the modifying comprises introducing one or more genome editing molecules into a plant or plant cell and selecting a plant comprising the hypomorphic allele.

[0222] 30. The method of embodiment 29, wherein the one or more genome editing molecules comprise an RNA-guided endonuclease and a guide RNA.

[0223] 31. The method of any one of embodiments 26-30, wherein the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, an A at position 4668, or a combination thereof, and wherein the position numbering corresponds to SEQ ID NO: 1.

[0224] 32. The method of any one of embodiments 26-31, wherein the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, and an A at position 4668, and wherein the position numbering corresponds to SEQ ID NO: 1.

[0225] 33. The method of any one of embodiments 26-32, wherein the endogenous Gα gene comprises a nucleotide sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, or 47.

[0226] 34. The method of any one of embodiments 26-33, wherein the endogenous Gα gene encodes a polypeptide having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, or 48.

[0227] 35. The method of any one of embodiments 26-34, wherein the plant is a rice, maize, sorghum, soybean, cotton, wheat, canola, potato, tomato, barley, or sugarcane plant.

[0228] 36. A crop comprising a plurality of the plants of any one of embodiments 1-24 planted together in an agricultural field.Agent Ref. No. P14945WO00

[0229] 37. A method of producing a plant part from a crop, the method comprising: cultivating a plurality of the plants of any one of embodiments 1-24 as a crop, and harvesting the plant part from the plants, optionally wherein the plant part is a fruit, tuber, leaf, stalk, root, or seed.

[0230] 38. A commodity plant product prepared from the plant or plant part of any one of embodiments 1-24, wherein the commodity plant product comprises a nucleic acid containing the hypomorphic allele.

[0231] 39. The commodity plant product of embodiment 38, wherein the product is fodder, seed meal, oil, or seed-treatment-coated seed.

[0232] 40. A method for producing a commodity plant product, the method comprising processing the plant or plant part of any one of embodiments 1-24 to obtain the product.

[0233] 41. The method of embodiment 40, wherein the commodity plant product is fodder, seed meal, oil, or seed-treatment-coated seed.

[0234] 42. The method of embodiment 40 or embodiment 41, wherein the commodity plant product comprises a nucleic acid containing the hypomorphic allele.

[0235] 43. A method of identifying or selecting a plant comprising a drought tolerance locus, the method comprising: genotyping at least one plant for the presence of a hypomorphic allele of an endogenous Gα gene or a marker in linkage disequilibrium therewith.

[0236] 44. The method of embodiment 43, wherein the marker is located within 10 cM, 5 cM, 1 cM, or 0.5 cM of the endogenous Gα gene.

[0237] 45. The method of embodiment 43 or embodiment 44, further comprising selecting at least one plant comprising the drought tolerance locus based on the genotyping.

[0238] 46. The method of embodiment 45, further comprising crossing the selected plant with a second plant to produce a population of progeny plants.

[0239] 47. The method of embodiment 45 or embodiment 46, further comprising assaying the selected plant for drought tolerance.

[0240] 48. The method of any one of embodiments 43-47, wherein the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, an A at position 4668, or a combination thereof, and wherein the position numbering corresponds to SEQ ID NO: 1.

[0241] 49. The method of any one of embodiments 43-48, wherein the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at positionAgent Ref. No. P14945WO00 4667, and an A at position 4668, and wherein the position numbering corresponds to SEQ ID NO: 1.

[0242] All publications and patent applications mentioned in the specification are indicative of the level of skill of those skilled in the art to which this disclosure pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0243] Although the foregoing disclosure has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.

[0244] The following examples are offered by way of illustration and not by way of limitation. EXAMPLES Example 1: Field performance of natural variants of RGA1

[0245] The rice 3K diversity panel, comprising approximately 3,010 fully sequenced rice varieties, represents a rich resource for unraveling the genetic basis of important agronomic traits. By leveraging this wealth of genetic diversity, breeders can develop novel rice varieties with enhanced productivity and resilience. In this study, the genetic diversity within the rice 3K diversity panel was harnessed to identify natural variants of Gα subunits, focusing on an RGA1 minor allele containing 14 single nucleotide variants across its promoter (8) and intronic regions (6). The objective was to evaluate their performance in two field conditions: well-watered and drought-stressed environments. Additionally, the aim was to elucidate the molecular mechanisms underlying the observed phenotypes associated with RGA1 alleles, providing insights into their roles in rice adaptation and potential applications in breeding programs. Methods Plant materials

