Gene therapy for treating cognitive decline and / or memory deficits

Abstract

A vector for use in treating cognitive decline and / or memory deficits in a subject in need thereof includes an expression cassette that includes a nucleic acid encoding asprosin and / or an analogue thereof, operably linked to one or more regulatory elements that promote expression of the asprosin and / or an analogue thereof coding sequence, wherein the one or more regulatory elements include a nucleic acid promoter, a polyadenylation (poly(A)) tail signal, and / or posttranscriptional regulatory element.

Description

PATENT GENE THERAPY FOR TREATING COGNITIVE DECLINE AND / OR MEMORY DEFICITS RELATED APPLICATION

[0001] This application claims priority from U.S. Provisional Application No.63 / 702,370, filed October 2, 2024, the subject matter of which is incorporated herein by reference in its entirety. SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on October 1, 2025, is named UH-033894WO ORD.st.26 and is 40,793 bytes in size. BACKGROUND

[0003] Alzheimer’s Disease (AD) is a devastating and ultimately fatal disease. Therefore, the elucidation and the identification of novel memory pathways and potential therapeutic targets are of paramount importance in combating this neurodegenerative disorder. Despite extensive research efforts, effective treatments for AD remain elusive, emphasizing the need for a deeper understanding of the underlying molecular mechanisms and the identification of new therapeutic strategies.

[0004] The cerebellum can integrate information from thousands of stimuli through the Purkinje neurons. These specialized neurons are critical to the function of the cerebellum and serve as the primary output neurons of the cerebellar cortex, relaying processed information to other part of the brain. Purkinje neurons specifically are known to play an integral role in the formation of fear conditioned associative memory. However, the molecular and cellular mechanisms of how Purkinje neurons modulate the associative fear memory network are largely unknown. Furthermore, fear conditioning is a form of classical conditioning that is evolutionarily needed to assess and evolve against threats. This type of associative memory is one of the first types of memories lost in Alzheimer’s disease. However, because there has yet to be a target identified that mediates the mechanism of fear conditioning through Purkinje neurons, no therapeutics have yet been developed to manipulate this pathway.

[0005] Embodiments described herein relate to a polynucleotide for expressing asprosin and / or an analogue thereof in a subject and, particularly, a vector that includes a polynucleotide for expressing asprosin and / or an analogue thereof in a subject, and its use in gene therapy for treating and / or preventing one or more of cognitive decline and / or memory deficits, amyloid β (Aβ) mediated neurological pathogenesis, cachexia, and Alzheimer's disease (AD) in a subject in need thereof.

[0006] We identified that membrane bound receptor protein tyrosine phosphatase delta (Ptprd) is a central nervous system (CNS) receptor for asprosin, a fasting-induced protein hormone. In mice, Purkinje neuron-specific genetic ablation of Ptprd leads to a deficit in fear-conditioned memory similar to that caused by AD. It has been shown that AD damages Purkinje neurons, and we have shown that this damage results in a decrease in Ptprd activity.

[0007] We found that while plasma and cerebrospinal fluid (CSF) asprosin levels are unchanged in AD, the pathological accumulation of Aβ interferes with asprosin-Ptprd signaling by binding to Ptprd and inhibiting its activity. This suggests that normal asprosin levels are insufficient to activate Ptprd in the presence of Aβ. Using AD mouse models, we demonstrated that asprosin gain-of-function through a viral vector is able to fully rescue fear- conditioned memory deficits or associative memory deficits as well as novel object recognition memory deficits. Therefore, a polynucleotide that increases or promotes expression of asprosin and / or an analogue thereof can increase Ptprd activity and / or decrease Aβ induced inhibition of Ptprd activity and be used for treating and / or preventing one or more of cognitive decline and / or memory deficits, Aβ mediated neurological pathogenesis, cachexia, and AD in a subject in need thereof.

[0008] In some embodiments, the polynucleotide includes an expression cassette that includes a nucleic acid encoding asprosin and / or an analogue thereof, operably linked to one or more regulatory elements that promote expression of the asprosin and / or an analogue thereof coding sequence in a cell of the subject. The one or more regulatory elements can include a nucleic acid promoter, a polyadenylation (poly(A)) tail signal, and / or a posttranscriptional regulatory element.

[0009] In some embodiments, the nucleic acid encoding asprosin and / or the analogue thereof has a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about87%, at least about 88%, at least about least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 2 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 2 or a reverse complementary sequence thereof.

[0010] In some embodiments, the regulatory element includes a nucleic acid encoding polyadenylation (poly(A)) tail signal, for example, a simian virus 40 (SV40) poly(A) tail signal or a bovine growth hormone pA (BGH pA).

[0011] In some embodiments, the nucleic acid encoding the polyadenylation (poly(A)) tail signal can have a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 6 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 6 or a reverse complementary sequence thereof.

[0012] In some embodiments, the regulatory elements can include a nucleic acid encoding an elongation factor-1 (EF-1) promoter, cytomegalovirus promoter, or a cytomegalovirus enhancer (CMV) / chicken β actin promoter (CAG promoter).

[0013] In some embodiments, the nucleic acid encoding the EF-1 promoter can have a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 13 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 13 or a reverse complementary sequence thereof.

[0014] In some embodiments, the nucleic acid encoding the CAG promoter can have a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, atleast about 93%, at least about 94%, at least 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 4 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 4 or a reverse complementary sequence thereof.

[0015] In some embodiments, the regulatory elements can include a nucleic acid encoding a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE).

[0016] In some embodiments, the nucleic acid encoding the WPRE can have a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 3 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 3 or a reverse complementary sequence thereof.

[0017] In some embodiments, the expression cassette can further include a nucleic acid encoding an IL2 signal peptide.

[0018] In some embodiments, the nucleic acid encoding the IL2 signal peptide can have a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 5 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 5 or a reverse complementary sequence thereof.

[0019] In some embodiments, the expression cassette can include an arrangement order (e.g., 5’ to 3’ arrangement order) of nucleic acids encoding an EF-1 promoter, an IL2 signal peptide, asprosin and / or the analogue thereof, WPRE, and SV40poly(A) tail signal.

[0020] In other embodiments, the expression cassette can include an arrangement order (e.g., 5’ to 3’ arrangement order) of nucleic acids encoding a CAG promoter, an IL2 signal peptide, asprosin and / or the analogue thereof, WPRE, an a SV40poly(A) tail signal.

[0021] In some embodiments, the polynucleotide can further include a nucleic acid encoding inverted terminal repeats (ITRs) flanking the expression cassette. At least one ITRcan be adjacent to the EF-1 or CAG 5’-ITR) and at least one ITR can be adjacent to the poly(A) tail signal (e.g., 3’-ITR).

[0022] In some embodiments, the ITRs are derived from an AAV serotype 2.

[0023] In some embodiments, the polynucleotide can include an arrangement order of nucleic acids encoding the 5’-ITR, EF-1 promoter or CAG promoter, IL2 signal peptide, asprosin and / or an analogue thereof, WPRE, SV40poly(A) tail signal, and 3’-ITR.

[0024] Other embodiments relate to a nucleic acid vector that includes a polynucleotide as described herein.

[0025] In some embodiments, the vector is an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector. The adeno-associated viral vector can include at least one of AAV1, AAV2, AAV6, AAV8, AAV9, AAVrh74, AAVrh10, AAV5, AAV7, AAVS3, AAVHSC, AAV2.7m8, AAV-LK03, AAV8 / Olig001, AAV2i8, AAVhu37, AAV2tYF, AAVh1, AAVhu68, AAVrh.8, AAVrh9, AAV.PHP.B., AAV.PHP.eB, AAV.PHP.S, AAV / BBB, AAV-DJ, AAVr3.45, AAV-sh10, AAV2(Y444F), AAV4, AAV-RPF2, or AAV3b. For example, the adeno-associated viral vector can include AAV1 or AAV8.

[0026] In other embodiments, the vector can be a circular plasmid DNA that includes a backbone having a length of at least about 5000 bp or at least about 5500 bp.

[0027] In some embodiments, the backbone can include a selection marker selected from an antibiotic resistance encoding nucleic acid or a kanamycin resistance encoding nucleic acid (KanR).

[0028] In some embodiments, the backbone further can further include a pUC18 origin of replication (ORI).

[0029] In some embodiments, the plasmid can have a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 14, 15, or SEQ ID NO: 16.

