Biomarkers for cancer therapy and uses thereof

Abstract

Disclosed herein are compositions and methods for predicting response to a BET inhibitor based on the expression level of S100A8 and ER stress response genes. Also disclosed are methods of sensitising subjects found to be resistant using one or more of a S100A8 inhibitor, an ER stress inducing agent and / or a c-KIT inhibitor.

Description

[0001] Biomarkers for Cancer Therapy and Uses Thereof

[0002] Technical field

[0003] The present invention relates, in general terms, to biomarkers for predicting drug response, and more specifically to biomarkers for predicting response to BET inhibitors, and uses thereof.

[0004] Background

[0005] Acute myeloid leukemia (AML) is the most common leukemia, accounting for about 80 percent of all adult leukemia cases. The standard of care in AML is the “7+3” chemotherapy regime, comprising a three-day anthracycline infusion followed by continuous seven-day intravenous delivery of cytarabin. Prognosis remains poor for many patients, primarily due to the limited effectiveness of chemotherapy leading to high relapse rates.

[0006] The bromodomain and extra-terminal domain (BET) family of proteins plays a role in epigenetic regulation of gene expression by binding to acetylated histones and other acetylated proteins through the bromodomains and recruiting transcriptional machinery to specific regions of the genome. Pharmacological inhibition of BET protein function is a promising therapeutic strategy for several diseases including cancer, inflammation, autoimmune disorders and cardiovascular disease. For example, pharmacological inhibition of the BET protein BRD4 has been shown to suppress the expression of oncogenes and inhibit progression of several hematological malignancies, including AML. However, it is known that patients exhibit differential sensitivity to BET inhibitors depending on AML subtype, and the underlying resistance mechanisms arc poorly understood. The ability to identify patients who are sensitive to BET inhibitors and to re- sensitise resistant AML subtypes can broadly enhance efficacy of BET inhibitor therapy in AML.

[0007] It would be desirable to overcome or alleviate at least one of the above-described problems, or at least to provide a useful alternative.

[0008] Summary Disclosed herein is a method of predicting the response of a subject to a BET inhibitor, the method comprising detecting the expression of S100A8 in a sample from the subject, wherein an increase in S100A8 expression as compared to a reference indicates that the subject is likely to be resistant to the BET inhibitor.

[0009] Disclosed herein is a method of sensitising a subject to a BET inhibitor, the method comprising administering at least one of a S100A8 inhibitor, an ER stress inducing agent and / or a c-KIT inhibitor to the subject.

[0010] Disclosed herein is a method of treating a subject, the method comprising: (a) detecting the expression of S100A8 in a sample from the subject, wherein an increase in S / 00A8 expression as compared to a reference indicates that the subject is likely to be resistant to a BET inhibitor; and (b) administering a therapeutically effective amount of an anti-cancer therapy to the subject found likely to be resistant to a BET inhibitor, wherein the anti-cancer therapy is not a BET inhibitor.

[0011] Disclosed herein is a method of treating a subject, the method comprising: (a) detecting the expression of SI 00 A8 in a sample from the subject, wherein a decrease in SI 00 A 8 expression as compared to a reference indicates that the subject is likely to respond to a BET inhibitor; and (b) administering a therapeutically effective amount of the BET inhibitor to the subject found likely to respond to the BET inhibitor.

[0012] Disclosed herein is a method of selecting a subject for treatment, the method comprising: (a) detecting the expression of S100A8 in a sample from the subject, wherein an decrease in S100A8 expression as compared to a reference indicates that the subject is likely to respond to the BET inhibitor; and (b) selecting the subject found likely to respond to the BET inhibitor for treatment with the BET inhibitor.

[0013] Disclosed herein is a method of selecting a subject for treatment, the method comprising: (a) detecting the expression of S100A8 in a sample from the subject, wherein an increase in S100A8 expression as compared to a reference indicates that the subject is likely to be resistant to the BET inhibitor; and (b) selecting a subject found likely to be resistant to the BET inhibitor for treatment with a combination of the BET inhibitor and at least one of a S100A8 inhibitor, an ER stress inducing agent and / or a c-KIT inhibitor. Disclosed herein is a method of treating cancer in a subject, the method comprising administering a therapeutically effective amount of a BET inhibitor in combination with at least one of a S100A8 inhibitor, an ER stress inducing agent and / or a c-KIT inhibitor to the subject.

[0014] Disclosed herein is a combination of a BET inhibitor and at least one of a S 100A8 inhibitor, an ER stress inducing agent or a c-KIT inhibitor, for use in treating cancer in a subject, wherein a therapeutically effective amount of the BET inhibitor is administered in combination with the S100A8 inhibitor, ER stress inducing agent and / or c-KIT inhibitor to the subject.

[0015] Disclosed herein is the use of a combination of a BET inhibitor and at least one of a S100A8 inhibitor, an ER stress inducing agent or a c-KIT inhibitor in the manufacture of a medicament for treating cancer in a subject, wherein a therapeutically effective amount of the BET inhibitor is to be administered in combination with the S100A8 inhibitor, ER stress inducing agent and / or c-KIT inhibitor to the subject.

[0016] Brief description of the drawings

[0017] Embodiments of the present invention will now be described, by way of non-limiting example, with reference to the drawings in which:

[0018] Figure 1 (A) shows the generation of JQ-1 resistant cells using a 10-week cycle of alternating 72h treatment with JQ-1 at IC20 and 72h dmg holiday. (B) Dose-response inhibition curves depicting the effect of JQ-1 on naive and JQ-1 -resistant OCI- AML-2, THP- 1 and MOLM-14 cells cultured in varying conditions. Readings were determined by normalising luminescence reading to DMSO using CellTiter-Glo assay after 72h of drug treatment. Data was fitted to four-parameter dose(log) inhibitor analysis and IC50 was determined. (C) Proliferation assay of OCI- AML-2 that are resistant or sensitive to JQ-1 upon treatment with ().5pM of JQ-1. Readings were determined by normalizing luminescence reading to day 0. (D) Immunoblot validating stabilization of S100A8 and S100A9 in JQ-1 -resistant OCI- AML-2 cells. (E) Immunoblot depicting S100A8 and GAPDH expression in naive and JQ-1 -resistant THP-1 cells after cellular thermal shift assay. GAPDH was used as loading control.

[0019] Figure 2 shows (A) Immunoblot depicting higher steady-state protein levels of S 100 protein family in OCI- AML-2 JQ-l-resistant cells. (B) Immunoblot depicting S100A4, S100A8 and S100A9 expression in naive and JQ-l-resistant THP-1 cells. GAPDH was used as loading control. (C) Immunoblot depicting steady state levels of autophagy and pro-survival markers in JQ-l-resistant OCI-AML-2 with S100A8 knockout. (D) Dose-response inhibition curves depicting the effect of JQ-1 on OCI-AML-2 cells that are resistant or sensitive to JQ-1 with or without S100A8 knockout. (E) Dose-response inhibition curves depicting the effect of JQ-1, paquinimod or a combination of the two on OCI- AML-2 cells that are resistant or sensitive to JQ- 1. (F) Immunoblot depicting upregulated cleaved caspase-3 in OCI-AML-2 JQ-l-scnsitivc and S100A8 knockout OCI-AML-2 JQ-1 -resistant line. (G) Immunoblot depicting downregulated pro-survival markers in OCI-AML-2 JQ-1 -sensitive and S100A8 knockout OCI-AML-2 JQ-l-resistant line.

[0020] Figure 3 shows (A) Immunoblot depicting phosphorylation status of CREB 1, STAT3 and STAT1 in JQ-l-resistant OCI-AML-2 cells with er without SI 00 A8 ablation, in the presence or absence of 0.5μM of JQ-1. (B) Dose-response inhibition curves depict the effect of JQ-1 in combination with STAT3 inhibitor, Stattic, on OCI-AML-2 cells that arc resistant to JQ- 1. (C) Immunoblot depicting activation of cKIT amongst other known S100A8-binding receptors. (D) S100A8 ELISA assay showing increased secreted S100A8 in JQ-l-resistant OCI-AML-2 cells. (E) Dose-response inhibition curves depict the effect of bromosporine, a broad spectrum bromodomain inhibitor, on naive and JQ-l-resistant OCI-AML-2 cells with or without S100A8 knockout cultured in MEM-alpha with 10% FBS. Readings were determined by normalising luminescence reading to DMSO using CellTiter-Glo assay after 72 hours of drug treatment. Data was fitted to four-parameter dosc(log) inhibitor analysis and IC50 was determined.

[0021] Figure 4 shows (A) Schematic of two activation routes of CREB1 , by extracellular factors or elevation of intracellular' calcium level. (B) Immunoblot depicting no observable changes in ERK1 / 2 or p38 pathway upon JQ-1 treatment in both resistant and sensitive OCI-AML-2 cells. (C) Schematic of calcium sensors and modulators on activation of calcium-dependent kinases. (D) Immunoblot depicting changes in activation status of calcium-dependent kinases that activate CREB1 in JQ-1 -resistant OCI-AML-2 cells. (E) Immunoblot depicting higher protein levels of calcium sensors and modulators in JQ-1 -resistant OCX- AML-2 cells. (F) Immunoblot depicting higher protein levels of ER stress sensors and (G) Immunoblot depicting expression level changes in ER-stress response genes (PERK, XBP-1S, XBP-1R, p-IREla) and autophagy marker LC3a / b. Expression in naive and JQ-l-resistant THP-1 cells. β-Actin was used as loading control. (H) ER stress effectors in JQ-l-resistant OCI- AML-2 cells. (I) Immunoblot depicting changes in histone acetylation patterns in JQ-l- resistant OCI-AML-2 cells.

[0022] Figure 5 shows (A) Dose-response inhibition curves depict the effect of JQ-1 on 10 primary AML patient lines. More sensitive lines are A1044 and A1400 PB. (B) Normalised SI 00 A8 protein expression with increasing JQ-1 concentration. Lighter line depicts normalised S100A8 protein expression at 52°C. Darker line depicts normalised S100A8 protein expression at 37°C. (C) Survival analyses of AML patients with high S100A8-A9 dimers, SRI, CAMKII or CHOP. (D) Kaplan-Meier plot of NSG mice with OCI-AML-2 naive cells, OCI-AML-2 JQ-l -resistant cells and OCI-AML-2 JQ-l -resistant cells with S100A8 KO with or without JQ-1 treatment (n = 4 per group), showing significantly improvement in survival upon S100A8 knockout in JQ-l-resistant OCI-AML-2 cells.

[0023] Figure 6 is a schematic of a proposed mechanism driving JQ-1 resistance in AML.

[0024] Figure 7 shows (A) Dose-response inhibition curves depicting the effect of JQ-1 on OCI- AML-2 cells that are resistant or sensitive to JQ-1 with or without S100A9 knockout. (B) Dose-response inhibition curves depict the effect of cytarabine on OCI-AML-2 cells that are resistant or sensitive to JQ-1 with or without S100A8 knockout.

[0025] Figure 8 shows an immunoblot depicting activation of Src and JAK1 / 2 in JQ-1 -resistant OCI-AML-2 cells that may be affected by S100A8 knockout.

[0026] Figure 9 shows dose-response inhibition curves depicting the effect of thapsigargin on OCI- AML-2 cells that are resistant or sensitive to JQ-1 with or without S100A8 knockout.

[0027] Detailed description

[0028] BET family proteins are important transcriptional regulators. The two bromodomains at the N-terminus of BET proteins (BD1 and BD2) bind to acetylated histones, while a C-terminal extraterminal (ET) domain recruits transcriptional cofactors to promote gene transcription. The BET protein BRD4 is uniquely enriched at super-enhancer sites in the genome, where it facilitates chromatin remodelling and drives transcription of various oncogenes and inflammatory mediators. Targeting BRD4 can thus disrupt super-enhancer-driven oncogene activation.

[0029] JQ1 is a BRD4 inhibitor which has shown promising preclinical results for treating various types of cancers, including hematological malignancies. JQ1 is known to induce apoptosis by increasing ER stress and ER-mediated calcium release. The inventors discovered that ER stress signatures are constitutively activated in JQl-resistant cells, and cell adaptation to elevated ER stress may be rendering JQ1 treatment ineffective.

[0030] Using mass spectrometry cellular thermal shift assay (MS-CETSA), it was found that S100A8, a member of the S100 protein family, is stabilised in acute myeloid leukemia (AML) cells that are resistant to JQ1. S100A8 levels were also found to be constitutively upregulated in JQl-resistant cells. Without being bound by theory, upregulation of S100A8 may be driven by constitutively active ER stress and calcium signaling in the resistant cells. Elevated levels of secreted S1OOA8 / A8 or S100A8 / A9 dimers then mediate JQ1 resistance by interacting with the c-KIT receptor to activate anti-apoptotic and pro-survival signatures. It was found that ablation of S100A8 re-sensitises JQl-resistant cells to the BET inhibitor, possibly through inactivation of c-KTT signalling.