[0246] A field trial was conducted to assess the performance of RGA1 natural variants. In the RGA1 field trial in 2021, a total of 232 rice accessions was evaluated, comprising of 219 accessions from the Japonica varietal group (including tropical, temperate, and subtropical subgroups), 7 accessions from the Indica varietal group (including subgroups ind1, ind2, ind3, and indx), 5 accessions from the Aus varietal group, and one accession from the Aromatica varietal group (Table 4). Seeds for all accessions were obtained from the International Rice GenBank Collection at the International Rice Research Institute (IRRI), Los Baños, Laguna, Philippines.

[0247] TABLE 4Agent Ref. No. P14945WO00 Field trial Natural variant Subgroup Number of accessions

[0248] The field trial was performed at the International Rice Research Institute (IRRI) in Los Baños, Laguna, Philippines. The RGA1 field experiment occurred during the wet season of 2021. Seeds from each accession were sown onto a seed bed on June 30, 2021. Fourteen days following sowing (DAS), seedlings were carefully transplanted into two distinct experimental fields.

[0249] Two distinct experimental field conditions were established: 1) the well-watered conditions, in which a flooded paddy field environment was maintained consistently throughout the entire experiment, and 2) the rain-out shelter, which initially experienced flooding until 30 days after sowing (DAS). Subsequently, irrigation was terminated, and the field was drained to initiate drought stress. Intermittent rewatering events were scheduled at 60, 80, and 96 DAS, exposing the plants to cyclic drought conditions for the remaining duration of the season. The experimental design followed an alpha lattice layout, where each accession was planted in three replicates. Each plant was arranged in single 2-meter rows with a spacing of 0.2 meters between plants. This configuration resulted in one focal plant positioned in the fourth hill, accompanied by nine neighboring plants of the same genotype per plot. At 25 days after sowing (DAS), a basal fertilizer comprising complete fertilizer (14-14-14) was applied at a rate of 50 kg ha−1each of N2, P2O5, and K2O. Additionally, pest control measures were implemented, including the application of Cymbush (1 L ha−1) and Cartap (0.96 kg ha−1) at 37 DAS, followed by Provado (1.92 L ha−1) at 40 DAS and again at 60 DAS to manage insect pests. Soil moisture levels in the drought-stressed fields were monitored using nine tensiometers (Soil Moisture Equipment Corp., USA) installed at a depth of 30 cm in each replicate. Trait measurementsAgent Ref. No. P14945WO00

[0250] For phenotyping, three replicates of each cultivar were measured, totaling 690 plants. The architectural phenotypes measured were plant height, tiller number, flag leaf length and width, and leaf and flag leaf angles. Days to flowering were recorded, and all plants were grown to maturity. Mature panicles were harvested, and the following reproductive phenotypes were recorded: panicle number, panicle length, panicle type, panicle exsertion type, grains per panicle and spikelet fertility (total number of filled grains / total number of spikelets). Seeds were collected and measured for 100-grain weight and total grain weight per plant (yield) per harvest area (m2). Grain size analysis was conducted on twenty-five seeds per genotype using PTRAP software (A L-Tam et al., 2013). For shoot biomass, the entire above-ground shoot material was harvested after panicle collection, dried for one week in a 65 °C oven, weighed, and biomass per harvest area (m2) calculated. Harvest index (HI) was calculated using the formula: HI = Yield (g / m2) / (Yield (g / m2) + Dry shoot biomass (g / m2)). RNA extraction and qRT-PCR analysis

[0251] Seeds from 11 rice cultivars carrying the RGA1 major allele and 8 rice cultivars carrying the RGA1 minor allele were germinated in petri dishes with moist filtered paper for one week. Rice seedlings were then transferred and grown in soil trays for an additional week. After 14 days, leaves were harvested for RNA extraction. Total RNA extraction was performed using the TRIzol RNA extraction kit (ThermoFisher), followed by cDNA synthesis using the SuperScript III First-Strand Synthesis system (ThermoFisher). Quantitative RT-PCR was carried out on an iQ5 Real-Time system (Bio-Rad) using 3’ primer pairs specific to the RGA1 gene. The GAPDH gene was employed as the housekeeping gene for normalization of gene expression levels. Fold changes, represented as the log2fold change of theΔΔCt, were calculated to determine relative changes in RGA1 gene expression. The primer sequences for RGA1 cDNA are as follows: RGA1_F (5' 3'): CTGGGAAACAGGAGGTTGAA (SEQ ID NO: 49) and RGA1_R (5' 3'): TAGGGCCGTAGTTCTGTAGAT (SEQ ID NO: 50). Statistical analysis

