Array for detecting nucleic acid spatial information and detection method

Abstract

Provided are a nucleic acid array for detecting nucleic acid spatial information in a sample, a method for detecting nucleic acid spatial information in a sample based on the array, and a method for producing the nucleic acid array.

Description

Arrays for detecting nucleic acid spatial information and methods of detection TECHNICAL FIELD

[0001] The present application relates to the field of biomolecular spatial detection. Specifically, the present application provides a nucleic acid array for detecting nucleic acid spatial information in a sample, a method of detecting nucleic acid spatial information in a sample based on the array, and a method of producing the nucleic acid array. BACKGROUND

[0002] Spatial omics technology is a technology for obtaining omics information such as transcriptome, genome, epigenome and proteome in cells in situ in tissues. Spatial omics technology was ranked as the annual technical method by Nature methods in 2020, and was again ranked as one of the seven most attention-worthy technologies by Nature in 2022, and was ranked as one of the top ten emerging technologies by the World Economic Forum in 2023. Spatial omics technology can be divided into four categories based on different principles, namely spatial omics technology of microdissection, in situ hybridization, in situ sequencing, chip in situ capture and high-throughput sequencing. Spatial omics technology based on chip in situ capture occupies a dominant position due to its advantages of simple operation, high throughput, etc., and the capture chip is the key to this technology.

[0003] The spatial omics technology based on chip capture is to capture nucleic acid molecules of tissue sections in situ by probes with spatial information on the chip, then obtain spatial information and intracellular nucleic acid molecule information on the chip by high-throughput sequencing technology, and finally restore the molecular information in the tissue by algorithm analysis. Since 2016, Joakim Lundeberg of the Royal Institute of Technology in Sweden first published the spatial transcriptome technology in Science, and because of the advantages of high-throughput whole transcriptome, this field has developed rapidly in recent years. Similar other spatial transcriptome technologies include HDST technology (High-definition spatial transcriptomics) based on silica magnetic beads, slide-seq technology (sequencing by oligonucleotide ligation and detection) based on barcoded microbeads, DBiT-seq technology (Deterministic Barcoding in Tissue) based on microfluidic technology, Seq-Scope technology based on Illumina sequencing platform, and stereo-seq technology (spatial enhanced resolution omics sequencing) based on DNB sequencing platform. Among them, Joakim's spatial transcriptome technology was acquired by 10x Genomics company at the end of 2018 and commercialized, and Visium product was released in 2019. So far, based on this technology, 10x has formed another spatial omics product line including instrument equipment, analysis software and reagent consumables in addition to the single-cell product line. Meanwhile, based on this technology, the domestic company Bionano has released the spatial transcriptome product in 2022.

[0004] Spatial omics is a kind of in situ cell omics technology, but compared with single-cell technology, the resolution and gene capture efficiency of existing spatial omics technology are not high, and it cannot realize real spatial single-cell sequencing, which limits the application scenarios of spatial omics technology.

[0005] SUMMARY

[0006] The high-throughput single-cell transcriptome technology synthesizes a large number of probes on the magnetic beads to capture the intracellular transcripts. The magnetic beads are three-dimensional structures, and the surface can be modified with a large number of probes. However, the existing spatial omics technology uses a flat capture chip, and the probes can only be modified on the surface of the two-dimensional chip, so the surface area for modifying the probes is limited, thereby limiting the number of probes.

[0007] In order to achieve high-resolution and high-capture-efficiency spatial omics technology at the same time, the present application splits the capture zone and spatial information on the capture probe of the prior art chip into two independent molecules, i.e. the positioning probe and the capture probe, wherein the positioning probe is used to provide spatial position information of spatial omics, and the capture probe is used to capture molecules in cells, and further, the capture chip of the present application is also connected with a skeleton molecule, which contains a plurality of anchor regions capable of binding to the capture probe, and the capture probe binds to the skeleton molecule to increase the number of capture probes that can be grafted on the chip, thereby breaking the limitation of the number of capture probes by grafting surface area, so as to improve the capture efficiency of molecules in biological samples while ensuring high resolution.

[0008] Nucleic acid array

[0009] Therefore, in one aspect, the present application provides a nucleic acid array for detecting spatial information of nucleic acids in a sample, comprising a solid support connected with a skeleton molecule and a positioning probe;

[0010] The skeleton molecule and the positioning probe are each independently connected to the solid support;

[0011] The positioning probe contains a positioning sequence, wherein the positioning sequence has a nucleotide sequence corresponding to the position of the positioning probe on the solid support;

[0012] The skeleton molecule contains an anchor region capable of anchoring a capture probe.

[0013] In certain embodiments, the positioning probe molecules and the skeleton molecules of the nucleic acid array are separated from each other.

[0014] In certain embodiments, the anchor region is capable of forming a covalent and / or non-covalent linkage with the capture probe. For example, the anchor region anchors the capture probe to the skeleton molecule by forming a covalent and / or non-covalent linkage with the capture probe. For example, the anchor region and the capture probe each contain one of a pair of reactive groups capable of undergoing a linkage reaction. For example, the anchor region contains a sequence capable of hybridizing with the capture probe.

[0015] In certain embodiments, the skeleton molecule is a polymer, the anchor region is located on a branch of the polymer, and the anchor region contains a group capable of forming a linkage with the capture probe. In certain embodiments, the anchor region contains a group capable of undergoing a linkage reaction with the capture probe. In certain embodiments, the anchor region contains a group capable of undergoing a linkage reaction with a modified group contained in the capture probe (e.g., a modified group contained in the non-capture sequence region of the capture probe, such as a modified group contained at the 5' end of the capture probe).

[0016] In certain embodiments, the anchor region comprises an anchor sequence capable of hybridizing to a capture probe.

[0017] In certain embodiments, the solid support is linked to at least two of the scaffold molecules, each of the scaffold molecules independently comprising at least one or at least two anchor regions.

[0018] In certain embodiments, each of the anchor regions independently comprises the anchor sequence capable of hybridizing to a capture probe.

[0019] In certain embodiments, each of the scaffold molecules independently comprises at least two anchor regions, the anchor sequences comprised by the same scaffold molecule are the same as each other, different from each other, or partially the same; and / or, the anchor sequences comprised by different scaffold molecules are the same as each other, different from each other, or partially the same.

[0020] In certain embodiments, different scaffold molecules linked to the solid support comprise the same anchor sequence.

[0021] In certain embodiments, each of the scaffold molecules independently comprises at least two anchor regions, the scaffold molecule optionally comprises a spacer between adjacent anchor regions.

[0022] In certain embodiments, each of the spacers is independently selected from the group consisting of: a gap sequence of abasic units, an alkyl group comprising 2 to 18 carbon atoms, a polyethylene glycol (PEG), a double-stranded nucleic acid, and any combination thereof.

[0023] In certain embodiments, each of the spacers is independently selected from the group consisting of: a C12 spacer, a C6 spacer, a C3 spacer, a C9 spacer, a C18 spacer, and any combination thereof.

[0024] In certain embodiments, the spacer is a C12 spacer.

[0025] In certain embodiments, the solid support is linked to at least one, at least two, or more localization probes, the localization sequences of different localization probes are different.

[0026] In certain embodiments, each of the localization probes occupies a different position on the solid support.

[0027] In certain embodiments, the localization sequence has a nucleotide sequence that uniquely corresponds to the position of the localization probe on the solid support.

[0028] In certain embodiments, each of the localization probes independently contains at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1500, at least 2000, at least 2500, at least 3000, at least 3500, at least 4000, at least 4500, at least 5000, at least 5500, at least 6000, at least 6500, at least 7000, at least 7500, at least 8000, at least 8500, at least 9000, at least 9500, or at least 10000 of the localization probe molecules.

[0029] In certain embodiments, localization probe molecules belonging to the same type of localization probe contain the same localization sequence, and localization probe molecules belonging to different types of localization probes contain different localization sequences.

[0030] As will be readily understood by one skilled in the art, one or more localization probe molecules of the same type of localization probe have the same localization sequence, however, it is not required that every localization probe molecule of each type of localization probe have the same complete sequence.

[0031] In certain embodiments of the nucleic acid arrays of the application, one, two, or more types of localization probes can be attached to the same location on the surface of the solid support, but different types of localization probes are attached to different locations on the surface of the support. For example, location A on the surface of the solid support can have attached thereto different types of localization probes al, a2, a3, and / or an, which contain different localization sequences from each other, and each of the localization probes al, a2, a3, an independently comprises one or more localization probe molecules (e.g., each of the localization probes al, a2, a3, an independently comprises one or more copies); location B on the surface of the solid support can have attached thereto different types of localization probes bl, b2, b3, and / or bm, which contain different localization sequences from each other, and each of the localization probes bl, b2, b3, bm independently comprises one or more localization probe molecules (e.g., each of the localization probes bl, b2, b3, bm independently comprises one or more copies); and the localization sequences contained in the localization probes al, a2, a3, an, bl, b2, b3, bm are different from each other.

[0032] In certain embodiments, the localization probe further comprises a first universal sequence.

[0033] In certain embodiments, the first universal sequence is located 3' of the localization sequence.

[0034] In certain embodiments, the first universal sequence comprised by different species of locater probes attached to the solid support is the same or not the same. In certain embodiments, the first universal sequence comprised by different species of locater probes attached to the solid support is the same. In certain embodiments, the first universal sequence comprised by the same species of locater probes attached to the solid support is the same or not the same.

[0035] In certain embodiments, the locater probe further comprises a second universal sequence.

[0036] In certain embodiments, the second universal sequence is located at the 5' end of the locater sequence.

[0037] As those skilled in the art readily appreciate, "the second universal sequence is located at the 5' end of the locater sequence" is intended to mean that the second universal sequence is located upstream of the locater sequence, the second universal sequence and the locater sequence can be immediately adjacent, or there can optionally be any number of nucleotide residues between the second universal sequence and the locater sequence.

[0038] Similarly, unless otherwise indicated herein or otherwise apparent from context, "sequence A is located at the 5' end of sequence B," "sequence A is located at the 3' end of sequence B," "sequence A is located upstream of sequence B," "sequence A is located downstream of sequence B," or other similar expressions, are used merely to describe the relative positions of sequence A and sequence B, which can be immediately adjacent, or there can optionally be any number of nucleotide residues between sequence A and sequence B.

[0039] As used herein, the term "downstream" is used to describe the relative position of two nucleic acid sequences (or two nucleic acid molecules), and has the meaning generally understood by those skilled in the art. For example, the expression "one nucleic acid sequence is located downstream of another nucleic acid sequence" means that, when arranged in the 5' to 3' direction, the former is located at a more posterior position (i.e., a position closer to the 3' end) than the latter. As used herein, the term "upstream" has the opposite meaning of "downstream."

[0040] In certain embodiments, the second universal sequence comprised by different species of locater probes attached to the solid support is the same or not the same. In certain embodiments, the second universal sequence comprised by different species of locater probes attached to the solid support is the same. In certain embodiments, the second universal sequence comprised by the same species of locater probes attached to the solid support is the same or not the same.

[0041] In certain embodiments, the locater probe does not comprise or further comprises a molecular identifier (MID).

[0042] In certain embodiments, the localization probe further comprises a MID sequence.

[0043] In certain embodiments, the MID sequence is located at the 5' end of the first universal sequence, and / or the MID sequence is located at the 3' end of the second universal sequence.

[0044] In certain embodiments, the MID sequence comprised by each localization probe in a same localization probe is different from each other.

[0045] In certain embodiments, the MID sequence comprised by each localization probe in all localization probes attached to the solid support is different from each other.

[0046] In certain embodiments, the localization probe does not comprise a capture sequence.

[0047] In certain embodiments, the 5' end and / or 3' end of the localization probe is optionally blocked.

[0048] In certain embodiments, the nucleic acid array has one or more of the following features:

[0049] (1) the anchor region comprises an anchor sequence capable of hybridizing to a capture probe, the anchor sequence being a nucleotide sequence consisting of 5-100 nucleotide residues;

[0050] (2) the scaffold molecule is a single-stranded nucleic acid or a double-stranded nucleic acid comprising a single-stranded region; in certain embodiments, the scaffold molecule is a single-stranded nucleic acid, or the scaffold molecule is a double-stranded nucleic acid comprising a single-stranded region comprising an anchor sequence capable of hybridizing to a capture probe;

[0051] (3) the scaffold molecule contains at least 1, at least 2, at least 3, at least 4, at least 5, at least 8, at least 10, at least 15, or at least 20 anchor regions;

[0052] (4) each localization probe comprises at least one localization probe molecule attached to the solid support;

[0053] (5) the localization sequence consists of a nucleotide sequence of 5-50 random nucleotides, in certain embodiments, each random nucleotide is independently any one of deoxyribonucleotides A, C, G, and T;

[0054] (6) the same kind of the localization probes occupy the same area of the surface of the solid support, different kinds of the localization probes occupy different areas of the surface of the support, and the center distance between any two adjacent areas is less than 10 μm (e.g., less than 8 μm, less than 5 μm, less than 3 μm, less than 1 μm, less than 900 nm, less than 800 nm, less than 700 nm, less than 600 nm, less than 500 nm, less than 400 nm, less than 300 nm, less than 250 nm, less than 220 nm, less than 200 nm, less than 100 nm, less than 90 nm, less than 80 nm, less than 70 nm, less than 60 nm, less than 50 nm, less than 40 nm, less than 30 nm, less than 20 nm, less than 10 nm);

[0055] (7) there are at least 100 (e.g., 500-10,000) of the scaffold molecules in the vicinity of each of the localization probes; in certain embodiments, there are at least 100 (e.g., 500-10,000) of the scaffold molecules within a radius of less than 10 μm (e.g., less than 8 μm, less than 5 μm, less than 3 μm, less than 1 μm, less than 900 nm, less than 800 nm, less than 700 nm, less than 600 nm, less than 500 nm, less than 400 nm, less than 300 nm, less than 200 nm, less than 100 nm, less than 90 nm, less than 80 nm, less than 70 nm, less than 60 nm, less than 50 nm, less than 40 nm, less than 30 nm, less than 20 nm, less than 10 nm, e.g., 200-300 nm) around the center of the location of the solid support (e.g., the center of the area of the surface of the solid support occupied by each of the localization probes);

[0056] (8) the solid support is selected from the group consisting of latex beads, dextran beads, polystyrene surface, polypropylene surface, polyacrylamide gel, gold surface, glass surface, chip, sensor, electrode, and silicon wafer; in certain embodiments, the solid support is a chip (e.g., a sequencing chip);

[0057] (9) the solid support is capable of releasing the localization probes spontaneously or upon exposure to one or more stimuli (e.g., change in temperature, change in pH, exposure to a particular chemical or phase, exposure to light, exposure to a reducing agent).

[0058] In certain embodiments, the localization probes and / or the scaffold molecules are covalently and / or non-covalently attached to the solid support.

[0059] In certain embodiments, the localization probes and / or the scaffold molecules are covalently attached to the solid support.

[0060] In certain embodiments, the localization probe and the scaffold molecule are each independently linked to the solid support via the same or different click chemistry reactions.

[0061] In certain embodiments, the pair of molecules or groups capable of undergoing a click chemistry reaction is selected from the group consisting of: alkyne / azido, azido / cyano, amine / enes, thiol / ene, thiol / alkyne, aldehyde / 1,3-diol, ketone / 1,3-diol. In certain embodiments, the pair of molecules or groups capable of undergoing a click chemistry reaction is azido / alkyne.

[0062] In certain embodiments, the solid support is surface-modified with a molecule or group X, the localization probe is modified with a molecule or group Y, the molecule or group X is capable of undergoing a click chemistry reaction with the molecule or group Y, the localization probe is linked to the solid support via the click chemistry reaction of the molecule or group X with the molecule or group Y; and / or, the solid support is surface-modified with a molecule or group X', the scaffold molecule is modified with a molecule or group Y', the molecule or group X' is capable of undergoing a click chemistry reaction with the molecule or group Y', the scaffold molecule is linked to the solid support via the click chemistry reaction of the molecule or group X' with the molecule or group Y'.

[0063] In certain embodiments, the pairs of molecules or groups X / Y and X' / Y' are each independently selected from the group consisting of: alkyne / azido, azido / cyano, amine / enes, thiol / ene, thiol / alkyne, aldehyde / 1,3-diol, ketone / 1,3-diol, azido / alkyne, cyano / azido, enes / amine, enes / thiol, alkyne / thiol, 1,3-diol / aldehyde, 1,3-diol / ketone.

[0064] In certain embodiments, the solid support is surface-modified with an azido group, the localization probe and / or the scaffold molecule is modified with a (DBCO), the localization probe and / or the scaffold molecule is linked to the solid support via the click chemistry reaction of the azido group with DBCO.

[0065] As will be readily understood by those skilled in the art, any portion of the anchor probe can be used for attachment to the solid support, so long as the attachment does not interfere with the anchor probe's ability to perform its function (e.g., annealing to a target sequence and / or initiating an extension reaction at the 3' end). In certain embodiments, the anchor probe is capable of annealing to a target sequence and the 3' end of the anchor probe is capable of initiating an extension reaction, in which case any portion of the anchor probe can be used for attachment to the solid support, so long as the attachment does not interfere with the anchor probe's ability to anneal to a target sequence and / or initiate an extension reaction at the 3' end. In certain embodiments, the anchor probe is capable of annealing to a target sequence and the 3' end of the anchor probe is blocked, in which case any portion of the anchor probe can be used for attachment to the solid support, so long as the attachment does not interfere with the anchor probe's ability to anneal to a target sequence. In certain embodiments, the anchor sequence of the anchor probe is not directly attached to the solid support. In certain embodiments in which the anchor probe comprises a first universal sequence, the first universal sequence of the anchor probe is not directly attached to the solid support. In certain embodiments in which the anchor probe comprises a first universal sequence, neither the first universal sequence nor the anchor sequence of the anchor probe is directly attached to the solid support. In certain embodiments in which the anchor probe comprises a second universal sequence, the anchor probe is attached to the solid support via the second universal sequence. In certain embodiments, the anchor probe is attached to the solid support via the 3' end or the 5' end (e.g., the 5' end).

[0066] As will be readily understood by those skilled in the art, any portion of the scaffold molecule can be used for attachment to the solid support, so long as the attachment does not interfere with the scaffold molecule's ability to perform its function (e.g., annealing to a capture probe). In certain embodiments, the scaffold molecule is attached to the solid support at a region at either end or a spacer. In certain embodiments, the scaffold molecule comprises nucleic acid sequences, and all of the nucleic acid sequences are oriented in the same direction, in which case the 5' end and the 3' end of the scaffold molecule are defined by the orientation of the nucleic acid sequences from 5' to 3', and the scaffold molecule is attached to the solid support via its 5' end (e.g., 5' end) or 3' end. In certain embodiments, the scaffold molecule is attached to the solid support via its 5' end (e.g., 5' end). In certain embodiments, the 3' end of the scaffold molecule is a nucleic acid sequence, in which case the 3' end of the scaffold molecule is blocked or unblocked. In certain embodiments, the scaffold molecule is attached to the solid support via its 3' end (e.g., 3' end), and the 5' end of the scaffold molecule is blocked or unblocked.

[0067] In certain embodiments, the distribution of the scaffold molecules and the localization probes on the solid support is arranged in such a way that a nucleic acid molecule linked to a scaffold molecule (e.g., a nucleic acid molecule annealed to a capture probe linked to a scaffold molecule, or a nucleic acid molecule extended from a capture probe by a nucleic acid polymerization reaction) is capable of contacting a localization probe proximal thereto.

[0068] In certain embodiments, there are at least 100 scaffold molecules proximal to each of the localization probes. For example, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1500, at least 2000, at least 2500, at least 3000, at least 3500, at least 4000, at least 4500, at least 5000, at least 5500, at least 6000, at least 6500, at least 7000, at least 7500, at least 8000, at least 8500, at least 9000, at least 9500, or at least 10000 scaffold molecules.

[0069] In certain embodiments, there are 500-10000 (e.g., 1000-1500, 1000-2000, 1000-3000, 1000-4000, 1000-5000, 1000-8000, 1000-10000) scaffold molecules proximal to each of the localization probes.

[0070] In certain embodiments, the expression "proximal to each of the localization probes" refers to a region on the surface of the solid support in the vicinity of each of the localization probes, wherein a nucleic acid molecule linked to a scaffold molecule distributed in the region (e.g., a nucleic acid molecule annealed to a capture probe linked to a scaffold molecule, or a nucleic acid molecule extended from a capture probe by a nucleic acid polymerization reaction) is capable of contacting a localization probe.

[0071] In certain embodiments, at least 100 of the scaffold molecules are distributed within a radius of 200-300 nm around the center of the location on the solid support occupied by each of the localization probes (e.g., at least 100 of the scaffold molecules are distributed within a radius of 200-300 nm around the center of the area on the surface of the solid support occupied by each of the localization probes).

[0072] In certain embodiments, 500-10,000 (e.g., 1000-1500, 1000-2000, 1000-3000, 1000-4000, 1000-5000, 1000-8000, 1000-10,000) of the scaffold molecules are distributed within a radius of 200-300 nm around the center of the location on the solid support occupied by each of the localization probes (e.g., 500-10,000 of the scaffold molecules are distributed within a radius of 200-300 nm around the center of the area on the surface of the solid support occupied by each of the localization probes).

[0073] As used herein, the expression “area on the surface of the solid support occupied by each of the localization probes” or similar expressions have the same meaning as “location on the solid support occupied by each of the localization probes” and are used interchangeably.

[0074] In certain embodiments, the nucleic acid array does not comprise capture probes.

[0075] In certain embodiments, the nucleic acid array further comprises capture probes, the capture probes comprising a capture sequence capable of annealing to a nucleic acid molecule to be captured.

[0076] In certain embodiments, the capture probes are covalently and / or non-covalently anchored on the anchor region.

[0077] For example, covalent anchoring can be that the anchor region and the capture probe respectively comprise one of a pair of groups capable of undergoing a ligation reaction, the capture probe being anchored to the anchor region by the ligation reaction. For example, non-covalent anchoring can be that the anchor region comprises an anchor sequence capable of hybridizing to the capture probe, the capture probe being anchored on the anchor region by annealing to the anchor sequence.

[0078] In certain embodiments, the scaffold molecule is a polymer, the anchor region is located at a branch of the polymer, and the anchor region comprises a group capable of forming a linkage with a capture probe. In certain embodiments, the anchor region comprises a group capable of undergoing a linkage reaction with the capture probe. In certain embodiments, the anchor region comprises a group capable of undergoing a linkage reaction with a modified group contained by the capture probe (e.g., a modified group contained by a non-capture sequence region of the capture probe, such as a modified group contained by the 5' end of the capture probe).

[0079] In certain embodiments, the anchor region comprises the anchor sequence capable of hybridizing with a capture probe; and the capture probe further comprises a fixation sequence capable of annealing with the anchor sequence.

[0080] In certain embodiments, the fixation sequence is located at the 5' end of the capture sequence.

[0081] In certain embodiments, the capture probe comprises or consists of, from 5' to 3' direction, the fixation sequence and the capture sequence.

[0082] In certain embodiments, the capture probe is anchored to the scaffold molecule via base complementary pairing of the fixation sequence with the anchor sequence.

[0083] In certain embodiments, the capture probe does not comprise or further comprises a molecular identifier (MID) sequence.

[0084] In certain embodiments, the capture probe further comprises a MID sequence.

[0085] In certain embodiments, the MID sequence is located at the 5' end of the capture sequence, and / or the MID sequence is located at the 5' end and / or 3' end of the fixation sequence.

[0086] In certain embodiments, the MID sequence comprised by each of the capture probes in the same kind of capture probe is different from each other.

[0087] In certain embodiments, the MID sequence comprised by each of the capture probes in the nucleic acid array is different from each other.

[0088] In certain embodiments, the nucleic acid array comprises one or more of the capture probes.

[0089] In certain embodiments, the capture sequences contained by different kinds of the capture probes are different.

[0090] In certain embodiments, the fixed sequences comprised by different capture probes are the same or different. In certain embodiments, the fixed sequences comprised by different capture probes are the same.

[0091] In certain embodiments, the capture sequence is a poly(dT) sequence, a random sequence, a target nucleic acid specific sequence, or any combination thereof.

[0092] In certain embodiments, the nucleic acid molecule to be captured is RNA (e.g., mRNA), the capture sequence of the capture probe contains a poly(dT) sequence or a random oligonucleotide sequence; or,

[0093] the nucleic acid molecule to be captured is a target nucleic acid (e.g., a target DNA and / or RNA) or a nucleic acid molecule (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA) derived from the target nucleic acid, the target nucleic acid or the nucleic acid molecule (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA) derived from the target nucleic acid has a target nucleotide sequence, the capture sequence of the capture probe comprises a sequence capable of annealing to the target nucleotide sequence; or,

[0094] the nucleic acid molecule to be captured includes (i) RNA (e.g., mRNA) and (ii) a target nucleic acid (e.g., a target DNA and / or RNA) and / or a nucleic acid molecule (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA) derived from the target nucleic acid, the nucleic acid array comprises a first capture probe capable of capturing RNA (e.g., mRNA) and a second capture probe capable of capturing the target nucleic acid and / or the nucleic acid molecule (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA) derived from the target nucleic acid, the target nucleic acid or the nucleic acid molecule (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA) derived from the target nucleic acid has a target nucleotide sequence; wherein the capture sequence of the first capture probe contains a poly(dT) sequence or a random oligonucleotide sequence, and the capture sequence of the second capture probe contains a sequence capable of annealing to the target nucleotide sequence.

[0095] As would be readily understood by one skilled in the art, the target nucleotide sequence is a sequence associated with the target nucleic acid, e.g., the target nucleotide sequence is a sequence comprised by the target nucleic acid, or the target nucleotide sequence is a sequence complementary to a sequence comprised by the target nucleic acid.

[0096] As will be readily understood by those skilled in the art, the above definitions / descriptions of a capture probe apply equally to the first capture probe and the second capture probe, unless otherwise indicated herein or clearly contradicted by context.

[0097] In certain embodiments, the nucleic acid array has one or more of the following features selected from:

[0098] (1) the capture sequence is located at the 3' end of the capture probe;

[0099] (2) the capture sequence is capable of initiating an extension reaction (e.g., the 3' end of the capture sequence has a free hydroxyl (-OH));

[0100] (3) the capture sequence is not base-paired to the backbone molecule;

[0101] (4) all or a portion of the anchor region in the backbone molecule attached to the solid support is attached to the capture probe;

[0102] (5) the localization probe comprises a first universal sequence that is capable of annealing to (i) an extension product obtained with the nucleic acid molecule captured by the capture sequence, or, (ii) a nucleic acid molecule derived from (i);

[0103] In certain embodiments, the spatial information of the nucleic acids comprises localization, distribution, and / or abundance of the nucleic acids.

[0104] In certain embodiments, the first universal sequence is a nucleotide sequence consisting of 5-80 (e.g., 5-20, 5-30, 5-40, 5-50, 5-70, 10-30, 10-50, 10-70, 20-30, 20-50, 20-70, 25-40, 25-50, 25-70) nucleotides.

[0105] In certain embodiments, the second universal sequence is a nucleotide sequence consisting of 5-80 (e.g., 5-20, 5-30, 5-40, 5-50, 5-70, 10-30, 10-50, 10-70, 20-30, 20-50, 20-70, 25-40, 25-50, 25-70) nucleotides.