[0031] Accordingly, this disclosure provides compositions and methods for predicting response to BET inhibitors using S100A8, ER stress response genes and / or proteins involved in S100A8 signalling as biomarkers. Also provided arc methods of treatment and methods for patient stratification based on biomarker level, and methods for overcoming resistance to BET inhibitors by treatment with a S100A8 inhibitor, ER stress inducing agent and / or c-KIT inhibitor.

[0032] Disclosed herein is a method of predicting the response of a subject to a BET inhibitor, the method comprising detecting the expression of S 100A8 in a sample from the subject. In one embodiment, an increase in S 100A8 expression as compared to a reference indicates that the subject is likely to be resistant to the BET inhibitor. In one embodiment, a decrease in S100A8 expression as compared to a reference indicates that the subject is likely to respond to the BET inhibitor.

[0033] Disclosed herein is a method of sensitising a subject to a BET inhibitor, the method comprising administering at least one of a S100A8 inhibitor, an ER stress inducing agent or a c-KIT inhibitor to the subject.

[0034] General definitions

[0035] The terms “resistant” and “resistance” refers to a lack of response or a sub-normal response (of a cell, tissue or organism) to a drug. Resistance may be intrinsic (i.e., present prior to drug exposure) or acquired (i.e., developing during or following drug exposure).

[0036] As used herein, the term “subject” includes any animal, including mammals. Mammals include, but are not limited to, farm animals (such as, for example, horse, cow, pig), companion animals (such as, for example, dog, cat), laboratory animals (such as, for example, mouse, rat, rabbits), and non-human primates (such as, for example, apes and monkeys). In one embodiment, the subject is a human. In one embodiment, the subject is a patient under the care of a physician.

[0037] The term “sample” herein is used in its broadest sense. In one sense, it is meant to include a specimen or culture obtained from any source, including both biological and environmental sources. A “biological sample” includes within its scope a collection of similar fluids, cells, or tissues isolated from a biological source, such as a whole organism or in vitro culture. Samples include but are not limited to tissue biopsies, tissue resections, tissue aspirates, swabs (c.g., buccal swabs), whole blood, plasma, scrum, urine, saliva, cerebrospinal fluid, and cell cultures, and may be obtained using any suitable method known in the art. Archival tissues, such as those having treatment or outcome history may also be used for sample extraction. The sample may be pooled from multiple aliquots. Samples include untreated, treated, diluted and concentrated samples.

[0038] A “biological fluid” herein includes, but is not limited to, intravascular fluid (e.g., blood, plasma, scrum, lymph), urine, saliva, sputum, cerebrospinal fluid, pleural fluid, fluid of the respiratory, intestinal, and genitourinary tracts, synovial fluid, vaginal secretion, tear fluid, pus, breast milk, semen, fluid from ascites, cyst or tumour, amniotic fluid, or combinations thereof.

[0039] The terms “increased” and “increase” are used herein to mean an increase by a statistically significant amount. In some embodiments, the terms “increased” and “increase” can mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, at least about a 3-fold, at least about a 4-fold, at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level.

[0040] The terms “decreased” and “decrease” are used herein to mean a decrease by a statistically significant amount. In some embodiments, the terms “decreased” and “decrease” can mean a decrease of at least 10% as compared to a reference level, for example a decrease of at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or up to and including a 100% decrease or any decrease between 10-100% as compared to a reference level.

[0041] As used herein, the terms “nucleic acid”, “nucleic acid molecule”, “nucleic acid sequence”, “polynucleotide”, or “oligonucleotide” can comprise a polymeric form of nucleotides of any length, can comprise DNA and / or RNA, and can be single-stranded, double-stranded, or multiple stranded. One strand of a nucleic acid also refers to its complement.

[0042] The terms “polypeptide”, “proteinaceous molecule”, “peptide” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues and to variants and synthetic analogues of the same. Thus, these terms apply to amino acid polymers in which one or more amino acid residues is a synthetic non-naturally-occurring amino acid, such as a chemical analogue of a corresponding naturally-occurring amino acid, as well as to naturally-occurring amino acid polymers. These terms do not exclude modifications, for example, glycosylations, acetylations, phosphorylations and the like. Soluble forms of the subject proteinaceous molecules are particularly useful. Included within the definition are, for example, polypeptides containing one or more analogues of an amino acid including, for example, unnatural amino acids or polypeptides with substituted linkages.

[0043] As used herein “sequence identity” refers to the number (or fraction expressed as a percentage %) of identical or similar amino acids or nucleotide bases in a comparison between a test and a reference polypeptide or polynucleotide. Sequence identity can be determined by sequence alignment of nucleic acid or protein sequences to identify regions of similarity or identity. For purposes herein, sequence identity is generally determined by alignment to identify identical residues. Alignment can be local or global, but for purposes herein alignment is generally a global alignment where the full-length of each sequence is compared. Matches, mismatches and gaps can be identified between compared sequences. Gaps arc null amino acids or nucleotides inserted between the residues of aligned sequences so that identical or similar characters are aligned. Generally, there can be internal and terminal gaps. Sequence identity can be determined by taking into account gaps as the number of identical residues / length of the shortest sequencexlOO. When using gap penalties, sequence identity can be determined with no penalty for end gaps (e.g., terminal gaps are not penalised). Alternatively, sequence identity can be determined without taking into account gaps as the number of identical positions / length of the total aligned sequencexlOO.

[0044] Alignment for purposes of determining percent amino acid or nucleotide sequence identity can be achieved in various ways that are known to those skilled in the art, for instance, using publicly available computer software available on internet web sites such as http: / / blast.ncbi.nlm.nih.gov / or http: / / ww'w. ebi.ac.uk / Tools / emboss / ). Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

[0045] As used herein “sequence variation” generally refers to differences in residues (such as nucleotide or amino acid residues) between two or more nucleic acid or polypeptide sequences under comparison. Such differences may be expressed as a fraction or a percentage of the number of residues in the compared sequences. Sequence variations herein include nucleotide and amino acid substitutions, insertions, deletions and sequence inversions, and may be naturally-occurring or engineered. Contemplated sequence var iations arc those which do not substantially affect a biological activity of a nucleic acid or polypeptide as defined in this disclosure. For example, in the case of polypeptides, the sequence variations may be conservative amino acid substitutions and / or are located in segments of the polypeptide which do not contain the following: an active site, an allosteric site, a chelating site, a site for protein modification (e.g., a phosphorylation, acetylation, glycosylation or cleavage site), a site for intramolecular interaction (e.g., a site of a disulphide or other covalent or non-covalent bond), a binding site for a receptor, ligand, antigen, nucleic acid, protein, lipid, ion or metabolite, a site for an intermolecular covalent or non-covalent interaction, or a multimerisation site (including a dimerisation site). A skilled person can identify appropriate segments and sites which minimally affect a biological activity of a polypeptide using, for example, structural or homology data available for the polypeptide.

[0046] The term “inhibit” is used consistently with its use in the art, i.c., meaning to cause or facilitate a reduction in the expression or activity of a gene or protein. The inhibition may be, for example, a decrease in levels or activity by at least 5% as compared to a reference level (e.g., the level or activity in a cell not treated with the inhibitor). The decrease may be, for example, a decrease of at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or up to and including a 100% decrease or any decrease between 5% to 100% as compared to a reference level.

[0047] As used herein, the terms “sensitise” or “sensitising” means making a subject more susceptible to a treatment. The sensitisation may be performed prior to, concurrent with or subsequent to the treatment.

[0048] The terms “treating”, “treatment” and the like include relieving, reducing, alleviating, ameliorating or otherwise inhibiting the effects of a disease for at least a period of time. It is also to be understood that terms “treating”, “treatment” and the like do not imply that the disease, or a symptom thereof, is permanently relieved, reduced, alleviated, ameliorated or otherwise inhibited and therefore also encompasses the temporary relief, reduction, alleviation, amelioration or otherwise inhibition of the disease, or of a symptom thereof. As used herein a “therapeutically effective amount” or “effective amount” is an amount that is non-toxic to the subject and sufficient to effect desired outcomes in a subject (i.e., achieve therapeutic efficacy). For purposes of this disclosure, a therapeutically effective amount of an inhibitor, drug or composition is an amount that is sufficient to palliate, ameliorate, stabilise, reverse, prevent, slow or delay the progression of a disease state. A therapeutically effective amount can be administered in one or more administrations.

[0049] Two or more therapeutic agents administered “in combination” means that the two or more agents are administered either simultaneously, or sequentially in any order at different points in time. If not administered simultaneously, then the two or more agents are administered to an individual sufficiently close in time so that the agents can act in concert to provide a desired therapeutic effect. Therapeutic agents administered “in combination” may be in a single composition or formulation, or may be in separate compositions or formulations, and may be administered by any suitable route.

[0050] As used herein, “and / or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (or).

[0051] As used in this application, the singular form “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “an agent” includes a plurality of agents, including mixtures thereof.

[0052] Throughout this specification and the claims which follow, unless the context requires otherwise, the word “comprise”, and variations such as “comprises” and “comprising”, will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

[0053] Throughout this specification and the claims which follow, unless the context requires otherwise, the phrase “consisting essentially of’, and variations such as “consists essentially of” will be understood to indicate that the recited element(s) is / are essential i.e. necessary elements of the invention. The phrase allows for the presence of other non-recited elements which do not materially affect the characteristics of the invention but excludes additional unspecified elements which would affect the basic and novel characteristics of the method defined.

[0054] Biomarker detection

[0055] This disclosure provides biomarkers indicative of likely response to BET inhibitors, and methods of using the biomarkers to predict drug resistance, select patients for treatment, and to guide therapeutic intervention. Methods herein generally involve detecting expression of S 100A8, ER stress response genes and / or proteins involved in S 100A8 signalling in a sample from a subject, and predicting likely response based on changes in gene expression relative to a reference.

[0056] Disclosed herein is a method of predicting the response of a subject to a BET inhibitor, the method comprising detecting the expression of one or more genes selected from S100A8 or an ER stress response gene in a sample from the subject. Tn one embodiment, an increase in the expression of the one or more genes as compared to a reference indicates that the subject is likely to be resistant to the BET inhibitor. In one embodiment, a decrease in the expression of the one or more genes as compared to a reference indicates that the subject is likely to respond to the BET inhibitor.

[0057] The ER stress response gene may be ATF4, ATF6, KIT, RSK1, RSK2, CAMK2A, PRKACA, PRKCB, STIM1 , SRI, XBP1 or CHOP. Thus, in some embodiments, the method comprises detecting the expression of one or more genes selected from S100A8, ATF4, ATF6, KIT, RSK1, RSK2, CAMK2A, PRKACA, PRKCB, STIM1, SRI, XBP1 and CHOP to determine the likelihood of resistance or response.

[0058] In one embodiment, the method comprises detecting the expression of SI 00A8 to determine the likelihood of resistance or response to the BET inhibitor. In one embodiment, the method comprises detecting the expression of S100A8 and at least one ER stress response gene (such as ATF4,ATF6, KIT, RSK1, RSK2, CAMK2A, PRKACA, PRKCB, STIM1, SRI, XBP1 and / or CHOP) to determine the likelihood of resistance or response.

[0059] Tabic 1 provides a list of possible combinations of biomarkers. Table 1 - Possible combinations of the panel of proteins Sequences for genes and expression products herein may be accessed on known databases of genome, transcriptome or proteome information, such as the GenBank or RefSeq databases maintained by the National Center for Biotechnology Information (NCBI), USA, or the Uniprot database maintained by the European Bioinformatics Institute (EMBL-EBI).

[0060] The following are exemplifications of the human genes, as identified by their NCBI GenelD identifiers:

[0061] Human S100 calcium binding protein A8 (S100A8): GenelD 6279

[0062] Human activating transcription factor 4 (ATF4): GenelD 468

[0063] Human activating transcription factor 6 (ATF6): GenelD 22926

[0064] Human KIT proto-oncogene, receptor tyrosine kinase {KIT)'. GenelD 3815

[0065] Human ribosomal protein S6 kinase Al (RPS6KA1 or RSK1): GenelD 6195

[0066] Human ribosomal protein S6 kinase A3 (RPS6KA3 or RSK2): GenelD 6197

[0067] Human calcium dependent protein kinase 2 alpha (CAMK2A): GenelD 815

[0068] Human protein kinase cAMP-activated catalytic subunit alpha (PRKACA): GenelD 5566

[0069] Human protein kinase C beta (PRKCB): GenelD 5579

[0070] Human stromal interaction molecule 1 (STIM1): GenelD 6786

[0071] Human sorcin (SRI): GenelD 6717

[0072] Human calmodulin 1 (CALM J): GenelD 801

[0073] Human X-box binding protein 1 (XBP1): GenelD 7494

[0074] Human DNA damage inducible transcript 3 (DDIT3 or CHOP): GenelD 1649

[0075] The S100A8 protein of the present disclosure is exemplified by, but is not limited to, the protein with Uniprot accession number P05109. S100A8 is also known as myeloid-related protein 8 (MRP8) or calgranulin A.

[0076] In some embodiments, the subject is suffering from a disease or condition where inhibition of BET provides abenefit. Such diseases and conditions include but are not limited to cancer, autoimmune disease, inflammatory diseases and cardiovascular diseases.

