Whitening composition comprising nicotiana debneyi extract, and use thereof

Abstract

The present application relates to a whitening composition comprising a Nicotiana debneyi extract, and use thereof. The composition according to one embodiment regulates a melanin production pathway by reducing tyrosinase protein expression, and thus exhibits intracellular and extracellular melanin production inhibitory activity. Therefore, the present application provides a cosmetic composition for skin whitening, a health functional food composition for skin whitening, and a pharmaceutical composition for preventing or treating melanin hyperpigmentation diseases, all of which comprise the Nicotiana debneyi extract as an active ingredient.

Description

Whitening composition containing Nicotiana debenay extract and uses thereof

[0001] The present application relates to a whitening composition comprising Nicotiana debenei extract and its uses.

[0002] Pigmentation on the skin, such as melasma and freckles, is caused by an increase in melanin within the epidermis, and melanin is known to act as an important factor in determining skin color. Melanin synthesis occurs through the production of melanosomes by melanocytes located in the basal layer of the skin, and the series of processes involved in melanin synthesis is collectively referred to as the melanogenesis pathway. Melanin production utilizes tyrosine, an amino acid, as a substrate. It is converted to DOPA (3,4-dihydroxyphenylalanine) and then to DOPA quinone by tyrosinase, TRP-1 (tyrosinase-related protein-1), and TRP-2 (tyrosinase-related protein-2). After undergoing non-enzymatic reactions and spontaneous oxidation processes, melanin is synthesized through polymerization with amino acids or proteins.

[0003] Skin color is determined by the content and distribution of melanin, and is associated with the number and distribution of melanosomes produced by intracellular melanocytes and released outside the cell. Skin hyperpigmentation can occur due to various factors, such as hormonal imbalances following inflammatory skin responses, genetic disorders, and ultraviolet radiation; however, the primary cause is abnormalities in melanin synthesis and distribution. The primary function of melanin is to protect the skin from damage caused by oxygen radicals by scavenging them; thus, a high level of melanin implies the presence of an effective defense system to protect the skin from physical and chemical toxic substances.

[0004] However, excessive melanin deposition can cause pathological problems such as skin issues, and can also be perceived as a cosmetic problem, such as melasma, freckles, moles, and age spots. Therefore, there is a need to develop skin whitening ingredients that can fundamentally inhibit melanin formation.

[0005] As a result of diligent efforts to develop a whitening composition derived from natural products, the inventors confirmed that an extract derived from *Nicotiana debenei* not only does not exhibit cytotoxicity as a natural material but can also effectively inhibit intracellular and extracellular melanin production by reducing tyrosinase protein expression, and based on this, the present invention was completed.

[0006]

[0007] One aspect provides a cosmetic composition for skin whitening comprising Nicotiana debneyi extract as an active ingredient.

[0008] Another aspect provides a pharmaceutical composition for the prevention or treatment of hypermelanosis of pigmentation comprising Nicotiana debenei extract as an active ingredient.

[0009] Another aspect is to provide a health functional food composition for skin whitening containing Nicotiana debenei extract as an active ingredient.

[0010] Another aspect provides the use of Nicotiana debenei extract for the preparation of compositions for skin whitening or for the prevention or treatment of hypermelanosis.

[0011] Another aspect provides a skin whitening method comprising the step of administering or applying a composition containing Nicotiana debenei extract as an active ingredient to an individual in need.

[0012] Another aspect provides a method for preventing or treating hypermelanosis, comprising the step of administering a composition containing Nicotiana debenei extract as an active ingredient to an individual in need.

[0013]

[0014] Other objects and advantages of this application will become more apparent from the following detailed description, together with the appended claims and drawings. Anything not described in this specification is omitted, as it can be sufficiently recognized and inferred by those skilled in the art of this application or a similar art field.

[0015] Each description and embodiment disclosed in this application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application should not be considered limited by the specific descriptions provided below.

[0016]

[0017] One aspect provides a cosmetic composition for skin whitening comprising Nicotiana debenei extract as an active ingredient.

[0018] In this specification, the term "skin whitening" may refer not only to brightening skin tone by inhibiting the synthesis of melanin pigment, but also to improving skin hyperpigmentation such as melasma or freckles caused by ultraviolet rays, hormones, or heredity. The term "skin whitening" may be used interchangeably with the terms "inhibition of melanin production," "melanin reduction," or "inhibition of excessive melanin pigmentation."