[0252] Student's t-tests were employed to assess significant differences between major and minor alleles for RGA1, and among all haplotypes compared to HapA (major allele) for OsXLG1. Chi-square tests were utilized for categorical phenotypes to evaluate significant differences between RGA1 alleles. All statistical analyses were conducted within the R statistical programming language (www.R-project.org). Significance levels are indicated as follows: *, p < 0.05; **, p < 0.01; ***, p < 0.001, ****, p < 0.0001. Results Population distribution and selection of RGA1 allele cultivarsAgent Ref. No. P14945WO00

[0253] An RGA1 minor allele has been identified and characterized. FIG.1A shows the distribution of the SNPs across the RGA1 gene, with 14 covarying SNPs: 8 SNPs located in the promoter and 6 SNPs in the introns. FIG.1B provides an overview of the distribution of the RGA1 alleles within the 3K diversity panel.

[0254] Interestingly, the RGA1 minor allele is predominantly present in the Japonica varietal group, with 196 rice cultivars in temperate japonica subgroup, 19 in tropical japonica subgroup, and 2 in subtropical japonica subgroup. Conversely, its presence is rare in the Indica varietal group, with only 3 occurrences in ind1a subgroup, and only one in the Aus varietal group. Conversely, the RGA1 major allele is primarily prevalent in the Indica subgroup, with 1096 accessions, followed by the Japonica group with 471 accessions, the Aus group with 183 accessions, and the Aromatica group with 70 accessions. To assess the performance of rice cultivars harboring either the RGA1 major or RGA1 minor allele, a field experiment was conducted under both well-watered and drought-stressed conditions. To mitigate the impact of early flowering following drought, rice accessions were selected using flowering time information obtained from the IRRI SNP-Seek database. Rice accessions with flowering periods ranging from 70 to 120 days after sowing (DAS) were selected.

[0255] A total of 141 rice accessions were selected for the RGA1 major allele, and 81 rice accessions were chosen for the RGA1 minor allele for the experiments. Table 4 provides an overview of the subgroups and the number of rice accessions utilized in this trial. Architectural phenotypes of RGA1 allele cultivars under well-watered conditions.

[0256] FIG.2A shows the RGA1 allele cultivars under the well-watered conditions. Specifically, RGA1 minor allele cultivars exhibited a shorter stature (FIG. 2B) alongside shorter and narrower flag leaves (FIG.2C-D) in contrast to cultivars carrying the RGA1 major allele. However, no significant difference was observed in the number of tillers between RGA1 major and minor allele cultivars (FIG.2E).

[0257] In rice, leaf angle refers to the inclination of the entire leaf blade relative to the stem, impacting light interception and photosynthetic efficiency. This trait is classified as erect, horizontal, or droopy. A higher proportion of RGA1 major and RGA1 minor allele cultivars exhibited an intermediate leaf angle (87% and 84%, respectively) followed by erect (11% and 12%, respectively) and a small proportion of droopy leaf angles (2% and 1%) (FIG.2F).

[0258] Flag leaf angle, which refers to the orientation of the topmost leaf, plays a crucial role in photosynthesis and nutrient remobilization during grain filling in rice. Similar to leaf angle, the flag leaf angle can be categorized as erect, intermediate, horizontal, or droopy. Notably, cultivars carrying the different RGA1 alleles exhibited diversity in flag leaf angle types. Surprisingly, only a smaller proportion of RGA1 major allele cultivars displayed erect flag leafAgent Ref. No. P14945WO00 angles (1%) compared to a higher proportion of RGA1 minor allele cultivars (18%). A higher proportion of RGA1 major and RGA1 minor allele cultivars exhibited a horizontal flag leaf angle (51% and 38%, respectively), followed by intermediate (33% for both alleles), and then droopy (15% and 11%, respectively) (FIG.2G).

