Method for constructing nucleic acid library, method for nanopore sequencing and use thereof
By combining circular library construction with rolling circle amplification and nicking restriction enzyme cleavage, the problems of low efficiency and sequencing accuracy in double-stranded nucleic acid library construction were solved, achieving efficient double-stranded nucleic acid library construction and improved sequencing accuracy.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-09-30
- Publication Date
- 2026-04-02
AI Technical Summary
Existing technologies for constructing double-stranded nucleic acid libraries suffer from problems such as numerous byproducts, low efficiency, high sequencing system complexity, and difficulty in amplifying copy numbers.
A circular library construction method was adopted, which involves rolling circle amplification and nicking endonuclease digestion to form a multinucleotide library with a stem-loop structure, which is then ligated to a sequencing adapter to achieve efficient construction of double-stranded nucleic acid libraries.
It improves the efficiency of double-stranded nucleic acid library construction and sequencing accuracy, ensures that errors do not accumulate during copy number amplification, enables two sequencing of target nucleic acids, and improves sequencing accuracy.
Smart Images

Figure CN2024122981_02042026_PF_FP_ABST
Abstract
Description
Method for constructing nucleic acid library, nanopore sequencing method and application TECHNICAL FIELD
[0001] The present application relates to the field of nucleic acid library construction, in particular to a method for constructing a nucleic acid library, a nanopore sequencing method and application. BACKGROUND
[0002] Single molecule sequencing is a high-throughput sequencing technology that can directly sequence a single nucleic acid molecule, providing more comprehensive and accurate sequence information, and has become an important tool in the field of genomics and biology research, providing more possibilities for scientific research and medical applications.
[0003] Nanopore sequencing technology is a typical single molecule level detection technology, which has the advantages of fast sequencing speed, long read length, direct sequencing, high throughput, low cost, small volume, portability, etc. In the process of nanopore sequencing, a single nanopore is embedded in an insulating impermeable membrane to form a stable ion current channel. Under the action of voltage, a single-stranded nucleic acid molecule passes through the nanopore, thereby reducing the ion current passing through the nanopore. Because the molecular structure and size of different bases on the single-stranded nucleic acid molecule are different, the current passing through the nanopore exhibits differences corresponding to the base sequence. By using algorithms to analyze the current change signal, the sequence of the single-stranded nucleic acid passing through the nanopore can be read in real time.
[0004] However, the existing single molecule sequencing technology usually only sequences a single strand of the target nucleic acid, and the accuracy of the sequencing is still limited, which seriously restricts the application range of single molecule sequencing technology, and double-stranded sequencing of the target nucleic acid can significantly improve the accuracy of sequencing.
[0005] The method for double-stranded sequencing developed by Oxford Nanopore Technologies (abbreviated as ONT) includes: (1) connecting the first strand and the second strand (usually a hairpin adapter) at or near one end of the target nucleic acid by a bridging moiety, and connecting a sequencing adapter complex (usually a Y-shaped sequencing adapter complex) at the other end, thereby forming a sequencing library; (2) performing single molecule nanopore sequencing on the sequencing library, since the double strands of the target nucleic acid are connected by a bridging moiety at one end, the first strand and the second strand of the target nucleic acid pass through the nanopore in turn, realizing double-stranded sequencing of the target nucleic acid, as in patent CN103827320B. On this basis, different anchors (usually a constrained sequence with a cholesterol or fatty acyl chain modification, which can couple the library to the membrane) are used to bind the hairpin adapter or Y-shaped sequencing adapter of the sequencing library, respectively, since the anchor binding the hairpin adapter has a stronger coupling strength to the membrane than the anchor binding the Y-shaped sequencing adapter, thereby improving the capture probability of the library that can perform double-stranded sequencing, as in patent CN106460061B.
[0006] However, the problems of the above patents CN103827320B and CN106460061B include: (1) In the process of connecting the first strand and the second strand at one end or near the end of the target nucleic acid by the bridging moiety, and connecting the sequencing adaptor complex at the other end to form the sequencing library, a by-product that cannot be subjected to double-stranded sequencing is also produced, i.e. the product in which both ends of the target nucleic acid are connected by the bridging moiety, and the product in which both ends of the target nucleic acid are connected by the sequencing adaptor complex, the proportion of the target library obtained is low, and the efficiency is low. (2) Two different anchors (usually a constrained sequence with a cholesterol or fatty acyl chain modification, which can couple the library to the membrane) need to be used in the sequencing process, which increases the sequencing components and increases the complexity of the sequencing system. (3) In the process of constructing the double-stranded sequencing library, the increase in the number of molecules (molecular copy number) cannot be performed.
[0007] SUMMARY
[0008] The main purpose of the present application is to provide a nucleic acid library construction method, a nanopore sequencing method and an application, so as to solve the problem that the copy number expansion cannot be realized at the same time when the double-stranded nucleic acid library is constructed in the prior art.
[0009] In order to achieve the above-mentioned purpose, according to the first aspect of the present application, a nucleic acid library construction method is provided, which comprises: a) providing a circular library; the circular library comprises a circular nucleic acid molecule, and the circular nucleic acid molecule comprises a to-be-detected nucleic acid sequence and a first hairpin sequence capable of forming a first hairpin structure; b) performing at least one copy of rolling circle amplification on the circular nucleic acid molecule to obtain a rolling circle amplification strand; the rolling circle amplification strand contains a second hairpin sequence forming a second hairpin structure, and the second hairpin sequence is the reverse complement sequence of the first hairpin sequence; c) cutting the single strand of the stem structure in the second hairpin structure to obtain an amplification copy sequence; d) using the single-stranded overhanging sequence of the amplification copy sequence as a template to perform: (i) extension, or (ii) extension followed by ligation, to obtain a polynucleotide with a stem-loop structure, i.e. to obtain a nucleic acid library comprising a polynucleotide with a stem-loop structure.
[0010] Further, the circular library comprises a single-stranded circular library, a dumbbell-shaped single-stranded circular library, a double-stranded circular library, and a double-stranded circular library with bubbles or gaps.
[0011] Further, b) comprises: annealing a rolling circle amplification primer with the circular library, and performing rolling circle amplification under the action of a polymerase with strand displacement activity to obtain a rolling circle amplification strand; preferably, the 3' nucleotide of the rolling circle amplification primer contains a modification group, more preferably a thio modification.
[0012] Further, c) comprises: cleaving the cleavage site on the second hairpin structure on the rolling circle amplification strand to form a cut, obtaining an amplified copy sequence; preferably, in b), the rolling circle amplification is performed for at least 2, at least 2 2 copies, at least 2 3 copies, at least 2 4 copies, at least 2 5 copies, at least 2 6 copies, at least 2 7 copies, at least 2 8 copies, at least 2 9 copies, at least 2 10 copies, at least 2 20 copies, at least 2 30 copies, at least 2 40 copies, at least 2 50 copies, at least 2 50 copies or more; further, in step c), at least 2, at least 2 2 copies, at least 2 3 copies, at least 2 4 copies, at least 2 5 copies, at least 2 6 copies, at least 2 7 copies, at least 2 8 copies, at least 2 9 copies, at least 2 10 copies, at least 2 20 copies, at least 2 30 copies, at least 2 40 copies, at least 2 50 copies, at least 2 50 copies or more amplified copy sequences are obtained.
[0013] Further, the cleavage is performed by using a nicking endonuclease or a CRISPR / Cas9 nicking enzyme; preferably, the nicking endonuclease comprises any one or more of: Nt.BstNBI, Nb.BtsI, Nb.BsrDI, Nt.BspQI, Nt.CviPII, Nt.AlwI, Nb.BbvCI, Nt.BbvCI, Nb.BsmI, Nb.BssSI or Nt.BsmAI; the rolling circle amplification strand comprises a second hairpin structure, and the second hairpin structure comprises a cleavage site for the nicking endonuclease.
[0014] Further, in the rolling circle amplification, the binding site of the rolling circle amplification primer is located in the first hairpin sequence; preferably, in the rolling circle amplification, the binding site of the rolling circle amplification primer is located in the loop sequence of the first hairpin sequence.
