Use of dshad gene in regulating growth, reproduction, virulence and stress resistance of didymella segeticola

Abstract

Provided is a use of the DsHAD gene in regulating growth, reproduction, virulence and stress resistance of Didymella segeticola. The DsHAD gene is derived from Didymella segeticola, and by means of constructing a knockout gene fragment of the DsHAD gene of D. segeticola and introducing it into D. segeticola protoplasts, a knockout mutant was obtained. Experiments have found that the DsHAD gene plays a role in the growth, reproduction and stress resistance of D. segeticola, and significantly reduces the virulence of D. segeticola in tea leaves. Therefore, DsHAD can serve as a fungicide target and a key protein in the disease pathogenic mechanism, and can be used for the development of agents against diseases caused by D. segeticola and the breeding of disease-resistant new plant varieties, having broad application prospects in the prevention and control of pathogenic fungal diseases of plants.

Description

Application of DsHAD gene in regulating growth, reproduction, pathogenicity and stress resistance of Didymella segeticola TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to application of DsHAD gene in regulating growth, reproduction, pathogenicity and stress resistance of Didymella segeticola. BACKGROUND

[0002] The genus Didymella belongs to the Ascomycota, Dothideomycetes, Pleosporales, Didymellaceae and many fungi of this genus are of certain pathogenicity to various plants (Crous, P.W., Gams, W., Stalpers, J.A., Robert, V., Stegehuis, G. MycoBank: an online initiative to launch mycology into the 21st century. Studies in Mycology, 2004, 50(1): 19-22; Chen, Q., Hou, L.W., Duan, W.J., Crous, P.W., Cai, L. Didymellaceae revisited. Studies in Mycology, 2017, 87: 105-159).For example, Didymella segeticola can cause pepper leaf spot disease (Yang, J., Chen, C., Yin, X., Xu, H., Long, H., Gu, G., Shu, R., Yuan, J., Zhou, H. Didymella segeticola is a new pathogen causing leaf spot disease on Zanthoxylum bungeanum. New Zealand Journal of Crop and Horticultural Science, 2022, 51: 694-703), tobacco leaf spot disease (Guo, Z. N., Xie, H. L., Wang, H. C., Huang, Y., Chen, Q. L., Xiang, L. G., Yu, Z. H., Yang, X. H. Leaf spot caused by Didymella segeticola on tobacco in China. Plant Disease, 2019, 104(5): 1559-1560), tea leaf spot disease (Deng, X., Yang, J., Wan, Y., Han, Y., Tong, H., Chen, Y. Characteristics of leaf spot disease caused by Didymella species and the influence of infection on tea quality. Phytopathology, 2023, 113(3): 516-527). The D. segeticola var. camelliae strain GZSQ-4 (preserved in China General Microbiological Culture Collection Center, strain preservation number: CGMCC 3.20152, preservation address: No. 1 Yard, Beichen West Road, Chaoyang District, Beijing, preservation time: August 2020) was isolated and identified from tea leaf spot disease in Shiqian County, Guizhou Province by the research group of the present inventors. The pathogen can infect tea tree shoots, tender leaves and mature leaves, and cause serious impact on the quality and yield of tea leaves, and technical measures need to be developed for the disease (Zhao, X. Z., Wang, Y., Li, D. X., Ren, Y. F., Chen, Z. Morphological characteristics and phylogenetic analysis of Phoma segeticola var. camelliae, a new pathogen of tea plant. Plant Disease, 2018, 48(4): 556-559).

[0003] The haloacid dehalogenase (HAD) superfamily is the largest of the enzyme superfamilies, and is composed mainly of phosphoesterases, ATPases, phosphotransferases, and sugar phosphomutases (Kaur, H., Rode, S., Sandra, K. P., Mahto, J. K., Alam, M. S., Gupta, D. N., Kar, B., Singla, J., Kumar, P., Sharma, A. K. Characterization of haloacid dehalogenase superfamily acid phosphatase from Staphylococcus lugdunensis. Archives of Biochemistry and Biophysics, 2024, 753, 109888.). Current research has focused mainly on the structural properties of the enzyme, its catalytic properties, and its potential for industrial applications (Kuznetsova, E., Nocek, B., Brown, G., Makarova, K. S., Flick, R., Wolf, Y. I., Khusnutdinova, A., Evdokimova, E., Jin, K., Tan, K., Hanson, A. D., Hasnain, G., Zallot, R., de Crecy-Lagard, V., Babu, M., Savchenko, A., Joachimiak, A., Edwards, A. M., Koonin, E. V., Yakunin, A. F. Functional diversity of haloacid dehalogenase superfamily phosphatases from Saccharomyces cerevisiae: biochemical, structural, and evolutionary insights. Journal of Biological Chemistry, 2015, 290(30): 18678-18698; Yang, L., Lu, Y., Tian, W., Feng, Y., Bai, J., Zhang, H. Insights into the functional divergence of the haloacid dehalogenase superfamily from phosphomonoesterase to inorganic pyrophosphatase.Archives of Biochemistry and Biophysics, 2021, 705, 108896; Wang, Y., Xiang, Q., Zhou, Q., Xu, J., Pei, D. Mini review: advances in 2-haloacid dehalogenases. Frontiers in Microbiology, 2021, 12, 758886.