[0259] During the reproductive stage under well-watered conditions, cultivars with the RGA1 minor allele displayed distinct traits compared to those with the RGA1 major allele. Specifically, the RGA1 minor allele was associated with early flowering, with an average of 72 days to flowering, compared to 86 days for cultivars with the RGA1 major allele (FIG.2H). Additionally, RGA1 minor allele cultivars exhibited shorter panicles compared to those with the RGA1 major allele (FIG.2I).

[0260] Panicle type in rice, reflects the arrangement of spikelets on the panicle and is categorized as compact, intermediate, and open. Notably, cultivars carrying the different RGA1 alleles exhibit diversity in panicle type. Specifically, RGA1 major allele cultivars show 41% compact, 39% intermediate, and 20% open types, while RGA1 minor allele cultivars display 60% compact, 34% intermediate, and 6% open types (FIG.2J).

[0261] Panicle exsertion type describes the extent to which the panicle extends beyond the leaf sheath, and ranges from fully enclosed to fully exserted. Cultivars carrying the RGA1 alleles exhibit diversity in panicle exsertion type. Specifically, RGA1 major allele cultivars comprise 44% well-exserted, 37% moderately well-exserted, 10% partly exserted, 8% just exserted, and 1% enclosed types, while RGA1 minor allele cultivars exhibit 45% well-exserted, 40% moderately well-exserted, 10% just exserted, and 5% partly exserted types, with none having enclosed panicles (FIG. 2K).

[0262] There were no significant differences observed in the number of panicles (FIG.2L), grains per panicle (FIG.2M), spikelet fertility (FIG.2N), and 100-grain weight (FIG.2O), between RGA1 allele cultivars.

[0263] FIG.3A-C illustrates the grain traits of RGA1 allele cultivars. Specifically, RGA1 minor allele cultivars exhibited shorter grain length compared to those with the RGA1 major allele (FIG.3A). However, there were no significant differences observed in grain width (FIG.3B) or sphericity index (ratio of length and width) (FIG.3C) between the two RGA1 allele cultivars. To evaluate the field performance of RGA1 allele cultivars, measurements of overall yield, biomass, and harvest index were conducted.

[0264] RGA1 minor allele cultivars demonstrated greater yield (mean = 104 g / m2) compared to RGA1 major allele cultivars (mean = 92 g / m2) (FIG.3D). Interestingly, the shorter stature of RGA1 minor allele resulted in lower dry shoot biomass (mean = 500 g / m2) compared to taller RGA1 major allele cultivars, which exhibited greater dry shoot biomass (mean = 644 g / m2)Agent Ref. No. P14945WO00 (FIG.3E). Consequently, RGA1 minor allele cultivars exhibited a superior harvest index under well-watered conditions, outperforming RGA1 major allele cultivars (FIG.3F). RGA1 minor allele cultivars show superior field performance under drought-stress conditions

[0265] FIG.4A illustrates the RGA1 allele cultivars under drought-stress conditions in the rainout shelter. Similar to well-watered conditions, RGA1 minor allele cultivars maintained a shorter stature (FIG.4B) and shorter and narrower flag leaf (FIG.4C-D) compared to RGA1 major allele cultivars. Unlike in the well-watered conditions, RGA1 minor allele cultivars showed higher tillering compared to RGA1 major allele cultivars under drought stress (FIG. 4E). RGA1 minor allele cultivars retained the early flowering (FIG.4F) and shorter panicle (FIG.4G) phenotypes observed under well-watered conditions. Interestingly, under drought- stress conditions, RGA1 minor allele cultivars displayed an increase in panicle number (FIG. 4H) compared to RGA1 major allele cultivars, opposite to well-watered conditions. However, despite the increase in panicle numbers, RGA1 minor allele cultivars showed no differences in grains per panicle (FIG.4I) and spikelet fertility (FIG.4J) compared to their RGA1 major allele cultivars, similar to observations under well-watered conditions. Unlike well-watered conditions, lower 100-grain weight was observed with RGA1 minor cultivars compared to RGA1 major cultivars (FIG.4K).

[0266] Similar to well-watered conditions, RGA1 minor allele cultivars exhibited shorter grain length (FIG.5A) and similar grain width (FIG.5B) and sphericity index (FIG.5C) with RGA1 major allele cultivars.