[0077] In one embodiment, the subject is suffering from cancer. The cancer may be one that is responsive to BET inhibitor therapy. Examples of such cancers include but are not limited to hematological cancers (c.g., lymphomas and leukemias), breast cancer (c.g., triple- negative breast cancer), prostate cancer (e.g., castration-resistant prostate cancer), lung cancer (e.g., small cell lung cancer, non-small cell lung cancer), brain cancer (e.g., glioblastoma multiforme, medulloblastoma), colon cancer, ovarian cancer, neuroblastoma and NUT midline carcinoma.

[0078] In some embodiments, the cancer is a hematological cancer, such as non-Hodgkin’s lymphoma, Hodgkin’s lymphoma, follicular lymphoma, Burkitt’s lymphoma, activated B cell diffuse large B cell lymphoma, high grade B cell lymphoma, anaplastic large cell lymphoma, acute myeloid leukemia, B cell acute lymphoblastic leukemia, pro-myelocytic leukemia or multiple myeloma.

[0079] In one embodiment, the subject is suffering from a cancer selected from acute myeloid leukemia (AML), multiple myeloma, diffuse large B-cell lymphoma (DLBCL), glioblastoma and prostate cancer. In one embodiment, the cancer is acute myeloid leukemia (AML). In one embodiment, the cancer is AML characterised by a FLT3 internal tandem duplication (FLT3-TTD) mutation and / or a p53 mutation.

[0080] In one embodiment, the one or more biomarkers are detected in a cancer sample from the subject. The sample may be a biopsy sample from a tumour or cancerous tissue. In one embodiment, the sample is a biological fluid, e.g., from a liquid biopsy.

[0081] In some embodiments, the method comprises detecting an RNA product of a biomarker gene as defined herein. In other embodiments, the method comprises detecting a polypeptide product of a biomarker gene as defined herein. The polypeptide product may be an intracellular, membrane -bound or secreted polypeptide. In one embodiment, the method comprises detecting S100A8 / S100A9 dimer.

[0082] Methods of detecting expression products such as RNA and proteins are well known to a person skilled in the art. Exemplary nucleic acid detection methods include blotting techniques (e.g., Northern blots), probe hybridisation-based methods, nucleic acid amplification-based methods and nucleic acid sequencing. Exemplary protein detection methods include gel electrophoresis (e.g., 2D electrophoresis), Western blotting, immunoassays, aptamer-based detection assays, protein activity assays and mass spectrometry. The expression level of a biomarker may be compared to a reference to determine changes in expression (such as overexpression or downregulation). In one embodiment, the reference is the gene expression level in a healthy tissue (i.e., a tissue without cancer or a disease that requires BET inhibitor therapy) from the same subject. In one embodiment, the reference is the population-average gene expression level in a group of subjects of the same species (e.g., of varying ages, ethnic backgrounds and genders) without cancer or a disease requiring BET inhibitor therapy. In one embodiment, the reference is the gene expression level in a tissue known to be responsive to the BET inhibitor. In one embodiment, the reference is the population-average gene expression level in tissues from a group of subjects of the same species known to be responsive to the BET inhibitor. The reference values can be stored in a database and used as a reference in subsequent analyses.

[0083] The measured expression level of a gene may first be normalised before comparison with a reference. Normalisation can be used to control for unwanted biological variation. In a non- limiting example, biological variation can result from some feature of the patient or the sample collection that is not relevant to the methods of the present disclosure, such as variations created by collecting samples at different times of the day and variations due to patient age or patient gender.

[0084] Normalisation can be performed using methods known in the art. In a non-limiting example, normalisation can be achieved by dividing the measured expression level of a gene disclosed herein by a reference gene. Useful reference genes are genes that show a low variation in their expression level across a variety of different samples and patients. For example, a useful reference gene will show the same expression level in subjects who are responsive to the BET inhibitor and in subjects who are not responsive to the BET inhibitor. Variation in expression level of a reference gene can be quantified by methods known in the art. For example, the variation can be quantified by calculating the coefficient of variation in the expression level of a particular gene across a set of different samples.

[0085] Disclosed herein is a kit for predicting the response of a subject to a BET inhibitor, comprising reagents for detecting in a sample from the subject the expression of one or more genes selected from SI00A8, ATF4,ATF6, KIT, RSK1.RSK2, CAMK2A, PRKACA, PRKCB, STIM1, SRI, CALM1, XBP1 and CHOP. Disclosed herein is the use of reagents for detecting in a sample from a subject the expression of one or more genes selected from S100A8, ATF4, ATF6, KIT, RSK1, RSK2, CAMK2A, PRKACA, PRKCB, STIM1, SRI, CALM1, KBP1 and CHOP, in the manufacture of a kit for predicting the response of the subject to a BET inhibitor.

[0086] In some embodiments the kit comprises oligonucleotides probes or primers that hybridise to an mRNA product of the one or more biomarker genes of this disclosure. The design of hybridisation probes and primers are well-known in the art. Software from Thermo Fisher, Integrated DNA Technologies, GenScript and LCG Biosearch Technologies have been developed for this purpose. The oligonucleotides may be labelled for detectable. Suitable labels for oligonucleotide detection are well known in the art and include, for example, fluorescent, chemiluminescent and radioactive labels.

[0087] In some embodiments the kit comprises antigen-binding molecules that bind specifically to a polypeptide product of one or more biomarker genes of this disclosure. The antigen- binding molecules may be, for example, aptamers, antibodies or antigen-binding fragments thereof that are capable of binding to a polypeptide product of the one or more genes. The antigen-binding molecules may contain a detectable label for detection. Detectable labels may include radioactive, fluorescent, chemiluminescent or colorimetric compounds or dyes, nanoparticles such as colloidal gold or semiconductor nanocrystals (e.g., quantum dots), and enzyme labels. Examples of suitable enzymes include, but are not limited to, horseradish peroxidase (HRP), alkaline phosphatase (AP), P-galactosidase, acetylcholinesterase and catalase. Useful substrates for enzyme-based detection are well known in the art and may be selected based on the level of detection required and the detection instrumentation used, e.g., spectrophotometer, fluorometer or luminometer.

[0088] Provided herein is a composition for predicting the response of a subject to a BET inhibitor. The composition may comprise an antigen-binding molecule (such as an antibody) or antigen-binding fragment thereof that binds specifically to a polypeptide product of one or more biomarker genes of this disclosure, and a sample obtained from a subject. The antigen- binding molecule or fragment thereof may be conjugated to a detectable label (such as an enzyme or fluorescent label). Provided herein is also a method for preparing a composition for predicting the response of a subject to a BET inhibitor. The sample may be mixed with the antigen-binding molecule to obtain the composition. For example, a cancer sample may be mixed with a labelled antibody that binds to S 100A8 to obtain a composition as described herein.

[0089] BET inhibitors

[0090] As used herein, a “BET inhibitor” refers to any compound that inhibits the expression and / or activity of one or more proteins in the bromodomain and extra-terminal domain (BET) family of proteins. The BET inhibitor may be a nucleic acid (such as a small interfering RNA, antisense oligonucleotide or inhibitory aptamer), polypeptide (including but not limited to peptide antagonist, antibody, enzyme, and functional fragments thereof), small molecule, proteolysis targeting chimera (PROTAC), or a combination thereof. The inhibitor may disrupt a gene, or an RNA product thereof, encoding a BET protein; modify a gene encoding a BET protein to reduce its expression or reduce the activity of the protein; disrupt normal post-transcriptional processing (e.g., splicing, translation) of RNA encoding a BET protein; promote degradation of a BET protein; and / or prevent interaction of a BET protein with an interaction partner (such as a protein or nucleic acid).

[0091] In some embodiments, the BET inhibitor inhibits one or more BET proteins selected from BRD2, BRD3, BRD4, and BRDT. The BET inhibitor may inhibit the BD1 and / or BD2 bromodomains of the BET protein. In one embodiment, the BET inhibitor is a BRD4 inhibitor. The inhibitor may be a selective or non-selective BRD4 inhibitor.

[0092] In some embodiments, the BET inhibitor is a small molecule, such as (but not limited to) JQ1, OTX-015, i-BET762, CPI-0610, ZEN-3694, NHWD-870, BMS-986158 (ezobresib), BMS-986378, INCB057643, R06870810 (TEN-010), FT-1101, MK-8628, PLX-2853, CC- 90010, GSK525762, MS436, olinonc, GSK789, RVX-208, ABBV-744, ABBV-075 (mivebresib), SJ432 and BY27.

[0093] In one embodiment, the BET inhibitor is selected from JQ1 , CPI-0610, BMS-986158, ABBV-075, FT-1101, GSK525762, and R0680810. In one embodiment, the BET inhibitor is JQ1.

[0094] In some embodiments, the BET inhibitor is a proteolysis targeting chimera (PROTAC). The PROTAC may comprise a BET binding moiety conjugated to an E3 ubiquitin ligase binding moiety, to target BET proteins for ubiquitination and proteasomal degradation. The PROTAC may comprise a small molecule inhibitor as described above as the BET binding moiety (such as JQ1, OTX-015, i-BET762, CPI-0610, ZEN-3694, NHWD-870, BMS- 986158, BMS-986378, INCB057643, R06870810, FT-1101, MK-8628, PLX-2853, CC- 90010, GSK525762, MS436, olinone, GSK789, RVX-208, ABBV-744, ABBV-075, SJ432 or BY27). The E3 ligase binding moiety in the PROTAC may bind to, for example, cereblon (CRBN), von Hippel-Lindau (VHL), IAP, MDM2, KEAP1, DCAF15, DCAF16, RNF4, RNF114, or AhR E3 ligase. Exemplary' PROTACs include but are not limited to dBETl, dBET6, ARV-771, ARV-825, MZ1, ATI and QCA570.

[0095] In one embodiment, the BET inhibitor comprises or consists of IQ1, CPI-0610, BMS- 986158, ABBV-075, FT-1101, GSK525762, or R0680810. In one embodiment, the BET inhibitor is a PROTAC comprising JQ1, CPI-0610, BMS-986158, ABBV-075, FT-1 101 , GSK525762, or R0680810. In one embodiment, the BET inhibitor is a PROTAC comprising JQ1.

[0096] Patient stratification and treatment

[0097] Methods herein may be used to guide therapeutic intervention for cancer or to guide BET inhibitor therapy. For example, a patient found likely to be resistant to a BET inhibitor may be administered an alternative therapy or administered a combination therapy that sensitises to the BET inhibitor, as described in this disclosure.

[0098] In some embodiments of the methods herein, an increase in expression of the one or more biomarkers as compared to the reference indicates that the subject is likely to be resistant to the BET inhibitor.

[0099] The increase in gene expression that is indicative of likely resistance to the BET inhibitor may be an increase of at least 10% relative to the reference. For example, the likelihood of resistance to the BET inhibitor may be indicated by an increase in gene expression of one or more of S100A8, ATF4, ATF6, KIT, RSK1, RSK2, CAMK2A, PRKACA, PRKCB, STIM1, SRI, XBP1 and CHOP that is about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 2-fold, about 3-fold, about 4-fold, about 5-fold, or more than 5-fold above the reference. In one embodiment, an increase in SI 00A8 expression of at least about 25% relative to the reference indicates likely resistance to the BET inhibitor.

[0100] In some embodiments, a decrease in expression of the one or more biomarkers as compared to the reference indicates that the subject is likely to respond to the BET inhibitor.

[0101] The decrease in gene expression that is indicative of likely response to the BET inhibitor may be a decrease of at least 10% relative to the reference. For example, a subject may be considered likely to respond to the BET inhibitor when there is a decrease in expression of one or more of S100A8, ATF4, ATF6, KIT, RSK1, RSK2, CAMK2A, PRKACA, PRKCB, STIM1, SRI, XBP1 and CHOP that is about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% as compared to the reference.

[0102] Disclosed herein is a method of treating a subject, the method comprising: (a) detecting the expression of one or more genes selected from S100A8, ATF4, ATF6, KIT, RSK1, RSK2, CAMK2A, PRKACA, PRKCB, ST1M1, SRI, XBP1 and CHOP in a sample from the subject, wherein an increase in the expression of the one or more genes as compared to a reference indicates that the subject is likely to be resistant to a BET inhibitor; and (b) administering a therapeutically effective amount of an anti-cancer therapy to the subject found likely to be resistant to a BET inhibitor, wherein the anti-cancer therapy is not the BET inhibitor. In some embodiments, the subject found likely to be resistant to the BET inhibitor is administered a BET inhibitor combination therapy as described herein.

[0103] Disclosed herein is a method of treating a subject, the method comprising: (a) detecting the expression of one or more genes selected from S100A8, ATF4, ATF6, KIT, RSK1, RSK2, CAMK2A, PRKACA, PRKCB, STIM1, SRI, XBP1 and CHOP in a sample from the subject, wherein a decrease in the expression of the one or more genes as compared to a reference indicates that the subject is likely to respond to a BET inhibitor; and (b) administering a therapeutically effective amount of the BET inhibitor to the subject found likely to respond to the BET inhibitor. Also disclosed herein is a method of selecting a subject for treatment, the method comprising: (a) detecting the expression of one or more genes selected from S100A8,ATF4, ATF6, KIT, RSK1, RSK2, CAMK2A, PRKACA, PRKCB, STIM1, SRI, XBPJ and CHOP in a sample from the subject, wherein a decrease in the expression of the one or more genes as compared to a reference indicates that the subject is likely to respond to the BET inhibitor; and (b) selecting a subject found likely to respond to the BET inhibitor for treatment with the BET inhibitor.