[0015] Further, the polymerase includes a DNA polymerase or an RNA polymerase; preferably, the polymerase is a polymerase with strand displacement activity; preferably, the polymerase has 3' to 5' exonuclease activity; preferably, the polymerase does not have 5' to 3' exonuclease activity; preferably, the polymerase includes any one or more of Q5 super-fidelity DNA polymerase, Taq DNA polymerase, Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu Large Fragment DNA polymerase, Klenow Fragment DNA polymerase, T4 DNA polymerase, T7 DNA polymerase, DNA Polymerase I, T3 RNA polymerase, T7 RNA polymerase, SP6 RNA polymerase, or E. coli RNA polymerase; preferably, the time for the rolling circle amplification is 1-120 minutes. Further, the reaction step is performed in an amplification buffer, and the reaction step includes any one or more of rolling circle amplification, (i) elongation, or (ii) post-elongation ligation; preferably, the amplification buffer contains a pH buffer system; preferably, the pH buffer system includes any one or more of a phosphate buffer system, a carbonate-sodium bicarbonate buffer system, a Tris-HCl buffer system, a HEPES buffer system, a MOPS buffer system; preferably, the amplification buffer contains one or more of NTP, dNTP, or ddNTP; preferably, the amplification buffer contains K + and / or Na + ; preferably, the amplification buffer further contains any one or more of metal ions of Mg 2+ , Mo 2+ , Cu 2+ , Fe 2+ , Zn 2+ , Ca 2+ , Pb 2+ , or Cd 2+ ; preferably, the amplification buffer further contains an additive capable of enhancing the reaction step; more preferably, the additive includes any one or more of dimethyl sulfoxide, glycerol, formamide, bovine serum albumin, ammonium sulfate, polyethylene glycol, gelatin, non-ionic detergent, N,N,N-trimethylglycine, single-stranded nucleic acid binding protein, dithiothreitol, or ethylenediaminetetraacetic acid; preferably, the amplification buffer for the ligation contains a ligase.
[0016] The skilled in the art can understand that the (ii) post-extension ligation can be performed in the same system, or the extension and ligation can be completed separately in different systems, the reaction buffer for extension is the same as the above-mentioned amplification buffer, and the reaction buffer for ligation generally comprises a ligase, a pH buffer and metal ions, and the pH buffer and metal ions can be selected from the pH buffer and metal ions in the above-mentioned amplification buffer. Unless otherwise specified, "ligation" in the present application refers to the formation of a phosphodiester bond between the phosphate group of the 5' end nucleotide of one nucleic acid sequence and the hydroxyl group of the 3' end nucleotide of another nucleic acid sequence.
[0017] Further, the construction method further comprises: e) after obtaining the polynucleotide with the stem-loop structure, further connecting the polynucleotide with a sequencing adapter to obtain a sequencing library containing the sequencing adapter.
[0018] Further, the sequencing adapter is a single molecule sequencing adapter; preferably, the sequencing adapter is a nanopore sequencing adapter; further preferably, the nanopore sequencing adapter is an annealing product of a top strand and a bottom strand complementary pairing; preferably, the top strand comprises, in sequence, a guide sequence, a helicase binding sequence, a limiting sequence and a bottom strand complementary sequence; the bottom strand comprises, in sequence in the same direction as the top strand, the bottom strand complementary sequence and a sequence complementary to the limiting sequence; the bottom strand complementary sequence and the top strand complementary sequence can complementarily pair, and the bottom strand and the top strand can anneal; preferably, the 3' end of the top strand has a free T base, and the 5' end of the bottom strand has a phosphate group; preferably, the 3' end of the synthesis product (i.e. the above-mentioned polynucleotide with the stem-loop structure) has a free A tail, and the 5' end has a phosphate group; preferably, the guide sequence is a sequence of 10-50 nucleotides or an intemucleotide spacer modification, and the intemucleotide spacer modification comprises one or more of iSp18, iSp9, iSpC3, iSpC6 or iSpC12; more preferably, the guide sequence is a sequence of 20-40 iSpC3; further preferably, the guide sequence is a sequence of 30 iSpC3; preferably, the helicase binding sequence is a sequence of 5-40 nucleotides, more preferably a sequence of 5-40 thymine nucleotides; further preferably, the helicase binding sequence is a sequence of 10 thymine nucleotides; preferably, the limiting sequence is a sequence of intemucleotide spacer modification, and the intemucleotide spacer modification comprises one or more of iSp18, iSp9, iSpC3, iSpC6 or iSpC12; more preferably, the limiting sequence is a sequence of 2-6 iSP18; further preferably, the limiting sequence is a sequence of 4 iSP18.
[0019] In order to achieve the above-mentioned purpose, according to a second aspect of the present application, a nucleic acid sequencing method is provided, which comprises: obtaining a nucleic acid library by using the above-mentioned nucleic acid library construction method, and sequencing the nucleic acid library to obtain the information of the target nucleic acid.
[0020] Further, the sequencing comprises high-throughput sequencing or single molecule sequencing; preferably, the single molecule sequencing comprises single molecule fluorescent sequencing or nanopore sequencing.
[0021] To achieve the above object, according to a third aspect of the present application, a nanopore sequencing method is provided, which comprises: obtaining a nucleic acid library by the method for constructing a nucleic acid library described above, loading the nucleic acid library onto a machine after incubation with a helicase or loading the nucleic acid library onto a machine without incubation with a helicase, and under the action of an electric field force, the nucleic acid library passes through a nanopore to achieve the acquisition of target nucleic acid information.
[0022] Further, the nanopore is located on a membrane material; preferably, the membrane material is combined with a tether sequence, the tether sequence is combined on the membrane material through a terminal cholesterol modification; the tether sequence can be at least partially complementary to the bottom strand of the sequencing adaptor described above.
[0023] Further, the nanopore is a transmembrane protein pore or a solid-state pore; preferably, the transmembrane protein in the transmembrane protein pore is selected from any one or more of the following: hemolysin, MspA, MspB, MspC, MspD, FraC, ClyA, PA63, CsgG, CsgD, XcpQ, SP1, phi29 connector protein, InvG or GspD; preferably, the transmembrane protein is further connected with an auxiliary fragment, the auxiliary fragment is selected from any one or more of the following: a tag, an enzyme cutting site, a signal peptide, a leader peptide or a detectable label; preferably, the helicase is selected from any one or more of the following: Dda helicase, Pif 1 helicase, XPD helicase, T7 Gp41 helicase, DnaB helicase, Rep helicase, UrvD helicase, Hel308 helicase, PcrA helicase or RecD2 helicase.
[0024] Further, the membrane material comprises an amphiphilic membrane; preferably, the membrane material comprises a phospholipid bilayer, a two-block copolymer or a three-block copolymer.
[0025] Further, the voltage for generating the electric field force is ≥10 mV, preferably 50 mV-250 mV.
[0026] Further, the nucleic acid library is subjected to nanopore sequencing in a sequencing buffer; preferably, the sequencing buffer contains a pH buffer system; preferably, the pH buffer system comprises any one or more of the following: a phosphate-dihydrogen phosphate buffer system, a carbonate-sodium bicarbonate buffer system, a Tris-HCl buffer system, a HEPES buffer system, a MOPS buffer system; preferably, the sequencing buffer contains one or more of NTP, dNTP or ddNTP; preferably, the sequencing buffer contains K + and / or Na +; preferably, the sequencing buffer also contains any one or more of the following metal ions: Mg 2+ , Mo 2+ , Cu 2+ , Fe 2+ , Zn 2+ , Ca 2+ , Pb 2+ or Cd 2+ .
[0027] To achieve the above object, according to a fourth aspect of the present application, there is provided a method for constructing a nucleic acid library, or a method for sequencing a nucleic acid, or a method for nanopore sequencing, for use in the construction of a sequencing library.
[0028] To achieve the above object, according to a fifth aspect of the present application, there is provided a method for constructing a nucleic acid library and / or a method for nanopore sequencing, for use in the nanopore sequencing of a target nucleic acid.