[0267] FIG.5D-F presents the post-harvest parameters of RGA1 allele cultivars. The higher tiller and panicle numbers exhibited by RGA1 minor allele cultivars were correlated with a greater overall yield (mean = 2.1 g / m2) compared to RGA1 major allele cultivars (mean = 1.9 g / m2) (FIG.5D), similar to the yield results under well-watered conditions. The reduced height observed in both RGA1 allele cultivars under drought conditions resulted in no significant difference in biomass (RGA1 major = 223.3 g / m2, RGA1 minor = 197.4 g / m2) between them (FIG.5E), contrary to the results under well-watered conditions. These positive parameters contributed to RGA1 minor allele cultivars maintaining a higher harvest index, thereby outperforming RGA1 major allele cultivars under drought stress conditions (FIG.5F). Transcript abundance analysis of RGA1 minor

[0268] To evaluate the influence of the 14 SNPs on RGA1 transcript expression, quantitative real-time PCR was performed (FIG.6). Representative rice cultivars carrying the RGA1 major and RGA1 minor alleles were examined. Remarkably, transcript abundance analysis revealed that RGA1 minor cultivars exhibited significantly lower levels of RGA1 transcripts compared to RGA1 major allele cultivars.Agent Ref. No. P14945WO00 Discussion

[0269] While d1 mutants exhibit desirable vegetative traits, such as wide, dark green leaves with erect angles, ideal for photoprotection, photo avoidance, and drought stress response, d1 mutants also display undesirable reproductive traits, including short and compact panicles associated with reduction in overall yield. This suggests that null mutation of the RGA1 gene may result in extreme effects, leading to these unfavorable traits. Therefore, identifying a weaker allele of RGA1 could be beneficial in mitigating these undesirable traits and potentially enhancing yield. This analysis shows that the RGA1 minor allele is a weaker variant of RGA1 at the transcript and phenotypic level. Representative cultivars harboring the RGA1 minor allele showed lower RGA1 transcript levels compared to those with the RGA1 major allele. This suggests that the SNPs located in the promoter or introns regulate RGA1 expression.

[0270] Under both well-watered and drought-stressed conditions, RGA1 minor allele cultivars demonstrate superior field performance in comparison to RGA1 major allele cultivars (Table 5). This superiority is underpinned by various advantageous traits observed across vegetative and reproductive stages. Consistent with low levels of RGA1 transcripts, RGA1 minor allele cultivars share similarities with the d1 mutant, such as shorter stature and flag leaves, early flowering, and reduced panicle length, albeit not as severe d1 mutant. Notably, RGA1 minor allele cultivars display narrower flag leaves, opposite of the d1 mutant, suggesting a potential link between the RGA1 null mutation and leaf width observed in d1 mutants. Furthermore, RGA1 minor allele cultivars exhibit a higher proportion of erect and intermediate flag leaf angles compared to RGA1 major cultivars, which are desirable vegetative traits also observed in d1 mutants. Additionally, RGA1 minor allele cultivars display a high proportion of moderately to well- exserted panicles compared to RGA1 major cultivars, which are favorable reproductive traits that are not present in d1 mutants. Moreover, d1 mutants typically produce small, round seeds, resulting in lower 100-grain weight and lower yields. RGA1 minor allele cultivars exhibit shorter grain length, similar to d1 mutants but to a lesser extent. Interestingly, this trait does not significantly impact 100-grain weight and yield under well-watered conditions, which remain comparable between the RGA1 allele cultivars. The presence of these favorable phenotypes in both the vegetative and reproductive stages resulted in a higher harvest index observed in RGA1 minor allele cultivars.

[0271] d1 mutants have been shown to demonstrate drought resistance, lodging resistance, increased photoprotection and decreased photoinhibition, and enhanced mesophyll conductance, leading to greater photosynthesis and water-use efficiency. However, the severe compactness of panicles and enclosed panicle exsertion associated with d1 mutants can negatively impact total yield under drought conditions. Unlike d1 mutants, cultivars carrying the RGA1 minor alleleAgent Ref. No. P14945WO00 display increased tiller and panicle numbers, leading to overall higher yields and harvest index compared to RGA1 major allele cultivars.