[0030] In some embodiments, the plasmid can be used to form rAAV particles that include the expression cassette encoding asprosin and / or an analogue thereof.

[0031] In some embodiments, the is configured to promote expression of asprosin and / or an analogue thereof in liver of a subject upon systemic administration to the subject.

[0032] Other embodiments described herein relate to a pharmaceutical composition that includes a vector as described herein and a pharmaceutically acceptable carrier.

[0033] In some embodiments, the pharmaceutical composition can be formulated for intramuscular or intravenous delivery.

[0034] In some embodiments, the vector or the pharmaceutical composition as described herein can be used in treating cognitive decline and / or memory deficits in a subject in need thereof. The memory deficits can include associative memory deficits and novel object recognition memory deficits.

[0035] In other embodiments, the vector or the pharmaceutical composition as described herein can be used in treating Aβ mediated neurological pathogenesis in a subject in need thereof.

[0036] In still other embodiments, the vector or the pharmaceutical composition as described herein can be used in treating cachexia in a subject in need thereof. The subject treated for cachexia can have or is at increased risk of Alzheimer’s disease, cognition deficiency disorder, age-associated memory impairment, or dementia.

[0037] In other embodiments, the vector or the pharmaceutical composition as described herein can be used in treating Alzheimer’s disease in a subject in need thereof. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Fig.1 illustrates a map of the plasmid AV0-BWS-IL2-His-Asp, which includes two AAV inverted terminal repeats (ITRs) flanking an expressing region comprising nucleic acids encoding an EF-1 promoter (SEQ ID NO: 4), an IL-2 signal peptide (SEQ ID NO: 3), a asprosin (SEQ ID NO: 2), a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (SEQ ID NO: 5), and an SV40 polyadenylation signal sequence (SEQ ID NO: 6). The plasmid further comprises an ampicillin resistance (AmpR) gene.

[0039] Fig.2 illustrates a map of the plasmid AAV1-CAG-BWS-IL2-His-Asp (SEQ ID NO: 15), which includes two AAV inverted terminal repeats (ITRs) flanking an expressing region comprising nucleic acids encoding a CAG promoter (SEQ ID NO: 13), IL-2 signal peptide (SEQ ID NO: 3), asprosin (SEQ ID NO: 2), a woodchuck hepatitis virus post- transcriptional regulatory element (WPRE) (SEQ ID NO: 5), and an SV40 polyadenylationsignal sequence (SEQ ID NO: 6). The further comprises a kanamycin resistance (KanR) gene.

[0040] Fig.3 illustrates a map of the plasmid AAV8(Kan)-BWS-IL2-Asp (SEQ ID NO: 16), which includes two AAV inverted terminal repeats (ITRs) flanking an expressing region comprising nucleic acids encoding an EF-1 promoter (SEQ ID NO: 4), IL-2 signal peptide (SEQ ID NO: 3), asprosin (SEQ ID NO: 2), a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (SEQ ID NO: 5), and an SV40 polyadenylation signal sequence (SEQ ID NO: 6). The plasmid further comprises a kanamycin resistance (KanR) gene.

[0041] Figs.4(A-I) illustrate a schematic, plots, and graphs showing Purkinje neuron- specific Ptprd is necessary for mammalian associative memory. (A) Schematic representation of the cued and contextual fear conditioning assay. (B) Fear acquisition on Day 1 in 3-month-old male mice, comparing Pcp2-cre (n=7), PtprdFlox / Flox(n=7) and Pcp2- cre;PtprdFlox / Flox(n=8) (C) Percent freezing during contextual fear conditioning on Day 2 in 3-month-old male mice, comparing control groups (Pcp2-cre (n = 5), PtprdFlox / Flox(n=7)) and Pcp2-cre;PtprdFlox / Flox(n = 6) (D) Percent freezing during Day 2 habituation in 3-month-old male mice, comparing control groups (Pcp2-cre (n=7), PtprdFlox / Flox(n=7)) and Pcp2- cre;PtprdFlox / Flox(n=8) mice. (E) Average percent freezing during cue presentation, comparing 3-month-old male control mice (Pcp2-cre (n=7), PtprdFlox / Flox(n=7)) and Pcp2- cre;PtprdFlox / Flox(n=8) mice. (F) Fear acquisition on Day 1 in 3-month-old female mice, comparing control groups (Pcp2-cre (n=7), PtprdFlox / Flox(n=9)) and Pcp2-cre;PtprdFlox / Flox(n=11) (G) Percent freezing during contextual fear conditioning on Day 2 in 3-month-old female mice, comparing control groups (Pcp2-cre (n = 7), PtprdFlox / Flox(n=7)) and Pcp2- cre;PtprdFlox / Flox(n = 5) (H) Percent freezing during Day 2 habituation in 3-month-old female mice, comparing control groups (Pcp2-cre (n=7), PtprdFlox / Flox(n=9)) and Pcp2- cre;PtprdFlox / Flox(n=11) mice. (I) Average percent freezing during cue presentation in 3- month-old female mice, comparing control groups (Pcp2-cre (n=7), PtprdFlox / Flox(n=9)) and Pcp2-cre;PtprdFlox / Flox(n=11) mice. Data are represented as mean ± SEM in (B,F) and mean ± SEM with individual data points in (C-E,G-I). Two-way ANOVA was used in (B,F) and one-sided unpaired t-test was used in (C-E,G-I). *, p<0.05; **, p<0.01; ****, p<0.0001.

[0042] Figs.5(A-L) illustrate graphs and images showing Ptprd activity is downregulated in Alzheimer’s disease (A) Plasma asprosin levels in human donors categorized as healthy controls (n = 11), individuals with mild cognitive impairment (MCI)(n = 15), and individuals with Alzheimer’s (AD) (n = 15). (B) CSF asprosin levels in human donors categorized as healthy controls (n = 19), individuals with MCI (n = 18), and individuals with AD (n = 13). (C) Representative western blot and relative quantification of β-actin and Ptprd in the whole cerebellum of males with Alzheimer’s disease compared to age- and sex-matched healthy controls. (D) Representative western blot and relative quantification of β-actin and Ptprd in the whole cerebellum of females with Alzheimer’s disease compared to age- and sex-matched healthy controls. (E) Plasma asprosin levels in 6- month-old male and female 5xFAD mice (n = 16) compared to age- and sex-matched WT controls (n = 14). (F) Representative western blot and relative quantification of β-actin and Ptprd in the whole cerebellum of male 5xFAD mice compared to age- and sex-matched WT controls (n = 5–6 per group). (G) Representative images of the anterior Crus 1 region, showing Calbindin (green) and p-Stat3 (red) staining in WT and 5xFAD mice. (H-L) Quantification of overlap between Purkinje neurons (stained for Calbindin, green) and p- Stat3 (red). Regions of Interest selected from cerebellar regions known to be involved in associative memory (n = 4-6 / group). Data are represented as mean ± SEM with individual data points in (A-F,H-L). One-way ANOVA analysis was used in (A,B) and two-sided unpaired t-tests (E,F), paired (C,D) or one-sided unpaired t-tests (H-L) were used in. *, p<0.05; **, p<0.01; ****, p<0.0001.