[0004] So far, the molecular biology research of D. segiticola is still relatively weak, especially the lack of pathogenic mechanism reports. Therefore, fully excavating the pathogenicity related genes of D. segiticola and carrying out functional research can help to fully understand the pathogenic mechanism and disease control of D. segiticola. SUMMARY

[0005] In view of this, one of the purposes of the present application is to provide a new use of DsHAD protein derived from D. segiticola, i.e. the application of DsHAD protein in regulating the pathogenicity and / or growth rate and / or reproductive capacity and / or stress resistance of D. segiticola, wherein the DsHAD protein is a protein with an amino acid sequence as shown in SEQ ID NO. 2 or a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein with an amino acid sequence as shown in SEQ ID NO. 2.

[0006] The second purpose of the present application is to provide the application of biological materials related to DsHAD protein in regulating the pathogenicity and / or growth rate and / or reproductive capacity and / or stress resistance of D. segiticola, wherein the biological materials are nucleic acid molecules encoding DsHAD protein or expression cassettes, recombinant vectors or recombinant microorganisms containing the nucleic acid molecules, such as recombinant vectors or recombinant microorganisms containing the expression cassettes.

[0007] Preferably, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO. 1. The nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA, or RNA, such as mRNA or hnRNA, etc. The vector can be a plasmid, cosmid, bacteriophage or viral vector; the microorganism can be yeast, bacteria, algae or fungi, such as Agrobacterium.

[0008] The third purpose of the present application is to provide the application of the above-mentioned DsHAD protein as a target in the design and screening of antifungal drugs.

[0009] The fourth object of the present application is to provide the use of the above-mentioned DsHAD protein or the above-mentioned biological material in breeding the transgenic D. segoeticola with reduced pathogenicity and / or reduced growth rate and / or reduced reproductive capacity and / or reduced stress resistance.

[0010] The fifth object of the present application is to provide a method for breeding the transgenic D. segoeticola with reduced pathogenicity and / or reduced growth rate and / or reduced reproductive capacity and / or reduced stress resistance, comprising the step of reducing the expression amount and / or activity of the above-mentioned DsHAD protein in the recipient D. segoeticola, to obtain the transgenic D. segoeticola (such as DsHAD knockout mutant). The pathogenicity and / or growth rate and / or reproductive capacity and / or stress resistance of the transgenic D. segoeticola is lower than that of the wild type D. segoeticola.

[0011] Preferably, the method for reducing the expression amount and / or activity of the DsHAD protein in the recipient D. segoeticola is achieved by knocking out or inhibiting or silencing the expression of the gene encoding the DsHAD protein in the recipient D. segoeticola.

[0012] Preferably, the method for knocking out is a method of homologous recombination to knock out the gene encoding the DsHAD protein in the recipient D. segoeticola.

[0013] Preferably, the method of homologous recombination is to introduce a homologous recombination fragment for homologous recombination into the protoplast of the recipient DsHAD.

[0014] The sixth object of the present application is to provide the use of the above-mentioned method in preventing and treating the disease caused by the DsHAD bacteria.