[0272] In summary, the RGA1 minor allele represents a potentially weaker variant of the RGA1 gene. Cultivars carrying the RGA1 minor allele exhibit several desirable traits reminiscent of d1 mutants, such as drought resistance, while avoiding undesirable traits like enclosed panicles. These traits contribute to increased yield and harvest index under both well-watered and drought-stressed conditions. Moreover, the prevalence of the RGA1 minor allele in japonica landraces originating from drought-prone environments, combined with RGA1 minor allele cultivars’ superior performance under drought conditions observed in this study, suggests that natural selection or conventional breeding may have favored the prevalence of the RGA1 minor allele in the Japonica varietal group. Moreover, since Indica populations, which are commonly grown by farmers in Southeast Asia including under rainfed conditions, are favored for cultivation, the RGA1 minor allele must be integrated into Indica populations. This integration is particularly crucial considering that the RGA1 minor allele is only present in three rice accessions of the Indica varietal group. In conclusion, the RGA1 minor allele emerges as a promising candidate for integration into rice breeding programs aimed at enhancing field performance, particularly under drought conditions.

[0273] TABLE 5 RGA1 alleles Phenotypes RGA1 major RGA1 minor d1 mutantAgent Ref. No. P14945WO00 Yield (RGA1 (g / m2), d1 (g))91.9 1.88 104 2.1 15.9 3.82Example 2: Field trials of cultivars harboring RGA1 major (-U) vs. RGA1 minor (-F) alleles

[0274] This example describes a second, comprehensive field trial of unfavorable RGA1 allele (“RGA1-U”) vs. minor, favorable allele (“RGA1-F”) drought experiment. The same RGA1-U vs. RGA1-F japonica landraces and other cultivars are grown as in the field trial of Example 1. The few indica landraces that possess the RGA1-F allele and a matched number of indica RGA1-U allele landraces are also included. Moreover, US japonica cultivars including Avant that harbor the (detrimental) RGA1-U allele are included. Check genotypes are the null (d1) mutant in the Taichung 65 background and wild-type Taichung 65 (a Taiwanese variety preferred for this purpose over Nipponbare due to its lack of photoperiod sensitivity), IR64 (a megavariety previously widely grown across Asia but drought-susceptible and still often used as a check), and IR 74371-70-1-1 (Sahbhagi dhan), a highly drought resistant variety.

[0275] Drought is imposed using automated rainout shelters. According to standard protocols, soil moisture is monitored using tensiometers and frequency domain reflectometry; rewatering is performed when soil moisture drops below -65 kPa at 30 cm soil depth. A standard planting density of 25 x 20 cm spacing is used. The randomized complete block design consists of 4 plots per genotype per treatment and about 30 plants per plot. The following phenotypes are quantified: plant architecture (plant height, leaf angle score, tiller number at harvest), physiology (canopy temperature, normalized difference vegetative index (NDVI), photosynthesis, transpiration, and chlorophyll fluorescence); and agronomic traits (biomass at harvest, grain yield, harvest index, categorical measures of panicle type and exsertion). Example 3: Evaluation of the RGA1-F allele introgressed into an elite indica background

[0276] A number of populations have been developed for introgression of traits into elite indica genetic backgrounds. From among the existing japonica x indica populations, there are at least three (Fan Geng 6, Hokkai 188, and Owarihatamochi) that harbor the RGA1-F allele of RGA1 based on whole-genome resequencing. Several different introgressions have been produced in the background of IRRI 154, which is currently the most popular and high yielding variety in the Philippines, but is drought susceptible. Pre-prepared CSSLs (Chromosome Segment Substitution Lines) from the temperate japonica Hokkai 188 in the elite indica IRRI 154 background wereAgent Ref. No. P14945WO00 assessed for presence of the desired RGA1-F allele and background recovery of the elite genome based on whole-genome fingerprint using the 1k RiCA genotyping panel. Candidate lines were confirmed using gene-specific KASP assays designed based off the polymorphism between Hokkai 188 and IRRI 154. The best CSSL line identified (BC2F1 plant IR 163549:2) possessed a fragment spanning the middle of chromosome 5. This line showed 88.8% recovery of the IRRI 154 genomic background (452 out of 509 polymorphic markers were fixed for the IRRI 154 allele; the RGA1 region was in the heterozygous state).

[0277] This germplasm is then built upon for two more seasons to achieve the target near- isogenic genotype (97-99% recovery of the elite IRRI 154 genome). Multiple contrasting sister lines are advanced after the target genotype is reached to provide additional validation of phenotypic effect. Introgression, selection, and seed increase then continues until sufficient seed is generated for the first major field trial on fixed-negative and fixed-positive sister lines (as well as recurrent and donor cultivars). Field trials on the NILs consists of field drought experiments, conducted and measured as described in Example 2, but with the addition of gas exchange measurements of assimilation (A), stomatal conductance (gsw), transpiration (E), and instantaneous water use efficiency (WUE; A / E).