[0106] In certain embodiments, the immobilization sequence is a nucleotide sequence consisting of 5-80 (e.g., 5-20, 5-30, 5-40, 5-50, 5-70, 10-30, 10-50, 10-70, 20-30, 20-50, 20-70, 25-40, 25-50, 25-70) nucleotides.

[0107] In certain embodiments, the capture sequence is a nucleotide sequence consisting of 5-50 (e.g., 5-25, 5-35, 5-45, 10-25, 10-35, 10-45, 15-25, 15-35, 15-45, 20-25, 20-35, or 20-45) nucleotides.

[0108] In certain embodiments, the random oligonucleotide sequence is a nucleotide sequence consisting of 5-50 (e.g., 5-25, 5-35, 5-45, 10-25, 10-35, 10-45, 15-25, 15-35, 15-45, 20-25, 20-35, or 20-45) random nucleotides. In certain embodiments, each random nucleotide is, independently of each other, any one of deoxyribonucleotides A, C, G, and T.

[0109] In certain embodiments, the poly(dT) sequence consists of 5-50 (e.g., 5-25, 5-35, 5-45, 10-25, 10-35, 10-45, 15-25, 15-35, 15-45, 20-25, 20-35, or 20-45) thymine deoxyribonucleotide residues.

[0110] In certain embodiments, each of the first universal sequence, the localization sequence, the second universal sequence, the immobilization sequence, the capture sequence independently comprises or does not comprise non-natural nucleotide residues (e.g., modified nucleotide residues).

[0111] Method for preparing a nucleic acid array

[0112] In another aspect, the present application provides a method for preparing a nucleic acid array as described above, comprising the following steps:

[0113] (A) attaching and / or synthesizing a localization probe on a solid support, the localization probe being as defined above; and,

[0114] (B) attaching and / or synthesizing a scaffold molecule on a solid support, the scaffold molecule being as defined above;

[0115] wherein the (A) and (B) can be performed in any order or simultaneously (e.g., simultaneously in the same reaction system).

[0116] In certain embodiments, the (A) is performed before the (B), and the solid support in the (B) is the solid support that has already attached the localization probe.

[0117] In certain embodiments, the (B) is performed before the (A), and the solid support in the (A) is a solid support to which the scaffold molecule has been attached.

[0118] In certain embodiments, the (A) and the (B) are performed simultaneously, and the solid support in the (A) and the (B) is the same solid support.

[0119] In certain embodiments, the step (A) comprises:

[0120] (1) providing: (a) the free positioning probe, wherein the positioning probe is modified with a molecule or group Y; and (b) the solid support, the surface of the solid support being modified with a molecule or group X, the molecule or group X being capable of forming a linkage (e.g., covalent and / or non-covalent linkage) with the molecule or group Y; and,

[0121] (2) contacting the positioning probe with the solid support under conditions suitable for the molecule or group X to form a linkage with the molecule or group Y, thereby obtaining a solid support to which the positioning probe is attached.

[0122] In certain embodiments, in step (2), after obtaining the positional sequence information of the positioning probe, the positioning probe is attached to a predetermined position on the solid support; or, before obtaining the positional sequence information of the positioning probe, the positioning probe is attached to a predetermined position on the solid support, and then the positional sequence information of the positioning probe at different positions is determined to achieve the association of the positioning probe with the position, so that the position corresponding to each positioning probe is determined.

[0123] In certain embodiments, the step (A) further comprises step (3): performing bridge amplification on the positioning probe on the solid support to which the positioning probe is attached, thereby obtaining a multi-copy cluster of each positioning probe.

[0124] As will be readily understood by one skilled in the art, any portion of the localization probe can be used to modify the molecule or group Y, so long as it does not interfere with the localization probe's ability to perform its function (e.g., annealing to a target sequence and / or initiating an extension reaction at the 3' end). In certain embodiments, the localization probe is capable of annealing to a target sequence and the 3' end of the localization probe is capable of initiating an extension reaction, in which case any portion of the localization probe can be used to modify the molecule or group Y, so long as it does not interfere with the localization probe's ability to anneal to a target sequence and / or initiate an extension reaction at the 3' end. In certain embodiments, the localization probe is capable of annealing to a target sequence and the 3' end of the localization probe is blocked, in which case any portion of the localization probe can be used to modify the molecule or group Y, so long as it does not interfere with the localization probe's ability to anneal to a target sequence. In certain embodiments, the localization sequence of the localization probe is not modified with the molecule or group Y. In certain embodiments in which the localization probe comprises a first universal sequence, the first universal sequence of the localization probe is not modified with the molecule or group Y. In certain embodiments, neither the first universal sequence nor the localization sequence of the localization probe is modified with the molecule or group Y. In certain embodiments in which the localization probe comprises a second universal sequence, the second universal sequence of the localization probe is modified with the molecule or group Y. In certain embodiments, the 5' end (e.g., 5' terminus) of the localization probe is modified with the molecule or group Y. In certain embodiments, the molecule or group X is capable of undergoing a click chemistry reaction with the molecule or group Y.

[0125] In certain embodiments, the molecule or group X / Y is selected from the group consisting of: alkyne / azido, azido / cyano, amine / enes, thiol / enes, thiol / alkynes, aldehyde / 1,3-diol, ketone / 1,3-diol, azido / alkyne, cyano / azido, enes / amine, enes / thiol, alkyne / thiol, 1,3-diol / aldehyde, 1,3-diol / ketone.

[0126] In certain embodiments, the molecule or group X / Y is azido / alkyne or alkyne / azido.

[0127] In certain embodiments, the localization probe is modified with (DBCO) and the solid support surface is modified with azido groups, the localization probe and the solid support are linked via a click chemistry reaction between DBCO and azido.

[0128] In certain embodiments, step (A) comprises:

[0129] (1) providing a carrier comprising at least one copy of a carrier sequence, wherein the carrier sequence comprises: a complement of a localization sequence; wherein the localization sequence is as defined above;

[0130] (2) placing the carrier on the surface of the solid support;

[0131] (3) providing a fixed primer and performing a nucleic acid polymerization reaction using the carrier sequence as a template to generate an extension product, wherein the extension product comprises the localization sequence; wherein the fixed primer can anneal to the carrier sequence and initiate the extension reaction; and,

[0132] (4) linking the fixed primer to the surface of the solid support;

[0133] wherein steps (3) and (4) are performed in any order (e.g., step (3) is performed before or after step (4), or step (3) is performed simultaneously with step (4)).

[0134] In certain embodiments, the extension product of step (3) is a localization probe.

[0135] In certain embodiments, in step (2), after obtaining the localization sequence information of the complement of the localization sequence of the carrier, the carrier is placed on a predetermined position on the surface of the solid support; or, before obtaining the localization sequence information of the complement of the localization sequence of the carrier, the carrier is placed on a random position on the solid support, and then the localization sequence information of the localization probe on the random position is determined.

[0136] In certain embodiments, in step (2), the carrier is placed on a random position on the solid support, and in step (3), the localization sequence information of the extension product is determined simultaneously with or after the completion of the nucleic acid polymerization reaction to achieve the association of the localization probe with the position, so that the position corresponding to each localization probe is determined.

[0137] In certain embodiments, in step (2), the carrier is placed on the surface of the solid support by forming a linkage (e.g., a non-covalent linkage and / or a covalent linkage) with the surface of the solid support.

[0138] In certain embodiments, the carrier comprises a plurality of copies of the carrier sequence.

[0139] In certain embodiments, the carrier is a DNB formed by a concatemer of a plurality of copies of the carrier sequence.

[0140] In certain embodiments, the carrier is a DNA cluster formed by a clonal population of the carrier sequence.

[0141] In certain embodiments, the nucleic acid polymerization reaction in step (3) is bridge PCR amplification or multiple strand displacement amplification, resulting in DNA clusters formed by a clonal population of the complement of the vector sequence, e.g., DNA clusters formed by the localization probes.

[0142] As known in the art, there are first immobilized primers and second immobilized primers on the solid support, the 3' end of the first immobilized primers anneals to the 3' end of the vector sequence, and the first immobilized primers are extended with the vector sequence as a template, the 3' end of the resulting first immobilized products anneals to the 3' end of the second immobilized primers, and the second immobilized primers are extended with the first immobilized products as a template, after the second immobilized products are dissociated from the first immobilized products, each of them anneals to and is extended with other first immobilized primers and second immobilized primers, and the cycle continues, initiating cluster amplification, and forming clusters of localization probes. Because each single-stranded DNA template contains different localization sequences representing spatial location information, the sequences of clusters are different from each other.

[0143] In certain embodiments, the method optionally comprises step (5): digesting the vector sequence, and / or, separating the extension products in step (3) from the vector sequence annealed thereto.

[0144] In certain embodiments, the vector sequence further comprises a cleavage site. In certain embodiments, the cleavage is selected from the group consisting of nicking enzyme cleavage, USER cleavage, photo cleavage, chemical cleavage, or CRISPR cleavage. In certain embodiments, in step (5), the vector sequence and the extension products of step (3) annealed thereto are separated by cleaving the cleavage site comprised in the vector sequence.

[0145] In certain embodiments, the vector is provided in step (1) by:

[0146] (i) providing a vector template sequence, the vector template sequence comprising the complement of the vector sequence;

[0147] (ii) performing a nucleic acid amplification reaction with the vector template sequence as a template to obtain an amplification product of the vector template sequence, the amplification product comprising at least one copy of the vector sequence; in certain embodiments, performing rolling circle replication to obtain a DNB formed by concatemers of the vector sequence.

[0148] As used herein, "DNB" (DNA nano ball) is a typical rolling circle amplification (RCA) product, which has the characteristics of RCA products. Among them, the RCA product is a multi-copy single-stranded DNA sequence, which can form a "spherical" structure due to the interaction force between the bases of the internal DNA sequence. Typically, the library molecules are circularized to form single-stranded circular DNA, which is then amplified by orders of magnitude using rolling circle amplification technology, and the resulting amplification product forms a DNB due to the hydrogen bonding between the bases in the molecule.

[0149] In certain embodiments, in step (1), at least one, at least two or more of the carriers are provided, each carrier comprising a positioning sequence in the carrier sequence that is different from the positioning sequence in the carrier sequence of the other carriers; and in step (2), the at least one, at least two or more of the carriers are placed on the surface of the solid support.

[0150] In certain embodiments, in step (1), at least two or more of the carriers are provided, each carrier independently comprising one or more copies (preferably multiple copies) of the carrier sequence.

[0151] In certain embodiments, the carrier sequence further comprises a complement of a first universal sequence, which is as defined above.

[0152] In certain embodiments, the complement of the first universal sequence is located at the 5' end of the complement of the positioning sequence.

[0153] In certain embodiments, the carrier sequence comprises, in the order from 5' to 3', the complement of the first universal sequence, and the complement of the positioning sequence.

[0154] In certain embodiments, the extension product comprises, in the order from 5' to 3', the positioning sequence, and the first universal sequence.

[0155] In certain embodiments, the carrier sequence further comprises a complement of a second universal sequence or a partial sequence thereof (e.g., the carrier sequence further comprises a complement of the second universal sequence or a 3' partial sequence thereof), which is as defined above.

[0156] In certain embodiments, the complement of the second universal sequence or the partial sequence thereof is located at the 3' end of the complement of the positioning sequence.

[0157] In certain embodiments, the immobilized primer comprises the second universal sequence or a partial sequence thereof (e.g., the immobilized primer comprises the second universal sequence or a 5' end partial sequence thereof).

[0158] In certain embodiments, the extension product comprises, in the 5' to 3' direction, in order: the second universal sequence, the indexing sequence, and the first universal sequence.

[0159] In certain embodiments, the carrier sequence does not comprise or further comprises a template sequence of a MID sequence.

[0160] In certain embodiments, the carrier sequence further comprises a template sequence of a MID sequence. In certain embodiments, the template sequence of the MID sequence is located 3' to the complement of the first universal sequence, and / or, the template sequence of the MID sequence is located 5' to the complement of the second universal sequence or a partial sequence thereof; in certain embodiments, the MID sequence consists of 5-50 (e.g., 5-25, 5-35, 5-45, 10-25, 10-35, 10-45, 15-25, 15-35, 15-45, 20-25, 20-35, or 20-45) degenerate deoxyribonucleotide residues.

[0161] In certain embodiments, the immobilized primer is covalently and / or non-covalently attached to the solid support.

[0162] In certain embodiments, the immobilized primer is covalently attached to the solid support.

[0163] In certain embodiments, the immobilized primer is attached to the solid support via a click chemistry reaction.

[0164] In certain embodiments, the molecule or group pair capable of undergoing the click chemistry reaction is selected from: alkynyl / azido, azido / cyano, amine / enes, thiol / ene, thiol / alkyne, aldehyde / 1,3-diol, ketone / 1,3-diol; in certain embodiments, the molecule or group pair capable of undergoing the click chemistry reaction is azido / alkynyl.

[0165] In certain embodiments, the immobilized primer is modified with (DBCO), the solid support surface is modified with azido, and the immobilized primer and the solid support are attached via a click chemistry reaction between DBCO and azido.

[0166] In certain embodiments, the nucleic acid array does not comprise a capture probe.

[0167] In certain embodiments, the step (B) comprises:

[0168] (1) providing: (a) the free scaffold molecule, wherein the scaffold molecule is as defined above, and the scaffold molecule is modified with a molecule or group Y'; and (b) the solid support, the surface of the solid support being modified with a molecule or group X' that is capable of forming a linkage (e.g., a covalent and / or non-covalent linkage) with the molecule or group Y'; and,

[0169] (2) contacting the scaffold molecule with the solid support under conditions suitable for the molecule or group X' to form a linkage with the molecule or group Y', thereby obtaining a solid support having the scaffold molecule linked thereto.

[0170] As will be readily appreciated by one skilled in the art, any portion of the scaffold molecule can be used to modify the molecule or group Y' as long as it does not interfere with the function of the capture probe (e.g., the function of annealing to a capture probe). In certain embodiments, the anchor sequence of the scaffold molecule does not modify the molecule or group Y'. In certain embodiments, the 5' end (e.g., 5' terminus) or 3' end (e.g., 3' terminus) of the scaffold molecule is modified with the molecule or group Y'.

[0171] In certain embodiments, the molecule or group X' is capable of undergoing a click chemistry reaction with the molecule or group Y'.

[0172] In certain embodiments, the molecule or group X' / Y' is selected from the group consisting of: alkyne / azido, azido / cyano, amine / alkene, thiol / alkene, thiol / alkyne, aldehyde / 1,3-diol, ketone / 1,3-diol, azido / alkyne, cyano / azido, alkene / amine, alkene / thiol, alkyne / thiol, 1,3-diol / aldehyde, 1,3-diol / ketone.

[0173] In certain embodiments, the molecule or group X' / Y' is azido / alkyne or alkyne / azido.

[0174] In certain embodiments, the scaffold molecule is modified with (DBCO), the surface of the solid support is modified with an azido group, and the scaffold molecule and the solid support form a linkage via a click chemistry reaction between DBCO and azido.

[0175] In certain embodiments, the nucleic acid array further comprises a capture probe, the capture probe being as defined above, and step (B) comprises:

[0176] (I) (1) providing: (a) free said scaffold molecule, wherein said scaffold molecule is as defined above, and said scaffold molecule is modified with a molecule or a group Y'; and, (b) said solid support, said solid support is surface-modified with a molecule or a group X' capable of forming a linkage (e.g., covalent and / or non-covalent linkage) with said molecule or group Y'; and, (c) free said capture probe, said capture probe is capable of forming a covalent and / or non-covalent linkage with the anchor region of said scaffold molecule;

[0177] (2) contacting said scaffold molecule with said solid support under conditions suitable for said molecule or group X' to form a linkage with said molecule or group Y', thereby obtaining a solid support with said scaffold molecule linked thereto; and,

[0178] (3) contacting said free capture probe with the solid support with said scaffold molecule linked thereto formed in step (2) under conditions suitable for said capture probe to form a linkage with said scaffold molecule, allowing said capture probe to link to said scaffold molecule, thereby obtaining a solid support with said scaffold molecule and said capture probe linked thereto;

[0179] or,

[0180] (II) (1) providing: (a) a scaffold molecule with said capture probe linked thereto, said scaffold molecule is modified with a molecule or a group Y'; and, (b) a solid support, said solid support is surface-modified with a molecule or a group X' capable of forming a linkage (e.g., covalent and / or non-covalent linkage) with said molecule or group Y'; and,

[0181] (2) contacting said scaffold molecule with said capture probe linked thereto provided in step (II)(1)(a) with said solid support under conditions suitable for said molecule or group X' to form a linkage with said molecule or group Y', thereby obtaining a solid support with said scaffold molecule and said capture probe linked thereto.

[0182] In certain embodiments, the anchor region of the scaffold molecule comprises an anchor sequence capable of hybridizing to a capture probe. In certain embodiments, the capture probe comprises a fixed sequence capable of hybridizing to the anchor sequence.

[0183] In certain embodiments, in step (I)(3), the free capture probe is contacted with the solid support with said scaffold molecule linked thereto formed in step (2) under conditions suitable for said scaffold molecule to anneal to said capture probe, allowing said capture probe to anneal to said scaffold molecule.

[0184] In certain embodiments, in step (II)(1), the capture probe-ligated backbone molecule is an annealed product of the backbone molecule and the capture probe. In certain embodiments, in the annealed product, the 3' end of the capture probe comprises a capture sequence, and the capture sequence does not base pair with the backbone molecule.

[0185] As will be readily understood by one skilled in the art, any portion of the backbone molecule can be used to modify the molecule or group Y' as long as it does not affect the function of the capture probe (e.g., the function of annealing to a capture probe). In certain embodiments, the anchor sequence of the backbone molecule does not modify the molecule or group Y'. In certain embodiments, the 5' end (e.g., 5' terminus) or 3' end (e.g., 3' terminus) of the backbone molecule is modified with the molecule or group Y'.

[0186] In certain embodiments, the molecule or group X' is capable of undergoing a click chemistry reaction with the molecule or group Y'.

[0187] In certain embodiments, the molecule or group X' / Y' is selected from the group consisting of: alkyne / azido, azido / cyano, amine / enes, thiol / enes, thiol / alkynes, aldehyde / 1,3-diol, ketone / 1,3-diol, azido / alkyne, cyano / azido, enes / amine, enes / thiol, alkyne / thiol, 1,3-diol / aldehyde, 1,3-diol / ketone.

[0188] In certain embodiments, the molecule or group X' / Y' is azido / alkyne or alkyne / azido.

[0189] In certain embodiments, the backbone molecule is modified with DBCO, and the solid support surface is modified with azido, and the backbone molecule and the solid support are linked via a click chemistry reaction between DBCO and azido.

[0190] In certain embodiments, the backbone molecule is provided by direct synthesis, or the backbone molecule is provided by hybridization or ligation of at least two anchor regions.

[0191] In certain embodiments, the anchor region of the backbone molecule comprises an anchor sequence that is capable of hybridizing to a capture probe, and step (B) comprises:

[0192] (1) providing a support, the support comprising at least one copy of a support sequence, the support sequence comprising a complement of an anchor sequence; the anchor sequence being as defined above;

[0193] (2) placing the support on the surface of the solid support;

[0194] (3) providing a fixed primer and performing a nucleic acid polymerization reaction with the carrier sequence as a template to generate an extension product, the extension product containing the anchor sequence; wherein the fixed primer can anneal to the carrier sequence and initiate the extension reaction; and,

[0195] (4) connecting the fixed primer to the surface of the solid support;

[0196] wherein steps (3) and (4) are performed in any order (e.g., step (3) is performed before or after step (4), or step (3) is performed simultaneously with step (4)).

[0197] In certain embodiments, the extension product of step (3) is the scaffold molecule.

[0198] In certain embodiments, the method further comprises blocking the extension product of step (3) using a blocking oligonucleotide molecule to obtain the scaffold molecule, wherein the blocking oligonucleotide molecule is capable of hybridizing to a non-anchor sequence region in the extension product.

[0199] In certain embodiments, the carrier sequence comprises at least one or at least two complements of the anchor sequence.

[0200] In certain embodiments, in step (2), the carrier is placed on the surface of the solid support by forming a linkage (e.g., a non-covalent linkage and / or a covalent linkage) with the surface of the solid support.

[0201] In certain embodiments, the extension product comprises at least one or at least two of the anchor sequence.

[0202] In certain embodiments, each carrier is a DNB formed from a concatemer of multiple copies of the carrier sequence.

[0203] In certain embodiments, the method optionally comprises step (5): digesting the carrier sequence, and / or separating the extension product of step (3) and the carrier sequence annealed thereto.

[0204] In certain embodiments, the carrier sequence further comprises a cleavage site. In certain embodiments, the cleavage is selected from the group consisting of a nicking enzyme cleavage, a USER cleavage, a photo cleavage, a chemical cleavage, or a CRISPR cleavage. In certain embodiments, in step (5), the carrier sequence and the extension product of step (3) annealed thereto are separated by cleaving the cleavage site comprised in the carrier sequence.

[0205] In certain embodiments, the carrier is provided in step (1) by:

[0206] (i) providing a carrier template sequence, which comprises a complement of the carrier sequence;

[0207] (ii) performing a nucleic acid amplification reaction with the carrier template sequence as a template to obtain an amplification product of the carrier template sequence, which comprises at least one copy of the carrier sequence; in certain embodiments, rolling circle replication is performed to obtain a DNB formed by concatemers of the carrier sequence.

[0208] In certain embodiments, the immobilized primer is covalently and / or non-covalently linked to the solid support.

[0209] In certain embodiments, the immobilized primer is covalently linked to the solid support.

[0210] In certain embodiments, the immobilized primer forms a linkage with the solid support through a click chemistry reaction.

[0211] In certain embodiments, the molecule or group pair capable of undergoing the click chemistry reaction is selected from the group consisting of: alkynyl / azido, azido / cyano, amine / enes, thiol / ene, thiol / alkyne, aldehyde / 1,3-diol, ketone / 1,3-diol; in certain embodiments, the molecule or group pair capable of undergoing the click chemistry reaction is azido / alkynyl.

[0212] In certain embodiments, the immobilized primer is modified with (DBCO), the solid support surface is modified with azido, and the immobilized primer and the solid support form a linkage through a click chemistry reaction between DBCO and azido.

[0213] In certain embodiments, the nucleic acid array further comprises a capture probe, which is as defined above, and the step (B) further comprises a step (6):

[0214] contacting the free capture probe with the solid support with the attached backbone molecule obtained in step (5) under conditions allowing annealing, to anneal the capture probe to the backbone molecule, thereby obtaining a solid support with the attached capture probe.

[0215] In certain embodiments, in step (6), the 3' end of the capture probe comprises a capture sequence, and the capture sequence does not base pair with the backbone molecule.

[0216] In certain embodiments, the backbone molecule does not contain a spacer.

[0217] In certain embodiments, the spacers are each independently selected from the group consisting of: gap sequences of no base units, alkyl groups comprising 2 to 18 carbon atoms, polyethylene glycol (PEG), double-stranded nucleic acids, and any combination thereof.

[0218] In certain embodiments, the spacers are each independently selected from the group consisting of: C12 spacer, C6 spacer, C3 spacer, C9 spacer, C18 spacer, and any combination thereof.

[0219] In certain embodiments, the spacers are C12 spacers.

[0220] In certain embodiments, the distribution of the scaffold molecules and the localization probes on the solid support is arranged in such a way that the nucleic acid molecules linked to the scaffold molecules (e.g., nucleic acid molecules annealed to the capture probes linked to the scaffold molecules, or nucleic acid molecules obtained by extension of the capture probes by nucleic acid polymerization) are able to contact the localization probes adjacent thereto.

[0221] In certain embodiments, there are at least 100 scaffold molecules per adjacent distribution of each of the localization probes. For example, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1500, at least 2000, at least 2500, at least 3000, at least 3500, at least 4000, at least 4500, at least 5000, at least 5500, at least 6000, at least 6500, at least 7000, at least 7500, at least 8000, at least 8500, at least 9000, at least 9500, or at least 10000 scaffold molecules.

[0222] In certain embodiments, there are 500-10000 (e.g., 1000-1500, 1000-2000, 1000-3000, 1000-4000, 1000-5000, 1000-8000, 1000-10000) scaffold molecules per adjacent distribution of each of the localization probes.

[0223] In certain embodiments, the expression “adjacent to each of the localization probes” refers to the area on the surface of the solid support in the vicinity of each of the localization probes, wherein the nucleic acid molecules linked to the scaffold molecules distributed in the area (e.g., nucleic acid molecules annealed to the capture probes linked to the scaffold molecules, or nucleic acid molecules obtained by extension of the capture probes by nucleic acid polymerization) are able to contact the localization probes. In certain embodiments, the expression “adjacent to each of the localization probes” refers to the area on the surface of the solid support in the vicinity of each of the localization probes, wherein the nucleic acid molecules linked to the scaffold molecules distributed in the area (e.g., nucleic acid molecules annealed to the capture probes linked to the scaffold molecules, or nucleic acid molecules obtained by extension of the capture probes by nucleic acid polymerization) are able to contact the localization probes.

[0224] In certain embodiments, at least 100 of the scaffold molecules are distributed within a radius of 200-300 nm around the center of the location on the solid support occupied by each of the localization probes (e.g., at least 100 of the scaffold molecules are distributed within a radius of 200-300 nm around the center of the area on the surface of the solid support occupied by each of the localization probes). For example, at least 100, at least 200, at least 300, 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1500, at least 2000, at least 2500, at least 3000, at least 3500, at least 4000, at least 4500, at least 5000, at least 5500, at least 6000, at least 6500, at least 7000, at least 7500, at least 8000, at least 8500, at least 9000, at least 9500, or at least 10000 of the scaffold molecules.

[0225] In certain embodiments, 500-10000 (e.g., 1000-1500, 1000-2000, 1000-3000, 1000-4000, 1000-5000, 1000-8000, 1000-10000) of the scaffold molecules are distributed within a radius of 200-300 nm around the center of the location on the solid support occupied by each of the localization probes (e.g., 500-10000 (e.g., 1000-1500, 1000-2000, 1000-3000, 1000-4000, 1000-5000, 1000-8000, 1000-10000) of the scaffold molecules are distributed within a radius of 200-300 nm around the center of the area on the surface of the solid support occupied by each of the localization probes).

[0226] As used herein, the expression “area on the surface of the solid support occupied by each of the localization probes” or similar expressions have the same meaning as “location on the solid support occupied by each of the localization probes” and are used interchangeably.

[0227] In another aspect, the present application provides a method of preparing a nucleic acid array as described above, comprising the steps of:

[0228] (A) providing a nucleic acid array to be treated, said nucleic acid array to be treated comprising a solid support having attached thereto oligonucleotide molecules;

[0229] said oligonucleotide molecules comprising a localization sequence, wherein said localization sequence has a nucleotide sequence corresponding to the location of the oligonucleotide molecule on the solid support; said localization sequence being as defined above;

[0230] and,

[0231] (B) attaching and / or synthesizing scaffold molecules on the solid support comprised in said nucleic acid array to be treated, said scaffold molecules being as defined above.

[0232] In certain embodiments, the solid support is attached to at least one, at least two, or more oligonucleotide molecules, each of which contains a different localization sequence.

[0233] In certain embodiments, each of the oligonucleotide molecules occupies a different position on the solid support.

[0234] In certain embodiments, the localization sequence has a nucleotide sequence that uniquely corresponds to the position of the oligonucleotide molecule on the solid support.