[0015] The present application provides the use of the DsHAD protein and the gene encoding the same derived from D. segoeticola in regulating the pathogenicity, growth rate, reproductive capacity and stress resistance of the plant pathogenic fungus D. segoeticola. It is found that the pathogenicity, growth rate, reproductive capacity and stress resistance of the D. segoeticola after the knockout of the gene encoding the DsHAD protein are significantly reduced. Therefore, the DsHAD can be used as a fungicide target and a key protein in the pathogenic mechanism of the disease caused by the D. segoeticola, to develop the agents for the disease caused by the D. segoeticola and breed new varieties resistant to the disease, and has a broad application prospect in the prevention and treatment of the plant pathogenic fungus disease. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 is a schematic diagram of the DsHAD gene knockout and mutant screening strategy of D. segeticola according to the present application;

[0017] Figure 2 is a map of the plasmid pct74 according to the present application;

[0018] Figure 3 is a PCR electrophoresis map for verification of transformants according to the present application;

[0019] Figure 4 is a diagram of the colony growth of wild type and mutant ΔDsHAD on PDA according to the present application;

[0020] Figure 5 is a statistical diagram of the colony growth rate of wild type and mutant ΔDsHAD on PDA according to the present application;

[0021] Figure 6 is a statistical diagram of the spore production and spore germination rate of wild type and mutant ΔDsHAD according to the present application;

[0022] Figure 7 is a diagram of the colony growth of wild type and mutant ΔDsHAD under different stress conditions according to the present application;

[0023] Figure 8 is a statistical diagram of the colony growth inhibition rate of wild type and mutant ΔDsHAD under different stress conditions according to the present application;

[0024] Figure 9 is the pathogenicity determination result of wild type and mutant ΔDsHAD on tea leaves according to the present application. DETAILED DESCRIPTION

[0025] The present application will be described in detail below with reference to the examples, which are merely illustrative and not restrictive to the scope of the present application. The present application is not limited to the following embodiments or examples, and any modification and variation made without departing from the spirit of the present application shall be included in the scope of the present application. The experimental materials used in the following examples are commercially available unless otherwise specified.

[0026] In the following examples, the wild type strain GZSQ-4 of D. segeticola was isolated and identified from tea leaf blight in a tea leaf base in Datun Village, Longtang Town, Shiqian County, Guizhou Province, and was deposited in China General Microbiological Culture Collection Center, with the strain deposit number CGMCC 3.20152 and the deposit address No. 1, Beichen West Road, Chaoyang District, Beijing. The genomic DNA sequence and CDS sequence of the DsHAD gene in the strain are shown in SEQ ID NO. 1, and by sequence alignment, the gene should belong to the haloacid dehalogenase (HAD) superfamily gene; the amino acid sequence of the DsHAD protein encoded by the gene is shown in SEQ ID NO. 2.

[0027] Example 1 DsHAD gene knockout of D. segeticola

[0028] 1. Constructing a knockout gene fragment

[0029] 1) Amplification of the homologous sequences upstream and downstream of the target gene: The genomic DNA of the wild type strain D. segiticola CGMCC 3.20152 was used as a template, and primer 1F and 2R were used to amplify the upstream A fragment, and primer 3F and 4R were used to amplify the downstream B fragment. A reverse complementary sequence of primer HYG-F was added to the 5' end of primer 2R, and a reverse complementary sequence of primer HYG-R was added to the 5' end of primer 3F. The sequences of primers 1F, 2R, 3F, 4R, HYG-F, and HYG-R (from 5' end to 3' end) are as follows:

[0030] 1F: TACGAAGTTTGGAAGAACCGC

[0031] 2R: ACCTCCACTAGCTCCAGCCAAGTACGTAGAGCTTCCTTACGATCG

[0032] 3F: GAATAGAGTAGATGCCGACCGGGGGAAGATCAAGAAGCCTACAGTG

[0033] 4R: AGAATCGTGACGGTGCTTTTC

[0034] HYG-F: CTTGGCTGGAGCTAGTGGAGGT

[0035] HYG-R: CCCGGTCGGCATCTACTCTATTC

[0036] 2) Amplification of the hygromycin resistance gene hph: The plasmid pCT74 (map as shown in Figure 1) was used as a template, and primers HYG-F and HYG-1R were used to amplify the first half of the hygromycin resistance gene H1 (1094 bp) fragment, and primers HYG-1F and HYG-R were used to amplify the second half of the hygromycin resistance gene H2 (748 bp) fragment. The sequences of primers HYG-1F and HYG-1R (from 5' end to 3' end) are as follows: HYG-1F: CGTTGCAAGACCTGCCTGAA; HYG-1R: GGATGCCTCCGCTCGAAGTA.