[0104] Disclosed herein is a method of selecting a subject for treatment, the method comprising: (a) detecting the expression of S100A8 in a sample from the subject, wherein an increase in S100A8 expression as compared to a reference indicates that the subject is likely to be resistant to the BET inhibitor; and (b) selecting a subject found likely to be resistant to the BET inhibitor for treatment with a combination of the BET inhibitor and at least one of a S100A8 inhibitor, an ER stress inducing agent or a c-KIT inhibitor. In some embodiments, a subject found likely to be resistant to the BET inhibitor is administered an alternative anti- cancer therapy that is not a BET inhibitor therapy.

[0105] Suitable alternative anti-cancer therapies include but are not limited to chemotherapeutic agents and other anti-proliferative therapies, such as surgery, radiotherapy, endocrine therapy, a cytokine therapy (e.g., using an interferon, interleukin, or tumor necrosis factor (TNF)), hyperthermia and cryotherapy, and any other approved chemotherapeutic drug. Examples of chemotherapeutic agents include but are not limited to aromatase inhibitors; anti-estrogens; anti- androgens; topoisomerase I inhibitors; topoisomerase II inhibitors; microtubule active agents; alkylating agents; retinoids, carotenoids, tocopherols; cyclooxygenase inhibitors; MMP inhibitors; mTOR inhibitors; antimetabolites; platin compounds; methionine aminopeptidase inhibitors; bisphosphonates; heparanase inhibitors; inhibitors of Ras oncogenic isoforms; telomerase inhibitors; HD AC inhibitors, proteasome inhibitors; FLT-3 inhibitors; MCL1 inhibitors, BCL2 inhibitors, PI3K / AKT / mT0R inhibitors, Hsp90 inhibitors; kinesin spindle protein inhibitors; MEK inhibitors; nitrosoureas; compounds targeting / decreasing protein or lipid kinase activity; compounds targeting / decreasing protein or lipid phosphatase activity; and anti- angiogenic compounds.

[0106] In one embodiment, a subject found likely to be resistant to BET inhibitor is administered an anti-cancer therapy selected from a BCL2 inhibitor, a MCL1 inhibitor, a HD AC inhibitor, a FLT3-inhibitor, an MEK inhibitor, a PI3K / AKT / mT0R inhibitor (e.g., idelalisib, everolinius, dactolisib), or a combination thereof.

[0107] The BCL2 family proteins are anti-apoptotic proteins frequently overexpressed in haematological malignancies. Exemplary BCL2 inhibitors include but are not limited to venetoclax (ABT- 199), which selectively targets BCL2, as well as broader spectrum inhibitors such as navitoclax (ABT-263) and obatoclax mesylate (GX15-070) that targets BCL2, BCL-XL, and BCL-W. MCL1 is a member of the BCL2 family. Exemplary' MCL1 inhibitors include but are not limited to S64315 (MIK665), S63845, tapotoclax (AMG 176), AZD5991, and GS-9716.

[0108] Exemplary MEK inhibitors include but arc not limited to trametinib, sclumctinib, cobimetinib, and binimetinib.

[0109] Inhibitors of the PT3K / AKT / mTOR pathway include, for example, idelalisib, alpelisib and copanlisib (PI3K inhibitors), capivasertib, ipatasertib and afuresertib (AKT inhibitors), everolimus, temsirolimus, ridaforolimus and sapanisertib (mTOR inhibitors), and dactolisib and omipalisib (PI3K / mT0R inhibitors).

[0110] Inhibitors of histone deacetylases (HDAC) include, for example, vorinostat (SAHA), romidepsin (FK228), belinostat (PXD101), panobinostat (LBH589), entinostat (SNDX- 275), tucidinostat (HBI-8000) and pracinostat (SB939).

[0111] Mutations in the FLT3 receptor tyrosine kinase, such as internal tandem duplications (ITD), are common in AML and other haematological malignancies, and are associated with a poor prognosis. Exemplary FLT3 inhibitors include midostaurin, giltcritinib, quizartinib, and crenolanib.

[0112] Combination therapies

[0113] This disclosure also provides pharmaceutical compositions and combination therapies for overcoming resistance to BET inhibitors. Without being bound by theory, constitutively active ER stress response pathways may prime JQl-resistant cells against drug-induced stress by upregulating expression of S 100A8. S100A8-mediated activation of cKIT in turn induces receptor dimerisation and downstream activation of STAT3, leading to enhanced expression of anti-apoptotic proteins that favour cancer cell survival. Disrupting the ER stress-S100A8-cKIT-STAT3 signalling axis (Figure 6) thus provides multiple intervention points for overcoming BET inhibitor resistance.

[0114] S100A8 inhibitors may work at the gene, RNA or protein level to prevent the protein from activating downstream cKIT signalling. ER stress inducing agents such as thapsigargin and tunicamycin may be used to overwhelm the adaptive ER stress response in resistant cells. cKIT inhibitors such as pazopanib can block receptor kinase activity and prevent STAT3 activation. STAT3 inhibitors like Stattic can disrupt the transcriptional program driving anti- apoptosis. Therapies that incorporate any combination of ER stress inducing agents, S100A8 inhibitors, c-KIT inhibitors and / or STAT3 inhibitors may be used to sensitise resistant cells to BET inhibitor therapy. Targeting multiple nodes in the signalling axis can potentially prevent the development of new resistance mechanisms.

[0115] Disclosed herein is a method of sensitising a subject to a BET inhibitor, the method comprising administering at least one of a S100A8 inhibitor, an ER stress inducing agent or a c-KIT inhibitor to the subject. In one embodiment, the BET inhibitor is administered to the subject in combination with the S100A8 inhibitor, ER stress inducing agent and / or c-KIT inhibitor.

[0116] The subject may be suffering from cancer (such as AML, multiple myeloma, DLBCL, glioblastoma or prostate cancer) or a disease or condition where inhibition of BET provides a benefit (such as an autoimmune disease, inflammatory disease or cardiovascular disease).

[0117] Disclosed herein is a method of treating cancer or a disease or condition where inhibition of BET provides a benefit in a subject, the method comprising administering a therapeutically effective amount of a BET inhibitor in combination with at least one of a S100A8 inhibitor, an ER stress inducing agent or a c-KIT inhibitor to the subject.

[0118] Disclosed herein is a combination of a BET inhibitor and at least one of a S 100A8 inhibitor, an ER stress inducing agent or a c-KIT inhibitor, for use in treating cancer or a disease or condition where inhibition of BET provides a benefit in a subject, wherein a therapeutically effective amount of the BET inhibitor is to be administered in combination with the S100A8 inhibitor, ER stress inducing agent and / or c-KTT inhibitor to the subject.

[0119] Disclosed herein is the use of a combination of a BET inhibitor and at least one of a S100A8 inhibitor, an ER stress inducing agent or a c-KIT inhibitor in the manufacture of a medicament for treating cancer or a disease or condition where inhibition of BET provides a benefit in a subject, wherein a therapeutically effect amount of the BET inhibitor is to be administered in combination with the S100A8 inhibitor, ER stress inducing agent and / or c- K1T inhibitor to the subject.

[0120] The subject may be resistant or found likely to be resistant to the BET inhibitor. In one embodiment, the subject is found likely to be resistant by a method as described in this disclosure, such as by detecting an increase in expression in S100A8 and / or one or more ER stress response genes selected from ATF4, ATF6, KIT, RSK1 , RSK2, CAMK2A, PRKACA, PRKCB, STIM1, SRI, XBP1 and CHOP in a sample from the subject.

[0121] Disclosed herein is a method of treating a subject, the method comprising: (a) detecting the expression of S100A8 in a sample from the subject, wherein an increase in SJ00A8 expression as compared to a reference indicates that the subject is likely to be resistant to a BET inhibitor; and (b) administering a therapeutically effective amount of the BET inhibitor in combination with at least one of a S100A8 inhibitor, an ER stress inducing agent or a c- KET inhibitor to the subject found likely to be resistant to the BET inhibitor.

[0122] The S100A8 inhibitor may inhibit expression of S100A8 or a signaling activity of S100A8. The inhibitor may, for example, interfere with transcription of the S100A8 gene, translation of S100A8 mRNA, dimerization of S100A8 protein with a binding partner (such as S100A8 or S100A9), or interaction of S100A8 protein or dimer with its receptor (e.g., c-KIT).

[0123] In some embodiments, the S100A8 inhibitor is a nucleic acid, site-specific nuclease (SSN) system, polypeptide or small molecule.

[0124] In some embodiments, the S100A8 inhibitor is capable of disrupting a gene, or an RNA product thereof, encoding S100A8. In one embodiment, the S100A8 inhibitor is capable of modifying a gene encoding S100A8 to reduce its expression. The S100A8 inhibitor may comprise a site-specific nuclease (SSN) targeting a gene encoding S100A8, or an RNA product of the gene.

[0125] In one embodiment, the S100A8 inhibitor comprises an inhibitory nucleic acid molecule. Examples of inhibitory nucleic acid molecules include, but are not limited to, antisense nucleic acid molecules, small interfering RNAs (siRNAs), and short hairpin RNAs (shRNAs). Such inhibitory nucleic acid molecules can be designed to target any region of a S100A8-encoding nucleic acid molecule, such as an mRNA molecule encoding S100A8.

[0126] In some embodiments, the antisense RNA, siRNA, or shRNA hybridises to a sequence within a genomic nucleic acid molecule or mRNA molecule encoding S 100A8 and decreases expression of S100A8 in a cell in the subject. In some embodiments, the S100A8 inhibitor comprises an antisense RNA molecule comprising a nucleic acid sequence that hybridises to a complementary sequence in a genomic nucleic acid molecule or mRNA molecule encoding S100A8, and decreases expression of S100A8 in a cell in the subject. In some embodiments, the S100A8 inhibitor comprises an siRNA molecule comprising a nucleic acid sequence that hybridises to a complementary sequence in a genomic nucleic acid molecule or mRNA molecule encoding S100A8, and decreases expression of S100A8 in a cell in the subject. In some embodiments, the S100A8 inhibitor comprises an shRNA molecule comprising a nucleic acid sequence that hybridises to a complementary sequence in a genomic nucleic acid molecule or mRNA molecule encoding S100A8, and decreases expression of S100A8 in a cell in the subject.

[0127] The gene, mRNA or cDNA sequence of S100A8 may be used to design a nucleic acid inhibitor according to methods known in the art. For example, S100A8 mRNA or cDNA sequence can be used to design a nucleic acid inhibitor or a silencing RNAi modulator or antisense molecule which inhibits S100A8 for use in the methods disclosed herein.

[0128] Nucleic acid inhibitors according to the present disclosure may comprise or consist of DNA and / or RNA. Nucleic acid inhibitors may be single-stranded (e.g., in the case of antisense oligonucleotides). Nucleic acid inhibitors may be double- stranded or may comprise double- stranded regions (e.g., in the case of siRNA, shRNA, etc.). Inhibitory nucleic acids may comprise both double-stranded and single stranded regions (e.g. in the case of shRNA and pre-miRNA molecules, which are double-stranded in the stem region of the hairpin structure, and single-stranded in the loop region of the hairpin structure).

[0129] As used herein, an “antisense nucleic acid” refers to a nucleic acid molecule (e.g., DNA or RNA) which is complementary to at least a portion of a target nucleotide sequence (e.g., of RNA encoding a target gene described herein). Antisense nucleic acids according to the present disclosure are preferably single-stranded nucleic acids, and bind via complementary Watson-Crick base-pairing to a target nucleotide sequence. Complementary base-pairing may involve hydrogen bonding between complementary base pairs. Antisense nucleic acids may be provided as single-stranded molecules, as for example in the case of antisense oligonucleotides, or may be comprised in double- stranded molecular' species, as for example in the case of siRNA, shRNA and prc-miRNA molecules.

[0130] Complementary base-pairing between the antisense nucleic acid and its target nucleotide sequence may be complete. Tn such embodiments the antisense nucleic acid comprises, or consists of, the reverse complement of its target nucleotide sequence, and complementary base-pairing occurs between each nucleotide of the target nucleotide sequence and complementary nucleotides in the antisense nucleic acid. Alternatively, complementary base-pairing between the antisense nucleic acid and its target nucleotide sequence may be incomplete / partial. In such embodiments complementary base-pairing occurs between some, but not all, nucleotides of the target nucleotide sequence and complementary nucleotides in the antisense nucleic acid.

[0131] Such binding between nucleic acids through complementary base pairing may be referred to as “hybridisation”. Through binding to its target nucleotide sequence, an antisense nucleic acid may form a nucleic acid complex comprising (i) the antisense nucleic acid and (ii) a target nucleic acid comprising the target nucleotide sequence.