[0278] Concurrently, populations are utilized for recombinant selection (targeting a total introgression size <2cM around RGA1, assessed using specific markers for peak and recombinant selection for which the genomic positions are known). This breaks any potential linkage drag and gives further confidence that effects seen are indeed due to variation at the RGA1 locus. Example 4: Advance introgression of the RGA1-F allele into a US elite japonica cultivar

[0279] Common US cultivars harbor the detrimental RGA1-U allele. Sequence information of 378 US cultivars were additionally analyzed and only 40 harbored the RGA1-F allele, clearly indicating opportunities for improvement. In this example, introgression of the RGA1-F allele into an elite US japonica RGA1-U cultivar in the public domains, including Avant, a recent (2022) cultivar, is initiated. IRRI 154 NILs are used as the RGA1-F donor, with a side-benefit of producing leveraged products with important disease resistance and other abiotic stress tolerance genes.

Claims

Agent Ref. No. P14945WO00 What is claimed is:

1. A rice plant, or a progeny plant, a plant part, or a plant cell thereof, having in its genome an introgressed genetic locus comprising a hypomorphic allele of the endogenous RICE G PROTEIN ALPHA 1 (RGA1) gene, wherein the hypomorphic allele confers drought tolerance.

2. The rice plant of claim 1, wherein the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, an A at position 4668, or a combination thereof, and wherein the position numbering corresponds to SEQ ID NO:

1.

3. The rice plant of claim 1, wherein the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, and an A at position 4668, and wherein the position numbering corresponds to SEQ ID NO:

1.

4. The rice plant of claim 1, wherein the hypomorphic allele comprises a nucleotide sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:

1.

5. The rice plant of claim 1, wherein yield of the elite rice plant is increased relative to a control rice plant without the hypomorphic allele under drought conditions and under well- watered conditions.

6. The rice plant of claim 1, wherein the hypomorphic allele confers semi-dwarf stature.

7. The rice plant of claim 1, wherein the introgressed genetic locus is derived from a genotype set forth in Table 3.

8. The rice plant of claim 1, wherein the rice plant is an elite rice plant; or wherein the rice plant is of a varietal group selected from indica, japonica, cAus, and cBasmati.Agent Ref. No. P14945WO00 9. A method of introgressing a genetic locus conferring drought tolerance to a rice plant, the method comprising: providing a first rice plant with the genetic locus, wherein the genetic locus comprises a hypomorphic allele of the endogenous RGA1 gene; providing a second rice plant; crossing the first rice plant with the second rice plant to produce a population of progeny rice plants; and selecting from the population at least one progeny rice plant having the genetic locus.

10. The method of claim 9, wherein the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, an A at position 4668, or a combination thereof, and wherein the position numbering corresponds to SEQ ID NO:

1.

11. The method of claim 9, wherein the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, and an A at position 4668, and wherein the position numbering corresponds to SEQ ID NO:

1.

12. The method of claim 9, wherein the hypomorphic allele comprises a nucleotide sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:

1.

13. The method of claim 9, wherein the first rice plant is selected from the genotypes set forth in Table 3.

14. The method of claim 9, wherein the second rice plant is ‘IRRI 154’, ‘Avant’, ‘Cypress’, ‘Katy’, ‘Drew’, ‘Cocodrie’, ‘LaGrue’, ‘Kaybonnet’, ‘Lemont’, ‘Saber’, ‘Cybonnet’, ‘Jefferson’, ‘Carolina Gold’, ‘Starbonnet’, ‘Labelle’, or ‘Tebonnet’.

15. The method of claim 9, further comprising crossing the selected progeny rice plant with itself or another rice plant.Agent Ref. No. P14945WO00 16. The method of claim 9, wherein the introgressing comprises marker assisted selection.

17. A modified plant, or a progeny plant, a plant part, or a plant cell thereof, having drought tolerance, the modified plant comprising a hypomorphic allele of an endogenous G protein alpha subunit (Gα) gene.

18. The modified plant of claim 17, wherein the hypomorphic allele comprises one or more nucleotide substitutions at a genomic locus comprising the endogenous Gα gene.

19. The modified plant of claim 18, wherein the one or more nucleotide substitutions are present within the promoter or untranslated region of the endogenous Gα gene.