[0037] 3) Fusion of the upstream and downstream fragments of the target gene with the hygromycin resistance gene: Overlapping PCR was used to overlap the recovered A fragment and B fragment with H1 fragment and H2 fragment, respectively, to obtain A-H1 and H2-B connection fragments. Primers 1F / HYG-1R and HYG-1F / 4R were used to amplify A-H1 and H2-B fragments, respectively, and the knockout fragment was purified to a concentration of 500 ng / μL.

[0038] 2. Preparation of D. segiticola protoplasts

[0039] 1) D. segiticola was inoculated in potato dextrose broth (PDB) and incubated at 25°C for 36 h, and the mycelium was collected into a 2 mL centrifuge tube. The mycelium was broken by a grinder, and the mycelium suspension was transferred into CM liquid medium and shaken for 36 h. Fresh mycelium of D. segiticola was collected by filtration.

[0040] 2) 10 mL of 0.8 mol / L potassium chloride solution was used as an osmotic pressure stabilizer to prepare a mixed enzyme solution of Drislase, lysozyme and snailase. The enzyme solution was used to lyse 5 g of the suspended mycelium at 30°C and 100 rpm for 4 h.

[0041] 3) The filtrate was collected by filtering through 2-3 layers of sterilized lens paper (fiber mesh size 45±12 μm) and washing with 0.8 mol / L potassium chloride. The filtrate was centrifuged at 4°C and 4000 rpm for 6 min, and resuspended in 15 mL of 1.2 mol / L sorbitol buffer (STC) solution.

[0042] 4) The supernatant was discarded, and the protoplasts were resuspended in 1 mL of STC buffer to prepare a protoplast suspension with a concentration of 1 x 10 7 protoplasts / mL. The suspension was placed on ice for use.

[0043] 3. Transformation of D. segiticola protoplasts

[0044] 1) 200 μL of the protoplast suspension was added to a 50 mL centrifuge tube, and 10-20 μg of the A-H1 and H2-B knockout transformation fragments were added. After gentle mixing, the mixture was placed on ice for 20 min.

[0045] 2) 1.4 mL of 40% polyethylene glycol 4000 buffer (PTC) was added in two portions, and the mixture was gently mixed and placed at room temperature for 20 min. Then, 5 mL of TB3 liquid medium was added, and the mixture was mixed and incubated at 25°C and 120 rpm for 12-16 h.

[0046] 3) The mixture was centrifuged at room temperature and 4000 rpm / min for 6 min, and the supernatant was discarded. The remaining 1 mL of the resuspension was used to resuspend the regenerated protoplasts.

[0047] 4) The mixture was mixed and plated on 50 mL of warm TB3 regeneration solid medium. After 24 h of inverted incubation at 25°C, the mixture was overlaid with PDA medium containing 30 μg / mL of hygromycin B, and incubated at 25°C for 2-4 days until the transformants grew. The transformants were subcultured and screened for 3 generations.

[0048] 4. PCR verification of transformants

[0049] After subculturing for 3 generations on PDA medium containing hygromycin, transformants of ΔDsHAD were obtained. DNA was extracted from the transformant colonies using the CTAB method, and PCR amplification was performed using primers to detect the hph gene using primer pair HYGF / HYGR to amplify fragment P1, and to detect whether the target gene was knocked out using primer pair 5F / 6R. The sequences of primers 5F and 6R (5' end to 3' end) are as follows:

[0050] 5F: CCGCTATGTACCCTTCGCAA

[0051] 6R: CACATGGTCTCGTCTGCACT

[0052] The gene knockout fragment was introduced into D. segiticola protoplasts using homologous recombination to obtain hygromycin-positive transformants. PCR verification analysis was performed on the positive transformants using hph gene-specific primers, and the results are shown in Figure 3. The hph gene, the occurrence of homologous recombination upstream, and the occurrence of homologous recombination downstream were detected in the transformants, and the DsHAD gene was not amplified in the electrophoresis map, so the corresponding positive transformants were screened, i.e., the ΔDsHAD knockout mutant was obtained.

[0053] Example 2. Phenotypic observation and stress resistance analysis of D. segiticola wild type and ΔDsHAD knockout mutant

[0054] 1. Colony morphology observation and growth rate determination

[0055] D. segiticola wild type and knockout mutant ΔDsHAD were inoculated on PDA medium, cultured at 25°C in the dark for 8 days, and then the colony diameter was measured using the cross intersection method, and the colony morphology was observed; 3 replicates were set for each treatment.