[0029] By using the nucleic acid library obtained by the method for constructing a nucleic acid library, the construction efficiency of a double-stranded nucleic acid library can be improved, and the copy number amplification is fully connected with the construction of a double-stranded nucleic acid library. The copy number amplification is completed by using rolling circle amplification and nicking endonuclease cleavage, and the errors occurring in the amplification will not be accumulated. The 3' end of the amplified copy sequence has a hairpin structure, and a double-stranded nucleic acid library can be easily obtained. Sequencing the double-stranded nucleic acid library is equivalent to sequencing the target nucleic acid twice, and the sequencing accuracy can be improved. BRIEF DESCRIPTION OF DRAWINGS
[0030] The drawings accompanying the specification of the present application form a part thereof and serve to provide further understanding of the present application, the illustrative embodiments of the present application and its description serve to explain the present application. The drawings do not limit the present application in any manner.
[0031] Fig. 1 shows a schematic diagram of the construction method of a dumbbell-shaped circular library according to an embodiment of the present application.
[0032] Fig. 2 shows a schematic diagram of an alternative construction method of a circular library according to an embodiment of the present application.
[0033] Fig. 3 shows a schematic diagram of an alternative circular library according to an embodiment of the present application.
[0034] Fig. 4 shows a schematic diagram of an alternative circular library preparation method according to an embodiment of the present application.
[0035] Fig. 5 shows a schematic diagram of the cleavage site of a nicking endonuclease according to embodiment 1 of the present application.
[0036] Fig. 6 shows a schematic diagram of the construction process of a sequencing adapter complex according to embodiment 1 of the present application.
[0037] Figure 7 shows the electrophoresis results of the sequencing adapter complex according to Example 1 of the present invention.
[0038] Figure 8 shows the current signal results of double-stranded nanopore sequencing of the target nucleic acid according to Embodiment 1 of the present invention. Detailed Implementation
[0039] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. The present invention will now be described in detail with reference to the embodiments.
[0040] As mentioned in the background section, existing technologies for constructing nucleic acid libraries for nanopore sequencing suffer from problems such as low sequencing accuracy. Therefore, in this application, the inventors attempted to develop a new method for constructing nucleic acid libraries, and thus proposed a series of protection schemes in this application.
[0041] In a first typical embodiment of this application, a method for constructing a nucleic acid library is provided, the method comprising: a) providing a circular library; the circular library comprising a circular nucleic acid molecule, the circular nucleic acid molecule comprising a nucleic acid sequence to be tested and a first hairpin sequence capable of forming a first hairpin structure; b) performing rolling circle amplification on the circular nucleic acid molecule by at least one copy to obtain a rolling circle amplification strand; the rolling circle amplification strand containing a second hairpin sequence forming a second hairpin structure, the second hairpin sequence being the reverse complementary sequence of the first hairpin sequence; c) cleaving the single strand of the stem structure in the second hairpin structure on the rolling circle amplification strand to obtain an amplified copy sequence; d) using the single strand overhang sequence of the amplified copy sequence as a template for: (i) extension, or (ii) extension followed by ligation, to obtain a polynucleotide with a stem-loop structure, i.e., obtaining a nucleic acid library comprising a polynucleotide with a stem-loop structure.
[0042] A schematic diagram of the above-mentioned nucleic acid library construction method is shown in Figure 1 or Figure 2. In the above-mentioned nucleic acid library construction method, firstly, in step a), a circular library containing circular nucleic acid molecules is provided. The circular nucleic acid molecules include the nucleic acid sequence to be tested and a first hairpin sequence forming a first hairpin structure. The first hairpin sequence can form a first hairpin structure by base complementarity pairing between some of its own bases. In the circular library, the first hairpin sequence can be a single-stranded DNA without secondary structure, or a double-stranded DNA containing a complementary strand (such as when the circular library is a double-stranded circular library), or it can exist directly in the circular library in the form of a first hairpin structure with secondary structure. None of these will affect the normal progress of the subsequent construction method.
[0043] It is to be understood that the "circular library" defined in the present application does not emphasize the shape of the nucleic acid molecules in the library, but refers to the fact that at least one strand of each nucleic acid molecule in the library is circularized, i.e. the two ends of the strand are connected together to form a closed structure. In a single-stranded circular library, the two ends of each nucleic acid molecule are connected together to form a closed structure; in a double-stranded circular library, the two ends of one strand of each nucleic acid molecule are connected together to form a closed structure, or the two ends of each of the two strands are connected together to form a closed structure. In the double-stranded circular library, each nucleic acid molecule contains at least one first hairpin sequence capable of forming a first hairpin structure, and the first hairpin sequence is located on the strand forming the closed structure.
[0044] Secondly, in step b), at least one copy of rolling circle amplification is performed using the circular nucleic acid molecule as a template to obtain a rolling circle amplification strand, which contains a second hairpin sequence, which is the reverse complement of the first hairpin sequence obtained by rolling circle amplification. Since the rolling circle amplification strand is a single-stranded DNA, the second hairpin sequence on the rolling circle amplification strand can spontaneously form a second hairpin structure. It should be understood that when the above-mentioned circular nucleic acid molecule is a double-stranded circular nucleic acid molecule, the template for the above-mentioned rolling circle amplification is the strand forming the closed structure and containing the first hairpin sequence. That is, the above-mentioned circular nucleic acid molecule includes at least one strand forming the closed structure and containing at least one first hairpin sequence capable of forming a first hairpin structure, which is used as a template for rolling circle amplification.
[0045] Preferably, in step b), at least two copies of rolling circle amplification are performed using the circular nucleic acid molecule as a template; further, in step c), at least two amplified copy sequences are obtained.
[0046] Further, in step c), the second hairpin structure on the rolling circle amplification strand is cut using a method that includes but is not limited to using a nicking endonuclease. Unlike a restriction endonuclease, which recognizes and cuts both strands of a double-stranded nucleic acid, a nicking endonuclease only cuts one strand of a double-stranded nucleic acid to produce a "nick" on one strand of the nucleic acid rather than simultaneously producing "nicks" on both strands of the nucleic acid. After multiple copies of rolling circle amplification are performed, the rolling circle amplification strand is cut to obtain multiple amplified copy sequences, each of which contains a copy of the target nucleic acid. Since the cutting occurs on the "stem" structure of the second hairpin structure, the amplified copy sequence obtained by cutting still contains part of the second hairpin structure (one complete "stem" single strand, a complete "loop" structure, and one truncated "stem" single strand).
[0047] In the present application, "double strand" includes, but is not limited to, a double strand nucleic acid structure formed by combining two independent nucleic acid sequences through complementary pairing or the like; and also includes a double strand nucleic acid structure formed by combining one nucleic acid sequence through complementary pairing between internal partial sequences or the like. Such structure, for example, includes an A strand, a B strand complementary to the A strand, and a loop structure connecting the A and B strands and existing in a single strand form.
[0048] As can be easily understood by those skilled in the art, "single strand overhang sequence" refers to a sequence not located in a "loop" structure or in a sequence of the complementary structure when the above-mentioned amplified copy sequence forms a complementary structure.
[0049] As can be easily understood by those skilled in the art, "(ii) extension and ligation" is extension and ligation dependent on an added extension primer, i.e., an extension primer complementary to the 5' end of the template. The above-mentioned "(ii) extension and ligation" refers to that, after adding an extension primer, the extension primer is extended with the single strand overhang sequence of the above-mentioned amplified copy sequence, and then a ligation reaction occurs between the extension primer and the single strand overhang sequence of the above-mentioned amplified copy sequence, to obtain a polynucleotide having a stem loop structure; "(i) extension" (without ligation) refers to self-extension of the above-mentioned amplified copy sequence, to obtain a polynucleotide having a stem loop structure. As can be easily thought by those skilled in the art, the cleavage in step c) can occur in the single strand of the 3' end or 5' end stem structure of the above-mentioned amplified copy sequence. In the case of cleaving the single strand of the 3' end stem structure of the above-mentioned second hairpin structure in step c), step d) is performed to extend from the 3' end of the above-mentioned amplified copy sequence as a starting point, to obtain the above-mentioned polynucleotide having a stem loop structure; in the case of cleaving the single strand of the 5' end stem structure of the above-mentioned second hairpin structure in step c), step d) is performed to add an extension primer for extension from the 3' end of the above-mentioned amplified copy sequence as a primer binding site, and the extension product is ligated to the 5' end of the above-mentioned amplified copy sequence, to obtain the above-mentioned polynucleotide having a stem loop structure. Preferably, the above-mentioned primer binding site is located downstream (i.e., in the 3' direction) of the complementary sequence of the nucleic acid sequence to be detected.