[0235] In certain embodiments, the oligonucleotide molecule further comprises a first universal sequence, which is as defined above.

[0236] In certain embodiments, the first universal sequence is located at the 3' end of the localization sequence.

[0237] In certain embodiments, the oligonucleotide molecule further comprises a second universal sequence, which is as defined above.

[0238] In certain embodiments, the second universal sequence is located at the 5' end of the localization sequence.

[0239] In certain embodiments, the oligonucleotide molecule does not comprise or further comprises a MID sequence.

[0240] In certain embodiments, the oligonucleotide molecule further comprises a MID sequence. In certain embodiments, the MID sequence is located at the 5' end of the first universal sequence, and / or, the MID sequence is located at the 3' end of the second universal sequence. In certain embodiments, the MID sequence comprised by the same oligonucleotide molecule is different from each other. In certain embodiments, the nucleic acid array comprises a different MID sequence comprised by each of the oligonucleotide molecules.

[0241] In certain embodiments, the 3' end of the oligonucleotide molecule does not comprise a capture sequence (e.g., the oligonucleotide molecule does not comprise a capture sequence at the 3' end of the first universal sequence), which is as defined above.

[0242] In certain embodiments, the 3' end of the oligonucleotide molecule comprises a capture sequence (e.g., the oligonucleotide molecule comprises a capture sequence at the 3' end of the first universal sequence), which is as defined above, and the method further comprises a step (B'): removing the capture sequence comprised by the oligonucleotide molecule;

[0243] wherein, the steps (B) and (B') can be performed in any order or simultaneously (e.g., simultaneously in the same reaction system).

[0244] In certain embodiments, the oligonucleotide molecules comprise the first universal sequence, and the capturing sequence contained in the oligonucleotide molecules is removed in step (B') by steps comprising:

[0245] (i) providing a blocking probe capable of annealing to (a) the first universal sequence or a partial sequence thereof (e.g., a 3' end partial sequence of the first universal sequence) of the oligonucleotide molecules, or, (b) a sequence in the oligonucleotide molecules which is 5' to the capturing sequence and 3' to the first universal sequence, or, (c) a combination of (a) and (b);

[0246] (ii) contacting the blocking probe with the nucleic acid array to be processed containing the oligonucleotide molecules under conditions suitable for annealing the blocking probe to the oligonucleotide molecules;

[0247] (iii) contacting an exonuclease with the product of step (ii) under conditions that allow the exonuclease to exert its cleavage activity; wherein the exonuclease has single-stranded nucleic acid 3' to 5' exonuclease activity.

[0248] In certain embodiments, the exonuclease is Exonuclease I.

[0249] In certain embodiments, the step (B') further comprises a step of removing the blocking probe (e.g., by unbinding the blocking probe from the oligonucleotide molecules).

[0250] In certain embodiments, in the method, step (B) is performed after the step (B').

[0251] In certain embodiments, in the nucleic acid array to be processed, the oligonucleotide molecules are covalently and / or non-covalently linked to the solid support.

[0252] In certain embodiments, the oligonucleotide molecules are covalently linked to the solid support.

[0253] In certain embodiments, the oligonucleotide molecules are linked to the solid support via a click chemistry reaction.

[0254] In certain embodiments, the pair of molecules or groups capable of undergoing the click chemistry reaction is selected from: alkyne / azido, azido / cyano, amine / alkene, thiol / alkene, thiol / alkyne, aldehyde / 1,3-diol, ketone / 1,3-diol; in certain embodiments, the pair of molecules or groups capable of undergoing the click chemistry reaction is azido / alkyne.

[0255] In certain embodiments, the solid support surface is modified with azido groups, the oligonucleotide molecule is modified with (DBCO), the oligonucleotide molecule forms a linkage with the solid support via a click chemistry reaction between the azido groups and the DBCO.

[0256] In certain embodiments, the step (B) comprises:

[0257] (1) providing: (a) the free scaffold molecule, wherein the scaffold molecule is as defined above, and the scaffold molecule is modified with a molecule or group Y'; and (b) the nucleic acid array to be treated or the nucleic acid array treated in step (B'), the solid support surface of the nucleic acid array being modified with a molecule or group X' capable of forming a linkage (e.g., covalent and / or non-covalent linkage) with the molecule or group Y'; and,

[0258] (2) contacting the scaffold molecule with the solid support under conditions suitable for the molecule or group X' to form a linkage with the molecule or group Y', thereby obtaining a solid support having the scaffold molecule linked thereto.

[0259] It is readily understood by one skilled in the art that any portion of the scaffold molecule can be used to modify the molecule or group Y' as long as it does not affect the function of the capture probe (e.g., the function of annealing to a capture probe). In certain embodiments, the anchor sequence of the scaffold molecule does not modify the molecule or group Y'. In certain embodiments, the 5' end (e.g., 5' terminus) or 3' end (e.g., 3' terminus) of the scaffold molecule is modified with the molecule or group Y'.

[0260] In certain embodiments, the molecule or group X' is capable of undergoing a click chemistry reaction with the molecule or group Y'.

[0261] In certain embodiments, the molecule or group X' / Y' is selected from: alkyne / azido, azido / cyano, amine / alkene, thiol / alkene, thiol / alkyne, aldehyde / 1,3-diol, ketone / 1,3-diol, azido / alkyne, cyano / azido, alkene / amine, alkene / thiol, alkyne / thiol, 1,3-diol / aldehyde, 1,3-diol / ketone.

[0262] In certain embodiments, the molecule or group X’ / Y’ is azide / alkyne or alkyne / azide.

[0263] In certain embodiments, the scaffold molecule is modified with a DBCO group, the solid support surface is modified with an azido group, and the scaffold molecule and the solid support form a linkage via a click chemistry reaction of DBCO with azido.

[0264] In certain embodiments, the nucleic acid array further comprises a capture probe, which is as defined above, and the step (B) comprises:

[0265] (I) (1) providing: (a) free scaffold molecule, wherein the scaffold molecule is as defined above, and the scaffold molecule is modified with a molecule or group Y’; and (b) the nucleic acid array to be treated or the nucleic acid array treated in step (B’), the solid support surface of which is modified with a molecule or group X’ capable of forming a linkage (e.g., covalent and / or non-covalent linkage) with the molecule or group Y’; and (c) free capture probe capable of forming a covalent and / or non-covalent linkage with the anchor region of the scaffold molecule;

[0266] (2) contacting the scaffold molecule with the solid support under conditions suitable for the molecule or group X’ to form a linkage with the molecule or group Y’, thereby obtaining a solid support with the scaffold molecule linked thereto; and,

[0267] (3) contacting the free capture probe with the solid support with the scaffold molecule linked thereto formed in step (2) under conditions suitable for the capture probe to form a linkage with the scaffold molecule, allowing the capture probe to link to the scaffold molecule, thereby obtaining a solid support with the scaffold molecule and the capture probe linked thereto;

[0268] or,

[0269] (II) (1) providing: (a) scaffold molecule with the capture probe linked thereto, the scaffold molecule being modified with a molecule or group Y’; and (b) the nucleic acid array to be treated or the nucleic acid array treated in step (B’), the solid support surface of which is modified with a molecule or group X’ capable of forming a linkage (e.g., covalent and / or non-covalent linkage) with the molecule or group Y’; and,

[0270] (2) contacting the capture probe-ligated backbone molecule provided in step (II)(1)(a) with the solid support under conditions suitable for allowing said molecule or group X' to form a linkage with said molecule or group Y', thereby obtaining a solid support having said backbone molecule and said capture probe ligated thereto.

[0271] In certain embodiments, the anchor region of the backbone molecule comprises an anchor sequence capable of hybridizing to a capture probe; preferably, the capture probe comprises a fixation sequence capable of hybridizing to the anchor sequence.

[0272] In certain embodiments, in step (I)(3), the free capture probe is contacted with the solid support having the backbone molecule ligated thereto formed in step (2) under conditions suitable for allowing the backbone molecule to anneal to the capture probe, thereby annealing the capture probe to the backbone molecule.

[0273] In certain embodiments, in step (II)(1), the capture probe-ligated backbone molecule is an annealing product of the backbone molecule and the capture probe. In certain embodiments, in the annealing product, the 3' end of the capture probe comprises a capture sequence and the capture sequence does not base pair with the backbone molecule.

[0274] It is readily understood by one skilled in the art that any portion of the backbone molecule can be used to modify the molecule or group Y' as long as it does not affect the function of the capture probe (e.g., the function of annealing to a capture probe). In certain embodiments, the anchor sequence of the backbone molecule does not modify the molecule or group Y'. In certain embodiments, the 5' end (e.g., 5' terminus) or 3' end (e.g., 3' terminus) of the backbone molecule is modified with the molecule or group Y'.

[0275] In certain embodiments, the molecule or group X' is capable of undergoing a click chemistry reaction with the molecule or group Y'.

[0276] In certain embodiments, the molecule or group X' / Y' is selected from the group consisting of: alkynyl / azido, azido / cyano, amine / enes, thiol / enes, thiol / alkynes, aldehyde / 1,3-diol, ketone / 1,3-diol, azido / alkynyl, cyano / azido, enes / amine, enes / thiol, alkynes / thiol, 1,3-diol / aldehyde, 1,3-diol / ketone.

[0277] In certain embodiments, the molecule or group X' / Y' is azido / alkynyl or alkynyl / azido.

[0278] In certain embodiments, the backbone molecule is modified with DBCO, said solid support surface being modified with azido groups, said scaffold molecule and said solid support forming a linkage via a click chemistry reaction between DBCO and azido groups.

[0279] In certain embodiments, said scaffold molecule is provided by direct synthesis, or, by hybridization or ligation of at least two of said anchor regions.

[0280] In certain embodiments, said anchor region of said scaffold molecule comprises an anchor sequence capable of hybridizing to a capture probe, and said step (B) comprises:

[0281] (1) providing a carrier comprising at least one copy of a carrier sequence, said carrier sequence comprising a complement of an anchor sequence; said anchor sequence being as defined above;

[0282] (2) placing said carrier on a solid support surface of said nucleic acid array to be treated or said nucleic acid array treated in step (B’);

[0283] (3) providing a fixed primer and performing a nucleic acid polymerization reaction using said carrier sequence as a template to generate an extension product, said extension product comprising said anchor sequence; wherein said fixed primer is capable of annealing to said carrier sequence and initiating an extension reaction; and,

[0284] (4) linking said fixed primer to said solid support surface;

[0285] wherein steps (3) and (4) are performed in any order (e.g., step (3) is performed before or after step (4), or, step (3) is performed simultaneously with step (4)).

[0286] In certain embodiments, the extension product of step (3) is said scaffold molecule.

[0287] In certain embodiments, said method further comprises blocking the extension product of step (3) with a blocking oligonucleotide molecule to obtain a scaffold molecule, wherein said blocking oligonucleotide molecule is capable of hybridizing to a non-anchor sequence region in said extension product.

[0288] In certain embodiments, said carrier sequence comprises a complement of at least one or at least two anchor sequences.

[0289] In certain embodiments, in step (2), said carrier is placed on said solid support surface by forming a linkage (e.g., a non-covalent linkage and / or a covalent linkage) with said solid support surface.

[0290] In certain embodiments, said extension product comprises at least one or at least two of said anchor sequences.

[0291] In certain embodiments, each of the vectors is a DNB formed by a concatemer of multiple copies of the vector sequence.

[0292] In certain embodiments, the method optionally comprises step (5) digesting the vector sequence, and / or separating the extension product of step (3) and the vector sequence annealed thereto.

[0293] In certain embodiments, the vector sequence further comprises a cleavage site. In certain embodiments, the cleavage is selected from the group consisting of a nicking enzyme cleavage, a USER cleavage, a photo cleavage, a chemical cleavage, or a CRISPR cleavage. In certain embodiments, in step (5), the vector sequence and the extension product of step (3) annealed thereto are separated by cleaving the cleavage site comprised in the vector sequence.

[0294] In certain embodiments, the vector is provided in step (1) by:

[0295] (i) providing a vector template sequence, the vector template sequence comprising a complement of the vector sequence;

[0296] (ii) performing a nucleic acid amplification reaction using the vector template sequence as a template to obtain an amplification product of the vector template sequence, the amplification product comprising at least one copy of the vector sequence; in certain embodiments, performing rolling circle replication to obtain a DNB formed by a concatemer of multiple copies of the vector sequence.

[0297] In certain embodiments, the immobilized primer is covalently and / or non-covalently linked to the solid support.

[0298] In certain embodiments, the immobilized primer is covalently linked to the solid support.

[0299] In certain embodiments, the immobilized primer is linked to the solid support via a click chemistry reaction.

[0300] In certain embodiments, the pair of molecules or groups capable of undergoing the click chemistry reaction is selected from the group consisting of: alkynyl / azido, azido / cyano, amine / enes, thiol / ene, thiol / alkyne, aldehyde / 1,3-diol, ketone / 1,3-diol; in certain embodiments, the pair of molecules or groups capable of undergoing the click chemistry reaction is azido / alkynyl.

[0301] In certain embodiments, the immobilized primer is modified with (DBCO), the solid support surface is modified with an azido group, and the immobilized primer and the solid support are linked via a click chemistry reaction between DBCO and azido.

[0302] In certain embodiments, the nucleic acid array further comprises a capture probe, which is as defined above, and the step (B) further comprises a step (6):

[0303] contacting the free capture probe with the solid support having the backbone molecule attached obtained in step (5) under conditions allowing annealing, annealing the capture probe to the backbone molecule, thereby obtaining a solid support having the capture probe attached.

[0304] In certain embodiments, in step (6), the 3' end of the capture probe comprises a capture sequence, and the capture sequence does not base pair with the backbone molecule.

[0305] In certain embodiments, the backbone molecule does not contain a spacer.

[0306] In certain embodiments, the spacer is each independently selected from the group consisting of: a gapmer, an alkyl group comprising 2 to 18 carbon atoms, polyethylene glycol (PEG), a double-stranded nucleic acid, and any combination thereof.

[0307] In certain embodiments, the spacer is each independently selected from the group consisting of: a C12 spacer, a C6 spacer, a C3 spacer, a C9 spacer, a C18 spacer, and any combination thereof.

[0308] In certain embodiments, the spacer is a C12 spacer.

[0309] In certain embodiments, the distribution of the backbone molecules and the localization probes on the solid support is arranged in such a way that a nucleic acid molecule attached to the backbone molecule (e.g., a nucleic acid molecule annealed to a capture probe attached to the backbone molecule, or a nucleic acid molecule obtained by extension of the capture probe via a nucleic acid polymerization reaction) is capable of contacting a localization probe adjacent thereto.

[0310] In certain embodiments, there are at least 100 of the scaffold molecules proximal to each of the localization probes. For example, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1500, at least 2000, at least 2500, at least 3000, at least 3500, at least 4000, at least 4500, at least 5000, at least 5500, at least 6000, at least 6500, at least 7000, at least 7500, at least 8000, at least 8500, at least 9000, at least 9500, or at least 10000 of the scaffold molecules.

[0311] In certain embodiments, there are 500-10000 (e.g., 1000-1500, 1000-2000, 1000-3000, 1000-4000, 1000-5000, 1000-8000, 1000-10000) of the scaffold molecules proximal to each of the localization probes.

[0312] In certain embodiments, the expression "proximal to each of the localization probes" means a region on the surface of the solid support in the vicinity of each of the localization probes, wherein a nucleic acid molecule associated with a scaffold molecule distributed in the region (e.g., a nucleic acid molecule annealed to a capture probe attached to the scaffold molecule, or a nucleic acid molecule extended from the capture probe by a nucleic acid polymerization reaction) is capable of contacting the localization probe.

[0313] In certain embodiments, at least 100 of the scaffold molecules are distributed within a radius of less than 10 pm (e.g., less than 8 pm, less than 5 pm, less than 3 pm, less than 1 pm, less than 900 nm, less than 800 nm, less than 700 nm, less than 600 nm, less than 500 nm, less than 400 nm, less than 300 nm, less than 200 nm, less than 100 nm, less than 90 nm, less than 80 nm, less than 70 nm, less than 60 nm, less than 50 nm, less than 40 nm, less than 30 nm, less than 20 nm, less than 10 nm, e.g., 200-300 nm) around the center of the location occupied by each of the localization probes (e.g., the center of the area of the surface of the solid support occupied by each of the localization probes). For example, at least 100, at least 200, at least 300, 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1500, at least 2000, at least 2500, at least 3000, at least 3500, at least 4000, at least 4500, at least 5000, at least 5500, at least 6000, at least 6500, at least 7000, at least 7500, at least 8000, at least 8500, at least 9000, at least 9500, or at least 10000 of the scaffold molecules.

[0314] In certain embodiments, 500-10000 (e.g., 1000-1500, 1000-2000, 1000-3000, 1000-4000, 1000-5000, 1000-8000, 1000-10000) of the scaffold molecules are distributed within a radius of 200-300 nm around the center of the location occupied by each of the localization probes (e.g., the center of the area of the surface of the solid support occupied by each of the localization probes).

[0315] As used herein, the expression “area of the surface of the solid support occupied by each of the localization probes” or similar expressions have the same meaning as “location occupied by each of the localization probes on the solid support” and are used interchangeably.

[0316] Nucleic acid spatial information detection method

[0317] In another aspect, the present application provides a method of detecting spatial information of a nucleic acid in a sample, comprising using a nucleic acid array as described above.

[0318] In certain embodiments, the nucleic acid array comprises a capture probe as described above.

[0319] In certain embodiments, the method comprises using a nucleic acid array comprising capture probes, and the method comprises the following steps:

[0320] (1) providing: a sample to be tested, and a nucleic acid array as described above, wherein the nucleic acid array comprises capture probes as described above;

[0321] (2) contacting the sample to be tested with the nucleic acid array, and performing a nucleic acid polymerization and / or a nucleic acid ligation reaction to generate a product nucleic acid molecule derived from a nucleic acid of the sample to be tested, the product nucleic acid molecule comprising a localization sequence of a localization probe or a complement thereof as a spatial information tag thereof.

[0322] In certain embodiments, in step (2), the sample to be tested is contacted with the nucleic acid array such that a nucleic acid derived from the sample to be tested anneals to a capture probe, and a nucleic acid polymerization and / or a nucleic acid ligation reaction is performed using as a template the nucleic acid molecule or fragment thereof annealed to the capture probe and the localization probe or a fragment thereof comprising the localization sequence of the nucleic acid array to obtain the product nucleic acid molecule.

[0323] In certain embodiments, in step (2), the sample to be tested is contacted with the nucleic acid array such that a nucleic acid derived from the sample to be tested anneals to a capture probe, and a nucleic acid polymerization and / or a nucleic acid ligation reaction is performed using as a template the nucleic acid molecule or fragment thereof annealed to the capture probe and the localization probe or a fragment thereof comprising the localization sequence and a template switch sequence, to obtain the product nucleic acid molecule; wherein a complement of the template switch sequence is capable of annealing to the localization probe. In certain embodiments, the complement of the template switch sequence is capable of annealing to (i) the localization sequence or a partial sequence thereof (e.g., a 3’-end partial sequence of the localization sequence), or (ii) a sequence downstream of the localization sequence in the localization probe or a partial sequence thereof, or (iii) a combination of (i) and (ii). In certain embodiments, the localization probe comprises a first universal sequence at the 3’-end of the localization sequence, and the complement of the template switch sequence is capable of annealing to the first universal sequence.

[0324] In certain embodiments, in step (2), the test sample is contacted with the end- alignment primer and the nucleic acid array, such that nucleic acids derived from the test sample anneal to the end-alignment primer and the capture probe, and i) nucleic acid ligation is performed after the annealed product is ligated to the end-alignment primer, or ii) nucleic acid polymerization is performed after the annealed product is ligated to the end-alignment primer, and nucleic acid ligation is performed after the nucleic acid polymerization, and the product nucleic acid molecule is obtained.

[0325] In certain embodiments, in step (2), the test sample is contacted with the nucleic acid array, such that nucleic acids derived from the test sample anneal to the capture probe, and i) nucleic acid polymerization is performed after the annealed product is ligated to the end-alignment primer, or ii) nucleic acid polymerization is performed after the annealed product is ligated to the end-alignment primer, and nucleic acid ligation is performed after the nucleic acid polymerization, and the product nucleic acid molecule is obtained.

[0326] In certain embodiments, the method further comprises step (3): analyzing the spatial information tag of the product nucleic acid molecule of step (2), thereby correlating the nucleic acid molecule derived from the test sample from which the product nucleic acid molecule is derived with the location of the localization probe on the nucleic acid array.

[0327] In certain embodiments, the method comprises the following steps:

[0328] (1) providing a test sample, and a nucleic acid array as described above, wherein the nucleic acid array comprises capture probes as described above;

[0329] (2) (a) contacting the nucleic acid array with the test sample (e.g., contacting the nucleic acid array with the test sample under conditions that allow annealing), such that nucleic acids derived from the test sample anneal to the capture probes of the nucleic acid array;

[0330] (b) performing a nucleic acid polymerization reaction (e.g., performing a nucleic acid polymerization reaction under conditions that allow nucleic acid polymerization) to generate a first extension product;

[0331] (c) annealing (e.g., annealing under conditions that allow annealing) the first extension product to a localization probe of the nucleic acid array adjacent thereto;

[0332] (d) performing a nucleic acid polymerization reaction (e.g., performing a nucleic acid polymerization reaction under conditions that allow nucleic acid polymerization) to generate a second extension product and / or its complementary strand, the second extension product comprising: (A) a localization sequence of the localization probe and a complementary sequence of the first extension product or a partial sequence thereof, or, (B) the first extension product sequence or a partial sequence thereof and a complementary sequence of the localization sequence of the localization probe; the localization sequence or its complementary sequence comprised in the second extension product as its spatial information tag, and the complementary sequence of the localization sequence or the localization sequence comprised in the complementary strand of the second extension product as its spatial information tag, such that the location of the nucleic acid derived from the test sample in the test sample is corresponded to the location of the localization probe to which the localization sequence corresponds; thereby obtaining a nucleic acid molecule containing the spatial information tag; and

[0333] (3) analyzing: (i) the sequence of the nucleic acid molecule containing the spatial information tag obtained in step (2), and / or, (ii) the sequence of the nucleic acid molecule containing the spatial information tag derived from (i).

[0334] In certain embodiments, in step (2)(b), the first extension product comprises a capture sequence and a complementary sequence of a nucleic acid molecule or a partial sequence thereof annealed to the capture sequence, the first extension product being attached to the solid support through the capture sequence comprised therein.

[0335] In certain embodiments, the spatial information of the nucleic acid comprises the localization, distribution and / or abundance of the nucleic acid.

[0336] In certain embodiments, steps (2)(a) to (2)(d) can be performed sequentially in different reaction systems, or in the same reaction system.

[0337] In certain embodiments, in step (2)(b), a nucleic acid polymerization reaction is performed with the nucleic acid molecule or fragment thereof that is annealed to the capture probe and the template switch sequence as templates, to generate a first extension product comprising a complement of the template switch sequence. In certain embodiments, the complement of the template switch sequence is capable of annealing to the localization probe. In certain embodiments, the complement of the template switch sequence is capable of annealing to (i) the localization sequence of the localization probe or a partial sequence thereof (e.g., a 3’-end partial sequence of the localization sequence), or, (ii) a sequence downstream of the localization sequence in the localization probe or a partial sequence thereof, or, (iii) a combination of (i) and (ii).

[0338] In certain embodiments, the localization probe of the nucleic acid array comprises a first universal sequence that is capable of annealing to the first extension product (e.g., the first universal sequence is capable of annealing to the complement of the template switch sequence comprised in the first extension product). In certain embodiments, the first universal sequence is located 3’ to the localization sequence of the localization probe.

[0339] In certain embodiments, in step (2)(b), the nucleic acid polymerization reaction extends the capture sequence with the nucleic acid molecule annealed to the capture sequence as template.

[0340] In certain embodiments, the capture sequence is located at the 3’-end of the capture probe, and / or, the 3’-end of the capture sequence has a free hydroxyl group (-OH).

[0341] In certain embodiments, in step (2)(d), the polymerization reaction extends the localization probe with the first extension product as template; and / or, extends the first extension product with the localization probe as template.

[0342] In certain embodiments, in step (2)(d), the polymerization reaction extends the localization probe with the first extension product as template to generate a second extension product and / or a complement strand thereof, the second extension product comprising the localization sequence of the localization probe and a complement of a partial sequence of the first extension product. In certain embodiments where the localization probe comprises a first universal sequence, the first universal sequence of the localization probe is located at the 3’-end of the localization probe, and / or, the 3’-end of the first universal sequence of the localization probe has a free hydroxyl group (-OH).

[0343] In certain embodiments, in step (2)(d), the polymerization reaction extends the first extension product with the localization probe as a template to generate a second extension product and / or its complementary strand, the second extension product comprising the first extension product sequence or a partial sequence thereof and the complement of the localization sequence of the localization probe. In certain embodiments where the localization probe comprises a first universal sequence, the first universal sequence of the localization probe is located at or not located at the 3' end of the localization probe, and / or, the 3' end of the first universal sequence of the localization probe is blocked or unblocked.

[0344] In certain embodiments, in step (2)(d), in the polymerization reaction, the first extension product and the localization probe are templates for each other, the first extension product and the localization probe are extended to generate a second extension product and / or its complementary strand, the second extension product comprising the localization sequence of the localization probe and the complement of the first extension product or a partial sequence thereof, and the second extension product comprising the first extension product sequence or a partial sequence thereof and the complement of the localization sequence of the localization probe. In certain embodiments where the localization probe comprises a first universal sequence, the first universal sequence of the localization probe is located at the 3' end of the localization probe, and / or, the 3' end of the first universal sequence of the localization probe has a free hydroxyl group (-OH).

[0345] In certain embodiments, in step (3), the sequence of the spatial information label- containing nucleic acid molecule attached to the solid support of the nucleic acid array is analyzed.

[0346] In certain embodiments, prior to step (3) after step (2), the method further comprises step pre-(6): releasing at least a portion of the spatial information label-containing nucleic acid molecules from the surface of the nucleic acid array.

[0347] In certain embodiments, in step (3), analyzing (i) the spatial information label- containing nucleic acid molecules released in step pre-(6), and / or, (ii) the sequence of the spatial information label-containing nucleic acid molecules derived from (i).

[0348] In certain embodiments, in step pre-(3), the nucleic acid molecules are released from the surface of the solid support by (i) nucleolytic cleavage; and / or, (ii) denaturation.

[0349] In certain embodiments, after step pre-(3) and prior to step (3), the method further comprises a step of amplifying the released nucleic acid molecules.

[0350] In certain embodiments, prior to performing step (3), the method further comprises a step of purifying the released nucleic acid molecules.

[0351] In certain embodiments, the method comprises one or more features selected from the group consisting of:

[0352] (i) in step (1), the nucleic acid array is provided by a method as described above;

[0353] (ii) in step (2)(a), the test sample is treated (e.g., permeabilized or lysed) to release nucleic acid derived from the test sample to anneal to the capture sequence;

[0354] (iii) after step (2)(b) and prior to step (2)(c), the method further comprises a step of removing the template strand bound to the first extension product (e.g., by cleavage or denaturation to remove the template strand bound to the first extension product);

[0355] (iv) after step (2)(b) and prior to step (2)(c), the method further comprises a step of washing the nucleic acid array to remove residual sample (e.g., tissue or cells);

[0356] (v) after step (2) and prior to step (3) (e.g., after step (2) and prior to step pre-(3)), the method further comprises a step of amplifying (e.g., in situ amplification) and / or enriching the nucleic acid molecules containing the spatial information label; in certain embodiments, the nucleic acid molecules containing the spatial information label are attached to the solid support of the nucleic acid array.