[0019] In this specification, "Nicotiana debneyi" refers to a wild tobacco species belonging to the genus Nicotiana of the family Solanaceae, and may be used interchangeably with Nicotiana forsteri. Generally, plants of the genus Nicotiana are known to possess various pharmacological activities, among which anti-inflammatory, antioxidant, antibacterial, and neuroprotective activities have been reported. However, research on the pharmacological activities of plants of the genus Nicotiana has been limited to Nicotiana tabacum, and studies on the activities of Nicotiana debneyi are lacking.

[0020] In this specification, the term "extract" includes all substances obtained by extracting components of a natural product, regardless of the extraction method, extraction solvent, extraction conditions, extracted components, or the form of the extract, and also includes substances that may be obtained by processing or treating the components of the natural product by other methods after extraction. For example, the processing or treatment may include dilution, concentration, drying, purification, fractionation, filtration, fermentation, enzymatic treatment, etc. Accordingly, the extract may include an extract solution, a diluted or concentrated extract solution, a dried product obtained by drying the extract solution, a modified or purified product thereof, or a fraction obtained by fractionating the same.

[0021] The above extract may be extracted from one or more selected from the group consisting of the whole plant, roots, stems, branches, leaves, seeds, and fruits of the plant. Preferably, the Nicotiana debenei extract may be extracted from the above-ground parts of Nicotiana debenei, including leaves, stems, etc.

[0022] The above extract may be used as is without damaging its original form, or it may be used after performing a pretreatment process considering the process speed and process (manufacturing) efficiency intended by those skilled in the art. The pretreatment process may include, for example, conventional steps such as sorting, washing, cutting, pulverizing, and drying.

[0023] The above extraction method may use known natural product extraction methods such as immersion extraction, hot water extraction, high-frequency extraction, hot water extraction, vacuum high-temperature extraction, reflux extraction, hot water extraction, cold maceration extraction, room temperature extraction, ultrasonic extraction, steam extraction, and fraction extraction, but is not limited thereto.

[0024] The extraction solvent may be selected from water, organic solvents, or mixtures thereof. The water may be distilled water or purified water. The organic solvent may include, but is not limited to, one or more of C1 to C6 lower alcohols, acetone, ether, ethyl acetate, diethyl ether, ethyl methyl ketone, and chloroform. In one embodiment, the extraction solvent may be a solvent selected from the group consisting of water, alcohols having 1 to 4 carbon atoms, and mixed solvents thereof. In another embodiment, the extraction solvent of the extract may be ethanol. In another embodiment, the extraction solvent of the extract may be 30% (v / v) to 70% (v / v), 30% (v / v) to 60% (v / v), 30% (v / v) to 50% (v / v), 30% (v / v) to 40% (v / v), 40% (v / v) to 70% (v / v), 40% (v / v) to 60% (v / v), 40% (v / v) to 50% (v / v), 50% (v / v) to 70% (v / v), 50% (v / v) to 60% (v / v), or 50% (v / v) to 70% (v / v) ethanol.

[0025] The above extraction conditions refer to conditions for extracting components of natural products, such as extraction time and extraction temperature. The above extraction time may be 30 minutes to 120 hours, 30 minutes to 100 hours, 30 minutes to 80 hours, 30 minutes to 60 hours, 30 minutes to 40 hours, 30 minutes to 20 hours, 30 minutes to 10 hours, 2 hours to 120 hours, 2 hours to 100 hours, 2 hours to 80 hours, 2 hours to 60 hours, 2 hours to 40 hours, 2 hours to 20 hours, or 2 hours to 10 hours, but may be appropriately selected depending on other conditions such as extraction solvent and extraction temperature. The above extraction temperature may be 10 to 150°C, 10 to 120°C, 10 to 100°C, 10 to 80°C, 20 to 150°C, 20 to 120°C, 20 to 100°C, 20 to 80°C, 20 to 60°C, 20 to 40°C, or room temperature, but can be appropriately selected depending on other conditions such as extraction solvent, extraction time, etc.

[0026] The above extract may subsequently undergo filtration, concentration, or drying processes to remove the solvent, and filtration, concentration, and drying may all be performed. For example, filtration may be performed using filter paper or a vacuum filter, concentration may be performed using a vacuum concentrator, and drying may be performed using freeze-drying methods, but are not limited thereto. Additionally, the above extract may subsequently undergo an additional fractionation process using a solvent selected from the group consisting of hexane, methylene chloride, acetone, ethyl acetate, ethyl ether, chloroform, water, and mixtures thereof. The temperature during the fractionation may be 4°C to 120°C, but is not limited thereto.