[0050] Preferably, when cleaving one single strand in the "stem" structure, the cleavage site is downstream (3' side of the stem structure) of the second hairpin structure. The amplified copy sequence obtained by such cleavage can be extended in the 5'-3' direction under the action of a polymerase using dNTP as a raw material.
[0051] Finally, the amplified copy sequence is extended to lengthen the truncated single strand of the "stem" structure, to obtain a polynucleotide having a stem loop structure, i.e., the above-mentioned nucleic acid library. In this case, no additional primer needs to be added.
[0052] In the above construction method, the extended nucleic acid library contains two copies of the target nucleic acid, and one sequencing process is performed on the single-stranded DNA, which can realize the sequencing of the genetic information of the target nucleic acid twice, thereby improving the sequencing accuracy. In the above construction method, the copy number amplification is fully connected with the construction of the double-stranded nucleic acid library, and the copy number amplification is completed by using the rolling circle amplification and cutting. Meanwhile, the 3' end of the amplified copy sequence has a hairpin structure, which is easy to obtain a double-stranded nucleic acid library, and the construction efficiency of the double-stranded nucleic acid library is high. The rolling circle amplification is used for copy number amplification, and even if an error occurs during amplification, such error will not be accumulated.
[0053] In a preferred embodiment, the hairpin sequence in the circular library is a first hairpin structure containing a single-stranded structure or a double-stranded structure; preferably, the hairpin sequence further contains an amplification primer binding sequence.
[0054] In the circular library, the hairpin sequence can be single-stranded DNA without secondary structure, or double-stranded DNA containing complementary strands (such as when the circular library is a double-stranded circle), or directly in the form of a first hairpin structure with secondary structure, all of which do not affect the normal progress of the subsequent construction method.
[0055] Further, in order to facilitate the subsequent rolling circle amplification and other operations, the hairpin sequence can further be provided with an amplification primer binding sequence, thereby realizing the library construction for different target nucleic acids.
[0056] In a preferred embodiment, the circular library includes a single-stranded circular library, a dumbbell-shaped single-stranded circular library, a double-stranded circular library, and a double-stranded circular library with bubbles or gaps.
[0057] In the above construction method, a person skilled in the art can flexibly select different types of circular libraries to construct nucleic acid libraries. Alternatively, the construction method of the circular library is as follows.
[0058] 1. Single-stranded circular library:
[0059] The preparation method includes but is not limited to: connecting the two ends of the double-stranded target nucleic acid with an auxiliary ring-forming linker (containing a first hairpin sequence), denaturing into a single strand, and then connecting the 5' and 3' ends of the single strand through a clamp strand complementary to the two ends of the single strand by means of a ligase, so as to form a single-stranded circular library containing a first hairpin sequence.
[0060] 2. Dumbbell-shaped single-stranded circular library:
[0061] The preparation method includes but is not limited to: connecting the two ends of the double-stranded target nucleic acid with a hairpin linker (containing a first hairpin sequence), to form a dumbbell-shaped single-stranded circular library.
[0062] 3. Double-stranded circular library:
[0063] The preparation method includes, but is not limited to, directly connecting the double-stranded target nucleic acid and the double-stranded auxiliary linker (containing the first hairpin sequence) to form the double-stranded circular library.
[0064] 4. The double-stranded circular library with bubble or gap:
[0065] The preparation method includes, but is not limited to, directly connecting the double-stranded target nucleic acid and the double-stranded auxiliary linker (containing the first hairpin sequence, the double-stranded auxiliary linker having bubble or gap) to form the double-stranded circular library with bubble or gap.
[0066] The schematic diagram of the plurality of optional circular libraries is shown in FIG. 3, wherein the bolded part is the hairpin sequence in the circular library. Among them, the dumbbell-shaped single-stranded circular-1 and the dumbbell-shaped single-stranded circular-2 are two optional dumbbell-shaped single-stranded circular libraries. The person skilled in the art can flexibly select the circular library for the construction of the nucleic acid library according to the actual needs of the experiment. For the construction of the circular library, the method shown in FIG. 4 is optionally used to prepare the circular library for subsequent rolling circle amplification.
[0067] In a preferred embodiment, b) comprises annealing the rolling circle amplification primer to the circular library, and performing rolling circle amplification under the action of the polymerase having strand displacement activity to obtain the rolling circle amplification strand. Preferably, the 3' nucleotide of the rolling circle amplification primer contains a modification group, more preferably a phosphorothioate modification, which can avoid the degradation of the primer by the polymerase.
[0068] During the synthesis of the oligonucleotide, one of the oxygen atoms in the phosphodiester bond can be replaced by a sulfur atom to form a phosphorothioate bond. This step is usually achieved by using a thio reagent (such as phosphorothioic trichloride). Generally, in order to prevent the oligonucleotide from being degraded by the nuclease while minimizing the impact on the Tm value, one or more (preferably 2-5) bases at the 3' end and / or 5' end can be selected for thio modification. The specific operation can be, after adding each nucleotide unit, using a thio reagent to replace the oxygen atom in the phosphodiester bond with a sulfur atom.
[0069] Optionally, the polymerase has 3' to 5' exonuclease activity to correct the incorrectly polymerized nucleotides during the rolling circle amplification. In order to prevent the digestion of the polymerase, the above-mentioned polymerase is optionally free of 5' to 3' exonuclease activity; and / or, a modification group (such as phosphorylation modification) is optionally provided at the 3' end of the rolling circle amplification primer to prevent the rolling circle amplification primer from being digested by the polymerase used for rolling circle amplification, affecting the progress of the rolling circle amplification.
[0070] In a preferred embodiment, c) comprises: cleaving the cleavage site on the second hairpin structure on the rolling circle amplification strand to form a nick, obtaining an amplification copy sequence; wherein the 3' end of the amplification copy sequence has a third hairpin structure, the third hairpin structure has the same loop structure as the second hairpin structure, and the stem structure of the third hairpin structure is truncated from the stem structure of the second hairpin structure.
[0071] In a preferred embodiment, in step b), at least 2, at least 2 2 , at least 2 3 , at least 2 4 , at least 2 5 , at least 2 6 , at least 2 7 , at least 2 8 , at least 2 9 , at least 2 10 , at least 2 20 , at least 2 30 , at least 2 40 , at least 2 50 , at least 2 50 , at least 2 2 , at least 2 3 , at least 2 4 , at least 2 5 , at least 2 6 , at least 2 7 , at least 2 8 , at least 2 9 , at least 2 10 , at least 2 20 , at least 2 30 , at least 2 40 , at least 2 50 , at least 2 50 , or more copies of rolling circle amplification are performed using the circular nucleic acid molecule as a template; further, in step c), at least 2, at least 2
[0072] In a preferred embodiment, the amplification copy sequence is a single-stranded structure containing "long chain-loop-short chain", the short chain is complementary to the long chain, and the 3' end of the short chain is a nick; preferably, the "long chain" in each amplification copy sequence contains genetic information of the target nucleic acid.