[0357] In certain embodiments, in step (3), the analysis comprises sequencing and / or sequence-specific PCR reactions.

[0358] In certain embodiments, prior to performing sequencing, the method further comprises a step of sequencing library construction of the nucleic acid molecules containing the spatial information label obtained in step (2) or amplification and / or enrichment products thereof.

[0359] In certain embodiments, the sample is a tissue sample (e.g., a tissue section) or a single cell sample (e.g., a single cell suspension).

[0360] In certain embodiments, the tissue sample (e.g., a tissue section) is prepared from a fixed tissue, e.g., a formalin-fixed paraffin-embedded (FFPE) tissue, a deep-frozen tissue, or a fresh tissue.

[0361] In certain embodiments, the nucleic acid derived from the sample to be tested is selected from the group consisting of: an RNA molecule (e.g., an mRNA molecule), a target nucleic acid (e.g., a target DNA and / or RNA) of interest or a nucleic acid molecule derived from the target nucleic acid of interest (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of an RNA), a genomic nucleic acid fragment at an open region of chromatin, and any combination thereof.

[0362] For mRNA capture

[0363] In certain embodiments, the method is used for detecting spatial information of RNA (e.g., mRNA) of cells in a sample.

[0364] In certain embodiments, in step (2)(a), the nucleic acid derived from the sample to be tested is RNA (e.g., mRNA) in a cell of the sample to be tested, and the capture sequence comprises a poly(dT) sequence or a random oligonucleotide sequence.

[0365] In certain embodiments, the step (2)(b) comprises:

[0366] (i) performing a nucleic acid polymerization reaction under conditions allowing nucleic acid polymerization, using the nucleic acid molecule annealed to the capture sequence as a template, to extend the capture sequence, to generate a cDNA strand comprising a cDNA sequence complementary to the RNA (e.g., mRNA) formed using the capture sequence as a reverse transcription primer, and a 3’ end overhang;

[0367] (ii) annealing a template switch sequence to the cDNA strand generated in (i) under conditions allowing nucleic acid polymerization, and continuing the nucleic acid polymerization reaction using the template switch sequence as a template, to generate the first extension product;

[0368] wherein the template switch sequence comprises a common sequence and a 3’ end overhang complementary sequence.

[0369] In certain embodiments, steps (2)(b)(i) to (2)(b)(ii) are performed in the same reaction system.

[0370] In certain embodiments, the template switch sequence contains a MID sequence. In certain embodiments, the MID sequence contained in each template switch sequence is different from each other.

[0371] In certain embodiments, the first extension product comprises: a capture sequence, the cDNA strand sequence or a partial sequence thereof, and a sequence complementary to the common sequence.

[0372] In certain embodiments, the first extension product comprises: a capture sequence, the cDNA strand sequence or a partial sequence thereof, a 3' end overhang, a complement of the universal sequence, and optionally a complement of the MID sequence.

[0373] In certain embodiments, the method further comprises a step of removing the template switch sequence bound to the first extension product prior to step (2)(c) (e.g., removing the template switch sequence bound to the first extension product by cleavage or denaturation).

[0374] In certain embodiments, the localization probe of the nucleic acid array comprises a first universal sequence, and the first universal sequence of the localization probe is capable of annealing to the complement of the universal sequence in step (2)(c) of the method.

[0375] In certain embodiments, the localization probe does not comprise a MID sequence, and the template switch sequence comprises a MID sequence; or, the localization probe comprises a MID sequence, and the template switch sequence does not comprise a MID sequence, or, both the localization probe and the template switch sequence comprise a MID sequence.

[0376] Target nucleic acid capture

[0377] In certain embodiments, the method is used to detect spatial information of a target nucleic acid (e.g., a target DNA and / or RNA) or a nucleic acid molecule derived from the target nucleic acid (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA) comprising a target nucleotide sequence in a cell in a sample.

[0378] In certain embodiments, the nucleic acid derived from the sample to be tested comprises the target nucleotide sequence in step (2)(a). In certain embodiments, the nucleic acid derived from the sample to be tested comprises the target nucleic acid and / or a nucleic acid molecule derived from the target nucleic acid (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA) comprising a target nucleotide sequence.

[0379] In certain embodiments, the capture sequence comprises a sequence capable of annealing to the target nucleotide sequence in step (2)(a).

[0380] In certain embodiments, the localization probe comprises a first universal sequence, in step (2)(a), the capture sequence comprises a sequence capable of annealing to a first segment of the target nucleotide sequence; in step (2)(c), the first universal sequence comprises a sequence capable of annealing to a complement of a second segment of the target nucleotide sequence, or, the first universal sequence comprises a random oligonucleotide sequence. In certain embodiments, in the target nucleotide sequence, the first segment is located 3' to the second segment. In certain embodiments, the first universal sequence is located 3' to the localization sequence.

[0381] In certain embodiments, in step (2)(a), the first segment is present in a single-stranded region of a nucleic acid molecule derived from the test sample.

[0382] In certain embodiments, in step (2)(a), the nucleic acid derived from the test sample that anneals to the capture sequence is a single-stranded nucleic acid comprising a single-stranded region comprising the first segment or a double-stranded nucleic acid.

[0383] Dual capture for mRNA and target nucleic acids

[0384] In certain embodiments, the method is used to detect spatial information of RNA (e.g., mRNA) of a cell in a sample and a target nucleic acid (e.g., a target DNA and / or RNA) and / or a nucleic acid molecule derived from the target nucleic acid (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA) of interest, wherein the target nucleic acid or the nucleic acid molecule derived from the target nucleic acid comprises a target nucleotide sequence.

[0385] In certain embodiments, the capture probe comprises a first capture probe capable of capturing the RNA (e.g., mRNA) and a second capture probe capable of capturing a nucleic acid molecule comprising the target nucleotide sequence; the first capture probe comprises a first capture sequence comprising a poly(dT) sequence or a random oligonucleotide sequence; the second capture probe comprises a second capture sequence comprising a sequence capable of annealing to the target nucleotide sequence.

[0386] In certain embodiments, in step (2)(a), the nucleic acid derived from the test sample comprises RNA (e.g., mRNA) derived from the test sample and a nucleic acid molecule comprising a target nucleotide sequence. In certain embodiments, the nucleic acid molecule comprising a target nucleotide sequence comprises the target nucleic acid and / or a nucleic acid molecule derived from the target nucleic acid (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA).

[0387] In certain embodiments, the step (2)(b) comprises:

[0388] (A) (a) performing a nucleic acid polymerization reaction under conditions permitting nucleic acid polymerization, using as a template a nucleic acid molecule annealed to the first capture sequence, to extend the first capture sequence, to generate a cDNA strand comprising a cDNA sequence complementary to the RNA (e.g., mRNA) formed using the first capture sequence as a reverse transcription primer, and a 3' terminal overhang;

[0389] (b) annealing a template switch sequence to the cDNA strand generated in (a) and continuing the nucleic acid polymerization reaction using the template switch sequence as a template, to generate a first extension product I;

[0390] wherein the template switch sequence comprises a common sequence and a 3' terminal overhang complementary sequence;

[0391] and,

[0392] (B) performing a nucleic acid polymerization reaction under conditions permitting nucleic acid polymerization, using as a template a nucleic acid molecule annealed to the second capture sequence, to extend the second capture sequence, to generate a first extension product II;

[0393] wherein the step (B) is performed in any order with respect to step (A); for example, step (B) is performed before or after step (A), or, step (B) is performed simultaneously with step (A) (e.g., in the same reaction system).

[0394] In certain embodiments, the first extension product II comprises the second capture sequence and a complement of a nucleic acid molecule or a partial sequence thereof annealed to the second capture sequence.

[0395] In certain embodiments, in step (2)(c), the localization probe contains a first universal sequence I capable of annealing to the first extension product I, and a first universal sequence II capable of annealing to the first extension product II; in certain embodiments, the first universal sequence I and the first universal sequence II are collectively present in the same localization probe, or, are separately present in different localization probes. In certain embodiments, the first universal sequence I and / or the first universal sequence II is located at the 3' end of the localization sequence.

[0396] In certain embodiments, the nucleic acid array comprises a first localization probe containing the first universal sequence I and a second localization probe containing the first universal sequence II. In certain embodiments, the first universal sequence I and / or the first universal sequence II is located at the 3' end of the localization sequence.

[0397] It is readily understood by one skilled in the art that the above definitions / descriptions regarding the positioning probe apply to the first positioning probe and the second positioning probe as well, unless otherwise specified herein or clearly contradicted by context, and that the above definitions / descriptions regarding the first universal sequence apply to the first universal sequence I and the first universal sequence II as well.

[0398] In certain embodiments, in step (2)(c) of the method, the first universal sequence I is capable of annealing to the complement of the consensus sequence.

[0399] In certain embodiments, in step (2)(a) of the method, the second capture sequence comprises a sequence capable of annealing to a first segment of the target nucleotide sequence. In step (2)(c), the first universal sequence II comprises a sequence capable of annealing to the complement of a second segment of the target nucleotide sequence, or, the first universal sequence II comprises a random oligonucleotide sequence. In certain embodiments, in the target nucleotide sequence, the first segment is located 3' to the second segment.

[0400] In certain embodiments, the method further comprises, prior to step (2)(c), a step of removing the template switch sequence bound to the first extension product I (e.g., removing the template switch sequence bound to the first extension product I by cleavage or denaturation).

[0401] In certain embodiments, in step (2)(a), the first segment is present in a single-stranded region of a nucleic acid molecule derived from the test sample.

[0402] In certain embodiments, in step (2)(a), the nucleic acid derived from the test sample that anneals to the second capture sequence is a single-stranded nucleic acid or a double-stranded nucleic acid that contains a single-stranded region comprising the first segment.

[0403] In certain embodiments, the first positioning probe does not contain a MID sequence, the template switch sequence contains a MID sequence; or, the first positioning probe contains a MID sequence, the template switch sequence does not contain a MID sequence, or, both the first positioning probe and the template switch sequence contain a MID sequence.

[0404] In certain embodiments, the template switch sequence contains a MID sequence. In certain embodiments, the MID sequence contained by each template switch sequence is different from each other.

[0405] In another aspect, the present application provides a method of detecting spatial information of a nucleic acid in a sample, comprising using a nucleic acid array as described above.

[0406] In certain embodiments, the nucleic acid array does not comprise a capture probe; and, the method further comprises using a capture probe. In certain embodiments, the capture probe comprises a capture sequence capable of annealing to a nucleic acid molecule to be captured.

[0407] In certain embodiments, the method comprises the following steps:

[0408] (1) providing: a test sample, a nucleic acid array as described above, the nucleic acid array not comprising a capture probe, and, a capture probe; the capture probe comprising a capture sequence capable of annealing to a nucleic acid molecule to be captured;

[0409] (2) contacting the test sample with the capture probe and the nucleic acid array, and performing a nucleic acid polymerization and / or a nucleic acid ligation reaction to generate a product nucleic acid molecule derived from a nucleic acid of the test sample, the product nucleic acid molecule containing a localization sequence of a localization probe or a complement thereof as its spatial information tag.

[0410] In certain embodiments, in step (2), the test sample is contacted with the capture probe and the nucleic acid array, such that a nucleic acid derived from the test sample anneals to the capture probe, and a nucleic acid molecule or a fragment thereof annealed to the capture probe and a localization probe or a fragment thereof comprising a localization sequence of the nucleic acid array are templates for a nucleic acid polymerization and / or a nucleic acid ligation reaction to obtain the product nucleic acid molecule.

[0411] In certain embodiments, in step (2), the test sample is contacted with the capture probe and the nucleic acid array, such that a nucleic acid derived from the test sample anneals to the capture probe, and a nucleic acid molecule or a fragment thereof annealed to the capture probe and a localization probe or a fragment thereof comprising a localization sequence and a template switch sequence are templates for a nucleic acid polymerization and / or a nucleic acid ligation reaction to obtain the product nucleic acid molecule; wherein a complement of the template switch sequence is capable of annealing to the localization probe. In certain embodiments, the complement of the template switch sequence is capable of annealing to (i) the localization sequence or a partial sequence thereof (e.g., a 3’-end partial sequence of the localization sequence), or, (ii) a sequence downstream of the localization sequence in the localization probe or a partial sequence thereof, or, (iii) a combination of (i) and (ii). In certain embodiments, the localization probe comprises a first universal sequence at the 3’-end of the localization sequence, and the complement of the template switch sequence is capable of annealing to the first universal sequence.

[0412] In certain embodiments, in step (2), the test sample is contacted with the nucleic acid array and the end-priming primer, such that nucleic acids derived from the test sample anneal to the end-priming primer and the capture probe, and a nucleic acid ligation reaction is performed to obtain a first extension product; the first extension product is annealed to and extended by the localization sequence (a) or (b) to obtain the product nucleic acid molecule. In certain embodiments, the 5' end sequence of the end-priming primer is capable of annealing to a nucleic acid derived from the test sample, and the 3' end sequence of the end-priming primer is capable of (A) annealing to a sequence downstream of the localization sequence in the localization probe, and (B) ligating to the 5' end of the localization probe. In certain embodiments, the localization probe comprises a first universal sequence at the 3' end of the localization sequence, and the 3' end sequence of the end-priming primer is capable of annealing to the first universal sequence. In certain embodiments, the ligation in (B) is template-dependent ligation, e.g., the 5' end of the ligation template is capable of annealing to the localization probe, and the 3' end of the ligation template is capable of annealing to the first extension product. In certain embodiments, the ligation in (B) is preceded by a nucleic acid polymerization (e.g., template-dependent nucleic acid polymerization).

[0413] In certain embodiments, in step (2), the test sample is contacted with the nucleic acid array, such that nucleic acids derived from the test sample anneal to the capture probe, and i) the annealed product is ligated to the end-priming primer and a nucleic acid polymerization reaction is performed, or ii) the annealed product is subjected to a nucleic acid polymerization reaction and then ligated to the end-priming primer and a nucleic acid polymerization reaction is initiated using the localization probe as a template; thereby obtaining the product nucleic acid molecule.

[0414] In certain embodiments, the method further comprises step (3): analyzing the spatial information tag of the product nucleic acid molecule of step (2), thereby correlating the nucleic acid molecule derived from the test sample from which the product nucleic acid molecule is derived with the location of the localization probe on the nucleic acid array.

[0415] In certain embodiments, the method comprises the following steps:

[0416] (1) providing: (a) a test sample, (b) a nucleic acid array as described above, wherein the nucleic acid array does not comprise a capture probe; and (c) a capture probe comprising a capture sequence capable of annealing to a nucleic acid molecule to be captured;

[0417] (2) (a) capturing (e.g., capturing under conditions permitting annealing) nucleic acids derived from the test sample with the capture sequence of the capture probe;

[0418] (b) performing a nucleic acid polymerization reaction (e.g., performing a nucleic acid polymerization reaction under conditions permitting nucleic acid polymerization) to generate a first extension product;

[0419] (c) annealing (e.g., annealing under conditions permitting annealing) the first extension product to the localization probe of the nucleic acid array;

[0420] (d) performing a nucleic acid polymerization reaction (e.g., performing a nucleic acid polymerization reaction under conditions permitting nucleic acid polymerization) to generate a second extension product and / or its complementary strand;

[0421] the second extension product comprises: (A) the localization sequence of the localization probe and the complementary sequence of the first extension product or a partial sequence thereof, or, (B) the first extension product sequence or a partial sequence thereof and the complementary sequence of the localization sequence of the localization probe; wherein the localization sequence or its complementary sequence comprised in the second extension product serves as a spatial information marker for the second extension product, and the complementary sequence of the localization sequence or the localization sequence comprised in the complementary strand of the second extension product serves as a spatial information marker for the complementary strand of the second extension product, thereby allowing the location of the nucleic acid derived from the test sample in the test sample to be corresponded to the location of the localization probe to which the localization sequence corresponds; thereby obtaining a nucleic acid molecule containing the spatial information marker;

[0422] (3) analyzing: (i) the sequence of the nucleic acid molecule containing the spatial information marker obtained in step (2), and / or, (ii) the sequence of the nucleic acid molecule containing the spatial information marker derived from (i).

[0423] In certain embodiments, the spatial information of the nucleic acid includes the localization, distribution, and / or abundance of the nucleic acid.

[0424] In certain embodiments, steps (2)(a) to (2)(d) can be performed sequentially in different reaction systems, or in the same reaction system.

[0425] In certain embodiments, in step (2)(b), a nucleic acid polymerization reaction is performed with the nucleic acid molecule or fragment thereof to which the capture probe is annealed and the template switch sequence as templates, to generate a first extension product comprising a complement of the template switch sequence. In certain embodiments, the complement of the template switch sequence is capable of annealing to the localization probe. In certain embodiments, the complement of the template switch sequence is capable of annealing to (i) the localization sequence of the localization probe or a partial sequence thereof (e.g., a 3' end partial sequence of the localization sequence), or, (ii) a sequence downstream of the localization sequence in the localization probe or a partial sequence thereof, or, (iii) a combination of (i) and (ii).

[0426] In certain embodiments, the localization probe of the nucleic acid array comprises a first universal sequence that is capable of annealing to the first extension product (e.g., the first universal sequence is capable of annealing to the complement of the template switch sequence comprised by the first extension product). In certain embodiments, the first universal sequence is located 3' to the localization sequence of the localization probe.

[0427] In certain embodiments, step (2) generates the second extension product and / or its complementary strand by a method selected from the group consisting of:

[0428] (i) (a) contacting the capture probe with a test sample under conditions that allow annealing, such that nucleic acids derived from the test sample anneal to the capture probe of the nucleic acid array; (b) performing a nucleic acid polymerization reaction under conditions that allow nucleic acid polymerization, to generate a first extension product; (c) contacting the first extension product with its adjacent localization probe of the nucleic acid array under conditions that allow annealing, such that the first extension product anneals to the localization probe of the nucleic acid array; (d) performing a nucleic acid polymerization reaction under conditions that allow nucleic acid polymerization, to generate a second extension product and / or its complementary strand;

[0429] or,

[0430] (ii) (a) contacting the capture probe with a nucleic acid array under conditions that allow annealing, such that the capture probe anneals to the backbone molecule of the nucleic acid array, thereby linking the capture probe to the nucleic acid array; contacting the nucleic acid array with the linked capture probe with a test sample under conditions that allow annealing, such that nucleic acids derived from the test sample anneal to the capture probe linked to the nucleic acid array; (b) performing a nucleic acid polymerization reaction under conditions that allow nucleic acid polymerization, to generate a first extension product; (c) annealing the first extension product to its adjacent localization probe of the nucleic acid array under conditions that allow annealing; (d) performing a nucleic acid polymerization reaction under conditions that allow nucleic acid polymerization, to generate a second extension product and / or its complementary strand;

[0431] or,

[0432] (iii) (a) contacting the capture probe and the nucleic acid array with the test sample under conditions that allow annealing, such that the capture probe anneals to the backbone molecules of the nucleic acid array, and / or, such that nucleic acids derived from the test sample anneal to the capture probe; (b) performing a nucleic acid polymerization reaction under conditions that allow nucleic acid polymerization, to generate a first extension product; (c) annealing the first extension product to its adjacent positioning probe of the nucleic acid array under conditions that allow annealing; (d) performing a nucleic acid polymerization reaction under conditions that allow nucleic acid polymerization, to generate a second extension product and / or its complementary strand.

[0433] In certain embodiments, the first extension product comprises a capture sequence and a complementary sequence of a nucleic acid molecule or a partial sequence thereof that anneals to the capture sequence.

[0434] In certain embodiments, step (2) generates the second extension product and / or its complementary strand by means (i), and, step (2)(a) and step (2)(b) are performed intracellularly and / or extracellularly.

[0435] In certain embodiments, step (2)(a) and step (2)(b) are performed intracellularly, and, in step (2)(c), the cell is treated (e.g., permeabilized or lysed) to release the first extension product of step (2)(b) for contact with the nucleic acid array.

[0436] In certain embodiments, step (2)(a) is performed extracellularly, and, in step (2)(a), the test sample is treated (e.g., permeabilized or lysed) to release nucleic acids derived from the test sample for annealing to the capture sequence.

[0437] In certain embodiments, step (2) generates the second extension product and / or its complementary strand by means (ii) or means (iii), and, in step (2)(a), the test sample is treated (e.g., permeabilized or lysed) to release nucleic acids derived from the test sample for annealing to the capture sequence.

[0438] In certain embodiments, in step (2)(a), the nucleic acid polymerization reaction extends the capture sequence using as a template a nucleic acid molecule that anneals to the capture sequence.

[0439] In certain embodiments, the capture sequence is located at the 3’ end of the capture probe, and / or, the 3’ end of the capture sequence has a free hydroxyl group (-OH).

[0440] In certain embodiments, in step (2)(d), the polymerization reaction extends the first extension product with the localization probe as a template; and / or, extends the localization probe with the first extension product as a template.

[0441] In certain embodiments, in step (2)(d), the polymerization reaction extends the localization probe with the first extension product as a template to generate a second extension product and / or its complementary strand, the second extension product comprising the localization sequence of the localization probe and the complement of the sequence of the first extension product or a partial sequence thereof. In certain embodiments where the localization probe comprises a first universal sequence, the first universal sequence of the localization probe is located at the 3' end of the localization probe, and / or, the 3' end of the first universal sequence of the localization probe has a free hydroxyl group (-OH).

[0442] In certain embodiments, in step (2)(d), the polymerization reaction extends the first extension product with the localization probe as a template to generate a second extension product and / or its complementary strand, the second extension product comprising the localization sequence of the localization probe and the complement of the sequence of the first extension product or a partial sequence thereof. In certain embodiments where the localization probe comprises a first universal sequence, the first universal sequence of the localization probe is located at the 3' end of the localization probe, and / or, the 3' end of the first universal sequence of the localization probe has a free hydroxyl group (-OH).

[0443] In certain embodiments, in step (2)(d), the polymerization reaction, the first extension product and the localization probe are templates for each other, extending the first extension product and the localization probe to generate a second extension product and / or its complementary strand, the second extension product comprising the localization sequence of the localization probe and the complement of the sequence of the first extension product or a partial sequence thereof, and, the second extension product comprising the localization sequence of the localization probe and the complement of the sequence of the first extension product or a partial sequence thereof. In certain embodiments where the localization probe comprises a first universal sequence, the first universal sequence of the localization probe is located at the 3' end of the localization probe, and / or, the 3' end of the first universal sequence of the localization probe has a free hydroxyl group (-OH).

[0444] In certain embodiments, in step (3), the sequence of the spatial information containing labeled nucleic acid molecule attached to the solid support of the nucleic acid array is analyzed.

[0445] In certain embodiments, prior to step (3), after step (2), the method further comprises a step pre-(3): releasing at least a portion of the spatial information containing labeled nucleic acid molecule from the surface of the nucleic acid array.

[0446] In certain embodiments, in step (3), the analyzing comprises sequencing and / or sequence-specific PCR reaction.

[0447] In certain embodiments, in step pre-(3), the nucleic acid molecules are released from the surface of the solid support by (i) nucleolytic cleavage; and / or, (ii) denaturation.

[0448] In certain embodiments, the method further comprises a step of amplifying the released nucleic acid molecules after step pre-(3) and before step (3).

[0449] In certain embodiments, the method further comprises a step of purifying the released nucleic acid molecules before performing step (3).

[0450] In certain embodiments, the method comprises one or more features selected from the group consisting of:

[0451] (i) in step (1), the nucleic acid array is provided by a method as described above;

[0452] (ii) the method further comprises a step of removing the template strand bound to the first extension product (e.g., by enzymatic cleavage or denaturation unbinding the template strand bound to the first extension product) after step (2)(b) and before step (2)(c);

[0453] (iii) the method further comprises a step of washing the nucleic acid array to remove residual sample (e.g., tissue or cells) after step (2)(b) and before step (2)(c);

[0454] (iv) the method further comprises a step of amplifying (e.g., in situ amplification) and / or enriching the nucleic acid molecules containing the spatial information label after step (2) and before step (3) (e.g., after step (2) and before step pre-(3)); in certain embodiments, the nucleic acid molecules containing the spatial information label are attached to the solid support of the nucleic acid array.

[0455] In certain embodiments, in step (3), the analyzing comprises sequencing and / or sequence-specific PCR reaction.

[0456] In certain embodiments, the method further comprises a step of sequencing library construction of the nucleic acid molecules containing the spatial information label obtained in step (2) or amplification and / or enrichment products thereof before performing sequencing.

[0457] In certain embodiments, the sample is a tissue sample (e.g., a tissue section) or a single cell sample (e.g., a single cell suspension).

[0458] In certain embodiments, the tissue sample (e.g., a tissue section) is prepared from a fixed tissue, e.g., a formalin-fixed paraffin-embedded (FFPE) tissue, a deep-frozen tissue, or a fresh tissue.

[0459] In certain embodiments, the nucleic acid derived from the sample to be tested is selected from the group consisting of: an RNA molecule (e.g., an mRNA molecule), a target nucleic acid (e.g., a target DNA and / or RNA), or a nucleic acid molecule derived from the target nucleic acid (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of an RNA), a genomic nucleic acid fragment at an open chromatin region, and any combination thereof.

[0460] For mRNA capture

[0461] In certain embodiments, the method is used for detecting spatial information of RNA (e.g., mRNA) of cells in a sample.

[0462] In certain embodiments, in step (2)(a), the nucleic acid derived from the sample to be tested is RNA (e.g., mRNA) in a cell of the sample to be tested, and the capture sequence comprises a poly(dT) sequence or a random oligonucleotide sequence.

[0463] In certain embodiments, the step (2)(b) comprises:

[0464] (i) performing a nucleic acid polymerization reaction under conditions allowing nucleic acid polymerization, using the nucleic acid molecule annealed to the capture sequence as a template, to extend the capture sequence, to generate a cDNA strand comprising a cDNA sequence complementary to the RNA (e.g., mRNA) formed using the capture sequence as a reverse transcription primer, and a 3’ end overhang;

[0465] (ii) annealing a template switch sequence to the cDNA strand generated in (i) under conditions allowing nucleic acid polymerization, and continuing the nucleic acid polymerization reaction using the template switch sequence as a template, to generate the first extension product;

[0466] wherein the template switch sequence comprises a consensus sequence and a 3’ end overhang complementary sequence.

[0467] In certain embodiments, steps (2)(b)(i) to (2)(b)(ii) are performed in the same reaction system.

[0468] In certain embodiments, the first extension product comprises: a capture sequence, the cDNA strand sequence or a partial sequence thereof, and a complement of the consensus sequence.

[0469] In certain embodiments, the method further comprises, prior to step (2)(c), a step of removing the template switch sequence bound to the first extension product (e.g., removing the template switch sequence bound to the first extension product by cleavage or denaturation).

[0470] In certain embodiments, the localization probe of the nucleic acid array comprises a first universal sequence, and the first universal sequence of the localization probe is capable of annealing to the complement of the consensus sequence in step (2)(c) of the method.

[0471] In certain embodiments, the localization probe does not comprise a MID sequence, and the template switch sequence comprises a MID sequence; or, the localization probe comprises a MID sequence, and the template switch sequence does not comprise a MID sequence, or, both the localization probe and the template switch sequence comprise a MID sequence.