[0027] According to one embodiment, it was confirmed that an extract derived from Nicotiana devney, for example, an ethanol extract of Nicotiana devney, not only does not exhibit cytotoxicity but also regulates the melanin production pathway by reducing tyrosinase protein expression and can effectively inhibit intracellular and extracellular melanin production. Therefore, a cosmetic composition containing the Nicotiana devney extract as an active ingredient may inhibit tyrosinase expression or inhibit melanin production, and thereby can be utilized for skin whitening purposes.

[0028] In this specification, the term "included as an active ingredient" means that Nicotiagi devnay extract is added to an extent capable of producing the effects mentioned in this specification, and includes formulation in various forms by adding various ingredients as auxiliary ingredients for drug delivery and stabilization.

[0029] The above Nicotiana debenei extract is present in an amount of 0.0001 wt% to 99.9999 wt% based on the total weight of the composition, for example, 0.001 wt% to 80 wt%, 0.01 wt% to 60 wt%, 0.01 wt% to 40 wt%, 0.01 wt% to 30 wt%, 0.01 wt% to 20 wt%, 0.01 wt% to 10 wt%, 0.01 wt% to 5 wt%, 0.05 wt% to 60 wt%, 0.05 wt% to 40 wt%, 0.05 wt% to 30 wt%, 0.05 wt% to 20 wt%, 0.05 wt% to 10 wt%, 0.05 wt% to 5 wt%, 0.1 wt% to 60 wt%, 0.1 wt% to 40 wt%. It may be included in weight%, 0.1 weight% to 30 weight%, 0.1 weight% to 20 weight%, 0.1 weight% to 10 weight%, or 0.1 weight% to 5 weight%, but is not particularly limited thereto. The content of the active ingredient may be selected as an appropriate content that can be formulated within a content range sufficient to produce the effects mentioned in this specification by a person skilled in the art.

[0030] The above cosmetic composition may additionally include ingredients commonly used in cosmetic compositions, functional additives, etc., in addition to the active ingredients disclosed in this specification, and may include, for example, conventional auxiliary agents such as antioxidants, stabilizers, solubilizers, surfactants, dispersants, thickeners, preservatives, vitamins, pigments, fragrances, etc., and cosmetically acceptable carriers.

[0031] The above cosmetic composition may be prepared in any formulation that is commonly manufactured. For example, the above cosmetic composition may have a cosmetic formulation such as a lotion, cream, essence, cleansing foam, cleansing water, pack, ampoule, body lotion, body oil, body gel, shampoo, rinse, hair conditioner, hair gel, foundation, lipstick, mascara, or makeup base.

[0032]

[0033] Another aspect provides a pharmaceutical composition for the prevention or treatment of hypermelanosis of pigmentation comprising Nicotiana debenei extract as an active ingredient.

[0034] In the above pharmaceutical composition, the terms and elements mentioned are identical to those already mentioned.

[0035] In this specification, the term "prevention" refers to any act of suppressing or delaying the onset of a disease through the administration of the above composition.

[0036] In this specification, the term “treatment” means any form of treatment that provides effects to an individual suffering from a disease or at risk of developing a disease, including improvement of the individual’s condition (e.g., one or more symptoms), delay of disease progression, delay of symptom onset, or slowing of symptom progression. Accordingly, “treatment” and “prevention” are not intended to mean the cure or complete elimination of symptoms.

[0037] The "melanin hyperpigmentation disease," which is the disease to be prevented or treated by the above pharmaceutical composition, is a broad concept that includes all melanin hyperpigmentation caused by various causes, and refers to a condition in which a specific part of the skin or fingernails / toenails becomes darker than other parts due to an excessive increase in melanin pigment. The melanin hyperpigmentation disease may be any one selected from, for example, freckles; melasma; chloasma; liver spots; nevus; solar lentigo; melanosis; Peutz-Jeghers syndrome; chloasma gravidarum; hyperpigmentation after drug use; and postinflammatory hyperpigmentation, but is not limited thereto.

[0038] The above pharmaceutical composition may additionally comprise a pharmaceutically acceptable diluent or carrier. The diluent may be lactose, corn starch, soybean oil, microcrystalline cellulose, mannitol, or a combination thereof. The carrier may be an excipient, a disintegrant, a binder, a lubricant, or a combination thereof. The excipient may be microcrystalline cellulose, lactose, low-substituted hydroxycellulose, or a combination thereof. The disintegrant may be calcium carboxymethylcellulose, sodium starch glycolate, calcium anhydrous phosphate, or a combination thereof. The binder may be polyvinylpyrrolidone, low-substituted hydroxypropylcellulose, hydroxypropylcellulose, or a combination thereof. The lubricant may be magnesium stearate, silicon dioxide, talc, or a combination thereof.