[0073] The short chain in the amplified copy sequence is the truncated single strand of the "stem" structure in the second hairpin structure; the long chain includes the intact single strand of the "stem" structure and the genetic information of the target nucleic acid. Taking the truncated single strand of the "stem" structure in the second hairpin structure as an example, in the extension, the polymerase can bind to the short chain, use the short chain as a primer and the long chain as a template to extend along the 5'-3' direction of the short chain, realize the re-completion of the second hairpin structure and the secondary copying of the genetic information of the target nucleic acid, complete the above-mentioned extension, and obtain a nucleic acid library with a double-stranded structure. At one end of the double-stranded structure, the "loop structure" connects the double-stranded structure. In the two complementary strands of the double-stranded structure, each contains the genetic information of one target nucleic acid sequence. In the subsequent sequencing, when the double-stranded structure is sequenced, the double-stranded structure is denatured to obtain a single-stranded DNA, which contains two copies of the target nucleic acid. One sequencing process of this single-stranded DNA can realize the sequencing of the genetic information of the target nucleic acid twice, thereby improving the sequencing accuracy.
[0074] The "genetic information of the target nucleic acid" and "copy of the target nucleic acid" in the present application include but are not limited to the sense strand of the target nucleic acid, and also include the antisense strand corresponding to the sense strand through the principle of base complementary pairing. Those skilled in the art can obtain the exact sequence of the target nucleic acid to be detected.
[0075] In a preferred embodiment, the above-mentioned cutting is performed by using a nicking endonuclease or CRISPR / Cas9 Nickase.
[0076] In a preferred embodiment, the nicking endonuclease includes but is not limited to any one or more of Nt.BstNBI, Nb.BtsI, Nb.BsrDI, Nt.BspQI, Nt.CviPII, Nt.AlwI, Nb.BbvCI, Nt.BbvCI, Nb.BsmI, Nb.BssSI or Nt.BsmAI; the rolling circle amplification chain contains a second hairpin structure, and the second hairpin structure has a nicking endonuclease enzyme cutting site.
[0077] Those skilled in the art can flexibly select the cutting method in the prior art to cut the cutting site and form a nick. The cutting method used above includes but is not limited to CRISPR / Cas9 Nickase.
[0078] The CRISPR / Cas9 system can recognize specific DNA sequences through guide RNA (gRNA). By mutating the Cas9 protein (such as D10A or H840A mutation), it can be modified into a CRISPR / Cas9 Nickase that only produces a single-stranded cut. This method can accurately introduce a single-stranded cut at the target position.
[0079] In a preferred embodiment, the binding site of the rolling circle amplification primer is located in the first hairpin sequence; preferably, the binding site of the rolling circle amplification primer is located in the loop sequence of the first hairpin sequence.
[0080] Preferably, the rolling circle amplification primer is a random sequence or a known sequence.
[0081] In a preferred embodiment, the polymerase comprises a DNA polymerase or an RNA polymerase; preferably, the polymerase is a polymerase with strand displacement activity; preferably, the polymerase with strand displacement activity has 5' to 3' strand displacement activity; preferably, the polymerase has 3' to 5' exonuclease activity; preferably, the polymerase does not have 5' to 3' exonuclease activity; preferably, the polymerase comprises any one or more of the following: Q5 super-fidelity DNA polymerase, Taq DNA polymerase, Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu Large Fragment DNA polymerase, Klenow Fragment DNA polymerase, T4 DNA polymerase, T7 DNA polymerase, DNA Polymerase I, T3 RNA polymerase, T7 RNA polymerase, SP6 RNA polymerase, or E. coli RNA polymerase; preferably, the rolling circle amplification is performed for 1-120 minutes, including but not limited to 1, 2, 5, 10, 20, 30, 60, 80, 100, or 120 minutes, and the person skilled in the art can flexibly adjust the parameters for amplification according to the length of amplification, the type of polymerase, and other factors.
[0082] In an extreme embodiment of the present application, the polymerase has no strand displacement activity, and the rolling circle amplification produces only one copy of the rolling circle amplification chain.
[0083] The polymerase used in the present application has strand displacement activity, which allows the generation of a new nucleic acid strand by "pushing away" the complementary nucleic acid strand on the template during replication. The rolling circle amplification described above can be achieved using such a polymerase with strand displacement activity. Alternatively, the polymerase is a polymerase with strand displacement activity obtained by modification of a polymerase without strand displacement activity.
[0084] In a preferred embodiment, the reaction step is performed in an amplification buffer, and the reaction step comprises any one or more of: the rolling circle amplification, (i) extension, or (ii) ligation after extension; preferably, the amplification buffer comprises a pH buffer system; preferably, the pH buffer system comprises any one or more of: a phosphate buffer system, a carbonate-sodium bicarbonate buffer system, a Tris-HCl buffer system, a HEPES buffer system, a MOPS buffer system; preferably, the amplification buffer comprises one or more of: NTPs, dNTPs, or ddNTPs; preferably, the amplification buffer comprises K + and / or Na + ; preferably, the amplification buffer further comprises any one or more of the following metal ions: Mg 2+ , Mo 2+ , Cu 2+ , Fe 2+ , Zn 2+ , Ca 2+ , Pb 2+ , or Cd 2+ ; preferably, the amplification buffer further comprises an additive capable of enhancing the reaction step; more preferably, the additive comprises any one or more of: dimethyl sulfoxide, glycerol, formamide, bovine serum albumin, ammonium sulfate, polyethylene glycol, gelatin, non-ionic detergents, N,N,N-trimethylglycine, single-stranded nucleic acid binding proteins, dithiothreitol, or ethylenediaminetetraacetic acid; preferably, the amplification buffer used for the ligation comprises a ligase.
[0085] As understood by those skilled in the art, the (ii) ligation after extension can be performed in the same system, or the extension and ligation can be performed separately in different systems, the reaction buffer for the extension being the same as the amplification buffer, and the reaction buffer for the ligation generally comprises a ligase, a pH buffer, and metal ions, which can be the same as the pH buffer and metal ions in the amplification buffer. Unless otherwise specified, "ligation" in the present application refers to the formation of a phosphodiester bond between the phosphate group of the 5' end nucleotide of one nucleic acid sequence and the hydroxyl group of the 3' end nucleotide of another nucleic acid sequence.
[0086] In a preferred embodiment, the construction method further comprises: e) after obtaining the polynucleotide with stem-loop structure, further ligating the polynucleotide with a sequencing adaptor to obtain a sequencing library comprising the sequencing adaptor.
[0087] In an embodiment, the sequencing adaptor is a single molecule sequencing adaptor; in a preferred embodiment, the sequencing adaptor is a nanopore sequencing adaptor; preferably, the nanopore sequencing adaptor is an annealing product of a top strand and a bottom strand complementary pairing; preferably, the top strand comprises, in order, a guide sequence, a helicase binding sequence, a limiting sequence, and a bottom strand complementary sequence; the bottom strand comprises, in order, the bottom strand complementary sequence and a sequence complementary to the limiting sequence, in the same direction as the top strand (here, the direction refers to 5'-3' or 3'-5'); the bottom strand complementary sequence and the top strand complementary sequence are capable of complementary pairing, and the bottom strand and the top strand are capable of annealing; preferably, the 3' end of the top strand has a free T base, and the 5' end of the bottom strand has a phosphate group; preferably, the 3' end of the stem-loop structure polynucleotide prepared above has a free A tail, and the 5' end has a phosphate group; preferably, the guide sequence is a sequence of 10-50 nucleotides or an intemucleotide modification, including but not limited to 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50; the intemucleotide modification includes one or more of iSp18, iSp9, iSpC3, iSpC6, or iSpC12; more preferably, a sequence of 20-40 iSpC3, and further preferably, a sequence of 30 iSpC3; preferably, the helicase binding sequence is a sequence of 5-40 nucleotides, including but not limited to 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, more preferably, a sequence of 5-40 homonucleotides (T10, A8, G5), and more preferably, a sequence of 5-40 thymine nucleotides; further preferably, a sequence of 10 thymine nucleotides; preferably, the limiting sequence is a sequence of intemucleotide modification, including one or more of iSp18, iSp9, iSpC3, iSpC6, or iSpC12; more preferably, a sequence of 2-6 iSP18; further preferably, a sequence of 4 iSP18.
[0088] In a second typical embodiment of the present application, a nucleic acid sequencing method is provided, characterized in that the nucleic acid sequencing method comprises: obtaining a nucleic acid library (preferably a sequencing library after connecting the sequencing adaptor) by using the nucleic acid library construction method described above, sequencing the nucleic acid library (preferably the sequencing library after connecting the sequencing adaptor), and obtaining the information of the target nucleic acid.