[0056] The results of colony morphology observation and growth rate determination of D. segiticola wild type and knockout mutant ΔDsHAD on PDA medium are shown in Figures 4 and 5, wherein Figure 4 is a colony growth chart, and Figure 5 is a colony growth rate chart, with the vertical axis representing the colony diameter, and the values being the mean values based on 3 independent experiments, and the data was analyzed by Duncan's new multiple range method (p<0.05). As can be seen from Figures 4 and 5, the colony morphology and growth rate of D. segiticola knockout mutant ΔDsHAD on PDA medium were significantly lower than those of D. segiticola wild type, indicating that the ΔDsHAD gene affects the growth of D. segiticola.

[0057] 2. Measurement of sporulation and spore germination

[0058] D. segicola wild type and knockout mutant ΔDsHAD were inoculated on oat agar (OA) medium and cultured at 25°C in the dark. After 14 days, the mycelium was washed with sterile water and spores were collected using 3-4 layers of sterile filter paper. The supernatant was discarded after centrifugation and the spores were suspended in 0.1% Tween water. The spores were counted using a hemocytometer. Three replicates were set for each treatment. The spores were diluted to a concentration of 10 5 μL was spread on 1% water agar medium. After 14-16 hours, the germination was counted.

[0059] The results of the measurement of sporulation and spore germination of D. segicola wild type and knockout mutant ΔDsHAD on OA medium are shown in Figure 6. The sporulation and spore germination rate of the D. segicola DsHAD knockout mutant ΔDsHAD were significantly lower than that of the wild type, indicating that the pathogenicity and growth and reproduction ability of D. segicola were inhibited after knocking out the DsHAD gene.

[0060] 3. Analysis of stress resistance

[0061] 1) High osmotic stress analysis

[0062] D. segicola wild type and knockout mutant ΔDsHAD were inoculated on PDA medium containing 1 mol / L KCl, 1.0 mol / L NaCl, and 1.0 mol / L sorbitol, respectively, and cultured in an inverted culture at 25°C for 8 days. The colony growth of the knockout mutant ΔDsHAD and the wild type strain was then observed.

[0063] The colony diameters of all strains were measured (cross method) and photographed. The growth inhibition rate of the strain was calculated as (colony diameter of the control strain - colony diameter of the treated strain) / colony diameter of the control strain * 100%.

[0064] 2) Oxidative stress analysis: D. segicola wild type and knockout mutant ΔDsHAD were inoculated on PDA medium containing 20 mmol / L H2O2, respectively, and cultured in an inverted culture at 25°C for 8 days. The colony growth of the knockout mutant ΔDsHAD and the wild type was then observed.

[0065] 3) Cell wall integrity analysis

[0066] The D. segicola wild type and knockout mutant ΔDsHAD were inoculated on PDA medium containing 200 μg / mL Congo red, respectively, and cultured in an inverted incubator at 25°C for 8 days, and then the colony growth of the knockout mutant ΔDsHAD and the wild type strain was observed.

[0067] 4) Cell membrane integrity analysis

[0068] The D. segicola wild type and knockout mutant ΔDsHAD were inoculated on PDA medium containing 0.005% sodium dodecyl sulfate (SDS), respectively, and cultured in an inverted incubator at 25°C for 8 days, and then the colony growth of the knockout mutant ΔDsHAD and the wild type strain was observed.

[0069] The growth of the D. segicola DsHAD knockout mutant ΔDsHAD and the wild type under different stress conditions is shown in Figure 7 (wherein A~F are the growth of the D. segicola wild type strain on medium under different stress conditions; Figure 7 G~L are the growth of the D. segicola mutant strain ΔDsHAD on medium under different stress conditions; 1 mol / L KCl: containing a final concentration of 1 mol / L KCl; 1 mol / L NaCl: containing a final concentration of 1 mol / L NaCl; 0.005% SDS: containing a final concentration of 0.005% SDS; 200 μg / mL Congo red: containing a final concentration of 200 μg / mL Congo red; 20 mmol / L H2O2: containing a final concentration of 20 mmol / L H2O2; 1 mol / L sorbitol: containing a final concentration of 1 mol / L sorbitol); and the relative colony growth inhibition rate of the wild type and the knockout mutant under different stress conditions is shown in Figure 8, wherein the vertical coordinate is the relative growth inhibition rate, the values are the mean values based on three independent experiments, and the data is analyzed by Duncan's new multiple range method (p<0.05). In Figure 8, from left to right are the relative colony growth inhibition rates of the wild type and the knockout mutant under NaCl, KCl, sorbitol, H2O2, SDS and Congo red stress; the data is analyzed by Duncan's new multiple range method (p<0.05). As can be seen from Figure 7 and Figure 8, the relative colony growth inhibition rate of the knockout mutant ΔDsHAD is significantly higher than that of the wild type in the medium containing 20 mmol / L H2O2, indicating that the knockout of the DsHAD gene improves the sensitivity to H2O2. In summary, the knockout of the DsHAD gene significantly reduces the tolerance to oxidative stress.