[0132] The nucleotide sequence of an antisense nucleic acid is sufficiently complementary to its target nucleotide sequence such that it binds or hybridises to the tar get nucleotide sequence. It will be appreciated that an antisense nucleic acid preferably has a high degree of sequence identity to the reverse complement of its target nucleotide sequence. In some embodiments, the antisense nucleic acid comprises or consists of a nucleotide sequence having at least 75% sequence identity (e.g., one of at least 75%>, 76%;, 77%, 78%>, 79%;, 80%, 81%, 82%;, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to the reverse complement of its target nucleotide sequence.

[0133] In some embodiments, the nucleic acid inhibitor is an antisense oligonucleotide (ASO). ASOs are single-stranded nucleic acid molecules comprising or consisting of an antisense nucleic acid to a target nucleotide sequence. An antisense oligonucleotide according to the present disclosure may comprise or consist of an antisense nucleic acid as described herein.

[0134] ASOs can modify expression of RNA molecules comprising then- target nucleotide sequence by altering splicing, or by recruiting RNase H to degrade RNA comprising the target nucleotide sequence. RNase H recognises nucleic acid complex molecules formed when the ASO binds to RNA comprising its target nucleotide sequence. ASOs according to the present disclosure may comprise or consist of an antisense nucleic acid according to the present disclosure. ASOs may comprise 10 to 40 (e.g., 17 to 30, 20 to 27, 21 to 23) nucleotides in length. Many ASOs are designed as chimeras, comprising a mix of bases with different chemistries, or as gapmers, comprising a central DNA portion surrounded by “wings” of modified nucleotides. ASOs sometimes comprise alterations to the sugar-phosphate backbone in order to increase their stability and / or reduce / prevent RNAse H degradation, such as phosphorothioatc linkages, phosphorodiamidatc linkages such as phosphorodiamidate morpholino linkages (PMOs), and may comprise, e.g., peptide nucleic acids (PNAs), locked nucleic acids (LNAs), methoxyethyl nucleotide modifications, e.g. 2’- O-methyl (2’-0Me) and 2’-O-methoxyethyl (MOE) ribose modifications and / or 5’- methylcytosine modifications.

[0135] The nucleic acid inhibitor may be an RNA interference (RNAi) agent (e.g., siRNA, shRNA or miRNA-bascd shRNA), or a nucleic acid encoding an RNAi agent that reduces expression of a gene / mRNA.

[0136] The term “RNAi agent” or “RNAi” as used interchangeably herein, refers to an agent that contains RNA, and which mediates the targeted cleavage of an RNA transcript via an RNA- induced silencing complex (RISC) pathway. The RNAi agent directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). The RNAi agent modulates, e.g., inhibits, the expression of a gene in a cell, e.g., a cell within a subject, such as a mammalian subject. The term “RNAi agent” includes both shRNAs, or precursor RNAs that are processed by RISC into siRNAs, as well as the siRNAs themselves that inhibits the expression of an endogenous gene.

[0137] In some embodiments, each strand of the RNAi agent may range from 12-30 nucleotides in length. For example, each strand may be between 14-30 nucleotides in length, 17-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 17-23 nucleotides in length, 17-21 nucleotides in length, 17-19 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length.

[0138] In some embodiments, the inhibitory nucleic acid is a small interfering RNA (siRNA). As used herein, “siRNA” refers to a double- stranded RNA molecule having a length between 17 to 30 base pairs, which is capable of engaging the RNA interference (RNAi) pathway for the targeted degradation of target RNA. Double- stranded siRNA molecules may be formed as a nucleic acid complex of RNA strands having a high degree of complementarity. The strand of the double-stranded siRNA molecule having complementarity to a target nucleotide sequence may be referred to as the antisense strand or the guide strand, and the other strand may be referred to as the sense strand or passenger strand.

[0139] In some embodiments, the guide or antisense strand of an siRNA according to the present disclosure may comprise or consist of an antisense nucleic acid as described herein.

[0140] The sense strand and antisense strand typically form a duplex double stranded RNA (“dsRNA”). The duplex region of an RNAi agent may be 12-30 nucleotide pairs in length. For example, the duplex region can be between 14-30 nucleotide pairs in length, 17-30 nucleotide pairs in length, 27-30 nucleotide pairs in length, 17-23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17-19 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19-21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length. In another example, the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.

[0141] The RNAi agent may contain one or more overhang regions and / or capping groups at the 3’- end, 5’-end, or both ends of one or both strands e.g., comprising one or two or three nucleotides (e.g. a UU 3’ overhang, a TT 3’ overhang, or a CCA 5’ overhang). The overhang can be 1-6 nucleotides in length, for instance 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1 -4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence. The first and second strands can also be joined, e.g., by additional bases to form a hairpin, or by other non-base linkers.

[0142] In some embodiments, a passenger strand of an siRNA according to the present disclosure may comprise a ‘CCA’ modification at the 5’ end, i.c., the addition of nucleotides ‘CCA’. In some embodiments, a passenger strand of an siRNA according to the present disclosure may comprise a ‘TT’ modification at the 3’ end, e.g., replacing the 3’ two nucleotides.

[0143] In some embodiments an siRNA according to the present disclosure may be contained within a longer shRNA sequence that undergoes processing to form the siRNA.

[0144] In some embodiments, the inhibitory nucleic acid is a dicer small interfering RNA (dsiRNA). As used herein, “dsiRNA” refers to a double- stranded RNA molecule having a length of about 27 base pairs, which is processed by Dicer to siRNA for RNAi-mediated degradation of target RNA. DsiRNAs are described e.g. in Raja et al., Asian J Pharm Sci. (2019) 14(5): 497-510, which is hereby incorporated by reference in their entirety.

[0145] DsiRNAs are optimised for Dicer processing and may have increased potency compared with 21-mcr siRNAs (sec e.g. Kim ct al., Nat Biotcchnol. (2005) 23(2):222-226), which may be related to the link between Dicer-mediated nuclease activity and RISC loading.

[0146] In some embodiments, the inhibitory nucleic acid is a micro RNA (miRNA), or a precursor thereof (e.g., a primiRNA or a pre-miRNA). miRNA molecules have a similar structure to siRNA molecules, but are encoded endogenously, and derived from processing of short hairpin RNA molecules. They are initially expressed as long primary transcripts (pri- miRNAs), which arc processed within the nucleus into 60 to 70 nucleotide hairpins (pre- miRNAs), which are further processed in the cytoplasm into smaller species that interact with RISC and target mRNA. miRNAs comprise “seed sequences” that are essential for binding to target mRNA. Seed sequences usually comprise six nucleotides and are situated at positions 2 to 7 at the miRNA 5’ end.

[0147] In some embodiments, the inhibitory nucleic acid is a short hairpin RNA (shRNA). shRNA molecules comprise sequences of nucleotides having a high degree of complementarity that associate with one another through complementary base pairing to form the stem region of the hairpin. The sequences of nucleotides having a high degree of complementarity may be linked by one or more nucleotides that form the loop region of the hairpin. shRNA molecules may be processed (e.g., via catalytic cleavage by DICER) to form siRNA or miRNA molecules. shRNA molecules may have a length of between 35-100 (e.g., 40-70) nucleotides. The stem region of the hairpin may have a length between 17-30 (e.g., 20-27) base pairs. The stem region may comprise G:U pairings to stabilise the hairpin structure. An shRNA sequence described herein may comprise sequences that will be subsequently processed into shorter siRNA strand(s). siRNA, dsiRNA, miRNAs and shRNAs for the targeted inhibition of gene and / or protein expression of S 100A8 may be identified / designed in accordance with principles and / or using tools well known to the skilled person, such as siRNA Wizard (InvivoGen). Details for making such molecules can be found in the websites of commercial vendors such as Ambion, Dharmacon, GenScript, Tnvitrogen and OligoEngine.

[0148] By way of example only, an siRNA inhibitor of S100A8 may contain the following sequences:

[0149] Sense: 5’ CCAGGAGUUCCUCAUUCUG 3’ (SEQ ID NO: 13) Antisense: 5’ CAGAAUGAGGAACUCCUGG 3’ (SEQ ID NO: 14)

[0150] In some embodiments, the inhibitor of S100A8 is a site-specific nuclease (SSN) system. SSN systems generally comprise a sequence- specific nuclease that recognises a target nucleic acid sequence. The sequence- specific nuclease may be, for example, a wild-type, engineered or chimeric nuclease. The SSN system may target a gene, or RNA product thereof, encoding S100A8. The SSN system may further comprise a donor template nucleic acid molecule for introducing specific sequence modifications at or adjacent to the target nucleic acid sequence. The term “donor template nucleic acid”, as used herein, refers to a nucleic acid molecule that can be used by one or more cellular proteins to modify the sequence of a target nucleic acid after a sequence- specific nuclease described herein has altered the target nucleic acid. In some embodiments, the donor template nucleic acid is a double-stranded nucleic acid molecule. In some embodiments, the donor template nucleic acid is a single- stranded nucleic acid molecule. In some embodiments, the donor template nucleic acid is linear molecule. In some embodiments, the donor template nucleic acid is circular (e.g., a plasmid). In some embodiments, the donor template nucleic acid is an exogenous nucleic acid molecule. In some embodiments, the donor template nucleic acid is an endogenous nucleic acid molecule (e.g., a chromosome). In some embodiments the donor template is a DNA molecule. In some embodiments, the donor template is an RNA molecule.

[0151] In some embodiments the SSN system is capable of disrupting a gene encoding S100A8 by modifying the nucleic acid sequence of the gene. Such modifications may include inserting, deleting or substituting one or more nucleic acid residues in the gene. The SSN system may comprise a donor template nucleic acid for introducing the nucleotide modification. In some embodiments, the SSN system is capable of disrupting a gene encoding S100A8 by nucleotide insertion or deletion.

[0152] SSNs capable of being engineered to generate target nucleic acid sequence-specific double- or single-strand breaks include zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and clustered regularly interspaced palindromic repeats / CRISPR-associated nuclease (CRISPR / Cas) systems.

[0153] In some embodiments the SSN system is a ZFN system, a TALEN system, or a CRISPR / Cas system (such as a CRISPR / Cas9 system, CRISPR / Cas 12 system or CRISPR / Cas 13 system).

[0154] CRISPR / Cas systems may include a Cas nuclease and a guide RNA (gRNA) with a guide sequence complementary to a target nucleic acid sequence (e.g., a gene sequence encoding S 100A8). The CRISPR / Cas system may additionally comprise a donor template nucleic acid for introducing specific sequence modifications at or adjacent to the target nucleic acid sequence. The CRISPR / Cas system may comprise a plurality of gRNAs and / or donor templates. In one embodiment the SSN system is a CRISPR / Cas9 system. The CRISPR / Cas9 system may comprise a gRNA, and the gRNA may comprise a CRISPR RNA (crRNA) containing the guide sequence. The gRNA may also comprise a trans -activating crRNA (tracrRNA) for processing the crRNA to its mature form. Alternatively, the gRNA may be an engineered construct comprising both the crRNA and tracRNA in a single nucleic acid molecule (i.e., a single guide RNA or sgRNA).

[0155] In one embodiment the SSN system is a CRISPR / Casl2 system, such as a CRISPR / Casl2a (also known as CRISPR / Cpfll) or CRISPR / Casl2b (also known as CRISPR / C2cl) system. In such an embodiment, the CRISPR / Cas system may comprise a single gRNA molecule containing the guide sequence.

[0156] The inventors have found that the following gRNAs can be used with CRISPR / Cas9 systems to knockout S100A8 in cell lines: sgRNA 1: 5’ CGAGTGTCCTCAGTATATCA 3’ (SEQ ID NO: 15) sgRNA 2: 5’ AGAAAAAGGGTGCAGACGTC 3’ (SEQ ID NO: 16) sgRNA 3: 5’ GAATTTCCATGCCGTCTACA 3’ (SEQ ID NO: 17)

[0157] Disclosed herein is a nucleic acid inhibitor of S100A8, wherein the nucleic acid inhibitor comprises, encodes or binds to a sequence selected from a nucleic acid sequence having at least 70% sequence identity (such as about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% sequence identity) to a nucleic acid sequence selected from SEQ ID NO: 13—17, or a complementary sequence thereof.

[0158] In some embodiments, the S100A8 inhibitor is a peptide or polypeptide. The peptide or polypeptide inhibitor may bind to and inhibit dimerization of S100A8 or inhibit interaction of S100A8 or a S100A8 dimer with a receptor (c.g., c-KIT).

[0159] Suitable peptides and polypeptides include but are not limited to peptide aptamers, antibodies, single chain antibodies, Fabs, nanobodies, minibodies, diabodies, and various antibody mimics such as adnectins, affibodies, affilins, affimers, affitins, alphabodies, armadillo repeat protein-based scaffolds, avimers, andcalins, DARPins, fynomers, knotting, Kunitz domain-based scaffolds and monobodies. The peptide / polypeptide inhibitors may be referred to as inhibitory peptides / polypeptides.