[0039] The above pharmaceutical composition may be formulated into an oral or parenteral administration formulation. Oral administration formulations may be granules, powders, liquids, tablets, capsules, dry syrups, etc. Parenteral administration formulations may be injections, ointments, etc.

[0040]

[0041] Another aspect provides a topical skin composition comprising Nicotiana debenei extract as an active ingredient.

[0042] In the above-mentioned topical skin composition, the terms and elements mentioned that are identical to those already mentioned are as described above.

[0043] The above-mentioned topical skin preparation may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal delivery patch, drug-containing bandage, lotion, or a combination thereof. The above-mentioned topical skin preparation may be appropriately formulated as needed with ingredients commonly used in topical skin preparations such as cosmetics or pharmaceuticals, for example, aqueous ingredients, oily ingredients, powder ingredients, alcohols, moisturizers, thickeners, UV absorbers, whitening agents, preservatives, antioxidants, surfactants, fragrances, colorants, various skin nutrients, or combinations thereof. The above external skin preparation may also appropriately contain metal chelating agents such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid; drugs such as caffeine, tannin, bellapamil, glablidin, various herbal medicines, tocopherol acetate, glycyrrhizic acid, tranexamic acid and its derivatives or salts thereof; and sugars such as vitamin C, magnesium ascorbate phosphate, ascorbate glucoside, arbutin, kojic acid, glucose, fructose, and trehalose.

[0044]

[0045] Another aspect provides a health functional food composition for skin whitening comprising Nicotiana devney extract as an active ingredient.

[0046] In the above-mentioned health functional food composition, the terms and elements mentioned that are identical to those already mentioned are as described above.

[0047] The above-mentioned health functional food composition may be used alone or in combination with other foods or food ingredients, and may be used appropriately according to conventional methods. The amount of the active ingredient mixture may be appropriately determined according to the purpose of use (prevention, health, or therapeutic treatment). There are no special restrictions on the types of the above-mentioned health functional food. Among the types of health functional foods, the beverage composition may contain various flavoring agents or natural carbohydrates as additional ingredients, as in ordinary beverages. The above-mentioned natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As sweeteners, natural sweeteners such as taumatin and stevia extract, or synthetic sweeteners such as saccharin and aspartame may be used. The above health functional food composition may also contain nutritional supplements, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, or combinations thereof. The above health functional food composition may also contain fruit pulp for the production of natural fruit juice, fruit juice beverages, or vegetable beverages, or combinations thereof.

[0048]

[0049] Another aspect provides the use of Nicotiana debenei extract for the preparation of compositions for skin whitening or for the prevention or treatment of melanin hyperpigmentation disorders.

[0050] Another aspect provides the use of Nicotiana debenei extract for the preparation of a cosmetic composition for skin whitening.

[0051] Another aspect provides a use of Nicotiana devney extract for the preparation of a health functional food composition for skin whitening.

[0052] Another aspect provides the use of Nicotiana debenei extract for the manufacture of medicines for the prevention or treatment of hypermelanosis.

[0053] In the above use, any terms or elements mentioned that are identical to those already mentioned are as stated above.

[0054]

[0055] Another aspect provides a skin whitening method comprising the step of administering or applying a composition containing Nicotiana debenei extract as an active ingredient to an individual in need.

[0056] Another aspect provides a method for preventing or treating hypermelanosis, comprising the step of administering a composition containing Nicotiana debenei extract as an active ingredient to an individual in need.

[0057]

[0058] In the above-mentioned skin whitening method or method for preventing or treating melanin hyperpigmentation disorders, any terms or elements mentioned that are identical to those already mentioned are as described above.

[0059] The above "individual" refers to a subject requiring improvement of skin condition or treatment of disease, and more specifically, refers to mammals such as humans or non-human primates, mice, dogs, cats, horses, and cattle.

[0060] In this specification, the terms “applying,” “administering,” and “applying” are used interchangeably and may mean causing at least partial localization of the composition according to one embodiment to a desired site, or dispensing the composition according to one embodiment into an individual by a route of administration.

[0061] Administration may be carried out by methods known in the art. Methods of administration, such as the route of administration and the frequency of administration, may be appropriately selected by a person skilled in the art. Administration may be administered directly to an individual by any means, for example, via routes such as intravenous, intramuscular, oral, transdermal, mucosal, intranasal, intratracheal, or subcutaneous administration. The administration may be systemic or local. The administration may include application to the skin.