[0089] In a preferred embodiment, the sequencing comprises high-throughput sequencing or single molecule sequencing; preferably, the single molecule sequencing comprises single molecule fluorescent sequencing or nanopore sequencing.
[0090] In a preferred embodiment, the nucleic acid sequencing method comprises: denaturing the nucleic acid library to obtain single-stranded library to be sequenced, and sequencing the single-stranded library to be sequenced.
[0091] In the above nucleic acid sequencing method, the nucleic acid library contains two copies of the target nucleic acid, and in one sequencing reaction of the nucleic acid library, especially the single-stranded nucleic acid library, two sequencing of the target nucleic acid can be achieved, which can be mutually corrected to improve the sequencing accuracy.
[0092] In a third typical embodiment of the present application, a nanopore sequencing method is provided, which comprises: obtaining a nucleic acid library by the method for constructing a nucleic acid library, incubating the nucleic acid library with a helicase before loading onto a machine or loading onto a machine without incubation with the helicase, and under the action of an electric field force, the nucleic acid library passes through a nanopore to achieve acquisition of information of the target nucleic acid.
[0093] In the above nanopore sequencing method, the nucleic acid library passes through the nanopore under the action of the electric field force, which can achieve acquisition of information of the target nucleic acid by the nanopore. Preferably, in the process of passing through the nanopore, the double-stranded nucleic acid library is first denatured into single-stranded DNA and then passes through the nanopore, and in one complete perforation process, two copies of the target nucleic acid pass through the nanopore to achieve two sequencing, and the sequencing information can be mutually corrected to improve the sequencing accuracy.
[0094] In a preferred embodiment, the nanopore is located on a membrane material; preferably, the membrane material is combined with a tether sequence, the tether sequence is combined on the membrane material through terminal cholesterol modification; the tether sequence can be at least partially complementary to the bottom strand of the sequencing adaptor of claim 10.
[0095] In a preferred embodiment, the nanopore is a transmembrane protein pore or a solid-state pore; preferably, the transmembrane protein in the transmembrane protein pore is selected from any one or more of the following: hemolysin, MspA, MspB, MspC, MspD, FraC, ClyA, PA63, CsgG, CsgD, XcpQ, SP1, phi29 connector protein, InvG or GspD; preferably, the transmembrane protein is further connected with an auxiliary fragment, and the auxiliary fragment is selected from any one or more of the following: a tag, an enzyme cutting site, a signal peptide, a leader peptide or a detectable label.
[0096] In a preferred embodiment, the helicase is selected from any one or more of: a Dda helicase, a Pif 1 helicase, a XPD helicase, a T7 Gp41 helicase, a DnaB helicase, a Rep helicase, a UrvD helicase, a Hel308 helicase, a PcrA helicase, or a RecD2 helicase.
[0097] In a preferred embodiment, the membrane material comprises an amphiphilic membrane; preferably, the membrane material comprises a phospholipid bilayer, di-block copolymers or tri-block copolymers.
[0098] In a preferred embodiment, the voltage to generate the electric field force is ≥ 10 mV, preferably 50-250 mV.
[0099] In a preferred embodiment, the nucleic acid library is subjected to nanopore sequencing in a sequencing buffer; preferably, the sequencing buffer contains a pH buffer system; preferably, the pH buffer system comprises any one or more of: a phosphate buffer system, a carbonate-sodium bicarbonate buffer system, a Tris-HCl buffer system, a HEPES buffer system, a MOPS buffer system; preferably, the sequencing buffer contains one or more of NTPs, dNTPs or ddNTPs; preferably, the sequencing buffer contains K + and / or Na + ; preferably, the sequencing buffer further contains any one or more of the following metal ions: Mg 2+ , Mo 2+ , Cu 2+ , Fe 2+ , Zn 2+ , Ca 2+ , Pb 2+ or Cd 2+ .
[0100] In a fourth exemplary embodiment of the present application, there is provided a method for constructing a nucleic acid library as described above, or a method for sequencing a nucleic acid as described above, or a method for nanopore sequencing as described above, for use in the construction of a sequencing library.
[0101] In a fifth exemplary embodiment of the present application, there is provided a method for constructing a sequencing library as described above, and / or a method for nanopore sequencing as described above, for use in the nanopore sequencing of a target nucleic acid.
[0102] The advantageous effects of the present application will be further explained in detail below with reference to specific examples.
[0103] Example 1:
[0104] (1) Construction of a dumbbell-shaped single-stranded circular library
[0105] 1. End repair and A-tailing of the target nucleic acid (SEQ ID NO: 1) with NEBNext FFPE DNA Repair Mix (NEB, M6630) and NEBNext Ultra II End repair / dA-tailing Module (NEB, E7546) according to the manufacturer’s instructions. The reaction condition is incubation at 20 °C for 10 min and at 65 °C for 10 min. Purification of the end repair and A-tailing product with AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer’s instructions.
[0106] wherein the underlined sequence is the signature sequence.
[0107] 2. Dissolving the hairpin sequence (SEQ ID NO: 2) in TE buffer (pH = 8) and annealing into a hairpin structure according to the manufacturer’s instructions. The annealing procedure is incubation at 95 °C for 5 min, ramp down to 25 °C at 0.1 °C / s, and continue incubation at 25 °C for 30 min.
[0108] SEQ ID NO: 2: Phosphorylation-TGCGCAATGGATTGCAGTTTTCCTTGGCTCACACGATTTTACTGCAATCCATTGCGCAT.
[0109] wherein Phosphorylation is phosphorylation.
[0110] 3. Ligation of the end repair and A-tailing product and the annealed hairpin linker with NEBNext Quick Ligation Module (NEB, E6056) according to the manufacturer’s instructions. The reaction condition is incubation at 25 °C for 60 min.
[0111] 4. Purification of the ligation product with AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer’s instructions.
[0112] 5. Digestion of the nucleic acid fragments with both ends not ligated to the hairpin linker with Exonuclease I (NEB, M0293) and Exonuclease III (NEB, M0206) according to the manufacturer’s instructions. The reaction condition is incubation at 37 °C for 30 min.
[0113] 6. Purify the digestion product with AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instruction to obtain the dumbbell single-stranded circular library.
[0114] (2) Rolling circle amplification
[0115] 1. Mix the obtained dumbbell single-stranded circular library formed by the two end-joining hairpin adapters, amplification primer (SEQ ID NO: 4), and phi29 DNA polymerase reaction buffer (NEB, M0269S) and perform annealing treatment. The annealing procedure is incubation at 95°C for 5 minutes, reduction to 25°C at a rate of 0.1°C / s, and further incubation for 30 minutes.
[0116] SEQ ID NO: 4: ATCGTGTGAGCCA*A*G*G, "*" represents phosphorothioate modification.
[0117] The structure of the phosphorothioate modification is wherein a sulfur atom replaces one of the oxygen atoms in the phosphodiester bond between the bases in the oligonucleotide.
[0118] 2. Perform rolling circle amplification by adding phi29 DNA polymerase (NEB, M0269) and dNTP to the incubation product of the previous step, and amplify at 30°C for 30 minutes.
[0119] 3. Purify the amplification product with AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instruction.
[0120] (3) Nicking endonuclease cleavage
[0121] 1. Perform cleavage on the amplification product using nicking endonuclease Nb.BsrDI (NEB, R0648). The sequence recognized by the nicking endonuclease Nb.BsrDI and the cleavage site are shown in FIG. 5 (the recognition sequence is in black and bold, and the cleavage site is indicated by an arrow). The sequence in FIG. 5 is SEQ ID NO: 3: ATGCGCAATGGATTGCAGTAAAATCGTGTGAGCCAAGGAAAACTGCAATCCATTGCGCA, which is the reverse complement of SEQ ID NO: 2 (the sequence obtained by amplification using SEQ ID NO: 2 as the template).
[0122] 2. Purify the cleavage product with AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instruction.