[0472] In certain embodiments, the template switch sequence comprises a MID sequence. In certain embodiments, the MID sequence comprised by each template switch sequence is different from each other.

[0473] Target nucleic acid capture

[0474] In certain embodiments, the method is used to detect spatial information of a target nucleic acid (e.g., a target DNA and / or RNA) or a nucleic acid molecule derived from the target nucleic acid (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA) of a cell in a sample, the target nucleic acid or the nucleic acid molecule derived from the target nucleic acid comprising a target nucleotide sequence.

[0475] In certain embodiments, the nucleic acid derived from the sample to be tested comprises the target nucleotide sequence in step (2)(a). In certain embodiments, the nucleic acid derived from the sample to be tested comprises the target nucleic acid and / or a nucleic acid molecule derived from the target nucleic acid (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA).

[0476] In certain embodiments, the capture sequence comprises a sequence capable of annealing to the target nucleotide sequence in step (2)(a).

[0477] In certain embodiments, the localization probe comprises a first universal sequence, in step (2)(a), the capture sequence comprises a sequence capable of annealing to a first segment of the target nucleotide sequence; in step (2)(c), the first universal sequence of the localization probe comprises a sequence capable of annealing to a complementary sequence of a second segment of the target nucleotide sequence, or, the first universal sequence comprises a random oligonucleotide sequence. In certain embodiments, in the target nucleotide sequence, the first segment is located 3' to the second segment. In certain embodiments, the first universal sequence is located 3' to the localization sequence.

[0478] In certain embodiments, in step (2)(a), the first segment is present in a single-stranded region of a nucleic acid molecule derived from the test sample that anneals to the capture sequence.

[0479] In certain embodiments, in step (2)(a), the nucleic acid derived from the test sample that anneals to the capture sequence is a single-stranded nucleic acid containing a single-stranded region comprising the first segment or a double-stranded nucleic acid.

[0480] In certain embodiments, the method is used to detect spatial information of RNA (e.g., mRNA) of a cell and a target nucleic acid (e.g., a target DNA and / or RNA) or a nucleic acid molecule derived from the target nucleic acid (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA) in a sample, wherein the target nucleic acid or the nucleic acid molecule derived from the target nucleic acid comprises a target nucleotide sequence.

[0481] In certain embodiments, the capture probe comprises a first capture probe capable of capturing the RNA (e.g., mRNA) and a second capture probe capable of capturing a nucleic acid molecule containing the target nucleotide sequence; the first capture probe contains a first capture sequence comprising a poly(dT) sequence or a random oligonucleotide sequence; the second capture probe contains a second capture sequence comprising a sequence capable of annealing to the target nucleotide sequence.

[0482] Dual capture of mRNA and target nucleic acid

[0483] In certain embodiments, in step (2)(a), the nucleic acid derived from the test sample comprises RNA (e.g., mRNA) derived from the test sample and a nucleic acid molecule comprising a target nucleotide sequence. In certain embodiments, the nucleic acid molecule comprising a target nucleotide sequence comprises the target nucleic acid and / or a nucleic acid molecule derived from the target nucleic acid (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA).

[0484] In certain embodiments, the step (2)(b) comprises:

[0485] (A) (i) performing a nucleic acid polymerization reaction under conditions permitting nucleic acid polymerization, with a nucleic acid molecule annealed to the first capture sequence as a template, to extend the first capture sequence, to generate a cDNA strand comprising a cDNA sequence complementary to the RNA (e.g., mRNA) formed with the first capture sequence as a reverse transcription primer, and a 3' terminal overhang;

[0486] (ii) annealing a template switch sequence to the cDNA strand generated in (i) under conditions permitting nucleic acid polymerization, and continuing the nucleic acid polymerization reaction with the template switch sequence as a template, to generate a first extension product I;

[0487] wherein the template switch sequence comprises a common sequence and a 3' terminal overhang complementary sequence;

[0488] and,

[0489] (B) performing a nucleic acid polymerization reaction under conditions permitting nucleic acid polymerization, with a nucleic acid molecule annealed to the second capture sequence as a template, to extend the second capture sequence, to generate a first extension product II;

[0490] wherein the step (B) is performed in any order with respect to the step (A); for example, the step (B) is performed before or after the step (A), or, the step (B) is performed simultaneously with the step (A) (e.g., in the same reaction system).

[0491] In certain embodiments, the first extension product II comprises a second capture sequence and a complement sequence of the nucleic acid molecule annealed to the second capture sequence or a partial sequence thereof.

[0492] In certain embodiments, in the step (2)(c), the indexing probe contains a first universal sequence I that can anneal to the first extension product I, and a first universal sequence II that can anneal to the first extension product II. In certain embodiments, the first universal sequence I and the first universal sequence II are collectively present in the same indexing probe, or, are separately present in different indexing probes. In certain embodiments, the first universal sequence I and / or the first universal sequence II is located at the 3' end of the indexing sequence.

[0493] In certain embodiments, the nucleic acid array comprises a first indexing probe containing the first universal sequence I and a second indexing probe containing the first universal sequence II. In certain embodiments, the first universal sequence I and / or the first universal sequence II is located at the 3' end of the indexing sequence.

[0494] It is readily understood by one skilled in the art that the above definitions / descriptions regarding the positioning probe apply to the first positioning probe and the second positioning probe as well, unless otherwise specified herein or clearly contradicted in context, and that the above definitions / descriptions regarding the first universal sequence apply to the first universal sequence I and the first universal sequence II as well.

[0495] In certain embodiments, in step (2)(c) of the method, the first universal sequence I is capable of annealing to the complement of the consensus sequence.

[0496] In certain embodiments, in step (2)(a) of the method, the second capture sequence comprises a sequence capable of annealing to a first segment of the target nucleotide sequence; and in step (2)(c) of the method, the first universal sequence II comprises a sequence capable of annealing to the complement of a second segment of the target nucleotide sequence, or the first universal sequence II comprises a random oligonucleotide sequence. In certain embodiments, in the target nucleotide sequence, the first segment is located 3' to the second segment.

[0497] In certain embodiments, the method further comprises, prior to step (2)(c), a step of removing the template switch sequence bound to the first extension product I (e.g., removing the template switch sequence bound to the first extension product I by cleavage or denaturation).

[0498] In certain embodiments, in step (2)(a) of the method, the first segment is present in a single-stranded region of a nucleic acid molecule derived from the sample under test that anneals to the second capture sequence.

[0499] In certain embodiments, in step (2)(a) of the method, the nucleic acid derived from the sample under test that anneals to the second capture sequence is a single-stranded nucleic acid or a double-stranded nucleic acid that contains a single-stranded region containing the first segment.

[0500] In certain embodiments, the first positioning probe does not contain a MID sequence, the template switch sequence contains a MID sequence; or, the first positioning probe contains a MID sequence, the template switch sequence does not contain a MID sequence, or, both the first positioning probe and the template switch sequence contain a MID sequence.

[0501] In certain embodiments, the template switch sequence contains a MID sequence. In certain embodiments, the MID sequence contained by each template switch sequence is different from each other.

[0502] Kit

[0503] In another aspect, the present application provides a kit comprising a nucleic acid array as described above.

[0504] In certain embodiments, the kit comprises: (a) a nucleic acid array as above, wherein the nucleic acid array does not comprise a capture probe; and (b) a capture probe comprising a capture sequence capable of annealing to a nucleic acid molecule to be captured.

[0505] In certain embodiments, the anchor region of the backbone molecule of the nucleic acid array comprises an anchor sequence capable of hybridizing to a capture probe, the capture probe further comprising a fixation sequence capable of annealing to the anchor sequence. In certain embodiments, the fixation sequence is located at the 5' end of the capture sequence.

[0506] In certain embodiments, the capture probe comprises or consists of the fixation sequence and the capture sequence, from 5' to 3' direction.

[0507] In certain embodiments, the capture probe is as defined above.

[0508] In certain embodiments, the kit comprises a nucleic acid array as described above, wherein the nucleic acid array comprises a capture probe.

[0509] In certain embodiments, the kit further comprises instructions for use. In certain embodiments, the instructions for use recite a nucleic acid spatial information detection method as described above.

[0510] In certain embodiments, the spatial information of the nucleic acid comprises localization, distribution and / or abundance of the nucleic acid.

[0511] For mRNA capture

[0512] In certain embodiments, the capture sequence of the capture probe comprises a poly(dT) sequence or a random oligonucleotide sequence.

[0513] In certain embodiments, the kit further comprises a template switch sequence comprising a common sequence and a cDNA 3' end overhang complement sequence. In certain embodiments, the MID sequence optionally further comprises a MID sequence. In certain embodiments, the MID sequence comprised by each template switch sequence is different from each other. In certain embodiments, the cDNA 3' end overhang has a length of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, 1-10, 1-5, or 2-10 nucleotides. In certain embodiments, the cDNA 3' end overhang is a 2-5 cytosine nucleotides overhang (e.g. CCC overhang).

[0514] In certain embodiments, the positioning probe of the nucleic acid array comprises a first universal sequence, and the complement of the consensus sequence of the template switch sequence is capable of annealing to the first universal sequence.

[0515] In certain embodiments, the positioning probe does not comprise a MID sequence, and the template switch sequence comprises a MID sequence; or, the positioning probe comprises a MID sequence, and the template switch sequence does not comprise a MID sequence; or, both the positioning probe and the template switch sequence comprise a MID sequence.

[0516] In certain embodiments, the kit further comprises an end-alignment primer, the 5' end sequence of which is capable of annealing to a nucleic acid molecule (e.g., an mRNA molecule) to be captured, and the 3' end sequence of which is capable of annealing to a sequence downstream of the positioning sequence in the positioning probe.

[0517] In certain embodiments, the positioning probe comprises a first universal sequence at the 3' end of the positioning sequence, and the 3' end sequence of the end-alignment primer is capable of annealing to the first universal sequence.

[0518] In certain embodiments, the kit further comprises an end-alignment primer and a ligation template, the 5' end sequence of the end-alignment primer is capable of annealing to a nucleic acid molecule (e.g., an mRNA molecule) to be captured, the 3' end sequence of the end-alignment primer is capable of annealing to the 3' end sequence of the ligation template, and the 5' end sequence of the ligation template is capable of annealing to the 5' end sequence of the positioning probe.

[0519] In certain embodiments, the positioning probe comprises a second universal sequence at the 5' end of the positioning sequence, and the 5' end sequence of the ligation template is capable of annealing to the second universal sequence.

[0520] Target nucleic acid capture

[0521] In certain embodiments, the capture sequence of the capture probe comprises a sequence capable of annealing to a target nucleotide sequence comprised by a target nucleic acid of interest (e.g., a particular target DNA and / or RNA) or a nucleic acid molecule derived from the target nucleic acid of interest (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of an RNA).

[0522] In certain embodiments, the positioning probe of the nucleic acid array comprises a first universal sequence, and the first universal sequence comprises a sequence capable of annealing to the complement of the target nucleotide sequence.

[0523] In certain embodiments, the capture sequence comprises a sequence that is capable of annealing to the first segment of the target nucleotide sequence, the first universal sequence comprises a sequence that is capable of annealing to the complement of the second segment of the target nucleotide sequence, or, the first universal sequence comprises a random oligonucleotide sequence.

[0524] In certain embodiments, in the target nucleotide sequence, the first segment is located 3' to the second segment.

[0525] In certain embodiments, the kit further comprises an end-alignment primer, the 5' end sequence of which is capable of annealing to a nucleic acid molecule to be captured (e.g., a target nucleic acid or a nucleic acid molecule derived from the target nucleic acid), and the 3' end sequence of which is capable of annealing to a sequence downstream of the localization sequence in the localization probe.

[0526] In certain embodiments, the localization probe comprises a first universal sequence at the 3' end of the localization sequence, and the 3' end sequence of the end-alignment primer is capable of annealing to the first universal sequence.

[0527] In certain embodiments, the kit further comprises an end-alignment primer and a ligation template, the 5' end sequence of the end-alignment primer is capable of annealing to a nucleic acid molecule to be captured (e.g., an mRNA molecule), the 3' end sequence of the end-alignment primer is capable of annealing to the 3' end sequence of the ligation template, and the 5' end sequence of the ligation template is capable of annealing to the 5' end sequence of the localization probe.

[0528] In certain embodiments, the localization probe comprises a second universal sequence at the 5' end of the localization sequence, and the 5' end sequence of the ligation template is capable of annealing to the second universal sequence.

[0529] Dual capture of mRNA and target nucleic acids

[0530] In certain embodiments, the capture probe comprises a first capture probe and a second capture probe; the first capture probe contains a first capture sequence, the first capture sequence comprises a poly(dT) sequence or a random oligonucleotide sequence; the second capture probe contains a second capture sequence, the second capture sequence comprises a sequence that is capable of annealing to a target nucleotide sequence comprised in a target nucleic acid (e.g., a specific target DNA and / or RNA) or a nucleic acid molecule derived from the target nucleic acid (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of an RNA).

[0531] In certain embodiments, the kit further comprises a template switch sequence comprising a common sequence and a cDNA 3' end overhang complement sequence. In certain embodiments, the MID sequence is optionally further comprises a MID sequence. In certain embodiments, the MID sequence comprised by each template switch sequence is different from each other. In certain embodiments, the cDNA 3' end overhang has a length of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, 1-10, 1-5, or 2-10 nucleotides. In certain embodiments, the cDNA 3' end overhang is a 2-5 cytosine nucleotide overhang (e.g., a CCC overhang).

[0532] In certain embodiments, the positioning probe of the nucleic acid array comprises a first universal sequence I and a first universal sequence II; wherein the first universal sequence I is capable of annealing to the complement of the common sequence, and the first universal sequence II comprises a sequence capable of annealing to the complement of the target nucleotide sequence, or the first universal sequence II comprises a random oligonucleotide sequence. In certain embodiments, the first universal sequence I and the first universal sequence II are present together in the same positioning probe, or are present separately in different positioning probes. In certain embodiments, the first universal sequence I and / or the first universal sequence II is located at the 3' end of the positioning sequence.

[0533] In certain embodiments, the nucleic acid array comprises a first positioning probe comprising the first universal sequence I and a second positioning probe comprising the first universal sequence II. In certain embodiments, the first positioning probe does not comprise a MID sequence, and the template switch sequence comprises a MID sequence; or the first positioning probe comprises a MID sequence, and the template switch sequence does not comprise a MID sequence, or both the first positioning probe and the template switch sequence comprise a MID sequence. In certain embodiments, the first universal sequence I and / or the first universal sequence II is located at the 3' end of the positioning sequence.

[0534] In certain embodiments, the second capture sequence comprises a sequence capable of annealing to the first segment of the target nucleotide sequence, and the first universal sequence II comprises a sequence capable of annealing to the complement of the second segment of the target nucleotide sequence, or the first universal sequence II comprises a random oligonucleotide sequence. In certain embodiments, in the target nucleotide sequence, the first segment is located at the 3' end of the second segment.

[0535] In certain embodiments, the kit further comprises an end- alignment primer, the 5' end sequence of which is capable of annealing to a nucleic acid molecule to be captured (e.g., i) an mRNA molecule, and / or, ii) a target nucleic acid of interest or a nucleic acid derived from the target nucleic acid of interest), and the 3' end sequence of which is capable of annealing to a sequence downstream of the localization sequence in the localization probe.

[0536] In certain embodiments, the localization probe comprises a first universal sequence at the 3' end of the localization sequence, and the 3' end sequence of the end- alignment primer is capable of annealing to the first universal sequence.

[0537] In certain embodiments, the kit further comprises an end- alignment primer and a ligation template, the 5' end sequence of the end- alignment primer is capable of annealing to a nucleic acid molecule to be captured (e.g., an mRNA molecule), the 3' end sequence of the end- alignment primer is capable of annealing to the 3' end sequence of the ligation template, and the 5' end sequence of the ligation template is capable of annealing to the 5' end sequence of the localization probe.

[0538] In certain embodiments, the localization probe comprises a second universal sequence at the 5' end of the localization sequence, and the 5' end sequence of the ligation template is capable of annealing to the second universal sequence.

[0539] It is readily understood by a person skilled in the art that the above definitions / descriptions regarding the localization probe apply equally to the first localization probe and the second localization probe, and the above definitions / descriptions regarding the first universal sequence apply equally to the first universal sequence I and the first universal sequence II, unless otherwise specified herein or clearly contradicted by context.

[0540] In certain embodiments, the first universal sequence comprised by the localization probe of the nucleic acid array is or is not located at the 3' end of the localization probe, and / or the 3' end of the first universal sequence of the localization probe of the nucleic acid array is blocked or unblocked.

[0541] In certain embodiments, the kit further comprises reagents for performing nucleic acid hybridization, reagents for performing nucleic acid extension, reagents for performing nucleic acid amplification, reagents for recovering or purifying nucleic acids, reagents for constructing a transcriptome sequencing library, reagents for sequencing (e.g., second or third generation sequencing), or any combination thereof.

[0542] Use

[0543] In another aspect, the present application provides use of a nucleic acid array or kit as described above for constructing a library of nucleic acid molecules, for performing nucleic acid sequencing, or for detecting nucleic acid spatial information in a sample.

[0544] In some embodiments, the spatial information of the nucleic acid comprises localization, distribution and / or abundance of the nucleic acid.

[0545] Advantages of the invention

[0546] The present invention splits the capture zone and spatial information on the capture chip probe into two independent parts, wherein the spatial probe (i.e. localization probe) is used to provide spatial location information of spatial omics, and the capture zone (i.e. capture probe) is used for molecular capture within the biological sample. Moreover, the capture chip of the present application is connected with a scaffold molecule, which comprises one or more anchor regions capable of binding with the capture probe. Therefore, the present invention has at least one of the following advantages: (1) the capture zone increases the number of capture probes that can be grafted on the chip by binding with the scaffold molecule, thereby getting rid of the limitation of the grafting surface area on the number of capture probes, thereby improving the capture efficiency of molecules within the biological sample while ensuring high resolution; (2) the presence of the scaffold molecule facilitates the replacement of the capture probe, and when different capture sequences are needed, the capture probe can be directly prepared without the need to re-prepare the capture chip.

[0547] Embodiments of the present invention will be described in detail below with reference to the accompanying drawings and examples, but those skilled in the art will understand that the following drawings and examples are only used to illustrate the present invention, and are not a limitation on the scope of the present invention. According to the following detailed description of the preferred embodiments and the accompanying drawings, various objects and advantageous aspects of the present invention will become apparent to those skilled in the art. BRIEF DESCRIPTION OF DRAWINGS

[0548] Figure 1: Traditional chip structure.

[0549] Figure 2: Chip structure prepared in Example 2 of the present application.

[0550] Figure 3: Chip structure prepared in Example 1 of the present application.

[0551] Figure 4: Schematic diagram of obtaining nucleic acid molecules containing positional sequence information by the chip of the present application and constructing and sequencing transcriptome library.

[0552] Figure 5: Spatial expression profile of mouse brain sections obtained in Example 1.

[0553] Figure 6: Spatial expression profile of mouse brain sections obtained in Example 2.

[0554] Sequence information

[0555] The description of the sequences involved in the present application is provided in the following table.

[0556] Table 1: Sequence information Note: "C12 spacer" refers to a C12 straight chain alkyl group located between different nucleotides, with its two ends connected to the hydroxyl group and the phosphate group of the nucleotides, respectively; V = A, C, or G; each N is independently A, T, C, or G; "r" indicates that the nucleotide at its 3' adjacent position is a ribonucleotide. DETAILED DESCRIPTION

[0557] The present application will now be described with reference to the following examples, which are intended to illustrate the present application (but not to limit the scope of the present application) and are not intended to limit the scope of the present application.

[0558] The experimental methods used in the following examples are conventional methods unless otherwise specified.

[0559] The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

[0560] Example 1: Hybridization of capture probes to a chip before the chip is contacted with a biological sample

[0561] 1. Preparation of a capture chip

[0562] One exemplary capture chip of the present application comprises a positioning probe and a scaffold molecule, wherein the positioning probe comprises, from 5' end to 3' end, a first linker sequence, a spatial position sequence (i.e., a positioning sequence), and a second linker sequence, and the scaffold molecule is hybridized with the capture probe (Figure 3).

[0563] This example shows one exemplary method for preparing the capture chip, which comprises:

[0564] (a) providing a conventional chip comprising a positioning sequence and a capture sequence in the same probe (e.g., a conventional chip as shown in Figure 1, which can be provided by purchase or self-preparation) that is conventionally used in the art; the probe of the conventional chip comprises, from 5' end to 3' end, a first linker sequence, a spatial position sequence (i.e., a positioning sequence), a second linker sequence, and a capture sequence;

[0565] (b) blocking the second linker, for example, by hybridizing an oligonucleotide molecule capable of annealing to the second linker sequence to the probe, so as to form a double-stranded structure at the position of the second linker of the probe;

[0566] (c) incubating the product of (b) with an exonuclease having 3' to 5' single-stranded exonuclease activity; so as to allow the capture sequence of the probe of the conventional chip to be cut off by the exonuclease, thereby forming a positioning probe containing the positioning sequence but not containing the capture sequence;

[0567] (d) connecting a skeleton molecule on the chip containing the localization probe obtained in (c) through a click chemistry reaction, and hybridizing a capture probe containing a capture sequence with the skeleton molecule, thereby obtaining an exemplary capture chip of the present application. Specifically, the capture chip preparation steps are as follows:

[0568] (1) Blocking chip capture area: A piece of oligo sequence GTCTTAGGAAGACAA (SEQ ID NO: 1) is synthesized from Shengong, 5x SSC (saline sodium citrate) is prepared into 1 mM; Take out the chip in the stereo-seq transcriptomics T kit (Huada, item number: 111KT114) reagent box (the chip contains probes containing localization sequences and capture sequences), take 100 ul of 1 mM oligo solution to the chip, and hybridize at room temperature for 30 min; The above hybridization solution is sucked off, and the chip is washed with 0.1x SSC, 50ul Exonuclease I (purchased from ThermoFisher, item number: EN0581) reaction solution (5ul Exonuclease I, 5ul 10x Reaction buffer, 40ul ddH2O) is added, and the reaction is carried out at 37℃ for 20 min, then the reaction solution is discarded, and the chip is washed with 0.1x SSC. In this way, the capture sequence in the probe on the chip is removed, and the 25bp space information (i.e., the localization sequence) in the probe is retained.

[0569] (2) Chip surface modification: configure 0.1% polylysine solution (purchased from sigma, item number: P8920), add to the above treated chip, incubate at 30°C for 3h, so that the chip surface is modified with amino group, discard the reaction solution, and wash the chip with ddH2O, then dry the chip for 1h. Configure the NHS-PEG-N3 reaction solution (purchased from sigma, item number: JKA5088) according to the instructions and add the reaction solution to the chip, react at 37°C for 5h, so that the chip surface is modified with azide group.

[0570] (4) Capture probe hybridization: commission shenggong to synthesize a capture probe sequence GCACATCAGGAGGTGGCAGGAGTCTAAGTCACACAGTCGGAGGNNNNNNTTTTTTTTTTTTTTTTTTTTTV (SEQ ID NO: 3), dilute to 1 μM with 5x SSC, add dropwise to the chip surface, hybridize at 55°C for 30 min, so that the capture probe hybridizes to the scaffold molecule on the chip.

[0571] 2. Biological sample transcriptome information capture

[0572] (1) Tissue permeation treatment: refer to the instructions of stereo-seq transcriptomics T kit, cut the tissue slice, such as mouse brain slice, and paste it on the chip, and release mRNA after permeation treatment of the slice, so that the mRNA in the tissue is captured by the capture probe on the chip;

[0573] (2) cDNA synthesis: configure the reverse transcription reaction system as follows, synthesize cDNA on the substrate surface at 42°C, and make it carry position information (for example, make the cDNA molecule carry the complementary sequence of the positioning sequence)

[0574] (3) Tissue removal: 0.5% SDS was applied to remove the tissue from the substrate and the chip surface was washed clean with 0.1X SSC solution.

[0575] 3. cDNA release and amplification:

[0576] 100 mM KOH solution was applied to the chip surface. After 1 h of reaction, the surface liquid was collected and neutralized with 0.1 μΜ HC1 to make the solution pH around 8.5. The following PCR reaction system (8 tubes in total) was prepared for cDNA amplification.

[0577] 4. Library construction and sequencing

[0578] The cDNA library was broken according to the instruction manual, prepared into DNB and sequenced; the sequencing was set at 25 bp for spatial information decoding, followed by 22 bp dark reaction, then 5 bp sequencing reaction for molecular tag (MID), and 50 bp-100 bp sequencing reaction for cDNA 5' end transcript information.

[0579] 5. Data analysis:

[0580] (1) The website http: / / stereomap.cngb.org / Stereo-Draftsman / report / index was logged in, and the data analysis was performed according to the website operation guide. The read 1 sequence (from single strand sequencing) obtained in step 4 was compared with the 25 bp position information of the capture chip in step 1, the reads that could be aligned to the chip position information were reserved, and they were corresponded to the corresponding chip position. The 46 bp starting sequence corresponding to the reads corresponding to the chip position was the cDNA sequence, and the sequence was reverse complemented and compared with the mouse brain genome, and the repeated reads were removed according to the MID information obtained from 41 bp-45 bp, to obtain the number of each gene expression in the mouse brain.

[0581] (2) The number of each gene expression was further mapped to obtain the spatial expression map of the mouse brain section as shown in Figure 5.

[0582] Example 2: The capture probe was added after the biological sample contacted the chip, i.e. during the RT reaction

[0583] 1. Preparation of capture chip

[0584] One exemplary capture chip of the present application comprises a positioning probe and a scaffold molecule, wherein the positioning probe comprises, from 5' end to 3' end, a first linker sequence, a spatial position sequence (i.e. a positioning sequence), and a second linker sequence (Figure 2).

[0585] This example shows one exemplary preparation method of the capture chip, which comprises:

[0586] (a) providing a conventional chip comprising a same probe containing a positioning sequence and a capture sequence (for example, a conventional chip as shown in Figure 1, which can be provided by purchase or self-preparation) commonly used in the art; the probe of the conventional chip comprises, in order from 5' end to 3' end, a first linker sequence, a spatial position sequence (i.e., a positioning sequence), a second linker sequence and a capture sequence;

[0587] (b) closing the second linker, for example, hybridizing an oligonucleotide molecule capable of annealing to the second linker sequence to the probe, so as to form a double-stranded structure at the position of the second linker of the probe;

[0588] (c) incubating an exonuclease with the product of (b), the exonuclease having 3' to 5' end single-stranded exonuclease activity; so that the capture sequence of the probe of the conventional chip is cut off by the exonuclease, thereby forming a positioning probe containing no capture sequence and containing a positioning sequence;

[0589] (d) connecting a backbone molecule to the chip containing a positioning probe obtained in (c) through a click chemistry reaction, thereby obtaining an exemplary capture chip of the present application.