[0043] Figs.6(A-I) illustrate graphs and plots showing asprosin can out compete Aβ to restore Ptprd activity in Purkinje neurons (A) STAT3-response element-driven luciferase activity in HEK293T cells transfected with 2 μg of 4×M67 pTATA-TK-Luc plasmid, measured 24 hours after the addition of 300 nM Aβ1-40or reverse-sequence Aβ40-1control. Results represent three technical replicates and 12 biological replicates per group. (B) STAT3-response element-driven luciferase activity in HEK293T cells transfected with 2 μg of 4×M67 pTATA-TK-Luc plasmid and 400 ng of either an empty vector or an IL2-his- asprosin-expressing plasmid. Media was changed 24 hours post-transfection, followed by the addition of 200 nM Aβ1-40 or reverse-sequence Aβ40-1 control. Luciferase activity was measured 6 hours after treatment (three technical replicates, 10 biological replicates per group). (C) STAT3-response element-driven luciferase activity in HEK293T cells transfected with 2 μg of 4×M67 pTATA-TK-Luc plasmid, measured 24 hours after the addition of 300 nM Aβ1-40 or GFP control (three technical replicates, 12 biological replicates per group). (D) STAT3-response element-driven luciferase activity in HEK293T cellstransfected with 2 μg of 4×M67 pTATA- plasmid and 400 ng of either an empty vector or an IL2-his-asprosin-expressing plasmid. Media was replaced 24 hours post- transfection, followed by the addition of 300 nM Aβ or GFP control. Luciferase activity was assessed 6 hours after treatment (three technical replicates, 8 biological replicates per group). (E) STAT3-response element-driven luciferase activity in HEK293T cells transfected with 2 μg of 4×M67 pTATA-TK-Luc plasmid and treated with control or Ptprd siRNA. Luciferase activity was measured after 24 hours of exposure to Aβ1-40 or GFP control (three technical replicates, 22 biological replicates per group). (F) STAT3-response element-driven luciferase activity in HEK293T cells transfected with 2 μg of 4×M67 pTATA-TK-Luc plasmid, measured 24 hours after the addition of 300 nM Aβ1-42 or GFP control (three technical replicates, 12 biological replicates per group). (G) Binding affinity between the reverse- sequence Aβ40-1 and the extracellular domain of Ptprd (Ptprd-ECD) quantified using Surface Plasmon Resonance (SPR). (H) Binding affinity between Aβ1-42and Ptprd-ECD quantified using SPR. (I) Competitive binding analysis of asprosin and Aβ1-42 to Ptprd-ECD performed using SPR. Data are represented as mean ± SEM (F-H) or mean ± SEM with individual data points (A-E). One-way ANOVA analysis was used in (B,D,E) and two-sided unpaired t-tests (A,C) were used *, p<0.05; **, p<0.01; ****, p<0.0001.

[0044] Figs.7(A-F) illustrate images and graphs showing plasma asprosin elevation is sufficient to reactivate Purkinje neuron Ptprd in 5xFAD mice (A) Representative images of the anterior Crus 1 region, showing Purkinje neurons (stained via Calbindin, green) and p- Stat3 (red) and the merge of both stains. (B-E) Quantification of overlap between Purkinje neurons (stained via Calbindin, green) and p-Stat3 (red). Regions of interests were selected from cerebellar regions known to be involved in associative memory (n = 2-4 / group). Data are represented as mean ± SEM with individual data points in (C-F). One-sided unpaired Mann-Whitney U-test (C,D,F) or one-sided unpaired Welch’s t-tests (B,E) (used when SD differed between the groups). *, p<0.05; **, p<0.01; ****, p<0.0001.

[0045] Figs.8(A-J) illustrate graphs and plots showing asprosin gene therapy restores associative memory in AD (A, B) Body Weight Changes: Body weight change over a three- month period (from 6 to 9 months of age) in (A) male 5xFAD mice (n^=^11 per group) and (B) male APPNL-G-Fmice (n^=^13 per group) treated with either AAV8-Empty control or AAV8-Asprosin (1^×^10¹² genome copies [GC] / mouse). (C, D) Associative Memory in APPNL-G-FMice: Six-month-old male APPNL-G-Fmice were tail-vein-injected with AAV8-Empty or AAV8-Asprosin (1^×^10¹² . Associative memory was assessed at 9 months of age. (C) Fear acquisition on Day 1 (D) Average percent freezing during cue presentation (n^=^12 per group). (E–G) Associative Memory in Male 5xFAD Mice: Six- month-old wild-type (WT) male mice were tail-vein-injected with AAV8-Empty, and age- and sex-matched 5xFAD mice were tail-vein-injected with either AAV8-Empty or AAV8- Asprosin (1^×^10¹² GC / mouse). Associative memory was assessed at 9 months. (E) Fear acquisition on Day 1 (F) Day 2 habituation before tone presentation (G). Average percent freezing during cue presentation (n^=^19 for WT group; n^=^11 per 5xFAD group). (H–J) Associative Memory in Female 5xFAD Mice: Six-month-old WT female mice were tail-vein- injected with AAV8-Empty, and age- and sex-matched 5xFAD mice were tail-vein-injected with either AAV8-Empty or AAV8-Asprosin (1^×^10¹² GC / mouse). Associative memory was assessed at 9 months. (H) Fear acquisition on Day 1 (I), Day 2 habituation before tone presentation (J) Average percent freezing during cue presentation (n^=^10-13 per group). 5xFAD mice were injected with AAV and tested by Bijoya Basu at Case Western Reserve University on Med Associates Fear Conditioning Apparatus, base dimensions: 20cm x 20cm; APPNL-G-Fmice were injected with AAV and tested at Baylor College of Medicine by Hesong Liu on Fusion Stimulus Hub with SuperFlex Open Field system (OmniTech Electronics, Inc), base dimensions: 60cm X 60cm. All fear conditioning data were collected under blinded conditions. Data are represented as mean ± SEM in (C,E,H) and mean ± SEM with individual data points in (A,B,D,F,G,I,J). Two-way ANOVA was used in (C,E,H), one-way ANOVA with post hoc were used in (F,G,I,J) and two-sided unpaired t-tests were used in (A,B,D). *, p<0.05; **, p<0.01; ****, p<0.0001.

[0046] Figs.9(A-H) illustrate graphs showing Purkinje neuron-specific Ptprd ablation does not impact other memory types (A) Total distance traveled in 15 minutes in the open field test, comparing 3-month-old male control mice (Pcp2-cre (n=9), PtprdFlox / Flox(n=8)) with age- and sex-matched Pcp2-cre;PtprdFlox / Flox(n=7) mice (B) Open field center-to- periphery ratio, used as a measure of anxiety, comparing 3-month-old male control mice (Pcp2-cre (n=9), PtprdFlox / Flox(n=8)) with age- and sex-matched Pcp2-cre;PtprdFlox / Flox(n=7) mice (C) Novel object recognition index, comparing 3-month-old male control mice (Pcp2- cre (n=9), PtprdFlox / Flox(n=9)) with age- and sex-matched Pcp2-cre;PtprdFlox / Flox(n=7) mice (D) Total time spent in the target quadrant for Barnes maze, comparing 3-month-old male control mice (Pcp2-cre (n=6), PtprdFlox / Flox(n=7)) with age- and sex-matched Pcp2-cre;PtprdFlox / Flox(n=10) mice (E) Total traveled in 15 minutes in the open field test, comparing 3-month-old female control mice (Pcp2-cre (n=4), PtprdFlox / Flox(n=14)) with age- and sex-matched Pcp2-cre;PtprdFlox / Flox(n=5) mice. (F) Open field center-to-periphery ratio, used as a measure of anxiety, comparing 3-month-old female control mice (Pcp2-cre (n=4), PtprdFlox / Flox(n=14)) with age- and sex-matched Pcp2-cre;PtprdFlox / Flox(n=5) mice. (G) Novel object recognition index, comparing 3-month-old female control mice (Pcp2-cre (n=7), PtprdFlox / Flox(n=14)) with age- and sex-matched Pcp2-cre;PtprdFlox / Flox(n=10) mice. (H) Total time spent in the target quadrant for Barnes maze, comparing 3-month-old female control mice (Pcp2-cre (n=6), PtprdFlox / Flox(n=12)) with age- and sex-matched Pcp2- cre;PtprdFlox / Flox(n=8) mice. Data are represented as mean ± SEM with individual data points in (a-h) and two-sided unpaired t-test was used. *, p<0.05; **, p<0.01; ****, p<0.0001.

[0047] Figs.10(A-L) illustrate graphs showing that there are no behavioral differences between the control groups Pcp2-cre and PtprdFlox / Flox(A) Total distance traveled in 15 minutes in the open field test, comparing 3-month-old male mice (Pcp2-cre (n=9), PtprdFlox / Flox(n=8)) (B) Open field center-to-periphery ratio, used as a measure of anxiety, comparing 3-month-old male mice (Pcp2-cre (n=9), PtprdFlox / Flox(n=8)) (C) Novel object recognition index comparing 3-month-old male mice (Pcp2-cre (n=9), PtprdFlox / Flox(n=9)) (D) Total time spent in the target quadrant for Barnes maze comparing 3-month-old male mice (Pcp2-cre (n=6), PtprdFlox / Flox(n=7)) (E) Percent freezing during Day 2 habituation comparing 3-month-old male mice (Pcp2-cre (n=7), PtprdFlox / Flox(n=7)) (F) Average percent freezing during cue presentation comparing 3-month-old male mice (Pcp2-cre (n=7), PtprdFlox / Flox(n=7)) (G) Total distance traveled in 15 minutes in the open field test, 3-month- old female mice (Pcp2-cre (n=4), PtprdFlox / Flox(n=14)) (H) Open field center-to-periphery ratio, used as a measure of anxiety, 3-month-old female mice (Pcp2-cre (n=4), PtprdFlox / Flox(n=14)) (I) Novel object recognition index comparing 3-month-old female mice (Pcp2-cre (n=7), PtprdFlox / Flox(n=14)) (J) Total time spent in the target quadrant for Barnes maze, comparing 3-month-old female mice (Pcp2-cre (n=6), PtprdFlox / Flox(n=12)) (K) Percent freezing during Day 2 habituation comparing 3-month-old female mice (Pcp2-cre (n=7), PtprdFlox / Flox(n=9)) (L) Average percent freezing during cue presentation comparing 3- month-old female control mice (Pcp2-cre (n=7), PtprdFlox / Flox(n=9)) Data are represented as mean ± SEM with individual data points in (A-L) and two-sided unpaired t-test was used. *, p<0.05; **, p<0.01; ****, p<0.0001.