[0160] In one embodiment, the S100A8 inhibitor is a small molecule. As used herein, a “small molecule” refers to an organic compound with a low molecular weight, typically less than 1000 daltons, such as between 200 and 800 daltons. The small molecule inhibitor may bind to and inhibit dimerization of S100A8 or inhibit interaction of S100A8 or a S100A8 dimer with a receptor (e.g., c-K.1T).

[0161] In some embodiments, the small molecule inhibitor is ABR-238901 or paquinimod (ABR 215757).

[0162] Suitable nucleic acid, polypeptide and small molecule inhibitors can be identified by screening of relevant nucleic acid, polypeptide and small molecule libraries. Candidate compounds can be screened for their ability to inhibit downstream signalling of S100A8, e.g., for their ability inhibit signalling through the C-KIT-STAT3 axis.

[0163] Exemplary ER stress inducing agents for use in methods herein include but are not limited to thapsigargin, tunicamycin, brcfcldin A, and protcasomc inhibitors (such as bortczomib and carfilzomib). In some embodiments, the ER stress inducing agent is thapsigargin or tunicamycin.

[0164] Exemplary c-KIT inhibitors for use in methods herein include imatinib (Gleevac), sunitinib (Sutent), nilotinib (Tasigna), dasatinib (Sprycel), midostaurin (Rydapet), avapritinib (Ayvakit), ripretinib (Qinlock), pazopanib, pexidartinib, masitinib, dovitinib, labuxtinib, tclatinib, flumatinib, ccdiranib, scralutinib, vimscltinib, vatalanib, apatinib, famitinib, cediranib, tandutinib, sutetinib, henatinib, chiauranib and sorafenib. In some embodiments, the c-KIT inhibitor is pazopanib, pexidartinib, imatinib, masitinib or dovitinib.

[0165] Disclosed herein is a pharmaceutical combination comprising a BET inhibitor and one or more of a S100A8 inhibitor, an ER stress inducing agent or a c-KIT inhibitor. In one embodiment, the pharmaceutical combination comprises a BET inhibitor and a S100A8 inhibitor (such as a nucleic acid inhibitor of S100A8). In one embodiment, the pharmaceutical combination comprises a BET inhibitor and an ER stress inducing agent (such as thapsigargin or tunicamycin). In one embodiment, the pharmaceutical combination comprises a BET inhibitor and a c-KIT inhibitor (such as pazopanib, pexidartinib, imatinib, masitinib or dovitinib). In one embodiment, the pharmaceutical combination comprises a BET inhibitor, a S100A8 inhibitor and an ER stress inducing agent. In one embodiment, the pharmaceutical combination comprises a BET inhibitor, a S100A8 inhibitor, an ER stress inducing agent and a c-KIT inhibitor.

[0166] Disclosed herein is a kit comprising a BET inhibitor and one or more of a S 100A8 inhibitor, an ER stress inducing agent or a c-KIT inhibitor. In one embodiment, the kit comprises a BET inhibitor and a S100A8 inhibitor (such as a nucleic acid inhibitor of S100A8). In one embodiment, the kit comprises a BET inhibitor and an ER stress inducing agent (such as thapsigargin or tunicamycin). In one embodiment, the kit comprises a BET inhibitor and a c-KIT inhibitor (such as pazopanib, pexidartinib, imatinib, masitinib or dovitinib). In one embodiment, the kit comprises a BET inhibitor, a S100A8 inhibitor and an ER stress inducing agent. In one embodiment, the kit comprises a BET inhibitor, a S100A8 inhibitor, an ER stress inducing agent and a c-KIT inhibitor.

[0167] Disclosed herein is the use of a BET inhibitor and one or more of a S100A8 inhibitor, an ER stress inducing agent or a c-KIT inhibitor in the manufacture of a pharmaceutical combination or kit for treating cancer or a disease or condition where inhibition of BET provides a benefit in a subject, wherein a therapeutically effect amount of the BET inhibitor is to be administered in combination with the S100A8 inhibitor, ER stress inducing agent and / or c-KIT inhibitor to the subject.

[0168] In one embodiment, methods herein comprise administering a BET inhibitor in combination with a S100A8 inhibitor to sensitise the subject to the BET inhibitor. In one embodiment, the S100A8 inhibitor is a nucleic acid inhibitor of S100A8. In one embodiment, the nucleic acid inhibitor comprises, encodes or binds to a sequence selected from a nucleic acid sequence having at least 70% sequence identity (such as about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% sequence identity) to a nucleic acid sequence selected from SEQ ID NO: 13-17, or a complementary sequence thereof.

[0169] In one embodiment, methods herein comprise administering a BET inhibitor in combination with an ER stress inducing agent to sensitise the subject to the BET inhibitor. In one embodiment, the ER stress inducing agent is thapsigargin or tunicamycin.

[0170] In one embodiment, methods herein comprise administering a BET inhibitor in combination with a c-KIT inhibitor to sensitise the subject to the BET inhibitor. In one embodiment, the c-KIT inhibitor is pazopanib, pexidartinib, imatinib, masitinib or dovitinib.

[0171] In one embodiment, methods herein comprise administering a BET inhibitor in combination with a S100A8 inhibitor (such as a nucleic acid inhibitor or S100A8) and an ER stress inducing agent (such as thapsigargin or tunicamycin) to sensitise the subject to the BET inhibitor.

[0172] In one embodiment, methods herein comprise administering a BET inhibitor in combination with a S100A8 inhibitor (such as a nucleic acid inhibitor or S100A8), an ER stress inducing agent (such as thapsigargin or tunicamycin) and a c-KIT inhibitor (such as pazopanib, pexidartinib, imatinib, masitinib or dovitinib) to sensitise the subject to the BET inhibitor.

[0173] In some embodiments, methods herein further comprise administering one or more S100A8 signaling pathway inhibitors, such as a STAT3 inhibitor. Exemplary STAT3 inhibitors include but are not limited to Stattic, cryptotanshinone, WP1066, STA-21, S31-201, napabucasin and niclosamide. In other embodiments, chemotherapeutic agents or other anti- proliferative therapies can be combined with combination therapies herein to treat proliferative diseases and cancer.

[0174] The administration of the combination of a BET inhibitor and one more partner drugs of this disclosure (such as a S100A8 inhibitor, ER stress inducing agent or c-KIT inhibitor) may result not only in overcoming resistance to the BET inhibitor, but also in further beneficial effects, e.g., an additive or synergistic therapeutic effect, for instance, with regard to treating, preventing or delaying the progression of cancer, autoimmune disease, inflammatory diseases or cardiovascular diseases. Additional beneficial effects may include fewer side effects, an improved quality of life or a decreased morbidity, compared with a monotherapy applying only the BET inhibitor or only the partner drugs. In one embodiment, the combination of a BET inhibitor and one more partner drugs of this disclosure (such as a S 100A8 inhibitor, ER stress inducing agent or c-KIT inhibitor) provides an additive effect in cancer treatment. In one embodiment, the combination of a BET inhibitor and one more partner drugs of this disclosure (such as a S 100A8 inhibitor, ER stress inducing agent or c-KIT inhibitor) provides a synergistic effect in cancer treatment.

[0175] Methods according to the invention may comprise: (i) administration of a BET inhibitor in free or pharmaceutically acceptable salt form; and (ii) administration of one or more partner drags in free or pharmaceutically acceptable salt form, simultaneously or sequentially in any order, in jointly therapeutically effective amounts, preferably in synergistically effective amounts, e.g., in daily or intermittent dosages corresponding to the predetermined amounts. The individual combination partners of the combination of the invention may be administered separately at different times during the course of therapy or concurrently in divided or single combination forms. Furthermore, the term administering also encompasses the use of a pro-drag of a combination partner that converts in vivo to the combination partner as such. The present invention is therefore to be understood as embracing all such regimens of simultaneous, sequential or alternating treatment and the term “administering” is to be interpreted accordingly.

[0176] As such it will be appreciated that the combination partners may be presented as a “kit of parts” for use in the treatment of a disease (e.g., in cancer therapy). The kit may comprise a package where the combination partners are supplied separately for co-administration with instructions for use in the particular therapy.

[0177] The effective dosage of each of the combination partners employed in the combination of the invention may vary depending on the particular compound or pharmaceutical composition employed, the mode of administration, the condition being treated and the severity of the condition being treated. Thus, the dosage regimen of a combination of this disclosure is selected in accordance with a variety of factors including the route of administration and the condition of the patient. A physician of ordinary skill can readily determine and prescribe the effective amount of the single active ingredients required to alleviate, counter or arrest the progress of the condition. The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.

[0178] Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications, which fall within the spirit and scope. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.

[0179] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0180] Certain embodiments of the invention will now be described with reference to the following examples which arc intended for the purpose of illustration only and arc not intended to limit the scope of the generality hereinbefore described.

[0181] EXAMPLES

[0182] Materials and Methods

[0183] Cell Lines and Culture Conditions

[0184] OCI-AML-2 (DMSZ cat. #ACC-99) were obtained from ATCC. Media and supplements used were obtained from Gibco unless stated otherwise. OCLAML-2 and CLAML-2-JQ1R (JQ1 resistant cells) were cultured in MEM-alpha supplemented with 20% (v / v) foetal bovine serum. L-glutamine, MEM non-essential amino acid, penicillin-streptomycin and sodium pyruvate were supplemented where necessary at 1 % (v / v). All cells were maintained within a humidified incubator at 37C with 5% CO2. JQ1 resistance was induced by exposing OCI-AML-2-JQ1R cells to 50 nM of JQ1 once per week. Sensitivity to JQ1 was assessed every two weeks to ensure a five-fold difference of IC50 between OCI-AML-2 and 0CI-AML-2-JQ1R. sgRNA CRISPR-Cas9 mediated gene editing sgRNA sequences for S100A8 and S100A9 were obtained from Broad Institute Genetic Perturbation Platform (Table 1). S100A8 sgRNA sequences were cloned into LentiCRISPRv2GFP lentiviral plasmid (Addgene plasmid #82416; RRID: Addgene_82416), whereas S100A9 sgRNA sequences were cloned into TLCV2 lentiviral plasmid (Addgene plasmid #87360; RRID: Addgene_87360).

[0185] Fu Gene (Promega #E5 91 1) was used for transfection of HEK293T cells to generate lentivirus. Viral supernatants were harvested 24 h post-transfection and filtered using 0.45 pm filters. Following infection of OCI-AML-.TQ1R cells with LentiCRISPRv2GFP lentiviral plasmid, cells were sorted for GFP expression to generate S100A8 CRISPR knockout lines. For OCI-AML-JQ1R infected with TLCV2 lentiviral plasmid, cells were selected using puromycin (1 pg / ml) for 7 days, followed by induction of Cas9 with doxycycline (1 pg / ml) and sorted for GFP expression to obtain S100A9 CRISPR knockout cell lines.

[0186] Table 1: sgRNA sequences used for CRISPR mediated knockout

[0187] Inhibitors

[0188] All compounds used in the study were obtained from MedChemExpress and reconstituted with DMSO to obtain a stock concentration of 10 mM and stored at -20°C. Working concentration were achieved with dilution using DMSO. Compounds used in the study were JQ1 (#HY-13030) and Stattic (#HY-13818).

[0189] Dose-response curve

[0190] Cells were seeded into 96- well Greiner flat-bottomed white plate with a density of 1,000 cells per well. Serial dilution was performed with respective inhibitors to obtained varying concentration and incubated with cells for 72 h. DMSO was used as a negative control. For combinatory' treatment, serial dilution was performed with JQ1, followed by addition of selected inhibitors at a fixed concentration of IC20 and incubated with cells for 72 h. DMSO was used as a negative control. Quantification of cell viability was performed with CellTiter- Glo Luminescent Cell Viability Assay (Promega #G7573). Dose-response curve was generated with GraphPad Prism and respective sensitivity were calculated.

[0191] Cell proliferation assay

[0192] Cells were seeded into 96- well Greiner flat-bottomed white plate with a density of 1,000 cells per well and incubated with 1 pM of JQ1. DMSO was used as a negative control. Quantification of growth rate was performed at 3 h interval for the first 24 h, followed by every 24 h up to 96 h with CcllTitcr-Glo Luminescent Cell Viability Assay (Promega #G7573). Dose-response curve was generated with GraphPad Prism.

[0193] Drug treatment with JQ1

[0194] Cells were seeded with a density of 1 x 106cells a day prior to drug treatment. Subsequently cells were treated with 1 u M JQ1 and collected at respective timepoints. DMSO serve as negative control. Cells were washed once with phosphate buffered saline (PBS) and pelleted for storage at -80°C prior to further experiment.