[0590] Specifically, the capture chip preparation steps are as follows:

[0591] (1) Close the capture area of the chip: synthesize an oligo sequence GTCTTAGGAAGACAA (SEQ ID NO: 1) from Shengwo, prepare 1 μM with 5x SSC; take out the chip in the stereo-seq transcriptomics T kit (Huada, item number: 111KT114) (the chip contains a probe containing a positioning sequence and a capture sequence), take 100 ul of 1 μM oligo solution to the chip, hybridize at room temperature for 30 min; aspirate the above hybridization solution, and wash the chip with 0.1x SSC, add 50 ul of Exonuclease I (purchased from ThermoFisher, item number: EN0581) reaction solution (5ul Exonuclease I, 5ul 10x Reaction buffer, 40ul ddH2O) 37℃ reaction 20min, discard the reaction solution, and wash with 0.1x SSC; so that the capture sequence in the probe on the chip is removed, and the 25bp spatial information (i.e., the positioning sequence) in the probe is retained.

[0592] (2) Chip surface modification: configure 0.1% polylysine solution (purchased from sigma, item number: P8920) and add it to the above-mentioned treated chip, incubate at 30°C for 3h, so that the chip surface is modified with amino groups, discard the reaction solution, and clean the chip with ddH2O, then dry the chip for 1h. Configure the NHS-PEG-N3 reaction solution (purchased from sigma, item number: JKA5088) according to the instructions and add it to the chip, react at 37°C for 5h, so that the chip surface is modified with azide groups.

[0593] (3) Skeleton molecule modification: commission Shengong to synthesize a skeleton molecule ACTCCTGCCACCTCCTGATGTGC(C12spacer)ACTCCTGCCACCTCCTGATGTGC(C12spacer)ACTCCTGCCACCTCCTGATGTGC(C12spacer)ACTCCTGCCACCTCCTGATGTGC(SEQ ID NO: 2), which contains a DBCO modification at the 5' end. Dilute the skeleton molecule to 1μM with PBS and add it to the chip containing azide groups obtained in step (2) and react at 37°C overnight. Thus, the skeleton molecule is connected to the chip through the click chemistry reaction between DBCO and azide groups on the chip.

[0594] 2. Capture of transcriptome information of biological samples

[0595] (1) Tissue permeation treatment: refer to the instructions of stereo-seq transcriptomics T kit, cut the tissue slice, such as mouse brain slice, and attach it to the chip, and then release mRNA by permeating the slice, so that the mRNA in the tissue is captured by the capture probe;

[0596] (2) cDNA synthesis: configure the reverse transcription reaction system as follows, synthesize cDNA on the substrate surface at 42°C, and make it carry position information (for example, make the cDNA molecule carry the complementary sequence of the positioning sequence)

[0597] (3) Tissue removal: configure 0.5% SDS to remove the tissue from the substrate, and clean the chip surface with 0.1X SSC solution.

[0598] 3. cDNA release and amplification:

[0599] Configure 100mM KOH solution and drop it onto the chip surface, react for 1h, then collect the surface liquid and neutralize it with 0.1μM HCl, so that the solution pH reaches about 8.5. Configure the PCR reaction system (8 tubes in total) as follows to amplify the cDNA.

[0600] 4. Library construction and sequencing

[0601] The cDNA library is broken, prepared into DNB and sequenced according to the instruction manual; the sequencing is set at 25bp for spatial information decoding, followed by 22bp dark reaction, then 5bp sequencing reaction for molecular tag (MID), and 50bp-100bp sequencing reaction for information of 5' end transcript of cDNA.

[0602] 5. Data analysis:

[0603] (1) Log in the website http: / / stereomap.cngb.org / Stereo-Draftsman / report / index, and perform data analysis according to the website operation guide. The read1 sequence (from one strand sequencing) obtained in step 4 is compared with the 25bp position information in step 1, and the reads that can be compared to the chip position information are reserved and corresponded to the corresponding chip position. The 46bp starting sequence corresponding to the reads corresponding to the chip position is the cDNA sequence, and the sequence is reverse complemented and compared with the mouse brain genome, and the repeated reads are removed according to the MID information obtained from 41bp-45bp, to obtain the number of each gene expression in the mouse brain.

[0604] (2) The number of each gene expression is further mapped to obtain the spatial expression map of the mouse brain section as shown in Figure 6.

[0605] Although the specific embodiments of the present application have been described in detail, those skilled in the art will understand that various modifications and changes can be made to the details according to all the teachings disclosed herein, and these changes are within the scope of protection of the present application. The entire scope of the present application is given by the appended claims and any equivalents thereof.

Claims

1. A nucleic acid array for detecting spatial information of nucleic acids in a sample, comprising a solid support, the solid support being attached with a scaffold molecule and a localization probe; the scaffold molecule and the localization probe are each independently attached with the solid support; the localization sequence has a nucleotide sequence corresponding to the position of the localization probe on the solid support; the scaffold molecule contains an anchor region capable of anchoring a capture probe; the anchor region is capable of forming a covalent and / or non-covalent linkage with the capture probe; preferably, the anchor region comprises an anchor sequence capable of hybridizing with the capture probe; preferably, the solid support is attached with at least two scaffold molecules, each of the scaffold molecules independently contains at least one or at least two anchor regions; preferably, each of the anchor regions independently comprises the anchor sequence capable of hybridizing with the capture probe; preferably, each of the scaffold molecules independently contains at least two anchor regions, the anchor sequences comprised by the same scaffold molecule are identical to each other, different from each other, or partially identical; and / or, the anchor sequences comprised by different scaffold molecules are identical to each other, different from each other, or partially identical; preferably, different scaffold molecules attached with the solid support contain identical anchor sequences. each of the scaffold molecules independently contains at least two anchor regions, and the scaffold molecule optionally contains a spacer between adjacent anchor regions; preferably, each of the spacers is independently selected from the group consisting of: a gap sequence of abasic units, an alkyl group comprising 2 to 18 carbon atoms, a polyethylene glycol (PEG), a double-stranded nucleic acid, and any combination thereof; preferably, each of the spacers is independently selected from the group consisting of: a C12 spacer, a C6 spacer, a C3 spacer, a C9 spacer, a C18 spacer, and any combination thereof; preferably, the spacer is a C12 spacer; the solid support is attached with at least one, at least two, or more localization probes, the localization sequences of different localization probes are different; preferably, each of the localization probes independently occupies a different position on the solid support; preferably, the localization sequence has a nucleotide sequence uniquely corresponding to the position of the localization probe on the solid support; the localization probe further comprises a first universal sequence; preferably, the first universal sequence is located at the 3' end of the localization sequence; preferably, the localization probe further comprises a second universal sequence; preferably, the second universal sequence is located at the 5' end of the localization sequence; the localization probe does not comprise or further comprises a molecular identifier (MID) sequence; preferably, the localization probe further comprises a MID sequence; preferably, the MID sequence is located at the 5' end of the first universal sequence, and / or the MID sequence is located at the 3' end of the second universal sequence; preferably, the MID sequence comprised by each of the localization probes is different from each other in the same localization probe; preferably, the MID sequence comprised by each of the localization probes is different from each other in all localization probes attached with the solid support. ​ The positioning probe contains a positioning sequence, wherein, ​ ​ 2. The nucleic acid array of claim 1, wherein, ​ ​ ​ ​ ​ ​ 3. The nucleic acid array of claim 1 or 2, wherein, ​ ​ ​ ​ 4. The nucleic acid array of any one of claims 1 to 3, wherein, ​ ​ ​ 5. The nucleic acid array of any one of claims 1 to 4, wherein, ​ ​ ​ 6. The nucleic acid array of any one of claims 1 to 5, wherein, ​ ​ ​ ​ ​ 7. The nucleic acid array of any one of claims 1-6, which has one or more of the following features selected from the group consisting of: (1) the anchor region comprises an anchor sequence capable of hybridizing to a capture probe, the anchor sequence being a nucleotide sequence consisting of 5-100 nucleotide residues; (2) the scaffold molecule is a single-stranded nucleic acid or a double-stranded nucleic acid comprising a single-stranded region; preferably, the scaffold molecule is a single-stranded nucleic acid, or, the scaffold molecule is a double-stranded nucleic acid comprising a single-stranded region comprising an anchor sequence capable of hybridizing to a capture probe; (3) the scaffold molecule comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 8, at least 10, at least 15, or at least 20 anchor regions; (4) each localization probe comprises at least one localization probe molecule attached to the solid support; (5) the localization sequence consists of a nucleotide sequence of 5-50 random nucleotides, preferably, each random nucleotide is independently any one of deoxyribonucleotides A, C, G, and T; (6) localization probes of the same species occupy the same area of the surface of the solid support, localization probes of different species occupy different areas of the support surface, and the center-to-center distance between any two adjacent areas is less than 10 μm (e.g., less than 8 μm, less than 5 μm, less than 3 μm, less than 1 μm, less than 900 nm, less than 800 nm, less than 700 nm, less than 600 nm, less than 500 nm, less than 400 nm, less than 300 nm, less than 250 nm, less than 220 nm, less than 200 nm, less than 100 nm, less than 90 nm, less than 80 nm, less than 70 nm, less than 60 nm, less than 50 nm, less than 40 nm, less than 30 nm, less than 20 nm, less than 10 nm); (7) each localization probe is surrounded by at least 100 (e.g., 500-10,000) scaffold molecules; preferably, each localization probe is surrounded by at least 100 (e.g., 500-10,000) scaffold molecules within a range of less than 10 μm (e.g., less than 8 μm, less than 5 μm, less than 3 μm, less than 1 μm, less than 900 nm, less than 800 nm, less than 700 nm, less than 600 nm, less than 500 nm, less than 400 nm, less than 300 nm, less than 200 nm, less than 100 nm, less than 90 nm, less than 80 nm, less than 70 nm, less than 60 nm, less than 50 nm, less than 40 nm, less than 30 nm, less than 20 nm, less than 10 nm, e.g., 200-300 nm) from the center of the localization probe (e.g., the center of the area occupied by the localization probe on the surface of the solid support). ​ (8) the solid support is selected from the group consisting of latex beads, dextran beads, polystyrene surfaces, polypropylene surfaces, polyacrylamide gels, gold surfaces, glass surfaces, chips, sensors, electrodes, and silicon wafers; preferably, the solid support is a chip (e.g., a sequencing chip); (9) the solid support is capable of releasing the localization probe spontaneously or upon exposure to one or more stimuli (e.g., a change in temperature, a change in pH, exposure to a particular chemical or phase, exposure to light, exposure to a reducing agent).

8. The nucleic acid array of any one of claims 1 to 7, wherein, the localization probe and / or the scaffold molecule are covalently and / or non-covalently attached to the solid support; preferably, the localization probe and / or the scaffold molecule are covalently attached to the solid support; preferably, the localization probe and the scaffold molecule are each independently attached to the solid support via the same or different click chemistry reactions; preferably, the pair of molecules or groups capable of undergoing a click chemistry reaction is selected from the group consisting of: alkynyl / azido, azido / cyano, amine / alkene, thiol / alkene, thiol / alkyne, aldehyde / 1,3-diol, ketone / 1,3-diol; preferably, the pair of molecules or groups capable of undergoing a click chemistry reaction is azido / alkynyl; for example, the solid support is surface-modified with a molecule or group X, the localization probe is modified with a molecule or group Y, the molecule or group X is capable of undergoing a click chemistry reaction with the molecule or group Y, the localization probe is attached to the solid support via the click chemistry reaction of the molecule or group X with the molecule or group Y; and / or or, the solid support is surface-modified with a molecule or group X', the scaffold molecule is modified with a molecule or group Y', the molecule or group X' is capable of undergoing a click chemistry reaction with the molecule or group Y', the scaffold molecule is attached to the solid support via the click chemistry reaction of the molecule or group X' with the molecule or group Y'; preferably, the pairs of molecules or groups X / Y and X' / Y' are each independently selected from the group consisting of: alkynyl / azido, azido / cyano, amine / alkene, thiol / alkene, thiol / alkyne, aldehyde / 1,3-diol, ketone / 1,3-diol, azido / alkynyl, cyano / azido, alkene / amine, alkene / thiol, alkyne / thiol, 1,3-diol / aldehyde, 1,3-diol / ketone; Preferably, the solid support surface is modified with azido groups and the positioning probe and / or the scaffold molecule is modified with (DBCO), the localization probe and / or the scaffold molecule are attached to the solid support via a click chemistry reaction of the azido group with DBCO.

9. The nucleic acid array of any one of claims 1 to 8, wherein, the nucleic acid array further comprises a capture probe, the capture probe comprising a capture sequence capable of annealing to a nucleic acid molecule to be captured; preferably, the capture probe is covalently and / or non-covalently anchored on the anchor region; preferably, the anchor region comprises an anchor sequence capable of hybridizing to a capture probe; the capture probe further comprises a fixation sequence capable of annealing to the anchor sequence; preferably, the fixation sequence is located 5' to the capture sequence; preferably, the capture probe comprises or consists of the fixation sequence and the capture sequence, in the 5' to 3' direction; preferably, the capture probe comprises or consists of the fixation sequence and the capture sequence, in the 5' to 3' direction; Preferably, the capture probe is anchored to the scaffold molecule via base-pairing of the immobilization sequence to the anchor sequence of the scaffold molecule; Preferably, the capture probe does not comprise or further comprises a molecular identifier (MID) sequence; Preferably, the capture probe further comprises a MlD sequence; Preferably, the MlD sequence is located at the 5' end of the capture sequence, and / or the MlD sequence is located at the 5' end and / or 3' end of the immobilization sequence; Preferably, the MlD sequence comprised by each of the capture probes of the same kind is different from each other; Preferably, the MlD sequence comprised by each of the capture probes of the nucleic acid array is different from each other.

10. The nucleic acid array of claim 9, wherein, The nucleic acid array comprises one or more of the capture probes; Preferably, the capture sequences comprised by different kinds of the capture probes are different; Preferably, the nucleic acid molecule to be captured is RNA (e.g., mRNA), and the capture sequence of the capture probe comprises a poly(dT) sequence or a random oligonucleotide sequence; or, the nucleic acid molecule to be captured is a target nucleic acid (e.g., a target DNA and / or RNA) or a nucleic acid molecule derived from the target nucleic acid (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA), the target nucleic acid or the nucleic acid molecule derived from the target nucleic acid (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA) has a target nucleotide sequence, and the capture sequence of the capture probe comprises a sequence capable of annealing to the target nucleotide sequence; or, the nucleic acid molecule to be captured comprises (i) RNA (e.g., mRNA) and (ii) a target nucleic acid (e.g., a target DNA and / or RNA) and / or a nucleic acid molecule derived from the target nucleic acid (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA), the nucleic acid array comprises a first capture probe capable of capturing RNA (e.g., mRNA) and a second capture probe capable of capturing the target nucleic acid and / or the nucleic acid molecule derived from the target nucleic acid (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA), the target nucleic acid or the nucleic acid molecule derived from the target nucleic acid has a target nucleotide sequence; wherein the capture sequence of the first capture probe comprises a poly(dT) sequence or a random oligonucleotide sequence, and the capture sequence of the second capture probe comprises a sequence capable of annealing to the target nucleotide sequence.

11. The nucleic acid array of claim 9 or 10, which has one or more of the features selected from the group consisting of: (1) the capture sequence is located at the 3' end of the capture probe; (2) the capture sequence is capable of initiating an extension reaction (e.g., the 3' end of the capture sequence has a free hydroxyl group (-OH)); (3) the capture sequence does not form base-pairing with the scaffold molecule; (4) all or part of the anchor region of the scaffold molecule linked to the solid support is linked to the capture probe; (5) the localization probe comprises a first universal sequence, which is capable of annealing to (i) an extension product obtained with a nucleic acid molecule as a template, which is captured by the capture sequence, or, (ii) a nucleic acid molecule derived from (i).

12. A method for preparing the nucleic acid array of any one of claims 1-11, comprising the following steps: (A) attaching and / or synthesizing the localization probe on the solid support, the localization probe being as defined in any one of claims 1, 4-8, 11; and, (B) attaching and / or synthesizing the scaffold molecule on the solid support, the scaffold molecule being as defined in any one of claims 1-3, 7-9; wherein, the (A) and (B) can be performed in any order or simultaneously (e.g., simultaneously in the same reaction system).

13. The method of claim 12, wherein, Step (A) comprises: (1) providing: (a) the free localization probe, wherein the localization probe is modified with a molecule or group Y; and, (b) the solid support, the surface of the solid support being modified with a molecule or group X, which is capable of forming a linkage (e.g., covalent and / or non-covalent linkage) with the molecule or group Y; and, (2) contacting the localization probe with the solid support under conditions suitable for the molecule or group X to form a linkage with the molecule or group Y, thereby obtaining the solid support with the localization probe attached thereto; Preferably, in step (2), after obtaining the localization sequence information of the localization probe, the localization probe is attached to a predetermined position on the solid support; or, before obtaining the localization sequence information of the localization probe, the localization probe is attached to a random position on the solid support, and then the localization sequence information of the localization probe at the random position is determined to achieve the association of the localization probe with the position, so that the position corresponding to each localization probe is determined; Preferably, the molecule or group X is capable of undergoing a click chemistry reaction with the molecule or group Y; Preferably, the molecule or group X / Y is selected from the group consisting of: alkynyl / azido, azido / cyano, amine / alkene, thiol / alkene, thiol / alkyne, aldehyde / 1,3-diol, ketone / 1,3-diol, azido / alkynyl, cyano / azido, alkene / amine, alkene / thiol, alkyne / thiol, 1,3-diol / aldehyde, 1,3-diol / ketone; Preferably, the molecule or group X / Y is azido / alkynyl or alkynyl / azido; Preferably, the positioning probe is modified with (DBCO), the surface of the solid support being modified with an azido group, the localization probe and the solid support forming a linkage through a click chemistry reaction of DBCO with the azido group.

14. The method of claim 12, wherein, Step (A) comprises: (1) providing a carrier, the carrier comprising at least one copy of a carrier sequence, the carrier sequence comprising: a complement of a localization sequence; the localization sequence being as defined in any one of claims 1, 4, 7; (2) placing the carrier on the surface of the solid support; (3) providing a fixed primer, and performing a nucleic acid polymerization reaction with the carrier sequence as a template to generate an extension product, the extension product being the localization probe; wherein, the fixed primer is capable of annealing to the carrier sequence and initiating the extension reaction; and, (4) removing the carrier from the surface of the solid support. (4) attaching the immobilized primer to the surface of the solid support; wherein steps (3) and (4) are performed in any order (e.g., step (3) is performed before or after step (4), or step (3) is performed simultaneously with step (4)); Preferably, the support comprises a plurality of copies of the support sequence. Preferably, the support is a DNB formed by a concatemer of a plurality of copies of the support sequence. Preferably, the support is a DNA cluster formed by a colony of the support sequence. Preferably, the method optionally comprises step (5): digesting the support sequence, and / or, separating the extension product in step (3) from the support sequence annealed thereto. Preferably, the support is provided in step (1) by: (i) providing a support template sequence comprising a complement of the support sequence; (ii) performing a nucleic acid amplification reaction using the support template sequence as a template to obtain an amplification product of the support template sequence, the amplification product comprising at least one copy of the support sequence; preferably, performing rolling circle replication to obtain a DNB formed by a concatemer of a plurality of copies of the support sequence.

15. The method of claim 14, wherein, In step (1), at least one, at least two or more supports are provided, each support comprising a positioning sequence in the support sequence that is different from the positioning sequence in the support sequence of the other support(s). Preferably, in step (1), at least two or more supports are provided, each support independently comprises one or more copies (preferably, a plurality of copies) of the support sequence.

16. The method of claim 14 or 15, wherein, The support sequence further comprises a complement of a first universal sequence, the first universal sequence being as defined in claim 5; Preferably, the complement of the first universal sequence is located 5' to the complement of the positioning sequence. Preferably, the support sequence comprises, in the order from 5' to 3', the complement of the first universal sequence, and the complement of the positioning sequence. Preferably, the extension product comprises, in the order from 5' to 3', the positioning sequence, and the first universal sequence. Preferably, the support sequence further comprises a complement of a second universal sequence or a partial sequence thereof (e.g., the support sequence further comprises a complement of the second universal sequence or a 3' partial sequence thereof), the second universal sequence being as defined in claim 5. Preferably, the complement of the second universal sequence or the partial sequence thereof is located 3' to the complement of the positioning sequence. Preferably, the immobilized primer comprises the second universal sequence or a partial sequence thereof (e.g., the immobilized primer comprises the second universal sequence or a 5' partial sequence thereof). Preferably, the extension product comprises, in the order from 5' to 3', the second universal sequence, the positioning sequence, and the first universal sequence. Preferably, the support sequence does not comprise or further comprises a template sequence of a MID sequence. ​ Preferably, the vector sequence further comprises a template sequence of the MID sequence; preferably, the template sequence of the MID sequence is located at the 3' end of the complement of the first universal sequence, and / or, the template sequence of the MID sequence is located at the 5' end of the complement of the second universal sequence or partial sequence thereof; preferably, the MID sequence consists of 5-50 (e.g. 5-25, 5-35, 5-45, 10-25, 10-35, 10-45, 15-25, 15-35, 15-45, 20-25, 20-35, or 20-45) degenerate deoxyribonucleotide residues.

17. The method of any one of claims 14-16, wherein, the immobilized primer is covalently and / or non-covalently linked to the solid support; preferably, the immobilized primer is covalently linked to the solid support; preferably, the immobilized primer is linked to the solid support via a click chemistry reaction; preferably, the molecule or group pair capable of undergoing the click chemistry reaction is selected from the group consisting of: alkynyl / azido, azido / cyano, amine / alkene, thiol / alkene, thiol / alkyne, aldehyde / 1,3-diol, ketone / 1,3-diol; preferably, the molecule or group pair capable of undergoing the click chemistry reaction is azido / alkynyl; Preferably, the immobilized primer is modified with the immobilized primer is linked to the solid support via a click chemistry reaction between DBCO and azido, the surface of the solid support being modified with azido.

18. The method of any one of claims 12-17, wherein, The step (B) comprises: (1) providing: (a) free said scaffold molecule, wherein said scaffold molecule is as defined in any one of claims 1-3, 7-9, and said scaffold molecule is modified with a molecule or group Y'; and, (b) said solid support, the surface of said solid support being modified with a molecule or group X' capable of forming a linkage (e.g. covalent and / or non-covalent linkage) with said molecule or group Y'; and, (2) contacting said scaffold molecule with said solid support under conditions suitable for said molecule or group X' to form a linkage with said molecule or group Y', thereby obtaining a solid support having said scaffold molecule linked thereto; preferably, said molecule or group X' is capable of undergoing a click chemistry reaction with said molecule or group Y'; preferably, said molecule or group X' / Y' is selected from the group consisting of: alkynyl / azido, azido / cyano, amine / alkene, thiol / alkene, thiol / alkyne, aldehyde / 1,3-diol, ketone / 1,3-diol, azido / alkynyl, cyano / azido, alkene / amine, alkene / thiol, alkyne / thiol, 1,3-diol / aldehyde, 1,3-diol / ketone; preferably, said molecule or group X' / Y' is azido / alkynyl or alkynyl / azido; Preferably, the scaffold molecule is modified with the immobilized primer is linked to the solid support via a click chemistry reaction between DBCO and azido, the surface of the solid support being modified with azido.

19. The method of any one of claims 12-17, wherein, The nucleic acid array further comprises a capture probe, said capture probe being as defined in any one of claims 9-11, and the step (B) comprises: (I) (1) providing: (a) free said scaffold molecule, wherein said scaffold molecule is as defined in any one of claims 1-3, 7-9, and said scaffold molecule is modified with a molecule or group Y'; and, (b) said solid support, said solid support is surface-modified with a molecule or group X' capable of forming a linkage (e.g., covalent and / or non-covalent linkage) with said molecule or group Y'; and, (c) free said capture probe, said capture probe is capable of forming a covalent and / or non-covalent linkage with the anchor region of said scaffold molecule; (2) contacting said scaffold molecule with said solid support under conditions suitable for said molecule or group X' to form a linkage with said molecule or group Y', thereby obtaining a solid support having said scaffold molecule linked thereto; and, (3) contacting said free capture probe with the solid support having said scaffold molecule linked thereto formed in step (2) under conditions suitable for said capture probe to form a linkage with said scaffold molecule, allowing said capture probe to link to said scaffold molecule, thereby obtaining a solid support having said scaffold molecule and said capture probe linked thereto; or, (II) (1) providing: (a) a scaffold molecule having said capture probe linked thereto, said scaffold molecule is modified with a molecule or group Y'; and, (b) a solid support, said solid support is surface-modified with a molecule or group X' capable of forming a linkage (e.g., covalent and / or non-covalent linkage) with said molecule or group Y'; and, (2) contacting said scaffold molecule having said capture probe linked thereto provided in step (II)(1)(a) with said solid support under conditions suitable for said molecule or group X' to form a linkage with said molecule or group Y', thereby obtaining a solid support having said scaffold molecule and said capture probe linked thereto; Preferably, the anchor region of said scaffold molecule comprises an anchor sequence capable of hybridizing with a capture probe; preferably, said capture probe comprises a fixed sequence capable of hybridizing with said anchor sequence; Preferably, in step (I)(3), said free capture probe is contacted with the solid support having said scaffold molecule linked thereto formed in step (2) under conditions suitable for said scaffold molecule to anneal with said capture probe, allowing said capture probe to anneal to said scaffold molecule; Preferably, in step (II)(1), said scaffold molecule having said capture probe linked thereto is an annealing product of said scaffold molecule and said capture probe; preferably, in said annealing product, the 3' end of said capture probe comprises a capture sequence, and said capture sequence does not base-pair with said scaffold molecule.

20. The method of claim 19, wherein, said molecule or group X' is capable of undergoing a click chemistry reaction with said molecule or group Y'; Preferably, the molecule or group X' / Y' is selected from the group consisting of: alkynyl / azido, azido / cyano, amine / enes, thiol / enes, thiol / alkynes, aldehyde / 1,3-diol, ketone / 1,3-diol, azido / alkynyl, cyano / azido, enes / amine, enes / thiol, alkynes / thiol, 1,3-diol / aldehyde, 1,3-diol / ketone; Preferably, the molecule or group X' / Y' is azido / alkynyl or alkynyl / azido; Preferably, the scaffold molecule is modified with a click chemistry reaction between DBCO and azido, to form a linkage.

21. The method of any one of claims 18-20, wherein, The scaffold molecule is provided by direct synthesis, or by hybridization or ligation of at least two of the anchor regions.

22. The method of any one of claims 12-17, wherein, The anchor region of the scaffold molecule comprises an anchor sequence that is capable of hybridizing to a capture probe, and the step (B) comprises: (1) providing a carrier comprising at least one copy of a carrier sequence, the carrier sequence comprising a complement of an anchor sequence; the anchor sequence being as defined in any one of claims 1-2, 7; (2) placing the carrier on the surface of the solid support; (3) providing a immobilized primer, and performing a nucleic acid polymerization reaction using the carrier sequence as a template, to generate an extension product, the extension product comprising the anchor sequence; wherein the immobilized primer is capable of annealing to the carrier sequence and initiating the extension reaction; and, (4) linking the immobilized primer to the surface of the solid support; wherein steps (3) and (4) are performed in any order (e.g., step (3) is performed before or after step (4), or step (3) is performed simultaneously with step (4)); Preferably, the carrier sequence comprises a complement of at least one or at least two anchor sequences; Preferably, the extension product comprises at least one or at least two of the anchor sequences; Preferably, each carrier is a DNB formed from a concatemer of multiple copies of the carrier sequence; Preferably, the method optionally comprises a step (5) of digesting the carrier sequence, and / or separating the extension product of step (3) from the carrier sequence to which it is annealed; Preferably, the carrier is provided in step (1) by: (i) providing a carrier template sequence, the carrier template sequence comprising a complement of the carrier sequence; (ii) performing a nucleic acid amplification reaction using the carrier template sequence as a template, to obtain an amplification product of the carrier template sequence, the amplification product comprising at least one copy of the carrier sequence; preferably, rolling circle replication is performed to obtain a DNB formed from a concatemer of multiple copies of the carrier sequence. the immobilized primer is covalently and / or non-covalently linked to the solid support; 23. The method of claim 22, wherein, Preferably, the immobilized primer is covalently linked to the solid support; Preferably, the immobilized primer is linked to the solid support by a click chemistry reaction. ​ Preferably, the pair of molecules or groups capable of undergoing the click chemistry reaction is selected from the group consisting of: alkynyl / azido, azido / cyanide, amine / alkene, thiol / alkene, thiol / alkyne, aldehyde / 1,3-diol, ketone / 1,3-diol; preferably, the pair of molecules or groups capable of undergoing the click chemistry reaction is azido / alkynyl; Preferably, the immobilized primer is modified with a first primer comprising a DBCO group, the solid support being surface-modified with azido groups, the immobilized primer and the solid support forming a linkage via a click chemistry reaction of DBCO with azido.