[0048] Figs.11(A-F) illustrate plots showing hypothalamic AgRP neuron- specific or forebrain excitatory neuron-specific Ptprd is dispensable for mammalian associative memory (A) Fear acquisition on Day 1 comparing 3-month-old male AgRP-cre (n=8) with age- and sex-matched AgrP-cre;PtprdFlox / Flox(n=6) mice (B) Percent freezing during Day 2 habituation in 3-month-old male mice comparing 3 month old male AgRP-cre (n=8) with age- and sex-matched AgrP-cre;PtprdFlox / Flox(n=6) mice (C) Average percent freezing during both cue presentations comparing 3-month-old male AgRP-cre (n=8) with age- and sex-matched AgRP-cre;PtprdFlox / Flox(n=6) mice (D) Fear acquisition on Day 1 comparing 3-month-old male CaMKIIα-cre (n=11) with age- and sex-matched CaMKIIα- cre;PtprdFlox / Flox(n=9) mice (E) Percent freezing during Day 2 habituation comparing 3- month-old male CaMKIIα-cre (n=11) with age- and sex-matched CaMKIIα- cre;PtprdFlox / Flox(n=9) mice (F) Average percent freezing during cue presentation comparing 3-month-old male CaMKIIα-cre (n=11) with age- and sex-matched CaMKIIα- cre;PtprdFlox / Flox(n=9) mice. Data are represented as mean ± SEM in (A,D) and mean ± SEM with individual data points in (B,C,E,F). Two-way ANOVA was used in (A,D) and two- sided unpaired t-test was used in (B,C,E,F). *, p<0.05; **, p<0.01; ****, p<0.0001.

[0049] Figs.12(A-J) illustrate graphs showing asprosin supplementation does not impact other memory types in 5xFAD mice (A-D) 6-month-old WT male mice were tail- vein-injected with AAV8-empty and age- and sex-matched 5xFAD mice were tail-vein- injected with AAV8-empty or AAV8-asprosin (1 × 1012GC / mouse) viruses, and at 9 months of age behavioral phenotyping was conducted. (A) Total distance traveled in 15 minutes in the open field test (WT; AAV8-Empty (n=19) 5xFAD; AAV8-Empty (n=11), 5xFAD; AAV8-Asprosin (n=11)). (B) Open field center-to-periphery ratio, used as a measure of anxiety (WT; AAV8-Empty (n=19) 5xFAD; AAV8-Empty (n=11), 5xFAD; AAV8-Asprosin (n=11)) (C) Novel Object Recognition index (WT; AAV8-Empty (n=16) 5xFAD; AAV8- Empty (n=10), 5xFAD; AAV8-Asprosin (n=11)) (D) Total time spent in the target quadrant for Barnes maze (WT; AAV8-Empty (n=19) 5xFAD; AAV8-Empty (n=8), 5xFAD; AAV8- Asprosin (n=8)) (E-H) 6-month-old WT female mice were tail-vein-injected with AAV8- empty and age- and sex-matched 5xFAD mice were tail-vein-injected with AAV8-empty or AAV8-asprosin (1 × 1012GC / mouse) viruses, and at 9 months of age behavioral phenotyping was conducted. (E) Total distance traveled in 15 minutes in the open field test (WT; AAV8- Empty (n=11) 5xFAD; AAV8-Empty (n=8), 5xFAD; AAV8-Asprosin (n=11)) (F) Open fieldcenter-to-periphery ratio, used as a anxiety (WT; AAV8-Empty (n=11) 5xFAD; AAV8-Empty (n=8), 5xFAD; AAV8-Asprosin (n=11)) (G) Novel Object Recognition index (WT; AAV8-Empty (n=11) 5xFAD; AAV8-Empty (n=8), 5xFAD; AAV8-Asprosin (n=6)) (H)Total time spent in the target quadrant for Barnes maze (WT; AAV8-Empty (n=12) 5xFAD; AAV8-Empty (n=5), 5xFAD; AAV8-Asprosin (n=4)) (I-J) Plasma asprosin in mice treated with AAV8-Asprosin in (I)WT (WT; AAV8-Empty (n=14) WT; AAV8-Asprosin (n=8)) and (J) 5xFAD (5xFAD; AAV8-Empty (n=10), 5xFAD; AAV8-Asprosin (n=8)) male mice. Data are represented as mean ± SEM in (A-H) and mean ± SEM with individual data points in (A-H). One-way ANOVA analysis was used followed by tukey’s multiple comparison post hoc test (A-H) and one-tailed unpaired t-test (I,J). *, p<0.05; **, p<0.01; ****, p<0.0001.

[0050] Figs.13(A-G) illustrate graphs showing Asprosin gene therapy restores associative and recognition memory in APPNL-GFmodel (A) Body Weight Changes: Body weight change over a three-month period (from 6 to 9 months of age) in (male APPNL-G-Fmice (n^=^13 per group) treated with either AAV8-Empty control or AAV8-Asprosin (1^×^10¹² genome copies [GC] / mouse). (B-E) 6-month-old WT male mice were tail-vein-injected with AAV8-empty and age- and sex-matched 5xFAD mice were tail-vein-injected with AAV8- empty or AAV8-asprosin (1 × 1012GC / mouse) viruses, and at 9 months of age behavioral phenotyping was conducted (B) Novel object recognition (C) Total time spent in the target quadrant for Barnes maze (D) Y maze € Contextual fear conditioning (F,G) Associative Memory in APPNL-G-FMice: Six-month-old male APPNL-G-Fmice were tail-vein-injected with AAV8-Empty or AAV8-Asprosin (1^×^10¹² GC / mouse). Associative memory was assessed at 9 months of age. (F) Fear acquisition on Day 1 (G) Average percent freezing during cue presentation (n^=^12 per group). DETAILED DESCRIPTION

[0051] Unless otherwise defined, scientific and technical terms used herein shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Generally, nomenclatures utilized in connection with, and techniques of, cell and tissue culture, molecular biology, and protein and oligo- or polynucleotide chemistry and hybridization described herein are those well-known and commonly used in the art.

[0052] For convenience, certain in the specification, examples, and appended claims are collected here. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0053] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0054] The terms "comprise," "comprising," "include," "including," "have," and "having" are used in the inclusive, open sense, meaning that additional elements may be included. The terms "such as", "e.g.,", as used herein are non-limiting and are for illustrative purposes only. "Including" and "including but not limited to" are used interchangeably.

[0055] The term "or" as used herein should be understood to mean "and / or” unless the context clearly indicates otherwise.

[0056] As used herein, the term "about" or "approximately" refers to a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that varies by as much as 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length. In one embodiment, the term "about" or "approximately" refers a range of quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length ± 15%, ± 10%, ± 9%, ± 8%, ± 7%, ± 6%, ± 5%, ± 4%, ± 3%, ± 2%, or ± 1% about a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length.

[0057] As used herein, “one or more of a, b, and c” means a, b, c, ab, ac, bc, or abc. The use of “or” herein is the inclusive or.

[0058] The term "administering" to a patient includes dispensing, delivering or applying an active compound or agent in a pharmaceutical formulation to a subject by any suitable route for delivery of the active compound to the desired location in the subject (e.g., to thereby contact a desired cell), including administration into the cerebrospinal fluid or across the blood-brain barrier, delivery by either the parenteral or oral route, intramuscular injection, subcutaneous or intradermal injection, intravenous injection, buccal administration, transdermal delivery and administration by the rectal, colonic, vaginal, intranasal or respiratory tract route.