[0195] Western blotting

[0196] Cells were lysed using RIPA buffer (Pierce™ #89901) supplemented with protease and phosphatase inhibitor cocktail (Halt™ #78446) followed by low frequency sonication. Cell debris were subsequently removed via centrifugation. Concentration of lysates was quantified using Bradford protein assay kit (Pierce™ #23200). 5 μg of lysate were prepared with 4x loading dye (NuPAGE™ #NP0008) and 1 Ox sample reducing agent (NuPAGE™ #NP0009). Samples were boiled at 96°C for six minutes and resolved with 4-12% SDS- PAGE (NuPAGE™ #NP0322BOX). Proteins were transferred onto nitrocellulose membrane and blocked for 1 h with 5% bovine serum albumin (BSA) dissolved in Tris- buffered saline supplemented with 0.1 % Tween-20 (TBST) at room temperature, followed by overnight incubation with primary antibodies of interest (1 : 1000) (Table 2) at 4°C. Following removal of primary antibodies, membranes were incubated for 1 h with HRP- linked secondary antibodies (1:5000) (Table 3) at room temperature. Immunolabelled proteins were visualised with West Dura Extended Duration Substrate (SuperSignal™ #34076) and captured with ChcmiDoc MP Imaging System (Bio-Rad). Membranes were stripped gently for 20 minutes with stripping buffer at room temperature and washed thoroughly with TBST prior to re-blocking with 5% BSA for 1 h at room temperature. Membranes were incubated overnight with primary antibodies of interest (1 :1000) at 4°C.

[0197] Table 2: Primary antibodies used for western blotting Table 3: Secondary antibodies used for western blotting

[0198] RNA extraction and RNA sequencing

[0199] Extraction of total RNA was performed using TRizol® Reagent and chloroform, followed by RNeasy MiniElute Cleanup Kit (Qiagen #74204) according to manufacturer's instructions. Total RNA extracted was used for library preparation with TruSeq Stranded RNA Library Prep Kit (Illumina), according to manufacturer's instructions. Sequencing was carried out via Illumina Standard HiSeq 4000 System with paired-end 151 basepair read. Relative gene expression level was filtered according to a log2 fold-change. A p-value of less than 0.05 were defined as statistically significant.

[0200] Statistical analysis and reproducibility

[0201] All densitometry analysis in the study were performed using Image.1. All statistical analysis in the study were performed using GraphPad Prism. Data were presented as mean with standard error of the mean. Analysis between groups were analysed using one-way ANOVA with Tukey's post-hoc test. Two-tailed unpaired student's t-test with Welch's correction was performed to compare differences between two individual groups. A p-valuc of less than 0.05 were defined as statistically significant, of which indicated as follows: ns: not significant, *: p < 0.05, **: p < 0.01, ***: p < 0.001, ****: p < 0.0001. Respective p-value significance was indicated in relevant figures.

[0202] Example 1: IMPRINTS-CETSA identifies stabilization of S100 protein family in JQ1- resistant AML cells To investigate the mechanism of JQ1 resistance in AML, JQ1 sensitive cells (OC1-AML-2 or O; MOLM-14 or M) were first subjected to selection pressure with JQ1 at sub-lethal dose (ICo) over 72h. A drug holiday spanning 72h follows, and the cycle is repeated over a 10- week period to derive JQ1 resistant OCI- AML-2 and MOLM-14 cells with incremental resistance to JQ1 (Figure 1A). These cells are termed as OCI-AML-2-JQ1R or OJ, and MOLM-14-JQ1R or MJ henceforth. OJ exhibits a five-fold difference in IC50 against JQ1 in comparison to their JQl-sensitive counterparts (Figure IB). Interestingly, even though proliferation rates of O and OJ were comparable for the first 21h period, sensitive O line quickly succumbed to lethality of JQ1 whereas OJ could continue proliferating under high dosage of JQ1 treatment over a 96h period (Figure 1C). This suggests that acquired resistance against JQ 1 demonstrated by OJ did not drastically affect its proliferative capacity.

[0203] To interrogate activated biological pathways in JQ1 -resistant AML cells, the highly sensitive TMPRTNTS implementation of MS-CETSA was employed and the protein scores of more than 4,500 detected proteins from biological triplicates of O, OJ, M, MJ and a control cell line HL-60 were quantified. The association of JQ1 with BRD4 was expected to increase protein stability and result in a thermal shift. Indeed, within Ih of treatment with JQ1, BRD4 appeared to be more stabilized and display a thermal shift in both O and OJ AML cells, suggesting on-target and inhibition of BRD4 epigenetic reader function (Figure ID). Curiously, JQ1 treatment also resulted in stabilization of BRD2 and BRD3, both members of BET family of proteins like BRD4, suggesting JQ1 may affect BRD2- and BRD3- regulated pathways as well (Figure 6).

[0204] In order to identify activated protein nodes in OJ and MJ which allow them to mitigate the lethal effects of JQ1, the 4,500 identified protein signatures from IMPRINTS-CETSA were screened to uncover proteins that are differentially stabilized in OJ and MJ and not in O and M. By categorizing changes in protein stability scores into nine different categories (CC++ denoting positive change in abundance and stability, NN as no significant changes in abundance and stability, CC - denoting negative change in abundance and stability, and 6 other possible permutations), it was observed that there were significant differences for protein stability in the proteome between JQl-resistant and JQl-sensitive AML cell lines (Figure IE). Notably, multiple members of S100 protein family (S100A4, SI00A8 and SI00A9) were found to be within the CC++ quadrant, suggesting that they are stabilized in JQl-resistant AML cells (Figure IF). To validate the 1MPR1NTS-CETSA readouts, CETSA-WB was performed and a similar trend was observed that demonstrated S100A8 and S100A9 to be more heat-stable in JQl-resistant OJ as compared to JQl-sensitive O (Figure 1G).

[0205] Example 2: S100A8 mediates JQ1 resistance

[0206] To further understand how proteins from S 100 family could mediate JQ1 resistance in AML cells, the steady-state levels of S100A4, S100A8 and S100A9 which were previously identified from the IMPR1NTS-CETS A screen were quantified. It was found that expression levels of these proteins was higher in JQl-resistant OJ cells (Figure 2A). In addition, at mRNA level S100A8 and S100A9 arc also detectable via RNA-scq to be uprcgulatcd in JQl-resistant OJ cells (Figure 7A). Hence, it was hypothesized that sustained translation and accumulation of proteins from S100 family could modulate JQ1 resistance in AML.

[0207] There was no evidence for lowered levels of autophagy when S100A8 was ablated by CRISPR knockout (Figure 2B). Instead, it was found that BCL-2 pro-survival protein expression was drastically reduced with loss of S100A8 protein (Figure 2B). In addition, S100A8 ablation re-sensitized JQl-resistant OCI- AML-2 cells to JQ1 by 2.4-fold (671nM to 280nM), further implicating S100A8 function in mediating JQ1 resistance (Figure 2C). Curiously, S100A8 knockout resulted in an accompanied reduction in (Figure 2C). Curiously, S 1 00A8 knockout resulted in an accompanied reduction in S100A9 expression, while S100A9 knockout also resulted in an accompanied reduction in S100A8 expression (Figure 7B-7C). This could be explained by reduction of protein stability when S100A9- S 100 A9 homodimer forms in S 100A8 knockout cells, or when S 100A8-S 100 A8 homodimer forms in S100A9 knockout cells observed previously. In normal physiological setting, S100A8 and S100A9 preferentially form heterodimers when calcium is limited, while formation of hetero tetramers are calcium- or zinc-dependent.

[0208] Interestingly, S100A9 knockout cells were not re-sensitized to JQ1 treatment, possibly due to residual function of S1OOA8-S1OOA8 homodimers (Figure 7). Paquinimod, an S100A8 / A9 inhibitor which functions by preventing S100A9 signalling via TLR4, also had no effect in re-sensitizing JQl-resistant OCI-AML-2 cells to JQ1 (Figure 2D). These data suggest that JQ1 -resistance phenotype is mostly driven via S100A8-mediated signalling. Based on previous studies, inhibition of BRD4 with JQ1 were demonstrated to initiate proliferation arrest and apoptosis in leukemia via downregulation of anti-apoptotic proteins. JQl-resistant AML cells generated in this study was able to evade apoptosis and continue to proliferate under JQ1 treatment (Figure 1C). Hence, it was reasoned that JQl-resistant OCI- AML-2 cells should display a more pro-survival and less apoptotic signature. Indeed, cleaved caspase-3 which is an effector of apoptosis was detected upon JQ1 treatment in JQ1- sensitive OCLAML-2 cells, while this signature was absent in JQl-treated JQl-resistant OCI- AML-2 cells (Figure 2E). In addition, it was demonstrated that S100A8 KO rescued this apoptotic phenotype where an appreciable amount of cleaved caspase-3 could be detected when S100A8 expression was ablated in OJ (Figure 2E).

[0209] To elucidate the mechanism for S100A8-mediated downregulation of apoptotic and upregulation of pro-survival family proteins, transcriptomic and IMPRINTS-CETSA analyses of JQ1 -treated OCLAML-2 and OCLAML-2-JQ1 R were performed to pinpoint the signal transduction pathways mediated by S 100A8 to drive JQ1 resistance. Pathway analysis using top upregulated genes in OJ suggested the enrichment of signaling pathways associated with several immune-related transcription factors, namely cAMP responsive binding clement 1 (CREB1), signal transducer and activator of transcription 3 (STAT3) and signal transducer and activator of transcription I (STAT1).

[0210] Interestingly, IMPRINTS-CETSA also identified CREB 1 , STAT3 and STAT1 to be stabilized in JQl-resistant OJ cells (Figure 3A). These data suggests that CREB1, STAT3 and STAT1 signalling could be enhanced in JQl-resistant cells. We were able to validate that phosphorylation and expression level of CREB1 and STAT3 in JQl-resistant cells were higher compared to their counterpart JQl-scnsitivc cells (Figure 3B). However, only phosphorylation level of STAT3 were affected by S100A8 knockout (Figure 3B). This suggests that activation of CREB1 and STAT3 signalling pathway in JQl-resistant OCI- AML-2 cells could be related to JQ1 resistance, though only STAT3 signalling is likely to be driven by S100A8, whereas CREB 1 could be upstream of S100A8 signalling.

[0211] Even though the role of STAT3 in modulating transcription of Bcl-2 and Mcl-1 and suppressing apoptosis via caspasc-3 is well characterized, it remains unclear if STAT3 is important in mediating S100A8-driven JQ1 resistance in AML cells. It was reasoned that STAT3 inhibition would re-sensitize JQl-resistant AML cells to JQ1 if STAT3 is indeed an effector of S100A8-mediated JQ1 -resistance. In agreement with this hypothesis, STAT3 inhibition at IC20 sub-lethal dose using Stattic, a small molecule STAT3 inhibitor, was able to re-sensitize JQl-resistant OCI-AML-2 cells to JQ1 (Figure 3C).

[0212] Thus far, it has been shown that S100A8 is important for phosphorylation of STAT3. Next, the kinase responsible for transducing signal from S 100A8 to STAT3 to drive JQl-resistance in AML cells was elucidated. Phosphorylation of STAT3 on tyrosine 705 is mainly regulated by J anus -activated kinases (JAKs), and it was desired to investigate if JAK1 and JAK2 axe the kinases responsible for phosphorylating S100A8-activated STAT3 phosphorylation. Curiously, even though JAK1 and JAK2 activation appear to be higher in JQl-resistant OCI- AML-2 cells, they were not modulated by S100A8 expression as phosphorylated JAK1 and JAK2 levels remained largely unaffected in S100A8 knockout cells (Figure 8B). Other intracellular activators of STAT3 activity such as Src were also more abundant in JQl- resistant OJ cells but were unperturbed by loss of S100A8 (Figure 8B). Collectively, this suggests that S100A8 may activate STAT3 via a non-canonical pathway in JQl-resistant AML cells.

[0213] Recently, ncuroplastin-P is suggested as a previously unreported S100A8 receptor. However, expression level of neuroplastin-P is low in JQl-resistant AML cells and did not seem to have the ability to drive STAT3 phosphorylation (data not shown). To identify the novel S100A8 receptor that may phosphorylate STAT3 in JQl -resistant AML cells, both known and unknown S100A8 receptors implicated in AML progression were intersected.

[0214] Potential candidates were narrowed down to a few S100A8 receptors including TLR4, RAGE and c-KIT. It was found that only c-KIT and its activated form p-cKIT were upregulated in JQl-resistant OCI-AML-2 cells, but expression levels of these were drastically reduced in S100A8 KO JQl-resistant AML cells (Figure 3D). In addition, as c- KTT is a cell surface receptor with tyrosine kinase function that was shown to have the ability to phosphorylate STAT3, it was hypothesized that JQl-resistant AML cells secreted a higher level or more stable form of S100A8 / S100A9 heterodimers that can activate c-KIT in neighbouring cells via paracrine signalling to mediate JQ1 resistance. Indeed, ELISA assay of S 100A8 / S 100A9 hctcrodimcrs reveal that extracellular media from cultured JQl-resistant OJ cells contained higher levels of the heterodimer, which becomes completely undetectable when S 100A8 is ablated via genetic knockout (Figure 3E). Taken together, this demonstrated the potential interaction of c-KIT as a novel S100A8 receptor with tyrosine kinase function that could induce activation STAT3 and drive JQ1 resistance in AML cells.