[0062] The dosage may vary depending on factors such as the formulation method, method of administration, patient's age, body weight, gender, pathological condition, food, time of administration, route of administration, and response sensitivity, and a person skilled in the art can appropriately adjust the dosage by considering these factors. The frequency of administration may be once a day or two or more times within the range of clinically acceptable side effects, and the administration site may be one or two or more sites. The total duration of administration may range from 1 to 30 days per treatment, administered daily or at intervals of 2 to 5 days. If necessary, the same treatment may be repeated after the appropriate time. For animals other than humans, the dosage may be the same as that for humans per kg, or an amount calculated by converting the above dosage based on, for example, the ratio of organ (e.g., heart) volumes between the target animal and humans (e.g., average value).

[0063] According to a composition according to one aspect, Nicotiana debenei extract regulates the melanin production pathway by reducing tyrosinase protein expression, thereby exhibiting inhibitory activity on intracellular and extracellular melanin production.

[0064] According to a composition according to one aspect, the Nicotiana debenei extract can be utilized as an active ingredient in a skin whitening composition and a pharmaceutical composition for the prevention or treatment of melanin hyperpigmentation disorders.

[0065] Figure 1 is the result of evaluating the extracellular melanin production inhibitory activity by treatment with Nicotiana devnay extract according to one embodiment on B16F10 cells in which melanin production was promoted by IBMX.

[0066] Figure 2 is the result of evaluating the intracellular melanin production inhibitory activity by treatment with Nicotiana devnay extract according to one embodiment on B16F10 cells in which melanin production was promoted by IBMX.

[0067] Figure 3 shows the results of evaluating the extracellular melanin production inhibitory activity according to the treatment concentration of Nicotiana devnay extract (ND50E) according to one embodiment on B16F10 cells in which melanin production was promoted by IBMX.

[0068] Figure 4 shows the results of evaluating the intracellular melanin production inhibitory activity according to the treatment concentration of Nicotiana devnay extract (ND50E) according to one embodiment on B16F10 cells in which melanin production was promoted by IBMX.

[0069] Figure 5 shows the results of evaluating tyrosinase mRNA levels according to the treatment concentration of Nicotiana devnay extract (ND50E) according to one embodiment using RT-PCR on B16F10 cells in which melanin production was promoted by IBMX.

[0070] Figure 6 is the result of evaluating the expression level of tyrosinase protein according to the treatment concentration of Nicotiana deptane extract (ND50E) according to one embodiment using Western blot on B16F10 cells in which melanin production was promoted by IBMX.

[0071] Figure 7 is the result of quantitatively evaluating the expression level of tyrosinase mRNA or protein according to the treatment concentration of Nicotiana debenei extract (ND50E) according to one embodiment in B16F10 cells in which melanin production was promoted by IBMX.

[0072] Figure 8 is the result of evaluating the cytotoxicity of Nicotiana debenei extract (ND50E) according to one embodiment at different treatment concentrations using an MTT assay.

[0073] Figure 9 shows the results of comparing the extracellular melanin production inhibitory activity between Nicotiana devabnai extract (ND70E) and Nicotiana tabacum ethanol extract according to one embodiment.

[0074] The present invention will be explained in more detail below through examples. However, these examples are intended to illustrate the invention and the scope of the invention is not limited to these examples.

[0075]

[0076] Preparation Example 1. Preparation of Nicotiana debneyi extract

[0077] (1.1) Preparation of Nicotiana debenei samples

[0078] Six sheets of filter paper moistened with distilled water were placed in 15mm Petri dishes, N. debneyi seeds were sown, and germination was carried out for one week. Subsequently, the tobacco seedlings were transplanted into 125-cell plug trays filled with commercial horticultural potting soil (Baroker, Seoul Bio, Chungbuk, Korea) and cultivated under greenhouse conditions for 18 days. Afterward, 20 tobacco seedlings were transplanted into individual plastic pots (12 cm in diameter) filled with commercial horticultural potting soil and cultivated for 27 days in a closed-loop plant production system. The conditions of the closed-loop plant production system were an air temperature of 23±2.3℃, a relative humidity of 40±3%, and a carbon dioxide concentration of 472±0.5μmol·mol. -1, White Light Emitting Diode (LED) PPFD 140μmol·m -2 ·s -1 , the photoperiod was 16 hours of light and 8 hours of darkness. During the cultivation period, the tomato culture solution (electrical conductivity EC 1.2 d·Sm -1 (pH 5.8 ~ 6.0) was supplied via bottom watering every 2 to 3 days. After harvest, the above-ground and underground parts were separated based on the base, and the above-ground parts were dried in a 60℃ dryer for 4 days and then ground.