[0059] The terms “Adeno-associated and “AAV” refer to viral particles, in whole or in part, of the family Parvoviridae and the genus Dependoparvovirus. AAV is a small replication-defective, nonenveloped virus. AAV includes, but is not limited to, AAV serotype 1, AAV serotype 2, AAV serotype 3 (including serotypes 3A and 3B), AAV serotypes 4, AAV serotypes 5, AAV serotypes 6, AAV serotypes 7, AAV serotypes 8, AAV serotypes 9, AAV serotypes 10, AAV serotypes 11, AAV serotypes 12, AAV serotype 13, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, and any variant of any of the foregoing. Wild-type AAV is replication deficient and requires co-infection of cells by a helper virus, e.g., adenovirus, herpes, or vaccinia virus, e.g., an Ad2 or Ad5 virus, or supplementation of helper viral genes, in order to replicate.

[0060] An "effective amount" of an agent is an amount sufficient to achieve a desired therapeutic or pharmacological effect, such as an amount that is capable of increasing plasma levels of asprosin and / or the analogue thereof in a subject. An effective amount of an agent as defined herein may vary according to factors, such as the disease state, age, and weight of the subject, and the ability of the agent to elicit a desired response in the subject. Dosage regimens may be adjusted to provide the optimum therapeutic response. An effective amount is also one in which any toxic or detrimental effects of the active compound are outweighed by the therapeutically beneficial effects.

[0061] The term “encoding” refers to the inherent property of a nucleic acid to serve as a template, whether directly (i.e., a sense strand) or indirectly (i.e., an antisense strand) for synthesis of peptide, polypeptides, proteins, or other nucleic acids (i.e., rRNA, tRNA, microRNA). A nucleic acid can “encode” whether it is the sense strand, antisense strand, or a double-stranded segment thereof. The sense strand directly encodes the rRNA, tRNA, microRNA, or mRNA. The mRNA then serves as the template for translation of a peptide, polypeptide, or protein. The anti-sense strand is generally considered to be the reverse complementary sequence and is sometimes called a “non-coding” strand in the art (although for present purposes “non-coding” is a misnomer because the non-coding strand still “encodes” the genetic information by perpetuating it during semi-conservative replication by acting as a template for the polymerization of a new, sense strand). Within semi-conservative replication two single strands in double-stranded nucleic acids are separated, and a new strand is polymerized from the information from each of the single-stranded nucleic acids (i.e., single-stranded template), regardless of whether one single-stranded template is thesense strand (e.g., that which is used to mRNA and thereby, or directly, encode the translate or protein) or the antisense strand. By perpetuating genetic information, the antisense strand is still encoding the genetic information for, for example, a protein. Accordingly, “a nucleic acid encoding X”, includes sense and antisense sequences or strands whether X is a peptide, a polypeptide, or a protein or X is a sequence that encodes a rRNA, tRNA, microRNA, antisense RNA, etc.

[0062] Further to which, “nucleic acid encoding X,” includes RNA, DNA, and combinations thereof, since nucleic acids are synthesized from transcription, reverse- transcription, and replication, as naturally occurring processes and man-made processes (recombinant biology, molecular biology, etc.).

[0063] Accordingly, a recited nucleic acid sequence contemplates and supports the complementary version thereof, the reverse complementary version thereof, and double- stranded versions thereof. That is, “a nucleic acid comprising SEQ ID NO: X” is to be understood, contemplate, and support “a nucleic acid comprising the reverse complementary of SEQ ID N: X” or, using the nomenclature regarding the prime symbol as in “′”, “a nucleic acid comprising SEQ ID NO: X′,” unless otherwise specified. For example, “the nucleic acid comprising SEQ ID NO: X” wherein SEQ ID NO.: X is 5′-ATGCC-3′ contemplates and supports the reverse complementary of SEQ ID NO.:X, and specifically 5′-GGCAT-3.

[0064] As noted above, a recited nucleic acid sequence contemplates and supports conversion between RNA and DNA versions thereof. For example, if SEQ ID NO.: X is “5′-ATGCC-3′,” contemplated and supported is 5′-AUGCC-3′, as well as the reverse complementary thereof, 5′-GGCAU-3.

[0065] The term "expression" refers to the process by which nucleic acid is translated into peptides or is transcribed into RNA, which, for example, can be translated into peptides, polypeptides or proteins. If the nucleic acid is derived from genomic DNA, expression may, if an appropriate eukaryotic host cell or organism is selected, include splicing of the mRNA. For heterologous nucleic acid to be expressed in a host cell, it must initially be delivered into the cell and then, once in the cell, ultimately reside in the nucleus.

[0066] The term "genetic therapy" and grammatical variants thereof (e.g., "gene therapy"), involves the transfer of heterologous DNA to cells of a mammal, particularly a human, with a disorder or conditions for which therapy or diagnosis is sought. The DNA isintroduced into the selected target cells in that the heterologous DNA is expressed and a therapeutic product encoded thereby is produced. Alternatively, the heterologous DNA may in some manner mediate expression of DNA that encodes the therapeutic product; it may encode a product, such as a peptide or RNA that in some manner mediates, directly or indirectly, expression of a therapeutic product. Genetic therapy may also be used to deliver nucleic acid encoding a gene product to replace a defective gene or supplement a gene product produced by the mammal or the cell in which it is introduced. The heterologous DNA encoding the therapeutic product may be modified prior to introduction into the cells of the afflicted host in order to enhance or otherwise alter the product or expression thereof.

[0067] The term "gene" or "recombinant gene" refers to a nucleic acid comprising an open reading frame encoding a polypeptide, including both exon and (optionally) intron sequences.

[0068] The term "heterologous nucleic acid sequence" is typically DNA that encodes RNA and proteins that are not normally produced in vivo by the cell in which it is expressed or that mediates or encodes mediators that alter expression of endogenous DNA by affecting transcription, translation, or other regulatable biochemical processes. A heterologous nucleic acid sequence may also be referred to as foreign DNA. Any DNA that one of skill in the art would recognize or consider as heterologous or foreign to the cell in which it is expressed is herein encompassed by heterologous DNA. Examples of heterologous DNA include, but are not limited to, DNA that encodes traceable marker proteins, such as a protein that confers drug resistance, DNA that encodes therapeutically effective substances, and DNA that encodes other types of proteins, such as antibodies.

[0069] The phrases "parenteral administration" and "administered parenterally" as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion.

[0070] The phrases "systemic administration," "administered systemically," "peripheral administration" and "administered peripherally" as used herein mean the administration of a compound, drug or other material other than directly into a target tissue, such that it enters theanimal's system and, thus, is subject to and other like processes, for example, subcutaneous administration.

[0071] The term "patient" or "subject" or "animal" or "host" or “individual” refers to any mammal. The subject may be a human but can also be a mammal in need of veterinary treatment, e.g., domestic animals (e.g., dogs, cats, and the like), farm animals (e.g., cows, sheep, fowl, pigs, horses, and the like) and laboratory animals (e.g., rats, mice, guinea pigs, and the like).

[0072] The terms "polynucleotide", "nucleotide", and “nucleic acid” are used interchangeably herein.

[0073] The terms "polynucleotide sequence", "nucleotide sequence", and “nucleic acid sequence” are also used interchangeably herein.

[0074] The terms "peptide" or "polypeptide" are used interchangeably herein and refer to compounds consisting of from about 2 to about 90 amino acid residues, inclusive, wherein the amino group of one amino acid is linked to the carboxyl group of another amino acid by a peptide bond. A peptide can be, for example, derived or removed from a native protein by enzymatic or chemical cleavage, or can be prepared using conventional peptide synthesis techniques (e.g., solid phase synthesis) or molecular biology techniques (see Sambrook et al., MOLECULAR CLONING: LAB. MANUAL (Cold Spring Harbor Press, Cold Spring Harbor, NY, 1989)). A "peptide" can comprise any suitable L-and / or D-amino acid, for example, common a-amino acids (e.g., alanine, glycine, valine), non-a-amino acids (e.g., P- alanine, 4-aminobutyric acid, 6aminocaproic acid, sarcosine, statine), and unusual amino acids (e.g., citrulline, homocitruline, homoserine, norleucine, norvaline, ornithine). The amino, carboxyl and / or other functional groups on a peptide can be free (e.g., unmodified) or protected with a suitable protecting group. Suitable protecting groups for amino and carboxyl groups, and means for adding or removing protecting groups are known in the art. See, e.g., Green & Wuts, PROTECTING GROUPS IN ORGANIC SYNTHESIS (John Wiley & Sons, 1991). The functional groups of a peptide can also be derivatized (e.g., alkylated) using art-known methods.