[0215] Example 3: Constitutively elevated ER stress response gene primes JQl-resistant AML cells from further ER stress induction mediated by JQ1 treatment

[0216] As CREB1 was previously identified to be a top regulator of S100A8 and S100A9 expression from a genome-wide CRISPR / Cas9 knockout screen, it was desired to know if mediators of CREB1 signalling were implicated with JQ1 resistance as well. CREB1 signalling is regulated by a plethora of upstream signalling molecules that transmit both extracellular and intracellular signals (Figure 4A).

[0217] Previous studies have implicated p38 and ERK1 / 2 in haematological malignancies by transducing external signals such as growth factors and oxidative stress, though it does not appear that they are important for mediating JQ1 resistance in AML cells. With the knowledge that the functions of S100A8 and its heterodimers were calcium-dependent, it was hypothesised that mediators involved in activation of CREB 1 that mediate S100A8 activity could also depend on calcium as a stimulus. Out of the other known mediators of CREB1 activation, there are four major protein kinases that are calcium-dependent which are ribosomal protein S6 kinase (RSKs), calmodulin-dependent protein kinase II (CaMKII), protein kinase A catalytic subunit (PKAc) and protein kinase C beta II (PKCpiI). Interestingly, expression and activation levels of all of these protein kinases were elevated in JQl-resistant OJ cells (Figure 4C). This revealed a potential association between calcium signalling and activation of CREB 1 in JQl-resistant AML cells.

[0218] To uncover the modulators of RSKs, CaMKII, PKA and PKC3II, RNA-seq was performed to compare O and OJ with or without JQ1 treatment. Via pathway enrichment analysis it was found that endoplasmic reticulum Ca2+sensors stromal interaction molecule 1 (STIM1 ) and sorcin (SRI), as well as key transducer of intracellular Ca2+signalling calmodulin (CALM1) were generally upregulated in JQl-resistant OJ cells (Figure 4D). These are validated via immunoblotting at the protein level, and suggests a potential connection where given a stimuli, ER-stored Ca2+can be regulated and released by STIM1 and SRI which in turn activated CALM1 to drive CaMKII-mediated signalling, or directly activated RSKs, PKCpiI and PKA-mediated downstream signalling to result in S100A8 transcription and eventual JQ1 resistance (Figure 4D and 4E).

[0219] Inhibition of BRD4 with JQ1 was previously shown to induce ER stress and upregulation of ER stress response genes. Here, it was demonstrated that JQ1 treatment activated ER stress in JQl-sensitive OCI-AML-2 cells (Figure 4F). Intriguingly, ER stress signatures appeared to be activated in JQ1 -resistant AML cells even in the absence of JQ1, and subsequent JQ1 treatment failed to enhance ER stress signatures further (Figure 4F). Further validation of downstream ER-stress response proteins also revealed similar' expression patterns for JQl- sensitive and JQl-resistant AML cells (Figure 4H). This suggested that JQl-resistant cells may be adapted to elevated levels of ER stress, rendering JQ1 treatment ineffective. It was reasoned that JQ1 elicited ER stress in JQl-sensitive cells leading to ER-mcdiatcd calcium release and result in mitochondrial Ca2+overload and eventual apoptosis, whereas other epigenetic mechanisms may activate and maintain constitutive expression of ER stress response genes in JQl-resistant AML cells that is not mediated by JQ1 .

[0220] To begin to elucidate the epigenetic mechanism that underlies JQ1 resistance, we compared the histone acetylation marks of JQl-sensitive and JQl-resistant cells. Expectedly, we found marked increase of H3K4mcl and H3K27ac enhancer specific marks in JQl-resistant as compared to JQl-sensitive cells, suggesting increased number of active gene promoters or higher levels of transcriptional activities (Figure 4H). Interestingly, JQ1 treatment did not further enhance these epigenetic marks in either JQl -sensitive or JQl -resistant cells. This data suggest that chronic exposure, rather than short-term exposure to JQ1 could rewire epigenetic landscape in JQl-resistant AML cells to sustain ER stress and calcium signalling.

[0221] Clinical relevance of calcium and S100A8 signalling in AML

[0222] Next, it was asked if protein stability could be used to stratify AML patients who are recalcitrant to JQ1 treatment. The sensitivity of 10 AML patient samples to JQ1 were first characterised and it was found that 2 of these samples exhibited higher levels of sensitivity to JQ1 (Figure 5A). We selected a pair of AML patient samples which are less sensitive (A1037) and more sensitive (AI044) to JQ1 treatment and determined isothermal dose response curves for S100A8 and CALM1. Interestingly, it was found that soluble S100A8 protein fraction remained relatively stable in A1037 at increasing concentrations of JQ1 administered but decreased drastically in A1044 (Figure 5B). This suggests that S100A8 protein stability could be reflective of JQ1 sensitivity in clinical settings. Survival analyses of key genes involved in mediating S100A8-driven JQ1 resistance in AML cells revealed that upregulation of either a combination of S100A8 and S100A9, or SRI involved in controlling calcium release from ER, or calcium-stimulated CAMKII kinase, or CHOP involved in ER stress response all resulted in poorer prognosis in AML patients (Figure 5C).

[0223] In summary, the findings suggest that JQl-resistant cells counteract inhibitor}' effect of JQ1 on BRD4 via constitutive upregulation and activation of ER stress responsive proteins. This potentially primed JQl-resistant cells against drug-induced stress and ER stress-mediated calcium release from ER storage. JQl-resistant cells likely exploited elevation of cytosolic calcium level via upregulation of ER-localiscd calcium-mcdiatcd regulatory proteins and effector of calcium signalling to mediate calcium signal transduction. Calcium could serve as either a direct or indirect activator of calcium-activated protein kinase to trigger activation of CREB1 signaling pathway. Phosphorylation of CREB1 could drive transcription of S100A8, and subsequent secretion of S100A8 into extracellular space enable interaction with tyrosine kinase receptor, cKIT. S100A8-mediated activation of cKIT induces receptor dimerization and downstream activation of STAT3, leading to enhanced expression of anti- apoptotic proteins and shift the balance of cellular fate to favour survival and inhibition of apoptosis (Figure 5D).

[0224] Example 4: Inactivation of S100A8 sensitises cells to ER stress

[0225] To investigate whether resistance to JQ1 in AML can be mitigated by targeting upstream of S100A8, the response of parental cells (O), JQl-resistant cells (OJ), and JQl-resistant cells with S100A8 knocked out (A8 KO) to endoplasmic reticulum (ER) stress was evaluated by exposure to increasing concentrations of thapsigargin, an ER stress inducing agent. As shown in Figure 9, both the presence of JQ1 resistance and the loss of S100A8 resulted in a leftward shift of the dose-response curve, demonstrating increased vulnerability and enhanced sensitivity to thapsigargin. The GI50 value decreased from 1.58 nM in parental cells to 0.74 nM in JQl-resistant cells and 0.61 nM in S 100A8 knockout cells, corresponding to approximately two-fold and 2.6-fold sensitisation, respectively. These results provide evidence that inhibition or suppression of S100A8, cither genetically or pharmacologically, can overcome JQ1 resistance and resensitise AML cells to ER stress-inducing agents such as BET inhibitors.

[0226] It will be appreciated that many further modifications and permutations of various aspects of the described embodiments are possible. Accordingly, the described aspects are intended to embrace all such alterations, modifications, and variations that fall within the spirit and scope of the appended claims.

Claims

CLAIMS1. A method of predicting the response of a subject to a BET inhibitor, the method comprising detecting the expression of S100A8 in a sample from the subject, wherein an increase in S100A8 expression as compared to a reference indicates that the subject is likely to be resistant to the BET inhibitor.

2. The method of claim 1, wherein a decrease in S100A8 expression as compared to a reference indicates that the subject is likely to respond to the BET inhibitor.

3. The method of claim 1 or 2, wherein the BET inhibitor is an inhibitor of BRD4.

4. The method of claim 3, wherein the BET inhibitor comprises or consists of JQ1, CPI- 0610, B MS-986158, ABBV-075, FT-1101, GSK525762, or R0680810.

5. The method of any one of claims 1 to 4, wherein the subject is suffering from cancer.

6. The method of claim 5, wherein the cancer is acute myeloid leukemia (AML), multiple myeloma, diffuse large B-cell lymphoma (DLBCL), glioblastoma or prostate cancer.

7. The method of claim 6, wherein the cancer is AML characterised by a FLT3 internal tandem duplication (FLT3-TTD) mutation and / or a p53 mutation.

8. The method of any one of claims 1 to 7, wherein the method comprises detecting a polypeptide product of S100A8.

9. The method of any one of claims 1 to 8, wherein the increase in expression is at least a 25% increase over the reference.

10. The method of any one of claims 1 to 9, further comprising detecting the expression of one or more ER stress response genes, wherein an increase in expression of the one or more ER stress response genes as compared to a reference indicates that the subject is likely to be resistant to the BET inhibitor.1 1 . The method of claim 10, wherein the one or more ER stress response genes is selected from ATF4, ATF6, KIT, RSK1, RSK2, CAMK2A, PRKACA, PRKCB, STIM1, SRI, XBP1 and CHOP.

12. A method of sensitising a subject to a BET inhibitor, the method comprising administering at least one of a S 100A8 inhibitor, an ER stress inducing agent or a c-KIT inhibitor to the subject.

13. The method of claim 12, wherein the S100A8 inhibitor is a nucleic acid, site-specific nuclease (SSN) system, polypeptide or small molecule.

14. The method of claim 12 or 13, wherein the ER stress inducing agent is thapsigargin.

15. The method of any one of claims 12 to 14, wherein the c-KIT inhibitor is pazopanib.

16. The method of any one of claims 12 to 15, wherein the BET inhibitor is administered to the subject in combination with the S100A8 inhibitor, ER stress inducing agent and / or c-KIT inhibitor.

17. The method of any one of claims 12 to 16, wherein the subject is resistant or found likely to be resistant to the BET inhibitor.

18. The method of claim 17, wherein the subject is found likely to be resistant to the BET inhibitor by a method of any one of claims 1 to 11.

19. A method of treating a subject, the method comprising: (a) detecting the expression of SI00A8 in a sample from the subject, wherein an increase in SI00A8 expression as compared to a reference indicates that the subject is likely to be resistant to a BET inhibitor; and (b) administering a therapeutically effective amount of an anti-cancer therapy to the subject found likely to be resistant to a BET inhibitor, wherein the anti- cancer therapy is not the BET inhibitor.

20. The method of claim 19, wherein the anti-cancer therapy is selected from a BCL2 inhibitor, a MCL1 inhibitor, a HD AC inhibitor, a FLT3 -inhibitor, an MEK inhibitor, aPT3K / AKT / mT0R inhibitor, or a combination thereof.

21. A method of treating a subject, the method comprising: (a) detecting the expression of S100A8 in a sample from the subject, wherein a decrease in S100A8 expression as compared to a reference indicates that the subject is likely to respond to a BET inhibitor; and (b) administering a therapeutically effective amount of the BET inhibitor to the subject found likely to respond to the BET inhibitor.

22. A method of selecting a subject for treatment, the method comprising: (a) detecting the expression of S100A8 in a sample from the subject, wherein an decrease in S100A8 expression as compared to a reference indicates that the subject is likely to respond to the BET inhibitor; and (b) selecting a subject found likely to respond to the BET inhibitor for treatment with the BET inhibitor.

23. A method of selecting a subject for treatment, the method comprising: (a) detecting the expression of S100A8 in a sample from the subject, wherein an increase in S100A8 expression as compared to a reference indicates that the subject is likely to be resistant to the BET inhibitor; and (b) selecting a subject found likely to be resistant to the BET inhibitor for treatment with a combination of the BET inhibitor and at least one of a S100A8 inhibitor, an ER stress inducing agent or a c-KTT inhibitor.

24. A method of treating cancer in a subject, the method comprising administering a therapeutically effective amount of a BET inhibitor in combination with at least one of a S100A8 inhibitor, an ER stress inducing agent or a c-KIT inhibitor to the subject.

25. A combination of a BET inhibitor and at least one of a S100A8 inhibitor, an ER stress inducing agent or a c-KIT inhibitor, for use in treating cancer in a subject, wherein a therapeutically effective amount of the BET inhibitor is to be administered in combination with the S100A8 inhibitor, ER stress inducing agent and / or c-KIT inhibitor to the subject.

26. Use of a combination of a BET inhibitor and at least one of a S100A8 inhibitor, an ER stress inducing agent or a c-KIT inhibitor in the manufacture of a medicament for treating cancer in a subject, wherein a therapeutically effective amount of the BETinhibitor is to be administered in combination with the S100A8 inhibitor, ER stress inducing agent and / or c-KIT inhibitor to the subject.

27. The method of claim 24, combination for use of claim 25, or use of claim 26, wherein the cancer is acute myeloid leukemia (AML), multiple myeloma, diffuse large B-cell lymphoma (DLBCL), glioblastoma or prostate cancer.

28. The method of claim 24 or 27, combination for use of claim 25 or 27, or use of claim 26 or 27, wherein the subject is resistant or found likely to be resistant to the BET inhibitor.

29. The method, combination for use or use of claim 28, wherein the subject is found likely to be resistant to the BET inhibitor by a method of any one of claims 1 to 11.

Images