[0123] (4) Extension
[0124] 1. Mix the obtained cleavage product, phi29 DNA polymerase and reaction buffer (NEB, M0269S), dNTPs, and perform extension, 30 °C for 30 min.
[0125] 2. Purify the amplification product with AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions.
[0126] (5) Nanopore sequencing
[0127] 1. The process of constructing the sequencing adapter complex is shown in Figure 6, wherein is a helicase.
[0128] 2. The top strand of the adapter sequence, the bottom strand of the adapter sequence (SEQ ID NO: 7) are dissolved with TE buffer (pH = 8) and annealed into a ligation adapter according to the manufacturer's instructions. The annealing process is incubated at 95 °C for 5 min, and then cooled to 25 °C at a rate of 0.1 °C / s, and incubated for another 30 min.
[0129] The sequence of the top strand is: 5' (iSpC3) 30 - SEQ ID NO: 5 - (iSp18)4- SEQ ID NO: 6 3'.
[0130] SEQ ID NO: 5: TTTTTTTTTT.
[0131] SEQ ID NO: 6: GGTTGTTTCTGTTGGTGCTGATATTGCT.
[0132] The sequence of the bottom strand is: SEQ ID NO: 7: Phosphorylation-GCAATATCAGCACCAACAGAAACAACCTTTGAGGCGAGCGGTCAA.
[0133] 3. Prokaryotic expression of the helicase He (T4 Dda-(AM1)G1 / E94C / C109A / C136A / K194L / A360C, SEQ ID NO: 8) is completed in E. coli, and the target protein is obtained after multi-step purification.
[0134] SEQ ID NO: 8:
[0135] 4. Mix the helicase and the sequencing adapter at a molecular ratio of 9: 1, and the final concentration of the reaction buffer is 25 mM HEPES, 50 mM KCl, 0.5 mM EDTA, 2.5 mM MgCl2, pH = 8.0, and incubate at room temperature for 30 min.
[0136] 5. Incubate the product with 0.25 volume of 5 mM ATP at room temperature for 30 minutes.
[0137] 6. Purify the product with AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions to obtain sequencing adapter complexes. Electrophoresis detection was performed, and the results are shown in Figure 7. A large amount of 1:1 sequencing adapter complexes were obtained.
[0138] 7. End preparation was performed on the obtained extension product with NEBNext Ultra II End repair / dA-tailing Module (NEB, E7546) according to the manufacturer's instructions. The reaction conditions were incubation at 20°C for 10 minutes and incubation at 65°C for 10 minutes.
[0139] 8. Purify the end preparation product with AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions.
[0140] 9. Connect the end preparation product and the sequencing adapter complex with T4 DNA ligase (NEB, M0202) according to the manufacturer's instructions, and incubate at 25°C for 60 minutes.
[0141] 10. Purify the product with AMPure XP beads (Beckman Coulter, A63882) according to the manufacturer's instructions to obtain a nucleic acid library.
[0142] 11. A single-channel nanopore detection system was built based on a patch clamp and a signal amplifier, and a single pore protein was embedded in a hole.
[0143] 12. The nucleic acid library was mixed with the confinement sequence and added to the single-channel system. The current signal change was observed and obtained under the condition of 180 mV, and the sequencing buffer was: 470 mM KCl, 25 mM HEPES, 10 mM MgCl2, 30 mM ATP, pH = 8.10; the sequencing temperature was: 30°C.
[0144] The sequence of the confinement sequence is 5' Cholesterol-(iSp18)4-SEQ ID NO: 9 3'.
[0145] SEQ ID NO: 9: TTGACCGCTCGCCTC.
[0146] Among them, 5' Cholesterol is a 5' cholesterol modification.
[0147] 13. The current signal of sequencing the double-stranded nanopore sequencing of the target nucleic acid to be tested is obtained, and a representative current signal is shown in Figure 8, which is respectively represented as 1D and 2D.
[0148] From the above description, it can be seen that the above-mentioned embodiments of the present application achieve the following technical effects: (1) The present application can sequence the target nucleic acid twice to improve the sequencing accuracy; (2) The above-mentioned construction method can improve the construction efficiency of the double-stranded nucleic acid library; (3) In the above-mentioned construction method, the copy number amplification is fully connected with the construction of the double-stranded nucleic acid library, and the copy number amplification is completed by using the rolling circle amplification and the nicking endonuclease cutting, and the 3' end of the amplified copy sequence has a hairpin structure, which is easy to obtain the double-stranded nucleic acid library. The rolling circle amplification is used for copy number amplification, and even if an error occurs during amplification, such error will not accumulate.
[0149] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Those skilled in the art can make various modifications and changes to the present application. Any modification, equivalent replacement, improvement, etc. within the spirit and principles of the present application shall be included in the protection scope of the present application.
Claims
1. A method for constructing a nucleic acid library, characterized by, The construction method comprises: a) providing a circular library; the circular library comprises circular nucleic acid molecules, the circular nucleic acid molecules comprise a nucleic acid sequence to be detected and a first hairpin sequence capable of forming a first hairpin structure; b) performing at least one copy of rolling circle amplification on the circular nucleic acid molecules to obtain a rolling circle amplification chain; the rolling circle amplification chain contains a second hairpin sequence forming a second hairpin structure, the second hairpin sequence is the reverse complement sequence of the first hairpin sequence; c) cutting the single strand of the stem structure in the second hairpin structure on the rolling circle amplification chain to obtain an amplification copy sequence; d) the amplification copy sequence is used as a template for the single-stranded overhanging sequence of the amplification copy sequence to perform: (i) extension, or (ii) extension and ligation, to obtain a polynucleotide with a stem-loop structure, that is, to obtain the nucleic acid library comprising the polynucleotide with the stem-loop structure.
2. The construction method according to claim 1, characterized in that, The circular library comprises a single-stranded circular library, a dumbbell single-stranded circular library, a double-stranded circular library, a double-stranded circular library with bubbles or gaps.
3. The construction method of claim 1, wherein, The b) comprises: annealing a rolling circle amplification primer with the circular library, and performing the rolling circle amplification under the action of a polymerase with strand displacement activity to obtain the rolling circle amplification chain; Preferably, the 3' nucleotide of the rolling circle amplification primer contains a modification group, more preferably a thio modification.
4. The construction method of claim 1, wherein, The c) comprises: cutting the cutting site on the second hairpin structure on the rolling circle amplification chain to form a cut to obtain the amplification copy sequence; Preferably, in said b), at least 2, at least 2 2 , at least 2 3 , at least 2 4 , at least 2 5 , at least 2 6 , at least 2 7 , at least 2 8 , at least 2 9 , at least 2 10 , at least 2 20 , at least 2 30 , at least 2 40 , at least 2 50 , at least 2 50 , at least 2 or more copies of rolling circle amplification are performed with said circular nucleic acid molecule as template; further, in step c), at least 2, at least 2 2 , at least 2 3 , at least 2 4 , at least 2 5 , at least 2 6 , at least 2 7 , at least 2 8 , at least 2 9 , at least 2 10 , at least 2 20 , at least 2 30 , at least 2 40 , at least 2 50 , at least 2 50 , at least 2 or more of said amplified copy sequences are obtained.
5. The construction method of claim 1, wherein, The cutting is performed by a nicking endonuclease or a CRISPR / Cas9 nicking enzyme; Preferably, the nicking endonuclease comprises any one or more of the following: Nt.BstNBI, Nb.BtsI, Nb.BsrDI, Nt.BspQI, Nt.CviPII, Nt.AlwI, Nb.BbvCI, Nt.BbvCI, Nb.BsmI, Nb.BssSI or Nt.BsmAI; the rolling circle amplification chain contains the second hairpin structure, and the second hairpin structure has the enzyme cutting site of the nicking endonuclease.
6. The construction method of claim 1, wherein, In the rolling circle amplification, the binding site of the rolling circle amplification primer is located in the first hairpin sequence; Preferably, in the rolling circle amplification, the binding site of the rolling circle amplification primer is located in the loop sequence of the first hairpin sequence.