[0075] Peptides can be synthesized and assembled into libraries comprising a few too many discrete molecular species. Such libraries can be prepared using well-known methods of combinatorial chemistry and can be screened as described herein or using other suitablemethods to determine if the library which can sequester asprosin. Such peptides can then be isolated by suitable means.

[0076] The term "peptidomimetic", refers to a protein-like molecule designed to mimic a peptide. Peptidomimetics typically arise either from modification of an existing peptide, or by designing similar systems that mimic peptides, such as peptoids and β-peptides. Irrespective of the approach, the altered chemical structure is designed to advantageously adjust the molecular properties such as, stability or biological activity. These modifications involve changes to the peptide that do not occur naturally (such as altered backbones and the incorporation of nonnatural amino acids).

[0077] The terms "portion", "fragment", "variant", "derivative" and "analog" or “analogue”, when referring to a polypeptide include any polypeptide that retains at least some biological activity referred to herein (e.g., inhibition of an interaction such as binding). Polypeptides as described herein may include portion, fragment, variant, or derivative molecules without limitation, as long as the polypeptide still serves its function. Polypeptides or portions thereof of the present invention may include proteolytic fragments, deletion fragments and in particular, or fragments that more easily reach the site of action when delivered to an animal.

[0078] In some embodiments, a "portion" or "fragment" polypeptide (including a domain) will be understood to mean a polypeptide of reduced length (e.g., reduced by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more residue(s) (e.g., peptide(s)) relative to a reference polypeptide, respectively, and comprising, consisting essentially of and / or consisting of a polypeptide of contiguous residues, respectively, identical or almost identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) to the reference polypeptide.

[0079] Different nucleic acids or proteins having homology are referred to herein as "homologues." The term homologue includes homologous sequences from the same and other species and orthologous sequences from the same and other species. "Homology" refers to the level of similarity between two or more nucleic acid and / or amino acid sequences in terms of percent of positional identity (i.e., sequence similarity or identity). Homology also refers to the concept of similar functional properties among different nucleic acids or proteins. Thus, the compositions and methods described herein further comprisehomologues to the nucleotide sequences of this invention. "Orthologous" and "orthologs" as used herein, refers to homologous nucleotide sequences and / or amino acid sequences in different species that arose from a common ancestral gene during speciation. A homologue or ortholog of a nucleotide sequence of this invention has a substantial sequence identity (e.g., at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100%) to the nucleotide sequence described herein.

[0080] The term "sequence identity" refers to the extent to which two optimally aligned polynucleotide or polypeptide sequences are invariant throughout a window of alignment of components, e.g., nucleotides or amino acids. "Identity" can be readily calculated by known methods including, but not limited to, those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, New York (1991).

[0081] The term "percent sequence identity" or "percent identity" refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a reference ("query") polynucleotide molecule (or its complementary strand) as compared to a test ("subject") polynucleotide molecule (or its complementary strand) when the two sequences are optimally aligned. In some embodiments, "percent identity" can refer to the percentage of identical amino acids in an amino acid sequence as compared to a reference polypeptide.

[0082] The phrase "substantially identical," or "substantial identity" in the context of two nucleic acid molecules, nucleotide sequences, polypeptide sequences, or protein sequences, refers to two or more sequences or subsequences that have at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection. In some embodiments, the substantial identity exists over a region of consecutive nucleotides of a nucleotide sequence of the invention that is about 10 nucleotidesto about 20 nucleotides, about 10 about 25 nucleotides, about 10 nucleotides to about 30 nucleotides, about 15 nucleotides to about 25 nucleotides, about 30 nucleotides to about 40 nucleotides, about 50 nucleotides to about 60 nucleotides, about 70 nucleotides to about 80 nucleotides, about 90 nucleotides to about 100 nucleotides, or more nucleotides in length, and any range therein, up to the full length of the sequence. In some embodiments, the nucleotide sequences can be substantially identical over at least about 20 nucleotides (e.g., about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 nucleotides). In some embodiments, a substantially identical nucleotide or protein sequence performs substantially the same function as the nucleotide (or encoded protein sequence) to which it is substantially identical.

[0083] For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.

[0084] Optimal alignment of sequences for aligning a comparison window are well known to those skilled in the art and may be conducted by tools such as the local homology algorithm of Smith and Waterman, the homology alignment algorithm of Needleman and Wunsch, the search for similarity method of Pearson and Lipman, and optionally by computerized implementations of these algorithms such as GAP, BESTFIT, FASTA, and TFASTA available as part of the GCG. Wisconsin Package (Accelrys Inc., San Diego, Calif.). An "identity fraction" for aligned segments of a test sequence and a reference sequence is the number of identical components which are shared by the two aligned sequences divided by the total number of components in the reference sequence segment, e.g., the entire reference sequence or a smaller defined part of the reference sequence. Percent sequence identity is represented as the identity fraction multiplied by 100. The comparison of one or more polynucleotide sequences may be to a full-length polynucleotide sequence or a portion thereof, or to a longer polynucleotide sequence. For purposes of this invention "percent identity" may also be determined using BLASTX version 2.0 for translated nucleotide sequences and BLASTN version 2.0 for polynucleotide sequences.

[0085] Two nucleotide sequences be considered substantially complementary when the two sequences hybridize to each other under stringent conditions. In some representative embodiments, two nucleotide sequences considered to be substantially complementary hybridize to each other under highly stringent conditions.

[0086] "Stringent hybridization conditions" and "stringent hybridization wash conditions" in the context of nucleic acid hybridization experiments such as Southern and Northern hybridizations are sequence dependent, and are different under different environmental parameters. An extensive guide to the hybridization of nucleic acids is found in Tijssen Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes part I chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays" Elsevier, New York (1993). Generally, highly stringent hybridization and wash conditions are selected to be about 5ºC lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH.

[0087] A polynucleotide and / or recombinant nucleic acid construct described herein can be codon optimized for expression. In some embodiments, a polynucleotide, nucleic acid construct, expression cassette, and / or vector described herein (e.g., that comprises / encodes a fusion or chimeric protein or polypeptide) may be codon optimized for expression in an organism (e.g., an animal, a plant, a fungus, an archaeon, or a bacterium). In some embodiments, the codon optimized nucleic acid constructs, polynucleotides, expression cassettes, and / or vectors of the invention have about 70% to about 99.9% (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%.99.9% or 100%) identity or more to the reference nucleic acid constructs, polynucleotides, expression cassettes, and / or vectors but which have not been codon optimized.

[0088] In any of the embodiments described herein, a polynucleotide or nucleic acid construct described herein may be operatively linked or associated with a variety of promoters and / or other regulatory elements for expression in an organism or cell thereof. Thus, in some embodiments, a polynucleotide or nucleic acid construct described herein may further comprise one or more promoters, introns, enhancers, and / or terminators operably linked to one or more nucleotide sequences. In some embodiments, a promoter may be operably associated with an intron. In some embodiments, a promoter associated with an intron may be referred to as a "promoter region".

[0089] A polynucleotide sequence RNA) is "operatively linked" to an expression control sequence when the expression control sequence controls and regulates the transcription and translation of that polynucleotide sequence. The term "operatively linked" includes having an appropriate start signal (e.g., ATG) in front of the polynucleotide sequence to be expressed and maintaining the correct reading frame to permit expression of the polynucleotide sequence under the control of the expression control sequence, and production of the desired polypeptide encoded by the polynucleotide sequence.

[0090] A "promoter" is a nucleotide sequence that controls or regulates the transcription of a nucleotide sequence (e.g., a coding sequence) that is operably associated with the promoter. The coding sequence controlled or regulated by a promoter may encode a polypeptide and / or a functional RNA. Typically, a "promoter" refers to a nucleotide sequence that contains a binding site for RNA polymerase II and directs the initiation of transcription. In general, promoters are found 5', or upstream, relative to the start of the coding region of the corresponding coding sequence.

[0091] Promoters can include, for example, constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-preferred and / or tissue- specific promoters for use in the preparation of recombinant nucleic acid molecules, e.g., "synthetic nucleic acid constructs" or "protein-RNA complex." These various types of promoters are known in the art.