[0079]

[0080] (1.2) Preparation of Nicotiana Devney extract

[0081] Room temperature immersion extraction was performed on the ground above-ground parts of Nicotiana debenei of Preparation Example (1.1) using ethanol solvents of different concentrations. Specifically, the ground above-ground parts were immersed in 30%, 50%, or 70% (v / v) ethanol at 20 times the volume, and then extracted for 24 hours at 20°C while stirring at 150 rpm. Afterward, the extract was filtered, and the filtrate was concentrated under reduced pressure to obtain the Nicotiana debenei ethanol extract.

[0082]

[0083] Preparation Example 1. Cell Culture and Statistical Analysis

[0084] (1.1) Cell culture

[0085] B16F10 cells (American Type Culture Collection (Manassas, VA, USA)) were cultured in DMEM / F-12 medium containing 10% Fetal bovine serum, 100 U / mL penicillin, and 100 µg / mL streptomycin at 37°C and 5% CO2.

[0086]

[0087] (1.2) Statistical Analysis

[0088] All experimental results were expressed as mean ± standard deviation after three repeated measurements, and the significance between treatments was verified using Student's t-test, with a p-value of less than 0.05 being deemed statistically significant (Microsoft Excel 2010, Microsoft, Redmond, WA, USA). Meanwhile, in the results of Experimental Example 1, "*" indicates a significant difference compared to the control group, and "#" indicates a significant difference compared to the negative control group.

[0089]

[0090] Experimental Example 1. Evaluation of Melanin Production Inhibitory Activity

[0091] In this experimental example, the effect of the Nicotiana debenay extract according to one embodiment on the inhibition of melanin production was confirmed. To evaluate the extracellular melanin production inhibitory activity, 3×10 B16F10 cells were placed in a 6-well plate. 4The cells were dispensed at a density of cells / mL. After 24 hours, the plates were pretreated for 2 hours with ethanol extracts of *Nicotiana devunae* (ND30E, ND50E, ND70E) extracted with different concentrations of ethanol solvent (30%, 50%, or 70% (v / v)). Subsequently, 100 μM of IBMX (isobutylmethylxanthin) was applied to all treatment groups, excluding the control group, to promote the melanogenesis reaction. 48 hours after IBMX treatment, the absorbance of the cell culture medium was measured at 405 nm using a UV / Visible spectrophotometer (Xma-3000PC, Human Corporation Co., Seoul, Korea). In addition, to evaluate the inhibitory activity on intracellular melanogenesis, plates containing B16F10 cells were pretreated with ethanol extracts of *Nicotiana devunae* in the same manner as above, followed by treatment with IBMX. After 48 hours had elapsed since IBMX treatment, 100 μL of 10 mM phosphate buffer (pH 6.8) containing 1% Triton X-100 (Sigma-Aldrich Co.) was added and stirred for 5 minutes, followed by centrifugation to obtain a cell pellet for melanin quantification. Subsequently, 100 μL of 1 N NaOH and 200 μL of distilled water were added to the cell pellet and reacted at 60°C for 1 hour to completely dissolve it. Afterward, the absorbance of the cell pellet was measured at 405 nm using a UV / Visible spectrophotometer (Xma-3000PC, Human Corporation Co., Seoul, Korea). Meanwhile, in this experimental example, the untreated group (CON) was used as the control group, and the group treated only with IBMX (DMSO) was used as the negative control group.

[0092]

[0093] As a result, as shown in Fig. 1, the group treated with only IBMX showed a significantly increased level of extracellular melanin production compared to the control group, whereas the group treated with the ethanol extract of Nicotiana debenei according to one embodiment showed a decreased level of extracellular melanin production. In addition, this extracellular melanin production inhibitory activity was superior in the ethanol extract (ND50E, ND70E) prepared using a high concentration of ethanol solvent. Furthermore, as shown in Fig. 2, the intracellular melanin production level was also significantly increased in the group treated with only IBMX compared to the control group, whereas the group treated with the ethanol extract of Nicotiana debenei according to one embodiment showed a decreased level of intracellular melanin production, and the inhibitory activity of the ethanol extract (ND50E, ND70E) prepared using a high concentration of ethanol solvent was superior.