7. The construction method of claim 3, wherein, The polymerase comprises a DNA polymerase or an RNA polymerase; Preferably, the polymerase has 3' to 5' exonuclease activity; Preferably, the polymerase does not have 5' to 3' exonuclease activity; Preferably, the polymerase comprises any one or more of: Q5 super-fidelity DNA polymerase, Taq DNA polymerase, Bst DNA polymerase, SD DNA polymerase, phi29 DNA polymerase, Bsu Large Fragment DNA polymerase, Klenow Fragment DNA polymerase, T4 DNA polymerase, T7 DNA polymerase, DNA Polymerase I, T3 RNA polymerase, T7 RNA polymerase, SP6 RNA polymerase, or E. coli RNA polymerase; Preferably, the time for the rolling circle amplification is 1-120 minutes.
8. The construction method according to any one of claims 1 to 7, characterized in that, The reaction step is performed in an amplification buffer, and the reaction step comprises any one or more of: the rolling circle amplification, the (i) extension, or (ii) ligation after extension; Preferably, the amplification buffer contains a pH buffer system; Preferably, the pH buffer system comprises any one or more of: a phosphate buffer system, a carbonate-sodium bicarbonate buffer system, a Tris-HCl buffer system, a HEPES buffer system, a MOPS buffer system; Preferably, the amplification buffer contains one or more of NTP, dNTP, or ddNTP; Preferably, the amplification buffer contains K + and / or Na + ; Preferably, said amplification buffer further contains any one or more of the following metal ions: Mg 2+ , Mo 2+ , Cu 2+ , Fe 2+ , Zn 2+ , Ca 2+ , Pb 2+ or Cd 2+ ; Preferably, the amplification buffer further contains an additive capable of enhancing the reaction step; More preferably, the additive comprises any one or more of: dimethyl sulfoxide, glycerol, formamide, bovine serum albumin, ammonium sulfate, polyethylene glycol, gelatin, a non-ionic detergent, N,N,N-trimethylglycine, a single-stranded nucleic acid binding protein, dithiothreitol, or ethylenediaminetetraacetic acid; Preferably, the amplification buffer contains a ligase for the ligation.
9. The construction method of claim 1, wherein, The construction method further comprises: e) after obtaining the polynucleotide with a stem-loop structure, further ligating the polynucleotide with a sequencing adapter to obtain a sequencing library containing a sequencing adapter.
10. The construction method of claim 9, wherein, The sequencing adapter is a single-molecule sequencing adapter; Preferably, the sequencing adapter is a nanopore sequencing adapter; Preferably, the nanopore sequencing adapter is an annealing product of a top strand and a bottom strand complementary pairing; Preferably, the top strand comprises, in order, a guide sequence, a helicase binding sequence, a limiting sequence, and a bottom strand complementary sequence; The bottom strand comprises, in order, a top strand complementary sequence and a sequence complementary to the limiting sequence, in the same direction as the top strand; The bottom strand complementary sequence and the top strand complementary sequence are capable of complementary pairing, and the bottom strand and the top strand are capable of annealing; Preferably, the 3' end of the top strand has a free T base, and the 5' end of the bottom strand has a phosphate group; preferably, the 3' end of the polynucleotide with a stem-loop structure has a free A tail, and the 5' end has a phosphate group; Preferably, the guide sequence is a sequence consisting of 10-50 nucleotides or a sequence consisting of one or more of the following: iSp18, iSp9, iSpC3, iSpC6 or iSpC12; more preferably a sequence consisting of 20-40 iSpC3; further preferably a sequence consisting of 30 iSpC3. Preferably, the helicase binding sequence is a sequence consisting of 5-40 nucleotides, more preferably a sequence consisting of 5-40 thymine nucleotides; further preferably a sequence consisting of 10 thymine nucleotides. Preferably, the limiting sequence is a sequence consisting of one or more of the following: iSp18, iSp9, iSpC3, iSpC6 or iSpC12; more preferably a sequence consisting of 2-6 iSP18; further preferably a sequence consisting of 4 iSP18.
11. A method of nucleic acid sequencing, characterized by, The nucleic acid sequencing method comprises: obtaining a nucleic acid library by the nucleic acid library construction method of any one of claims 1-10, sequencing the nucleic acid library, and obtaining the information of the target nucleic acid.
12. The method of nucleic acid sequencing of claim 11, wherein, The sequencing comprises high-throughput sequencing or single molecule sequencing. Preferably, the single molecule sequencing comprises single molecule fluorescent sequencing or nanopore sequencing.
13. A method of nanopore sequencing, characterized in that, The nanopore sequencing method comprises: obtaining a nucleic acid library by the nucleic acid library construction method of any one of claims 1-10, co-incubating the nucleic acid library with a helicase before loading onto the machine or loading the nucleic acid library and the helicase onto the machine at the same time without incubation, and under the action of an electric field force, the nucleic acid library passes through a nanopore to obtain the information of the target nucleic acid.
14. The nanopore sequencing method of claim 13, wherein, The nanopore is located on a membrane material. Preferably, the membrane material is combined with a constraining sequence, and the constraining sequence is combined with the membrane material through terminal cholesterol modification. The constraining sequence can be at least partially complementary to the bottom strand of the sequencing adaptor of claim 10.
15. The nanopore sequencing method of claim 13, wherein, The nanopore is a transmembrane protein pore or a solid-state pore. Preferably, the transmembrane protein in the transmembrane protein pore is selected from one or more of the following: hemolysin, MspA, MspB, MspC, MspD, FraC, ClyA, PA63, CsgG, CsgD, XcpQ, SP1, phi29 connector protein, InvG or GspD. Preferably, the transmembrane protein is further connected with an auxiliary fragment selected from one or more of the following: a tag, an enzyme cutting site, a signal peptide, a leader peptide or a detectable label. Preferably, the helicase is selected from one or more of the following: Dda helicase, Pif 1 helicase, XPD helicase, T7 Gp41 helicase, DnaB helicase, Rep helicase, UrvD helicase, Hel308 helicase, PcrA helicase or RecD2 helicase.
16. The nanopore sequencing method of claim 14, wherein, The membrane material comprises an amphiphilic membrane. Preferably, the membrane material comprises a phospholipid bilayer, a two-block copolymer or a three-block copolymer.
17. The nanopore sequencing method of claim 13, wherein, The voltage for generating the electric field force is ≥10 mV, preferably 50-250 mV.
18. The nanopore sequencing method of claim 13, wherein, the nucleic acid library is subjected to nanopore sequencing in a sequencing buffer; Preferably, the sequencing buffer contains a pH buffer system; Preferably, the pH buffer system comprises any one or more of: a phosphoric biphosphate-phosphoric hydrogen buffer system, a carbonic acid-sodium bicarbonate buffer system, a Tris-HCl buffer system, a HEPES buffer system, a MOPS buffer system; Preferably, the sequencing buffer contains one or more of NTPs, dNTPs or ddNTPs; Preferably, the sequencing buffer contains K + and / or Na + ; Preferably, the sequencing buffer further contains any one or more of the following metal ions: Mg 2+ , Mo 2+ , Cu 2+ , Fe 2+ , Zn 2+ , Ca 2+ , Pb 2+ or Cd 2+ .
19. A method of constructing a nucleic acid library according to any one of claims 1 to 10, or a method of sequencing a nucleic acid according to claim 11 or 12, or a method of nanopore sequencing according to any one of claims 13 to 18, for use in the construction of a sequencing library.
20. A method of constructing a nucleic acid library according to any one of claims 1 to 10, and / or a method of nanopore sequencing according to any one of claims 13 to 18, for use in the nanopore sequencing of a target nucleic acid.
Citation Information
Patent Citations
Double-stranded nucleic acid cyclization method, methylation sequencing library construction method and kit
CN112795620A
Library preparation method and sequencing method
CN116732136A
Nanopore sequencing method and kit
CN118207308A
Hybridization-extension-ligation strategy for generating circular single-stranded DNA libraries
WO2019053215A1
Method for obtaining double-stranded sequence by single-stranded rolling circle amplification
WO2022261874A1