24. The method of claim 22 or 23, wherein, The nucleic acid array further comprises a capture probe, the capture probe being as defined in any one of claims 9-11, and the step (B) further comprises a step (6): under conditions allowing annealing, contacting the free capture probe with the solid support having the backbone molecule attached obtained in step (5), annealing the capture probe to the backbone molecule, thereby obtaining a solid support having the capture probe attached; Preferably, in step (6), the 3' end of the capture probe comprises a capture sequence, and the capture sequence does not base pair with the backbone molecule.

25. A method of preparing a nucleic acid array according to any one of claims 1-11, comprising the steps of: (A) providing a nucleic acid array to be processed, the nucleic acid array to be processed comprising solid supports having oligonucleotide molecules attached; the oligonucleotide molecules comprising a localization sequence, wherein the localization sequence has a nucleotide sequence corresponding to the position of the oligonucleotide molecule on the solid support; the localization sequence being as defined in any one of claims 1, 4, 7; and, (B) attaching and / or synthesizing a backbone molecule on the solid supports comprised by the nucleic acid array to be processed, the backbone molecule being as defined in any one of claims 1-3, 7-9. the solid supports having attached at least one, at least two or more oligonucleotide molecules, each oligonucleotide molecule comprising a different localization sequence; 26. The method of claim 25, wherein, Preferably, each oligonucleotide molecule individually occupies a different position on the solid support; Preferably, the localization sequence has a nucleotide sequence corresponding uniquely to the position of the oligonucleotide molecule on the solid support. the oligonucleotide molecule further comprising a first universal sequence, the first universal sequence being as defined in claim 5; 27. The method of claim 25 or 26, wherein, Preferably, the first universal sequence is located at the 3' end of the localization sequence; Preferably, the oligonucleotide molecule further comprises a second universal sequence, the second universal sequence being as defined in claim 5; Preferably, the second universal sequence is located at the 5' end of the localization sequence; Preferably, the oligonucleotide molecule does not comprise or further comprises a MID sequence; Preferably, the oligonucleotide molecule further comprises a MID sequence; preferably, the MID sequence is located at the 5' end of the first universal sequence, and / or the MID sequence is located at the 3' end of the second universal sequence; preferably, the MID sequence comprised by the same oligonucleotide molecule is different from the MID sequence comprised by another oligonucleotide molecule; preferably, the nucleic acid array comprises oligonucleotide molecules each comprising a different MID sequence. ​ 28. The method of any one of claims 25-27, wherein, the 3' end of the oligonucleotide molecule does not comprise a capture sequence (e.g., the oligonucleotide molecule does not comprise a capture sequence at the 3' end of the first universal sequence), the capture sequence being as defined in any one of claims 9-11.

29. The method of any one of claims 25-27, wherein, the 3' end of the oligonucleotide molecule comprises a capture sequence (e.g., the oligonucleotide molecule comprises a capture sequence at the 3' end of the first universal sequence), the capture sequence being as defined in any one of claims 9-11, and, the method further comprises a step (B') of removing the capture sequence comprised by the oligonucleotide molecule; wherein, the steps (B) and (B') can be performed in any order or simultaneously (e.g., simultaneously in the same reaction system).

30. The method of claim 29, wherein, the oligonucleotide molecule comprises the first universal sequence, and the capture sequence comprised by the oligonucleotide molecule is removed in step (B') by a step comprising: (i) providing a blocking probe, the blocking probe being capable of annealing to (a) the first universal sequence or a partial sequence thereof (e.g., a 3' end partial sequence of the first universal sequence) of the oligonucleotide molecule, or, (b) a sequence of the oligonucleotide molecule which is located 5' to the capture sequence and which is located 3' to the first universal sequence, or, (c) a combination of (a) and (b); (ii) contacting the blocking probe with the nucleic acid array to be treated containing the oligonucleotide molecule under conditions suitable for annealing the blocking probe to the oligonucleotide molecule; (iii) contacting an exonuclease with the product of step (ii) under conditions which allow the exonuclease to exert its cleavage activity; wherein, the exonuclease has a single-stranded nucleic acid 3' to 5' exonuclease activity; Preferably, the exonuclease is Exonuclease I. Preferably, the step (B') further comprises a step of removing the blocking probe (e.g., by unzipping the blocking probe from the oligonucleotide molecule to thereby remove the blocking probe); Preferably, in the method, step (B) is performed after step (B').

31. The method of any one of claims 25-30, wherein, the oligonucleotide molecule is covalently and / or non-covalently attached to the solid support in the nucleic acid array to be treated; Preferably, the oligonucleotide molecule is covalently attached to the solid support; Preferably, the oligonucleotide molecule forms a linkage to the solid support via a click chemistry reaction; Preferably, the molecule or group pair capable of undergoing the click chemistry reaction is selected from the group consisting of: alkynyl / azido, azido / cyano, amine / alkene, thiol / alkene, thiol / alkyne, aldehyde / 1,3-diol, ketone / 1,3-diol; Preferably, the molecule or group pair capable of undergoing the click chemistry reaction is azido / alkynyl; Preferably, the solid support surface is modified with azido groups and the oligonucleotide molecules are modified with the oligonucleotide molecule forms a linkage to the solid support via a click chemistry reaction between the azido group of the oligonucleotide molecule and DBCO.

32. The method of any one of claims 25-31, wherein, the step (B) comprises: (1) providing: (a) said scaffold molecule in free form, wherein said scaffold molecule is as defined in any one of claims 1 to 3, 7 to 9, and wherein said scaffold molecule is modified with a molecule or group Y'; and (b) said nucleic acid to be treated an array of nucleic acids or an array of nucleic acids treated in step (B'), the solid support surface of said array of nucleic acids being modified with a molecule or group X' capable of forming a linkage (e.g. covalent and / or non-covalent linkage) with said molecule or group Y'; and, (2) contacting said scaffold molecule with said solid support under conditions suitable for said molecule or group X' to form a linkage with said molecule or group Y', thereby obtaining a solid support having said scaffold molecule linked thereto; Preferably, said molecule or group X' is capable of undergoing a click chemistry reaction with said molecule or group Y'. Preferably, said molecule or group X' / Y' is selected from the group consisting of: alkynyl / azido, azido / cyano, amine / alkene, thiol / alkene, thiol / alkyne, aldehyde / 1,3-diol, ketone / 1,3-diol, azido / alkynyl, cyano / azido, alkene / amine, alkene / thiol, alkyne / thiol, 1,3-diol / aldehyde, 1,3-diol / ketone. Preferably, said molecule or group X' / Y' is azido / alkynyl or alkynyl / azido. Preferably, the scaffold molecule is modified with (DBCO), the solid support surface being modified with an azido group, said scaffold molecule and said solid support being linked by a click chemistry reaction of DBCO with azido.

33. The method of any one of claims 25-32, wherein, Said array of nucleic acids further comprises a capture probe, said capture probe being as defined in any one of claims 9 to 11, and said step (B) comprises: (I) (1) providing: (a) said scaffold molecule in free form, wherein said scaffold molecule is as defined in any one of claims 1 to 3, 7 to 9, and wherein said scaffold molecule is modified with a molecule or group Y'; and (b) said array of nucleic acids to be treated or array of nucleic acids treated in step (B'), the solid support surface of said array of nucleic acids being modified with a molecule or group X' capable of forming a linkage (e.g. covalent and / or non-covalent linkage) with said molecule or group Y'; and (c) said capture probe in free form, said capture probe being capable of forming a covalent and / or non-covalent linkage with the anchor region of said scaffold molecule; (2) contacting said scaffold molecule with said solid support under conditions suitable for said molecule or group X' to form a linkage with said molecule or group Y', thereby obtaining a solid support having said scaffold molecule linked thereto; and, (3) contacting said capture probe in free form with the solid support having said scaffold molecule linked thereto formed in step (2) under conditions suitable for said capture probe to form a linkage with said scaffold molecule, said capture probe being linked to said scaffold molecule, thereby obtaining a solid support having said scaffold molecule and said capture probe linked thereto; or, (3) contacting said capture probe in free form with the solid support having said scaffold molecule linked thereto formed in step (2) under conditions suitable for said capture probe to form a linkage with said scaffold molecule, said capture probe being linked to said scaffold molecule, thereby obtaining a solid support having said scaffold molecule and said capture probe linked thereto; (II) (1) providing: (a) a scaffold molecule linked to the capture probe, the scaffold molecule being modified with a molecule or group Y'; and, (b) the array of nucleic acids to be processed or the array of nucleic acids after being processed in step (B'), the surface of the solid support of the array of nucleic acids being modified with a molecule or group X' capable of forming a linkage (e.g., covalent and / or non-covalent linkage) with the molecule or group Y' between the molecule or group X' and the molecule or group Y'; and, (2) contacting the scaffold molecule linked to the capture probe provided in step (II) (1) (a) with the solid support under conditions suitable for the molecule or group X' to form a linkage with the molecule or group Y', thereby obtaining a solid support linked to the scaffold molecule and the capture probe; Preferably, the anchor region of the scaffold molecule comprises an anchor sequence capable of hybridizing to a capture probe; preferably, the capture probe comprises a fixed sequence capable of hybridizing to the anchor sequence. Preferably, in step (I) (3), the free capture probe is contacted with the solid support linked to the scaffold molecule formed in step (2) under conditions suitable for the scaffold molecule to anneal to the capture probe, allowing the capture probe to anneal to the scaffold molecule. Preferably, in step (II) (1), the scaffold molecule linked to the capture probe is an annealing product of the scaffold molecule and the capture probe; preferably, in the annealing product, the 3' end of the capture probe comprises a capture sequence, and the capture sequence does not base pair with the scaffold molecule. The molecule or group X' is capable of undergoing a click chemistry reaction with the molecule or group Y'; 34. The method of claim 33, wherein, Preferably, the molecule or group X' / Y' is selected from the group consisting of: alkynyl / azido, azido / cyano, amine / alkene, thiol / alkene, thiol / alkyne, aldehyde / 1,3-diol, ketone / 1,3-diol, azido / alkynyl, cyano / azido, alkene / amine, alkene / thiol, alkyne / thiol, 1,3-diol / aldehyde, 1,3-diol / ketone; Preferably, the molecule or group X' / Y' is azido / alkynyl or alkynyl / azido; Preferably, the molecule or group X' is DBCO, and the molecule or group Y' is azido, the surface of the solid support is modified with azido, and the scaffold molecule and the solid support are linked by a click chemistry reaction of DBCO with azido. Preferably, the scaffold molecule is modified with The scaffold molecule is provided by direct synthesis, or by hybridizing or ligating at least two anchor regions.

35. The method of any one of claims 32-34, wherein, The anchor region of the scaffold molecule comprises an anchor sequence capable of hybridizing to a capture probe, and the step (B) comprises:

36. The method of any one of claims 25-32, wherein, (1) providing a vector comprising at least one copy of a vector sequence, the vector sequence comprising a complement of an anchor sequence; the anchor sequence being as defined in any one of claims 1-2, 7; (2) placing the vector on the surface of the solid support of the array of nucleic acids to be processed or the array of nucleic acids after being processed in step (B'); and, (3) allowing the anchor sequence to hybridize to the complement of the anchor sequence on the surface of the solid support. ​ (3) providing a fixed primer, and performing a nucleic acid polymerization reaction with the carrier sequence as a template, to generate an extension product, the extension product containing the anchor sequence; wherein the fixed primer can anneal to the carrier sequence and initiate the extension reaction; and, (4) connecting the fixed primer to the surface of the solid support; wherein steps (3) and (4) are performed in any order (e.g., step (3) is performed before or after step (4), or step (3) is performed simultaneously with step (4)); Preferably, the carrier sequence comprises at least one or at least two complements of the anchor sequence; Preferably, the extension product comprises at least one or at least two of the anchor sequence; Preferably, each carrier is a DNB formed by a concatemer of multiple copies of the carrier sequence; Preferably, the method optionally comprises step (5): digesting the carrier sequence, and / or separating the extension product in step (3) from the carrier sequence annealed thereto; Preferably, the carrier is provided in step (1) by: (i) providing a carrier template sequence, the carrier template sequence comprising a complement of the carrier sequence; (ii) performing a nucleic acid amplification reaction with the carrier template sequence as a template, to obtain an amplification product of the carrier template sequence, the amplification product comprising at least one copy of the carrier sequence; preferably, rolling circle replication is performed to obtain a DNB formed by a concatemer of multiple copies of the carrier sequence.

37. The method of claim 36, wherein, the fixed primer is covalently and / or non-covalently connected to the solid support; Preferably, the fixed primer is covalently connected to the solid support; Preferably, the fixed primer is connected to the solid support through a click chemistry reaction; Preferably, the molecule or group pair capable of undergoing the click chemistry reaction is selected from the group consisting of: alkynyl / azido, azido / cyano, amine / alkene, thiol / alkene, thiol / alkyne, aldehyde / 1,3-diol, ketone / 1,3-diol; preferably, the molecule or group pair capable of undergoing the click chemistry reaction is azido / alkynyl; Preferably, the immobilized primer is modified with the fixed primer is connected to the solid support through a click chemistry reaction between DBCO and azido, wherein the solid support is modified with azido on the surface thereof.

38. The method of claim 36 or 37, wherein, the nucleic acid array further comprises a capture probe, the capture probe being as defined in any one of claims 9-11, and step (B) further comprises step (6): contacting the free capture probe with the solid support having the scaffold molecule connected thereto obtained in step (5) under conditions allowing annealing, to anneal the capture probe to the scaffold molecule, thereby obtaining a solid support having the capture probe connected thereto; Preferably, in step (6), the 3' end of the capture probe comprises a capture sequence, and the capture sequence does not base pair with the scaffold molecule.

39. A method of detecting spatial information of a nucleic acid in a sample, comprising using the nucleic acid array of any one of claims 1-11. For example, the method comprises using the nucleic acid array of any one of claims 1-8, which does not comprise a capture probe; and, the method further comprises using a capture probe; preferably, the capture probe comprises a capture sequence capable of annealing to the nucleic acid molecule to be captured; For example, the method comprises using the nucleic acid array of any one of claims 9-11.

40. The method of claim 39, which comprises using the nucleic acid array of any one of claims 9-11, the method comprising the following steps: (1) providing: a test sample, and, the nucleic acid array of any one of claims 9-11; (2) contacting the test sample with the nucleic acid array, and performing a nucleic acid polymerization and / or a nucleic acid ligation reaction to generate a product nucleic acid molecule derived from the nucleic acid of the test sample, which contains the localization sequence of the localization probe or its complement as its spatial information tag; Preferably, in step (2), the test sample is contacted with the nucleic acid array such that the nucleic acid derived from the test sample anneals to the capture probe, and the nucleic acid polymerization and / or the nucleic acid ligation reaction is performed using the nucleic acid molecule or fragment thereof annealed to the capture probe and the localization probe or its fragment containing the localization sequence of the nucleic acid array as templates to obtain the product nucleic acid molecule; Preferably, in step (2), the test sample is contacted with the nucleic acid array such that the nucleic acid derived from the test sample anneals to the capture probe, and the nucleic acid polymerization and / or the nucleic acid ligation reaction is performed using the nucleic acid molecule or fragment thereof annealed to the capture probe and the localization probe or its fragment containing the localization sequence and a template switch sequence as templates to obtain the product nucleic acid molecule; wherein, the complement of the template switch sequence is capable of annealing to the localization probe; preferably, the complement of the template switch sequence is capable of annealing to (i) the localization sequence or a partial sequence thereof (e.g., a 3’-end partial sequence of the localization sequence), of the localization probe, or, (ii) a sequence or a partial sequence thereof downstream of the localization sequence in the localization probe, or, (iii) a combination of (i) and (ii); preferably, the localization probe comprises a first universal sequence at the 3’-end of the localization sequence, and the complement of the template switch sequence is capable of annealing to the first universal sequence; Preferably, in step (2), the sample to be tested is contacted with the end- alignment primer and the nucleic acid array, such that the nucleic acid derived from the sample to be tested anneals to the end-alignment primer and the capture probe, and (i) a nucleic acid ligation reaction, or (ii) a nucleic acid polymerization and a nucleic acid ligation reaction (e.g., first a nucleic acid polymerization reaction, and then a nucleic acid ligation reaction) is performed to generate a first extension product, using the nucleic acid molecule or fragment thereof annealed to the capture probe as a template; the first extension product is annealed to and extended from the localization sequence (a), or (b) ligated to, to generate the product nucleic acid molecule; wherein the 5' end sequence of the end-alignment primer is capable of annealing to the nucleic acid derived from the sample to be tested, and the 3' end sequence of the end-alignment primer is capable of (A) annealing to a sequence downstream of the localization sequence in the localization probe, and (B) ligating to the 5' end of the localization probe. In certain embodiments, the localization probe comprises a first universal sequence at the 3' end of the localization sequence, and the 3' end sequence of the end-alignment primer is capable of annealing to the first universal sequence. In certain embodiments, the ligation in (B) is a ligation dependent on a ligation template, e.g., the 5' end of the ligation template is capable of annealing to the localization probe, and the 3' end of the ligation template is capable of annealing to the first extension product. In certain embodiments, the ligation in (B) is preceded by a nucleic acid polymerization. Preferably, the method further comprises step (3): analyzing the spatial information tag of the product nucleic acid molecule of step (2), thereby correlating the nucleic acid molecule derived from the sample to be tested from which the product nucleic acid molecule is derived to the position of the localization probe in the nucleic acid array.

41. The method of claim 40, comprising the following steps: (1) providing a sample to be tested, and a nucleic acid array of any one of claims 9-11; (2) (a) contacting the nucleic acid array with the sample to be tested, such that the nucleic acid derived from the sample to be tested anneals to the capture probe of the nucleic acid array; (b) performing a nucleic acid polymerization reaction to generate a first extension product; (c) annealing the first extension product to its adjacent localization probe of the nucleic acid array; (d) performing a nucleic acid polymerization reaction to generate a second extension product and / or its complementary strand, the second extension product comprising: (A) the localization sequence of the localization probe and the complementary sequence of the first extension product or a portion thereof, or (B) the first extension product sequence or a portion thereof and the complementary sequence of the localization sequence of the localization probe; the localization sequence or its complement comprised in the second extension product as its spatial information tag, and the complementary sequence of the localization sequence or the localization sequence comprised in the complementary strand of the second extension product as its spatial information tag, such that the position of the nucleic acid derived from the sample to be tested in the sample to be tested is correlated to the position of the localization probe to which the localization sequence corresponds; thereby generating the nucleic acid molecule comprising the spatial information tag; and and (3) analyzing (i) the sequence of the nucleic acid molecule comprising the spatial information tag obtained in step (2), and / or, (ii) the sequence of the nucleic acid molecule comprising the spatial information tag derived from (i); Preferably, the spatial information of the nucleic acid comprises localization, distribution and / or abundance of the nucleic acid; Preferably, steps (2)(a) to (2)(d) can be performed sequentially in different reaction systems, or, in the same reaction system. Preferably, in step (2)(b), a nucleic acid polymerization reaction is performed using the nucleic acid molecule or fragment thereof annealed to the capture probe and the template switch sequence as templates, to generate a first extension product comprising the complement of the template switch sequence; preferably, the complement of the template switch sequence is capable of annealing to the localization probe; preferably, the complement of the template switch sequence is capable of annealing to (i) the localization sequence of the localization probe or a partial sequence thereof (e.g., a 3' end partial sequence of the localization sequence), or, (ii) a sequence downstream of the localization sequence in the localization probe or a partial sequence thereof, or, (iii) a combination of (i) and (ii). Preferably, the localization probe of the nucleic acid array comprises a first universal sequence, which is capable of annealing to the first extension product (e.g., the first universal sequence is capable of annealing to the complement of the template switch sequence comprised in the first extension product); preferably, the first universal sequence is located at the 3' end of the localization sequence of the localization probe.

42. The method of claim 41, wherein, In step (3), the sequence of the nucleic acid molecule comprising the spatial information tag attached to the solid support of the nucleic acid array is analyzed.

43. The method of claim 41, wherein, Prior to step (3), after step (2), the method further comprises a step pre-(3): releasing at least a portion of the nucleic acid molecule comprising the spatial information tag from the surface of the nucleic acid array; Preferably, in step (3), (i) the nucleic acid molecule released in step pre-(6) is analyzed, and / or, (ii) the sequence of the nucleic acid molecule comprising the spatial information tag derived from (i) is analyzed; Preferably, in step pre-(3), the nucleic acid molecule is released from the surface of the solid support by (i) nucleic acid cleavage; and / or, (ii) denaturation; Preferably, after step pre-(3) and prior to step (3), the method further comprises a step of amplifying the released nucleic acid molecule; Preferably, prior to performing step (3), the method further comprises a step of purifying the released nucleic acid molecule.

44. The method of any one of claims 39-43, which is provided with one or more features selected from the group consisting of: (i) in step (1), the nucleic acid array is provided by the method of any one of claims 19-20, 33-34, 38; (ii) in step (2)(a), the test sample is treated (e.g., permeabilized or lysed) to release nucleic acids derived from the test sample, which are allowed to anneal to the capture sequence; (iii) after step (2)(b) and before step (2)(c), the method further comprises a step of removing the template strand bound to the first extension product (e.g., removing the template strand bound to the first extension product by cleavage or denaturation); (iv) after step (2)(b) and before step (2)(c), the method further comprises a step of washing the nucleic acid array to remove residual sample (e.g., tissue or cells); (v) after step (2) and before step (3) (e.g., after step (2) and before pre-(3)), the method further comprises a step of amplifying (e.g., amplifying in situ) and / or enriching the nucleic acid molecules containing the spatial information label; preferably, the nucleic acid molecules containing the spatial information label are attached to the solid support of the nucleic acid array.

45. The method of claim 39, comprising using the nucleic acid array of any one of claims 1-8, which does not comprise the capture probe; the method comprising the following steps: (1) providing: a test sample, the nucleic acid array of any one of claims 1-8, and, a capture probe; the capture probe comprising a capture sequence capable of annealing to a nucleic acid molecule to be captured; (2) contacting the test sample with the capture probe and the nucleic acid array, and performing a nucleic acid polymerization and / or nucleic acid ligation reaction to generate a product nucleic acid molecule derived from the nucleic acid of the test sample, the product nucleic acid molecule containing the localization sequence of the localization probe or its complement as its spatial information label; Preferably, in step (2), the test sample is contacted with the capture probe and the nucleic acid array such that the nucleic acid derived from the test sample anneals to the capture probe, and the nucleic acid polymerization and / or nucleic acid ligation reaction is performed using the nucleic acid molecule or fragment thereof annealed to the capture probe and the localization probe or its fragment containing the localization sequence of the nucleic acid array as templates to obtain the product nucleic acid molecule; Preferably, in step (2), the test sample is contacted with the capture probe and the nucleic acid array such that the nucleic acid derived from the test sample anneals to the capture probe, and the nucleic acid polymerization and / or nucleic acid ligation reaction is performed using the nucleic acid molecule or fragment thereof annealed to the capture probe and the localization probe or its fragment containing the localization sequence and the template switch sequence as templates to obtain the product nucleic acid molecule; wherein the complement of the template switch sequence is capable of annealing to the localization probe; preferably, the complement of the template switch sequence is capable of annealing to (i) the localization sequence of the localization probe or a partial sequence thereof (e.g., a 3’-end partial sequence of the localization sequence), or, (ii) a sequence downstream of the localization sequence in the localization probe or a partial sequence thereof, or, (iii) a combination of (i) and (ii); preferably, the localization probe comprises a first universal sequence at the 3’-end of the localization sequence, and the complement of the template switch sequence is capable of annealing to the first universal sequence. Preferably, in step (2), the sample to be tested is contacted with the end- alignment primer and the nucleic acid array, such that the nucleic acid derived from the sample to be tested anneals to the end-alignment primer and the capture probe, and (i) a nucleic acid ligation reaction, or (ii) a nucleic acid polymerization and a nucleic acid ligation reaction (e.g., first a nucleic acid polymerization reaction, and then a nucleic acid ligation reaction) is performed to generate a first extension product using the nucleic acid molecule or fragment thereof annealed to the capture probe as a template. The first extension product is annealed to and extended from the localization sequence (a) or (b) to generate the product nucleic acid molecule; wherein the 5' end sequence of the end-alignment primer is capable of annealing to the nucleic acid derived from the sample to be tested, and the 3' end sequence of the end-alignment primer is capable of (A) annealing to a sequence downstream of the localization sequence in the localization probe, or (B) ligating to the 5' end of the localization probe. In certain embodiments, the localization probe comprises a first universal sequence at the 3' end of the localization sequence, and the 3' end sequence of the end-alignment primer is capable of annealing to the first universal sequence. In certain embodiments, the ligation in (B) is a ligation dependent on a ligation template, e.g., the 5' end of the ligation template is capable of annealing to the localization probe, and the 3' end of the ligation template is capable of annealing to the first extension product. In certain embodiments, the ligation in (B) is preceded by a nucleic acid polymerization. Preferably, the method further comprises step (3): analyzing the spatial information marker of the product nucleic acid molecule of step (2), thereby correlating the nucleic acid molecule derived from the sample to be tested from which the product nucleic acid molecule is derived to the position of the localization probe in the nucleic acid array.