[0094]

[0095] Experimental Example 2. Evaluation of melanin production inhibitory activity according to treatment concentration of extract

[0096] In this experimental example, the effect of the Nicotiana devnay 50% (v / v) ethanol extract (ND50E) according to one embodiment on the inhibition of melanin production was confirmed while varying the treatment concentration of the said extract. Specifically, the extracellular melanin production inhibitory activity and intracellular melanin production inhibitory activity were evaluated in the same manner as in Experimental Example 1 by treating B16F10 cells with the Nicotiana devnay 50% (v / v) ethanol extract at concentrations of 50 μg / mL, 100 μg / mL, or 200 μg / mL, respectively. Meanwhile, in this experimental example, an untreated group (CON) was used as the control group, and a group treated only with IBMX (DMSO) was used as the negative control group.

[0097]

[0098] As a result, as shown in Figures 3 and 4, the levels of extracellular melanin and intracellular melanin production showed a decreasing trend depending on the treatment concentration of Nicotiana debnei 50% (v / v) ethanol extract.

[0099]

[0100] Experimental Example 3. Evaluation of tyrosinase expression inhibitory activity according to treatment concentration of extract

[0101] In this experimental example, the effect of the Nicotiana devnay 50% (v / v) ethanol extract on the inhibition of tyrosinase expression was confirmed while varying the treatment concentration according to one embodiment. To this end, B16F10 cells were treated with the Nicotiana devnay 50% (v / v) ethanol extract at concentrations of 100 μg / mL or 200 μg / mL, respectively, in the same manner as in Experimental Example 2, and the resulting tyrosinase mRNA or tyrosinase protein levels were evaluated. Tyrosinase mRNA was measured via RT-PCR after cDNA synthesis. Specifically, B16F10 cells were washed twice with 1 × PBS maintained at 4°C, and total RNA was extracted using the RNeasy Mini kit (QIAGEN GmbH., Hilden, Germany). Subsequently, cDNA was synthesized using the Verso cDNA synthesis kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) with 1 µg of total RNA. Then, RT-PCR was performed using the PCR Master Mix Kit (Promega Co., Madison, WI, USA), and the primer information is as shown in Table 1 below.

[0102] PrimerSequence (5'-> 3')SEQ ID NO.Tyrosinase forwardGACGGTCACTGCACACTTTG1Tyrosinase reverseGCCATGACCAGGATGAC2GAPDH forwardACCACAGTCCATGCCATCAC3GAPDH reverseTCCACCACCCTGTTGCTGTA4

[0103]

[0104] In addition, tyrosinase protein was measured via SDS-PAGE and Western blot. Specifically, B16F10 cells were washed twice with 1 × phosphate-buffered saline (PBS) maintained at 4°C, and then proteins were extracted by treating them with radioimmunoprecipitation buffer (Boston Bio Products, Ashland, MA, USA) containing a protease inhibitor cocktail (Sigma-Aldrich Co.) and a phosphatase inhibitor cocktail (Sigma-Aldrich Co.) at 4°C for 30 minutes. The extracted proteins were quantified using a bicinchinoninic acid protein assay (Pierce Biotechnology Inc., Waltham, MA, USA), after which an equal amount of protein was electrophoresed on a 10% SDS-acrylamide gel, transferred to a PVDF membrane (Bio-Rad, Hercules, CA, USA), and blocked with 5% non-fat dry milk at room temperature for 1 hour. After 1 hour, the primary antibody was dissolved in 5% non-fat dry milk and reacted at 4°C for 16 hours, and the membrane was washed three times for 5 minutes with tris-buffered saline (TBS-T) containing 0.05% tween-20. Subsequently, the secondary antibody was dissolved in 5% non-fat dry milk and applied to the membrane at room temperature for 1 hour. After washing three times for 5 minutes with TBS-T, the membrane was analyzed for protein using ECL western blotting substrate (Amersham Biosciences Co., Little Chalfont, England). Meanwhile, in this experimental example, the control group (CON) treated only with IBMX was used.

[0105]

[0106] As a result, as shown in FIGS. 5 to 7, it was confirmed that the group treated with the 50% (v / v) ethanol extract of Nicotiana debnei according to one embodiment did not affect the transcriptional stage of tyrosinase, that is, the tyrosinase mRNA level, but affected the expression of tyrosinase protein at the post-transcriptional or translational level. In other words, this suggests that the ethanol extract of Nicotiana debnei according to one embodiment affects the stability of tyrosinase protein or activates the tyrosinase protein degradation pathway, thereby reducing the protein level of tyrosinase, a key enzyme in the melanin synthesis process, and thereby inhibiting melanin production.