[0092] The choice of promoter may vary depending on the temporal and spatial requirements for expression, and also may vary based on the host cell to be transformed. Promoters for many different organisms are well known in the art. Based on the extensive knowledge present in the art, the appropriate promoter can be selected for the particular host organism of interest. Thus, for example, much is known about promoters upstream of highly constitutively expressed genes in model organisms and such knowledge can be readily accessed and implemented in other systems as appropriate.

[0093] A “constitutive” promoter is a nucleotide sequence which, when operably linked with a polynucleotide that encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell and without requiring the addition of exogenous factors or the introduction of a different phenotype to the cell. This constitutive promoter can be cell-specific so long as it is produced in the specific, or target, cell under most or all physiological conditions of the cell.

[0094] The term "recombinant," as means that a protein is derived from a prokaryotic or eukaryotic expression system.

[0095] The term "therapeutically effective" means that the amount of the composition used is of sufficient quantity to ameliorate one or more causes, symptoms, or sequelae of a disease or disorder. Such amelioration only requires a reduction or alteration, not necessarily elimination, of the causes, symptoms, or sequelae of a disease or disorder.

[0096] The term "treatment" refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder.

[0097] The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Preferred vectors are those capable of one or more of, autonomous replication and expression of nucleic acids to which they are linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors".

[0098] By way of example, inverted-terminal repeats (ITRs) from adeno-associated viruses (AAVs) constitute a vector when adjoined to the nucleic acid encoding a target protein because the ITRs will provide for the nucleic acid encoding the target protein to be packaged within an AAV virion. ITRs also provide other cis-acting functions for expression of the nucleic acid encoding the target protein in the host cell upon entry of the vector into the host cell. Such cis-acting functions of ITRs include aiding in concatemer formation for genomic insertion; initiation of second strand formation in the case of a single-stranded (ss) AAV (ssAAV) vector; or initiation of replication and transcription in the case of ssAAV and self-complementary (sc) AAV (scAAV) vectors. In this regard, the AAV ITRs can becharacterized based on the nucleic acid providing such cis-acting functions from the serotypes of AAVs. That is, an ITR isolated from an AAV2 serotype can be known as an AAV2 ITR, even though the ITR generally does not contribute to the serotype of an AAV.

[0099] “Expression vector” refers to a vector comprising an expressing region. An expressing region includes a recombinant polynucleotide comprising a nucleic acid that controls expression (i.e. a promoter) and a nucleic acid that encodes. The nucleic acid that encodes includes a nucleic acid that encodes a protein. Generally, the promoter is operatively linked to the nucleic acid that encodes the target protein in a manner that is capable of promoting expression of the protein upon entry of the vector into the host cell. In some embodiments, the promoter can be operably linked by ensuring that there is no codon misalignment.

[0100] The term "wild type" (or "WT") refers to the naturally-occurring polynucleotide sequence encoding a protein, or a portion thereof, or protein sequence, or portion thereof, respectively, as it normally exists in vivo. As used herein, the term "nucleic acid" refers to polynucleotides, such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The term should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides.

[0101] The agents, compounds, compositions, polypeptides, proteins, etc. used in the methods described herein are considered to be purified and / or isolated prior to their use. Purified materials are typically "substantially pure", meaning that a nucleic acid, polypeptide or fragment thereof, or other molecule has been separated from the components that naturally accompany it. Typically, the polypeptide is substantially pure when it is at least 60%, 70%, 80%, 90%, 95%, or even 99%, by weight, free from the proteins and other organic molecules with which it is associated naturally. For example, a substantially pure polypeptide may be obtained by extraction from a natural source, by expression of a recombinant nucleic acid in a cell that does not normally express that protein, or by chemical synthesis. "Isolated materials" have been removed from their natural location and environment. In the case of an isolated or purified domain or protein fragment, the domain or fragment is substantially free from amino acid sequences that flank the protein in the naturally-occurring sequence. The term "isolated DNA" means DNA has been substantially freed of the genes that flank thegiven DNA in the naturally occurring Thus, the term "isolated DNA" encompasses, for example, cDNA, cloned genomic DNA, and synthetic DNA.

[0102] The term “cognitive decline” refers to a reduction in one or more cognitive abilities, such as memory, awareness, judgement, and mental acuity, across the adult lifespan. The presence and degree of decline varies with the cognitive ability being measured as fluid abilities often show greater declines than crystallized. Cognitive decline is a part of normal healthy aging, but a severe decline is not normative and could be symptomatic of disease. Cognitive decline is the primary symptom of disease-induced dementias, such as Alzheimer’s disease.

[0103] The term “memory deficits” refers to unusual forgetfulness or memory impairment where a subject may not be able to remember new events or facts, recall one or more memories of the past, or both. The memory deficits can be either short term and then resolve (transient) or it may be permanent and depending on the cause, it can get worse over time.

[0104] The term “amyloid beta (Aβ) mediated neurological pathogenesis” or “β amyloid mediated neurological pathogenesis” refers to the origination and development of neurological conditions, diseases, or disorders that are caused by the aggregation and / or accumulation of Aβ peptides.

[0105] The term “Alzheimer's disease " (AD) refers to an age-related, progressive brain disorder associated with general degeneration of the brain and initially manifesting itself with partial amnesia, and later restlessness, disorientation, aphasia, agnosia or apraxia (cognitive decline), dementia and sometimes euphoria or depressions. AD may be associated with neurological and communication disorders and the National Institute of Stroke Neurological and Communicative Disorders and Stroke, and Alzheimer's Disease and Related Disorders Association criteria.

[0106] The term “cachexia”, also known as “wasting syndrome”, refers to a complex metabolic syndrome that is associated with an underlying illness and which is characterized by the loss of body weight, which negatively affects mortality, morbidity, and quality of life.

[0107] Embodiments described herein relate to a polynucleotide for expressing asprosin and / or an analogue thereof in a subject and, particularly, a vector that includes a polynucleotide for expressing asprosin and / or an analogue thereof in a subject, and its use in gene therapy for treating and / or preventing one or more of cognitive decline and / or memorydeficits, amyloid β (Aβ) mediated pathogenesis, cachexia, and Alzheimer's disease (AD) in a subject in need thereof.

[0108] We identified that membrane bound receptor protein tyrosine phosphatase delta (Ptprd) is a central nervous system (CNS) receptor for asprosin, a fasting-induced protein hormone. In mice, Purkinje neuron-specific genetic ablation of Ptprd leads to a deficit in fear-conditioned memory similar to that caused by AD. It has been shown that AD damages Purkinje neurons, and we have shown that this damage results in a decrease in Ptprd activity.

[0109] We found that while plasma and cerebrospinal fluid (CSF) asprosin levels are unchanged in AD, the pathological accumulation of Aβ interferes with asprosin-Ptprd signaling by binding to Ptprd and inhibiting its activity. This suggests that normal asprosin levels are insufficient to activate Ptprd in the presence of Aβ. Using AD mouse models, we demonstrated that asprosin gain-of-function through a viral vector is able to fully rescue fear- conditioned memory deficits or associative memory deficits as well as novel object recognition memory deficits. Therefore, a polynucleotide that increases or promotes expression of asprosin and / or an analogue thereof can increase Ptprd activity and / or decrease Aβ induced inhibition of Ptprd activity and be used for treating and / or preventing one or more of cognitive decline and / or memory deficits, Aβ mediated neurological pathogenesis, cachexia, and AD in a subject in need thereof.

[0110] In some embodiments, the asprosin and / or analogue thereof can have an amino acid sequence at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, or at least about 140 consecutive amino acids of SEQ ID NO: 8 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the amino acid sequence of SEQ ID NO: 8.

[0111] For example, the asprosin and / or an analogue thereof can have an amino acid sequence at least about 70%, at least about 71%, at least about 72%, at least about 73%, atleast about 74%, at least about 75%, at 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to about 10 to about 140, about 20 to about 120, about 30 to about 110, about 40 to about 100, about 50 to about 90, about 60 to about 80, consecutive amino acids of SEQ ID NO: 8 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the amino acid sequence of SEQ ID NO: 8.

[0112] In other embodiments, the asprosin and / or an analogue thereof can have an amino acid sequence at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 8 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the amino acid sequence of SEQ ID NO: 8.