20. The modified plant of claim 17, wherein the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, an A at position 4668, or a combination thereof, and wherein the position numbering corresponds to SEQ ID NO:

1.

21. The modified plant of claim 17, wherein the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, and an A at position 4668, and wherein the position numbering corresponds to SEQ ID NO:

1.

22. The modified plant of claim 17, wherein the endogenous Gα gene comprises a nucleotide sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, or 47.

23. The modified plant of claim 17, wherein the endogenous Gα gene encodes a polypeptide having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, or 48.Agent Ref. No. P14945WO00 24. The modified plant of claim 17, wherein the plant is a rice, maize, sorghum, soybean, cotton, wheat, canola, potato, tomato, barley, or sugarcane plant.

25. A seed or an asexual propagate of the plant of any one of claims 1-24.

26. A method for producing a plant having drought tolerance, the method comprising: modifying the plant to comprise a hypomorphic allele of an endogenous Gα gene.

27. The method of claim 26, wherein the hypomorphic allele comprises one or more nucleotide substitutions at a genomic locus comprising the endogenous Gα gene.

28. The method of claim 27, wherein the one or more nucleotide substitutions are within the promoter or untranslated region of the endogenous Gα gene.

29. The method of claim 26, wherein the modifying comprises introducing one or more genome editing molecules into a plant or plant cell and selecting a plant comprising the hypomorphic allele.

30. The method of claim 29, wherein the one or more genome editing molecules comprise an RNA-guided endonuclease and a guide RNA.

31. The method of claim 26, wherein the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, an A at position 4668, or a combination thereof, and wherein the position numbering corresponds to SEQ ID NO:

1.

32. The method of claim 26, wherein the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, and an A at position 4668, and wherein the position numbering corresponds to SEQ ID NO: 1.Agent Ref. No. P14945WO00 33. The method of claim 26, wherein the endogenous Gα gene comprises a nucleotide sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, or 47.

34. The method of claim 26, wherein the endogenous Gα gene encodes a polypeptide having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, or 48.

35. The method of claim 26, wherein the plant is a rice, maize, sorghum, soybean, cotton, wheat, canola, potato, tomato, barley, or sugarcane plant.

36. A crop comprising a plurality of the plants of any one of claims 1-24 planted together in an agricultural field.

37. A method of producing a plant part from a crop, the method comprising: cultivating a plurality of the plants of any one of claims 1-24 as a crop, and harvesting the plant part from the plants, optionally wherein the plant part is a fruit, tuber, leaf, stalk, root, or seed.

38. A commodity plant product prepared from the plant or plant part of any one of claims 1- 24, wherein the commodity plant product comprises a nucleic acid containing the hypomorphic allele.

39. The commodity plant product of claim 38, wherein the product is fodder, seed meal, oil, or seed-treatment-coated seed.

40. A method for producing a commodity plant product, the method comprising processing the plant or plant part of any one of claims 1-24 to obtain the product.

41. The method of claim 40, wherein the commodity plant product is fodder, seed meal, oil, or seed-treatment-coated seed.Agent Ref. No. P14945WO00 42. The method of claim 40, wherein the commodity plant product comprises a nucleic acid containing the hypomorphic allele.

43. A method of identifying or selecting a plant comprising a drought tolerance locus, the method comprising: genotyping at least one plant for the presence of a hypomorphic allele of an endogenous Gα gene or a marker in linkage disequilibrium therewith.

44. The method of claim 43, wherein the marker is located within 10 cM, 5 cM, 1 cM, or 0.5 cM of the endogenous Gα gene.

45. The method of claim 43, further comprising selecting at least one plant comprising the drought tolerance locus based on the genotyping.

46. The method of claim 45, further comprising crossing the selected plant with a second plant to produce a population of progeny plants.

47. The method of claim 45, further comprising assaying the selected plant for drought tolerance.

48. The method of claim 43, wherein the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, an A at position 4668, or a combination thereof, and wherein the position numbering corresponds to SEQ ID NO:

1.

49. The method of claim 43, wherein the hypomorphic allele comprises a G at position 898, an A at position 1264, a G at position 1310, a T at position 1625, an A at position 3633, an A at position 3837, an A at position 4286, an A at position 4334, an A at position 4356, an A at position 4412, a T at position 4481, a T at position 4502, a T at position 4667, and an A at position 4668, and wherein the position numbering corresponds to SEQ ID NO: 1.

Images