[0070] Example 3 Pathogenicity analysis of D. segicola knockout mutant

[0071] D. segicola wild type and knockout mutant ΔDsHAD were inoculated on PDA medium respectively, and cultured in 25℃ incubator for 7 days, and then several 4mm diameter sterilized punchers were used to punch the colony cake at the edge of the colony, and then the tea surface was inoculated by the punch, and the tea disease was investigated after 3 days.

[0072] The pathogenicity of D. segicola DsHAD gene knockout mutant ΔDsHAD to tea was determined, and the results are shown in Figure 9, wherein Figure 9A is a diagram of the lesion of tea inoculated with D. segicola wild type strain and mutant strain ΔDsHAD after 3 days; Figure 9B is a diagram of the lesion area measurement results of tea inoculated with D. segicola wild type strain and mutant strain ΔDsHAD after 3 days, the vertical coordinate is the lesion area measurement value, the value is the mean value based on 20 independent experiments, and the data is analyzed by Duncan new complex range method (p<0.05). As shown in Figure 9, compared with the wild type, the lesion area of the knockout mutant ΔDsHAD on the tea is greatly reduced, which indicates that the pathogenicity of D. segicola is inhibited after knocking out the DsHAD gene.

[0073] In summary, the DsHAD gene provided by the present application can be used for the prevention and treatment of diseases caused by D. segicola, and can be used as a target for plant disease prevention and treatment drugs. Those skilled in the art can follow the present specification to develop fungicides for preventing and treating plant diseases, especially diseases caused by D. segicola.

[0074] The conventional techniques and schemes not described in detail in the above examples are well known in the art, and therefore will not be described in detail here. The above examples and / or experimental examples describe the preferred embodiments of the present application in detail, however, the present application is not limited to the specific details in the above embodiments, and within the technical concept of the present application, the technical solutions of the present application can be variously modified, and these simple modifications all belong to the protection scope of the present application.

Claims

1. Use of a DsHAD protein for modulating the pathogenicity and / or growth rate and / or reproductive capacity and / or stress resistance of Didymella segeticola, characterized in that, The DsHAD protein is a protein with an amino acid sequence as shown in SEQ ID NO. 2 or a fusion protein with a tag linked to the N-terminus and / or C-terminus of the protein with an amino acid sequence as shown in SEQ ID NO.

2.

2. Use of a biological material associated with the DsHAD protein as defined in claim 1, for modulating the pathogenicity and / or growth rate and / or reproductive capacity and / or stress resistance of D. segeto- mola, characterized in that, The biological material is a nucleic acid molecule encoding the DsHAD protein or an expression cassette, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule.

3. Use according to claim 2, wherein the compound is ###0002### The nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO.

1.

4. Use of the DsHAD protein as claimed in claim 1 as a target in designing and screening antifungal drugs.

5. Use of the DsHAD protein as claimed in claim 1 in cultivating transgenic D. segeticola with reduced pathogenicity and / or reduced growth rate and / or reduced reproductive ability or reduced stress resistance.

6. A method for breeding a transgenic D. segeticola with reduced pathogenicity and / or reduced growth rate and / or reduced reproductive capacity and / or reduced stress tolerance, characterized in that, The method for reducing the expression amount and / or activity of the DsHAD protein as claimed in claim 1 in the recipient D. segeticola is achieved by knocking out or inhibiting or silencing the expression of the gene encoding the DsHAD protein in the recipient D. segeticola.

7. The method of claim 6, wherein, The method for knocking out is a method for homologous recombination.

8. The method of claim 7, wherein, The method for homologous recombination is a method for introducing a homologous recombination fragment for homologous recombination into the protoplast of the recipient D. segeticola.

9. The method of claim 8, wherein, 10. Use of the method as claimed in claim 9 in preventing and treating diseases caused by D. segeticola. ​

Images