46. The method of claim 45, comprising the following steps: (1) providing: (a) a sample to be tested, (b) a nucleic acid array of any one of claims 1-8, wherein the nucleic acid array does not comprise a capture probe; and (c) a capture probe comprising a capture sequence capable of annealing to a nucleic acid molecule to be captured; (2) (a) allowing nucleic acid derived from the sample to be tested to be captured by the capture sequence of the capture probe; (b) performing a nucleic acid polymerization reaction to generate a first extension product; (c) annealing the first extension product to the localization probe of the nucleic acid array; (d) performing a nucleic acid polymerization reaction to generate a second extension product and / or a complementary strand thereof; the second extension product comprises: (A) the localization sequence of the localization probe and the complementary sequence of the first extension product or a portion of the sequence thereof, or (B) the first extension product sequence or a portion of the sequence thereof and the complementary sequence of the localization sequence of the localization probe; wherein the localization sequence or the complementary sequence thereof comprised in the second extension product serves as a spatial information marker for the second extension product, and the complementary sequence of the localization sequence or the localization sequence comprised in the complementary strand of the second extension product serves as a spatial information marker for the complementary strand of the second extension product, thereby allowing the position of the nucleic acid derived from the sample to be tested in the sample to be tested to be correlated to the position of the localization probe to which the localization sequence corresponds; thereby obtaining a nucleic acid molecule comprising the spatial information marker; the second extension product comprises: (A) the localization sequence of the localization probe and the complementary sequence of the first extension product or a portion of the sequence thereof, or (B) the first extension product sequence or a portion of the sequence thereof and the complementary sequence of the localization sequence of the localization probe; wherein the localization sequence or the complementary sequence thereof comprised in the second extension product serves as a spatial information marker for the second extension product, and the complementary sequence of the localization sequence or the localization sequence comprised in the complementary strand of the second extension product serves as a spatial information marker for the complementary strand of the second extension product, thereby allowing the position of the nucleic acid derived from the sample to be tested in the sample to be tested to be correlated to the position of the localization probe to which the localization sequence corresponds; thereby obtaining a nucleic acid molecule comprising the spatial information marker; (3) analyzing: (i) the sequence of the nucleic acid molecule comprising the spatial information tag obtained in step (2), and / or, (ii) the sequence of the nucleic acid molecule comprising the spatial information tag derived from (i); Preferably, the spatial information of the nucleic acid comprises localization, distribution and / or abundance of the nucleic acid; Preferably, steps (2)(a) to (2)(d) can be performed sequentially in different reaction systems, or, in the same reaction system; Preferably, in step (2)(b), a nucleic acid polymerization reaction is performed using the nucleic acid molecule or fragment thereof annealed to the capture probe and the template switch sequence as templates, to generate a first extension product comprising the complement of the template switch sequence; Preferably, the complement of the template switch sequence is capable of annealing to the localization probe; preferably, the complement of the template switch sequence is capable of annealing to (i) the localization sequence of the localization probe or a partial sequence thereof (e.g., a 3' end partial sequence of the localization sequence), or, (ii) a sequence downstream of the localization sequence in the localization probe or a partial sequence thereof, or, (iii) a combination of (i) and (ii); Preferably, the localization probe of the nucleic acid array comprises a first universal sequence, which is capable of annealing to the first extension product (e.g., the first universal sequence is capable of annealing to the complement of the template switch sequence comprised by the first extension product); preferably, the first universal sequence is located at the 3' end of the localization sequence of the localization probe.

47. The method of claim 46, wherein, Step (2) generates the second extension product and / or its complementary strand by a means selected from the group consisting of: (i) (a) contacting the capture probe with the test sample under conditions permitting annealing, such that nucleic acids derived from the test sample anneal to the capture probe of the nucleic acid array; (b) performing a nucleic acid polymerization reaction under conditions permitting nucleic acid polymerization, to generate a first extension product; (c) contacting the first extension product with the nucleic acid array under conditions permitting annealing, such that the first extension product anneals to its adjacent backbone molecule and localization probe of the nucleic acid array; (d) performing a nucleic acid polymerization reaction under conditions permitting nucleic acid polymerization, to generate a second extension product and / or its complementary strand; or, (ii) (a) contacting the capture probe with the nucleic acid array under conditions permitting annealing, such that the capture probe anneals to the backbone molecule of the nucleic acid array, thereby linking the capture probe to the nucleic acid array; contacting the nucleic acid array linked with the capture probe with the test sample under conditions permitting annealing, such that nucleic acids derived from the test sample anneal to the capture probe linked to the nucleic acid array; (b) performing a nucleic acid polymerization reaction under conditions permitting nucleic acid polymerization, to generate a first extension product; (c) contacting the first extension product with its adjacent localization probe of the nucleic acid array under conditions permitting annealing; (d) performing a nucleic acid polymerization reaction under conditions permitting nucleic acid polymerization, to generate a second extension product and / or its complementary strand; or, (iii) (a) contacting the capture probes and the nucleic acid array with the test sample under conditions that allow annealing, such that the capture probes anneal to the scaffold molecules of the nucleic acid array, and / or such that nucleic acids derived from the test sample anneal to the capture probes; (b) performing a nucleic acid polymerization reaction under conditions that allow nucleic acid polymerization, resulting in first extension products; (c) annealing the first extension products to their adjacent positioning probes of the nucleic acid array under conditions that allow annealing; (d) performing a nucleic acid polymerization reaction under conditions that allow nucleic acid polymerization, resulting in second extension products and / or their complementary strands.

48. The method of claim 47, wherein, Step (2) generates second extension products and / or their complementary strands by means (i), and steps (2)(a) and (2)(b) are performed intracellularly and / or extracellularly; For example, steps (2)(a) and (2)(b) are performed intracellularly, and in step (2)(c) the cells are treated (e.g. permeabilized or lysed) to release the first extension products of step (2)(b) for contact with the nucleic acid array; For example, step (2)(a) is performed extracellularly, and in step (2)(a) the test sample is treated (e.g. permeabilized or lysed) to release nucleic acids derived from the test sample for annealing to the capture sequences.

49. The method of claim 47, wherein, Step (2) generates second extension products and / or their complementary strands by means (ii) or (iii), and in step (2)(a) the test sample is treated (e.g. permeabilized or lysed) to release nucleic acids derived from the test sample for annealing to the capture sequences.

50. The method of any one of claims 46-49, wherein, In step (3), the sequences of the spatial-information-tagged nucleic acid molecules attached to the solid support of the nucleic acid array are analyzed.

51. The method of any one of claims 46-50, wherein, Prior to step (3), after step (2), the method further comprises a step pre-(3) of releasing at least a portion of the spatial-information-tagged nucleic acid molecules from the surface of the nucleic acid array; Preferably, in step (3), the sequences of (i) the spatial-information-tagged nucleic acid molecules released in step pre-(3), and / or (ii) the spatial-information-tagged nucleic acid molecules derived from (i) are analyzed; Preferably, in step pre-(3), the nucleic acid molecules are released from the surface of the solid support by (i) nucleic acid cleavage; and / or (ii) denaturation; Preferably, after step pre-(3) and prior to step (3), the method further comprises a step of amplifying the released nucleic acid molecules; Preferably, prior to performing step (3), the method further comprises a step of purifying the released nucleic acid molecules.

52. The method of any one of claims 46-51, which is provided with one or more features selected from the group consisting of: (i) in step (1), the nucleic acid array is provided by the method of any one of claims 12-18, 21-32, 35-37; (ii) after step (2)(b) and before step (2)(c), the method further comprises a step of removing the template strand bound to the first extension product (e.g., removing the template strand bound to the first extension product by enzymatic cleavage or denaturation); (iii) after step (2)(b) and before step (2)(c), the method further comprises a step of washing the nucleic acid array to remove residual sample (e.g., tissue or cells); (iv) after step (2) and before step (3) (e.g., after step (2) and before pre-(3)), the method further comprises a step of amplifying (e.g., amplifying in situ) and / or enriching the nucleic acid molecules containing the spatial information label; preferably, the nucleic acid molecules containing the spatial information label are attached to the solid support of the nucleic acid array.

53. The method of any one of claims 40-52, wherein, In step (3), the analysis comprises sequencing and / or sequence-specific PCR reaction; Preferably, before sequencing, the method further comprises a step of sequencing library construction of the nucleic acid molecules containing the spatial information label obtained in step (2) or the amplification and / or enrichment products thereof.

54. The method of any one of claims 40-53, wherein, The sample is a tissue sample (e.g., a tissue section) or a single cell sample (e.g., a single cell suspension); Preferably, the tissue sample (e.g., a tissue section) is prepared from a fixed tissue, e.g., a formalin-fixed paraffin-embedded (FFPE) tissue, a deep-frozen tissue or a fresh tissue.

55. The method of any one of claims 40-54, wherein, The nucleic acid derived from the sample to be tested is selected from the group consisting of: an RNA molecule (e.g., an mRNA molecule), a target nucleic acid (e.g., a target DNA and / or RNA) or a nucleic acid molecule derived from the target nucleic acid (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of an RNA), a genomic nucleic acid fragment in an open chromatin region, and any combination thereof.

56. The method of any one of claims 40-55, wherein, The method is used for detecting the spatial information of RNA (e.g., mRNA) of cells in a sample.

57. The method of claim 56, wherein, In step (2)(a), the nucleic acid derived from the sample to be tested is RNA (e.g., mRNA) in cells of the sample to be tested, and the capture sequence comprises a poly(dT) sequence or a random oligonucleotide sequence; Preferably, the step (2)(b) comprises: (i) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with the nucleic acid molecule annealed to the capture sequence as a template to extend the capture sequence to generate a cDNA strand, the cDNA strand comprising a cDNA sequence complementary to the RNA (e.g., mRNA) formed with the capture sequence as a reverse transcription primer, and a 3' end overhang; (ii) under conditions allowing nucleic acid polymerization, annealing the template switch sequence to the cDNA strand generated in (i) and continuing the nucleic acid polymerization reaction with the template switch sequence as a template to generate the first extension product; wherein the template switch sequence comprises a consensus sequence and a 3' end overhang complementary sequence; Preferably, steps (2)(b)(i) to (2)(b)(ii) are performed in the same reaction system; (ii) after step (2)(b) and before step (2)(c), the method further comprises a step of removing the template strand bound to the first extension product (e.g., removing the template strand bound to the first extension product by enzymatic cleavage or denaturation); (iii) after step (2)(b) and before step (2)(c), the method further comprises a step of washing the nucleic acid array to remove residual sample (e.g., tissue or cells); (iv) after step (2) and before step (3) (e.g., after step (2) and before pre-(3)), the method further comprises a step of amplifying (e.g., amplifying in situ) and / or enriching the nucleic acid molecules containing the spatial information label; preferably, the nucleic acid molecules containing the spatial information label are attached to the solid support of the nucleic acid array. In step (3), the analysis comprises sequencing and / or sequence-specific PCR reaction; Preferably, before sequencing, the method further comprises a step of sequencing library construction of the nucleic acid molecules containing the spatial information label obtained in step (2) or the amplification and / or enrichment products thereof. The sample is a tissue sample (e.g., a tissue section) or a single cell sample (e.g., a single cell suspension); Preferably, the tissue sample (e.g., a tissue section) is prepared from a fixed tissue, e.g., a formalin-fixed paraffin-embedded (FFPE) tissue, a deep-frozen tissue or a fresh tissue. The nucleic acid derived from the sample to be tested is selected from the group consisting of: an RNA molecule (e.g., an mRNA molecule), a target nucleic acid (e.g., a target DNA and / or RNA) or a nucleic acid molecule derived from the target nucleic acid (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of an RNA), a genomic nucleic acid fragment in an open chromatin region, and any combination thereof. The method is used for detecting the spatial information of RNA (e.g., mRNA) of cells in a sample. In step (2)(a), the nucleic acid derived from the sample to be tested is RNA (e.g., mRNA) in cells of the sample to be tested, and the capture sequence comprises a poly(dT) sequence or a random oligonucleotide sequence; Preferably, the step (2)(b) comprises: (i) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with the nucleic acid molecule annealed to the capture sequence as a template to extend the capture sequence to generate a cDNA strand, the cDNA strand comprising a cDNA sequence complementary to the RNA (e.g., mRNA) formed with the capture sequence as a reverse transcription primer, and a 3' end overhang; (ii) under conditions allowing nucleic acid polymerization, annealing the template switch sequence to the cDNA strand generated in (i) and continuing the nucleic acid polymerization reaction with the template switch sequence as a template to generate the first extension product; wherein the template switch sequence comprises a consensus sequence and a 3' end overhang complementary sequence; Preferably, steps (2)(b)(i) to (2)(b)(ii) are performed in the same reaction system; Preferably, the first extension product comprises: a capture sequence, the cDNA strand sequence or a partial sequence thereof, and a complement sequence of the consensus sequence; Preferably, the method further comprises a step of removing the template switch sequence bound to the first extension product (e.g., removing the template switch sequence bound to the first extension product by cleavage or denaturation) before step (2)(c); Preferably, the localization probe of the nucleic acid array comprises a first universal sequence, and the first universal sequence of the localization probe is capable of annealing to the complement sequence of the consensus sequence in step (2)(c) of the method; Preferably, the localization probe does not comprise a MID sequence, and the template switch sequence comprises a MID sequence; or, the localization probe comprises a MID sequence, and the template switch sequence does not comprise a MID sequence; or, the localization probe and the template switch sequence both comprise a MID sequence; Preferably, the template switch sequence comprises a MID sequence; preferably, the MID sequence comprised by each template switch sequence is different from each other.

58. The method of any one of claims 40-55, wherein, The method is used for detecting spatial information of a target nucleic acid (e.g., a target DNA and / or RNA) or a nucleic acid molecule derived from the target nucleic acid (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA) in a sample, the target nucleic acid or the nucleic acid molecule derived from the target nucleic acid comprising a target nucleotide sequence; Preferably, the nucleic acid derived from the sample to be tested comprises the target nucleotide sequence in step (2)(a); preferably, the nucleic acid derived from the sample to be tested comprises the target nucleic acid and / or a nucleic acid molecule derived from the target nucleic acid (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA); Preferably, the capture sequence comprises a sequence capable of annealing to the target nucleotide sequence in step (2)(a); Preferably, the localization probe comprises a first universal sequence, and the capture sequence comprises a sequence capable of annealing to a first segment of the target nucleotide sequence in step (2)(a); and the first universal sequence comprises a sequence capable of annealing to a complement sequence of a second segment of the target nucleotide sequence, or the first universal sequence comprises a random oligonucleotide sequence in step (2)(c); preferably, the first segment is located at the 3' end of the second segment in the target nucleotide sequence; preferably, the first universal sequence is located at the 3' end of the localization sequence; Preferably, the first segment exists in a single-stranded region of the nucleic acid derived from the sample to be tested annealed to the capture sequence in step (2)(a); Preferably, the nucleic acid derived from the sample to be tested annealed to the capture sequence is a single-stranded nucleic acid or a double-stranded nucleic acid comprising a single-stranded region comprising the first segment in step (2)(a). ​ 59. The method of any one of claims 40-55, wherein, The method is used for detecting spatial information of RNA (e.g., mRNA) of cells in a sample and a target nucleic acid (e.g., a target DNA and / or RNA) and / or a nucleic acid molecule derived from the target nucleic acid (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA), wherein the target nucleic acid or the nucleic acid molecule derived from the target nucleic acid comprises a target nucleotide sequence; Preferably, the capture probe comprises a first capture probe capable of capturing the RNA (e.g., mRNA), and a second capture probe capable of capturing a nucleic acid molecule containing the target nucleotide sequence; the first capture probe contains a first capture sequence comprising a poly(dT) sequence or a random oligonucleotide sequence; the second capture probe contains a second capture sequence comprising a sequence capable of annealing to the target nucleotide sequence; Preferably, in step (2)(a), the nucleic acid derived from the sample to be tested comprises RNA (e.g., mRNA) derived from the sample to be tested and a nucleic acid molecule comprising a target nucleotide sequence; preferably, the nucleic acid molecule comprising a target nucleotide sequence comprises the target nucleic acid and / or a nucleic acid molecule derived from the target nucleic acid (e.g., a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of RNA); Preferably, the step (2)(b) comprises: (A)(i) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the first capture sequence as a template, extending the first capture sequence to generate a cDNA strand, the cDNA strand comprising a cDNA sequence complementary to the RNA (e.g., mRNA) formed with the first capture sequence as a reverse transcription primer, and a 3' end overhang; (ii) under conditions allowing nucleic acid polymerization, annealing a template switch sequence to the cDNA strand generated in (i) and continuing the nucleic acid polymerization reaction with the template switch sequence as a template to generate a first extension product I; wherein the template switch sequence comprises a consensus sequence and a 3' end overhang complementary sequence; and, (B) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the second capture sequence as a template, extending the second capture sequence to generate a first extension product II; wherein the step (B) is performed in any order with step (A); for example, step (B) is performed before or after step (A), or step (B) is performed simultaneously with step (A) (e.g., in the same reaction system); Preferably, the method further comprises the following steps: (C) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the first extension product I as a template, extending the first extension product I to generate a second extension product III; wherein the second extension product III comprises a second capture sequence and a 3' end overhang complementary sequence; and (D) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the second extension product II as a template, extending the second extension product II to generate a second extension product IV; wherein the second extension product IV comprises a second capture sequence and a 3' end overhang complementary sequence; and (E) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the second capture sequence as a template, extending the second capture sequence to generate a second extension product V; wherein the second extension product V comprises a second capture sequence and a 3' end overhang complementary sequence; and (F) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the second extension product III as a template, extending the second extension product III to generate a second extension product VI; wherein the second extension product VI comprises a second capture sequence and a 3' end overhang complementary sequence; and (G) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the second extension product IV as a template, extending the second extension product IV to generate a second extension product VII; wherein the second extension product VII comprises a second capture sequence and a 3' end overhang complementary sequence; and (H) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the second extension product V as a template, extending the second extension product V to generate a second extension product VIII; wherein the second extension product VIII comprises a second capture sequence and a 3' end overhang complementary sequence; and (I) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the second extension product VI as a template, extending the second extension product VI to generate a second extension product IX; wherein the second extension product IX comprises a second capture sequence and a 3' end overhang complementary sequence; and (J) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the second extension product VII as a template, extending the second extension product VII to generate a second extension product X; wherein the second extension product X comprises a second capture sequence and a 3' end overhang complementary sequence; and (K) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the second extension product VIII as a template, extending the second extension product VIII to generate a second extension product XI; wherein the second extension product XI comprises a second capture sequence and a 3' end overhang complementary sequence; and (L) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the second extension product IX as a template, extending the second extension product IX to generate a second extension product XII; wherein the second extension product XII comprises a second capture sequence and a 3' end overhang complementary sequence; and (M) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the second extension product X as a template, extending the second extension product X to generate a second extension product XIII; wherein the second extension product XIII comprises a second capture sequence and a 3' end overhang complementary sequence; and (N) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the second extension product XI as a template, extending the second extension product XI to generate a second extension product XIV; wherein the second extension product XIV comprises a second capture sequence and a 3' end overhang complementary sequence; and (O) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the second extension product XII as a template, extending the second extension product XII to generate a second extension product XV; wherein the second extension product XV comprises a second capture sequence and a 3' end overhang complementary sequence; and (P) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the second extension product XIII as a template, extending the second extension product XIII to generate a second extension product XVI; wherein the second extension product XVI comprises a second capture sequence and a 3' end overhang complementary sequence; and (Q) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the second extension product XIV as a template, extending the second extension product XIV to generate a second extension product XVII; wherein the second extension product XVII comprises a second capture sequence and a 3' end overhang complementary sequence; and (R) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the second extension product XV as a template, extending the second extension product XV to generate a second extension product XVIII; wherein the second extension product XVIII comprises a second capture sequence and a 3' end overhang complementary sequence; and (S) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the second extension product XVI as a template, extending the second extension product XVI to generate a second extension product XIX; wherein the second extension product XIX comprises a second capture sequence and a 3' end overhang complementary sequence; and (T) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the second extension product XVII as a template, extending the second extension product XVII to generate a second extension product XX; wherein the second extension product XX comprises a second capture sequence and a 3' end overhang complementary sequence; and (U) under conditions allowing nucleic acid polymerization, performing a nucleic acid polymerization reaction with a nucleic acid molecule annealed to the second extension product XVIII as a template, extending the second extension product XVIII to generate a second extension product XXI; wherein the second extension product XXI comprises a second capture sequence and a 3' end overhang complementary sequence; and (V) under Preferably, in step (2)(c), the indexing probe contains a first universal sequence I capable of annealing to the first extension product I, and a first universal sequence II capable of annealing to the first extension product II; preferably, the first universal sequence I and the first universal sequence II are present together in the same indexing probe, or, are present separately in different indexing probes; preferably, the first universal sequence I and / or the first universal sequence II is / are located at the 3' end of the indexing sequence; 3' end of the indexing sequence; Preferably, the nucleic acid array comprises a first indexing probe containing the first universal sequence I, and a second indexing probe containing the first universal sequence II; preferably, the first universal sequence I and / or the first universal sequence II is / are located at the 3' end of the indexing sequence; Preferably, in step (2)(c) of the method, the first universal sequence I is capable of annealing to the complement of the consensus sequence; Preferably, in step (2)(a) of the method, the second capture sequence comprises a sequence capable of annealing to the first segment of the target nucleotide sequence; and in step (2)(c), the first universal sequence II comprises a sequence capable of annealing to the complement of the second segment of the target nucleotide sequence, or, the first universal sequence II comprises a random oligonucleotide sequence; preferably, in the target nucleotide sequence, the first segment is located at the 3' end of the second segment; Preferably, the method further comprises, prior to step (2)(c), a step of removing the template switch sequence bound to the first extension product I (e.g., removing the template switch sequence bound to the first extension product I by enzymatic cleavage or denaturation); Preferably, in step (2)(a), the first segment is present in a single-stranded region of a nucleic acid molecule derived from the sample under test that anneals to the second capture sequence; Preferably, in step (2)(a), the nucleic acid derived from the sample under test that anneals to the second capture sequence is a single-stranded nucleic acid or a double-stranded nucleic acid containing a single-stranded region comprising the first segment; Preferably, the first indexing probe does not contain a MID sequence, the template switch sequence contains a MID sequence; or, the first indexing probe contains a MID sequence, the template switch sequence does not contain a MID sequence, or, both the first indexing probe and the template switch sequence contain a MID sequence; Preferably, the template switch sequence contains a MID sequence; preferably, the MID sequence contained by each template switch sequence is different from each other.

60. A kit comprising the nucleic acid array of any one of claims 1-11.

61. The kit of claim 60, wherein, The kit comprises: (a) the nucleic acid array of any one of claims 1-8, wherein the nucleic acid array does not comprise a capture probe; and, (b) a capture probe comprising a capture sequence capable of annealing to a nucleic acid molecule to be captured; Preferably, the anchor region of the backbone molecule of the nucleic acid array comprises an anchor sequence capable of hybridizing to a capture probe, the capture probe further comprises a fixation sequence capable of annealing to the anchor sequence; preferably, the fixation sequence is located at the 5' end of the capture sequence; Preferably, the capture probe comprises or consists of the immobilization sequence and the capture sequence, in the 5' to 3' direction; Preferably, the capture probe is as defined in any one of claims 9-11.

62. The kit of claim 60, wherein, The kit comprises the nucleic acid array of any one of claims 9-11.

63. The kit of any one of claims 60-62, wherein, The capture sequence of the capture probe comprises a poly(dT) sequence or a random oligonucleotide sequence; Preferably, the kit further comprises a template switching sequence, the template switching sequence comprising a consensus sequence and a cDNA 3' end overhang complementary sequence; preferably, the MID sequence optionally further comprises a MID sequence; preferably, the MID sequence comprised by each template switching sequence is different from each other; preferably, the cDNA 3' end overhang has a length of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, 1-10, 1-5 or 2-10 nucleotides; preferably, the cDNA 3' end overhang is a 2-5 cytosine nucleotide overhang (e.g. CCC overhang); Preferably, the localization probe of the nucleic acid array comprises a first universal sequence, the complement of the consensus sequence of the template switching sequence is capable of annealing to the first universal sequence; Preferably, the localization probe does not comprise a MID sequence, the template switching sequence comprises a MID sequence; or, the localization probe comprises a MID sequence, the template switching sequence does not comprise a MID sequence; or, both the localization probe and the template switching sequence comprise a MID sequence.

64. The kit of any one of claims 60-62, wherein, The capture sequence of the capture probe comprises a sequence capable of annealing to a target nucleotide sequence comprised by a target nucleic acid (e.g. a specific target DNA and / or RNA) or a nucleic acid molecule derived from the target nucleic acid (e.g. a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of an RNA); Preferably, the localization probe of the nucleic acid array comprises a first universal sequence, the first universal sequence comprises a sequence capable of annealing to the complement of the target nucleotide sequence; Preferably, the capture sequence comprises a sequence capable of annealing to a first segment of the target nucleotide sequence, the first universal sequence comprises a sequence capable of annealing to the complement of a second segment of the target nucleotide sequence, or the first universal sequence comprises a random oligonucleotide sequence; Preferably, in the target nucleotide sequence, the first segment is located at the 3' end of the second segment.

65. The kit of any one of claims 60-62, wherein, The capture probe comprises a first capture probe and a second capture probe; the first capture probe comprises a first capture sequence, the first capture sequence comprises a poly(dT) sequence or a random oligonucleotide sequence; the second capture probe comprises a second capture sequence, the second capture sequence comprises a sequence capable of annealing to a target nucleotide sequence comprised by a target nucleic acid (e.g. a specific target DNA and / or RNA) or a nucleic acid molecule derived from the target nucleic acid (e.g. a modified nucleic acid molecule, a cDNA molecule obtained by reverse transcription of an RNA); Preferably, the kit further comprises a template switch sequence comprising a consensus sequence and a cDNA 3' end overhang complementary sequence; preferably, the MID sequence is optionally further comprised by the template switch sequence; preferably, the MID sequence comprised by each template switch sequence is different from each other; preferably, the cDNA 3' end overhang has a length of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, 1-10, 1-5 or 2-10 nucleotides; preferably, the cDNA 3' end overhang is a 2-5 cytosine nucleotide overhang (e.g. CCC overhang); Preferably, the positioning probe of the nucleic acid array comprises a first universal sequence I and a first universal sequence II; wherein the first universal sequence I is capable of annealing to the complement of the consensus sequence, and the first universal sequence II comprises a sequence capable of annealing to the complement of the target nucleotide sequence, or the first universal sequence II comprises a random oligonucleotide sequence; preferably, the first universal sequence I and the first universal sequence II are present together in the same positioning probe, or are present separately in different positioning probes; preferably, the first universal sequence I and / or the first universal sequence II is located at the 3' end of the positioning sequence; Preferably, the nucleic acid array comprises a first positioning probe comprising the first universal sequence I and a second positioning probe comprising the first universal sequence II; preferably, the first positioning probe does not comprise a MID sequence, and the template switch sequence comprises a MID sequence; or the first positioning probe comprises a MID sequence, and the template switch sequence does not comprise a MID sequence, or both the first positioning probe and the template switch sequence comprise a MID sequence; preferably, the first universal sequence I and / or the first universal sequence II is located at the 3' end of the positioning sequence; Preferably, the second capture sequence comprises a sequence capable of annealing to the first segment of the target nucleotide sequence, and the first universal sequence II comprises a sequence capable of annealing to the complement of the second segment of the target nucleotide sequence, or the first universal sequence II comprises a random oligonucleotide sequence; preferably, in the target nucleotide sequence, the first segment is located at the 3' end of the second segment.

66. The kit of any one of claims 60-65, wherein, The first universal sequence comprised by the positioning probe of the nucleic acid array is or is not located at the 3' end of the positioning probe, and / or the 3' end of the first universal sequence of the positioning probe of the nucleic acid array is blocked or unblocked; Preferably, the kit further comprises reagents for performing nucleic acid hybridization, reagents for performing nucleic acid extension, reagents for performing nucleic acid amplification, reagents for recovering or purifying nucleic acid, reagents for constructing a transcriptome sequencing library, reagents for sequencing (e.g. second generation sequencing or third generation sequencing), or any combination thereof.

67. Use of the nucleic acid array of any one of claims 1 to 11 or the kit of any one of claims 60 to 66 for constructing a library of nucleic acid molecules, for performing nucleic acid sequencing or for detecting spatial information of nucleic acids in a sample.

Images