[0107]

[0108] Experimental Example 4. Evaluation of Cytotoxicity

[0109] In this experimental example, the cytotoxicity of the 50% (v / v) ethanol extract of *Nicotiana debenei* according to one embodiment was evaluated using an MTT assay. Specifically, 1×10 B16F10 cells 4 Cells were seeded into a 96-well plate at a rate of cells / well and cultured for 24 hours at 37°C under 5% CO2. Subsequently, 50% (v / v) ethanol extract of *Nicotiana debenay* was added at various concentrations (50 µg / mL, 100 µg / mL, or 200 µg / mL), and cultured for 72 hours at 37°C under 5% CO2. Afterward, 50 µL of MTT solution (1 mg / mL) was added to each well and reacted for 4 hours, after which the supernatant was removed. 100 µL of DMSO was added to each well to dissolve the formazan crystals, and the absorbance was measured at 570 nm using a UV / Visible spectrophotometer (Xma-3000PC, Human Corporation Co., Seoul, Korea). Meanwhile, the untreated group (CON) was used as the control group in this experiment.

[0110]

[0111] As a result, as shown in Figure 8, all groups treated with Nicotiana debenei 50% (v / v) ethanol extract showed cell viability similar to that of the control group, and it was confirmed that there was no cytotoxicity.

[0112]

[0113] Experimental Example 5. Comparison of activity with Nicotiana tabacum extract

[0114] In this experimental example, the extracellular melanin production inhibitory activity was compared between the extract of Nicotiana tabacum, a heterogeneous plant of the same genus, and the extract of Nicotiana debnei according to one embodiment. Specifically, three types of Nicotiana tabacum 70% ethanol extracts and Nicotiana debnei 70% (v / v) ethanol extracts according to one embodiment were prepared in the same manner as in Preparation Example (1.2), and the extracellular melanin production inhibitory activity was measured by treating B16F10 cells with each extract at a concentration of 200 μg / mL in the same manner as in Experimental Example 1. Meanwhile, in this experimental example, an untreated group (CON) was used as the control group, and a group treated only with IBMX (DM) was used as the negative control group.

[0115]

[0116] As a result, as shown in Figure 9, the group treated only with IBMX showed an increased level of extracellular melanin production compared to the control group, whereas the group treated with the 70% (v / v) ethanol extract of Nicotiana debnei according to one embodiment showed a decreased level of extracellular melanin production. In addition, no melanin production inhibitory activity was observed in the group treated with the 70% (v / v) ethanol extract of Nicotiana tabacum, a substance derived from a plant of the same genus; thus, it was found that the melanin production inhibitory activity confirmed in the previous experimental example originated from the inherent characteristics of the Nicotiana debnei plant.

[0117]

[0118] The foregoing description of the present invention is for illustrative purposes only, and those skilled in the art will understand that other specific forms can be easily modified without altering the technical spirit or essential features of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.

Claims

1. A cosmetic composition for skin whitening comprising Nicotiana debneyi extract as an active ingredient.

2. A cosmetic composition according to claim 1, wherein the extract is extracted with a solvent selected from the group consisting of water, alcohols having 1 to 4 carbon atoms, and mixed solvents thereof.

3. A cosmetic composition according to claim 1, wherein the extraction solvent of the extract is 30% (v / v) to 70% (v / v) ethanol.

4. A cosmetic composition according to claim 1, wherein the extract is obtained by one or more methods selected from the group consisting of immersion extraction, hot water extraction, high-frequency extraction, hot water extraction, vacuum high-temperature extraction, reflux extraction, hot water extraction, cold maceration extraction, room temperature extraction, ultrasonic extraction, steam extraction, and fraction extraction.

5. The cosmetic composition of claim 1, wherein the cosmetic composition inhibits tyrosinase expression or inhibits melanin production.

6. A pharmaceutical composition for the prevention or treatment of hypermelanosis of pigmentation comprising Nicotiana debneyi extract as an active ingredient.

7. A pharmaceutical composition according to claim 6, wherein the melanin hyperpigmentation disorder is any one selected from the group consisting of freckle; melasma; chloasma; liver spot; nevus; solar lentigo; melanosis; Peutz-Jeghers syndrome; chloasma gravidarum; hyperpigmentation after drug use; and postinflammatory hyperpigmentation.

8. A health functional food composition for skin whitening containing Nicotiana debneyi extract as an active ingredient.

9. Use of Nicotiana debenei extract for the preparation of a composition for skin whitening or for the prevention or treatment of hypermelanin pigmentation disorders.

10. A skin whitening method comprising the step of administering or applying a composition containing Nicotiana debenei extract as an active ingredient to an individual in need thereof.

11. A method for preventing or treating hypermelanosis of pigmentation, comprising the step of administering a composition containing Nicotiana debenei extract as an active ingredient to an individual in need thereof.

Images