[0113] In still other embodiments, the asprosin and / or an analogue thereof can have an amino acid sequence at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 140 consecutive amino acids of an asprosin polypeptide having the amino acid sequencer of SEQ ID NO: 8 or1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions deletions, or combinations thereof within the asprosin polypeptide.

[0114] In some embodiments, the asprosin and / or an analogue thereof has a binding affinity KDto Ptprd (SEQ ID NO: 7) less than about 10 μM, less than about 1 μM, less than about 500 nM, less than about 400 nM, less than about 300 nM, less than about 200 nM, less than about 100 nM, less than about 10 nM, less about 1 nM, or less than about 500 pM.

[0115] The asprosin and / or an analogue thereof described herein can be subject to other various changes, substitutions, insertions, and deletions where such changes provide for certain advantages in its use. In this regard, asprosin and / or an analogue thereof that have an amino acid sequence substantially identical to asprosin and / or an analogue thereof that binds to Ptprd can correspond to or be substantially homologous with, rather than be identical to, the sequence of a recited polypeptide where one or more changes are made and it retains the ability to increase or promote one or more of activity, signaling, and / or function of Ptprd.

[0116] In some embodiments, the polynucleotide encoding asprosin and / or an analogue thereof can be introduced into a cell, in vivo or ex vivo, using a vector that includes the polynucleotide. A vector (sometimes referred to as gene delivery or gene transfer “vehicle”) refers to a macromolecule or complex of molecules comprising a polynucleotide to be delivered to the cell. The polynucleotide to be delivered may comprise a coding sequence of interest in gene therapy. Vectors include, for example, viral vectors (such as adenoviruses (Ad), adeno-associated viruses (AAV), and retroviruses), liposomes and other lipid- containing complexes, and other macromolecular complexes capable of mediating delivery of a polynucleotide to a target cell.

[0117] In some embodiments, the vector can include an expression cassette or expression region. The expression cassette can include a nucleic acid molecule or polynucleotide that includes the asprosin and / or an analogue thereof coding sequences, i.e., nucleic acid encoding asprosin or an analogue thereof, operably linked to one or more regulatory elements that promote expression of the asprosin and / or an analogue thereof coding sequence. The one or more regulatory elements can include, for example, a nucleic acid promoter, a polyadenylation (poly(A)) tail signal, and / or posttranscriptional regulatory element

[0118] In some embodiments, the nucleic acid that encodes asprosin has a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, atleast about 84%, at least about 85%, at 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 2 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 2 or a reverse complementary sequence thereof.

[0119] The expression cassette may be engineered into a genetic element and / or packaged into the capsid of a viral vector (e.g., a viral particle). Typically, such an expression cassette for generating a viral vector contains the asprosin and / or an analogue thereof sequences described herein flanked by packaging signals of the viral genome and other expression control sequences such as those described herein. Any of the expression control sequences can be optimized for a specific species using techniques known in the art including, e.g., codon optimization, as described herein.

[0120] The expression cassette typically contains a promoter sequence as part of the expression control sequences. For example, the promoter can include a liver-specific promoter, such as thyroxin binding globulin (TBG). Alternatively, other liver-specific promoters may be used, such as TTR minimal enhancer / promoter, alpha-antitrypsin promoter, LSP (845 nt)25 (requires intron-less scAAV). Although less desired, other promoters, such as viral promoters, constitutive promoters, regulatable promoters (see, e.g., WO 2011 / 126808 and WO 2013 / 04943), or a promoter responsive to physiologic cues may be used may be utilized in the vectors described herein.

[0121] In some embodiments, the promoter can include a constitutive viral transcription promoter for the production of a high level of recombinant protein in mammalian cells. For example, the promoter can include a cytomegalovirus (CMV), a simian virus 40 (SV40), or a hybrid thereof. In another example, the expression cassette described herein can include a CB7 promoter or a cytomegalovirus enhancer (CMV) / chicken β actin promoter (CAG promoter). CB7 is a chicken β-actin promoter with cytomegalovirus enhancer elements.

[0122] In some embodiments, the nucleic acid that encodes the CAG promoter has a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about97%, at least about 98%, or at least about identical to SEQ ID NO: 13 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 13 or a reverse complementary sequence thereof.

[0123] In some embodiments, the promoter can include a constitutive promoter of human origin used to drive ectopic gene expression in vivo. For example, the promoter can include a human Ubiquitin C promoter (UBC) or a human elongation factor-1 (EF-1) promoter, such as an EF-1 alpha promoter.

[0124] In some embodiments, the nucleic acid that encodes EF-1 promoter has a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 4 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 4 or a reverse complementary sequence thereof.

[0125] In addition to a promoter, the expression cassette and / or a vector may contain other appropriate control sequences, such as transcription initiation, termination, enhancer sequences, efficient RNA processing signals, such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. Examples of polyA sequences include, e.g., SV40, bovine growth hormone (bGH), and TK polyA. Examples of enhancers include, e.g., the alpha fetoprotein enhancer, the TTR minimal promoter / enhancer, LSP (TH-binding globulin promoter / alpha1-microglobulin / bikunin enhancer), amongst others. These control sequences can be operably linked to the asprosin and / or an analogue thereof sequences.

[0126] In some embodiments, the expressing region or expression cassette further includes a nucleic acid that encodes a polyadenylation (poly(A)) signal 3′ of the asprosin coding sequence such that the expressed mRNA has a polyA tail. In some embodiments, the nucleic acid that encodes the poly(A) signal comprises a bovine growth hormone (bGH) poly(A) tail signal or a simian virus 40 (SV40) poly(A) tail signal.

[0127] In some embodiments, the acid that encodes the simian virus 40 (SV40) poly(A) tail signal has a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 6 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 6 or a reverse complementary sequence thereof.

[0128] In some embodiments, the expression cassette can further include other regulatory elements that may enhance the expression of the nucleic acid encoding asprosin or an analogue thereof. In one embodiment, the expressing region or expression cassette further includes a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). The WPRE can be downstream (3′ of), the EF-1 promoter sequence, the asprosin coding sequence and upstream (5′ of) the poly(A) tail signal.

[0129] In some embodiments, the nucleic acid that encodes WPRE has a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 5 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 5 or a reverse complementary sequence thereof.

[0130] In some embodiments, the expressing region or expression cassette is in an anti- sense (e.g., reverse complementary) orientation or in sense orientation. In some embodiments, the vector comprises two or more expressing regions. In some embodiments, the two or more expressing regions comprise one in antisense orientation and another in sense orientation

[0131] In some embodiments, the vector and / or expression cassette may further encode a secretory peptide that is expressed with the asprosin and / or an analogue thereof and promotes secretion / excretion of the asprosin and / or an analogue thereof from a cell or tissue of a subject that is treated. For example, the vector and / or expression cassette may furtherencode a signal sequence that promotes of the expressed asprosin and / or an analogue thereof from a cell. For example, the expression cassette can include a nucleic acid encoding an IL2 signal peptide. In some embodiments, the IL2 signal peptide can be downstream (3′ of), the EF-1 or CAG promoter sequence and upstream (5′ of) of the asprosin coding sequence and the poly(A) tail signal.

[0132] In some embodiments, the nucleic acid encoding the IL-2 signal peptide has a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 3 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 3 or a reverse complementary sequence thereof.

[0133] In some embodiments, the expression cassette can include an arrangement order (e.g., 5’ to 3’ arrangement order) of nucleic acids encoding an EF-1 promoter, an IL2 signal peptide, asprosin and / or the analogue thereof, WPRE, and SV40poly(A) tail signal.

[0134] In other embodiments, the expression cassette can include an arrangement order (e.g., 5’ to 3’ arrangement order) of nucleic acids encoding a CAG promoter, an IL2 signal peptide, asprosin and / or the analogue thereof, WPRE, an a SV40poly(A) tail signal.

[0135] In some embodiments, the polynucleotide can further include a nucleic acid encoding inverted terminal repeats (ITRs) flanking the expression cassette. At least one ITR can be adjacent to the EF-1 or CAG promoter (e.g., 5’-ITR) at a first end of the expression cassette, and at least one ITR can be adjacent to the poly(A) tail signal (e.g., 3’-ITR) at the second end of the expression cassette. Advantageously, this allows for efficient replication and packaging during manufacturing.

[0136] In some embodiments, the ITRs are derived from an adeno-associated virus (AAV) serotype 2 (ITR AAV2).

[0137] In some embodiments, the polynucleotide can include an arrangement order of nucleic acids encoding the 5’-ITR, EF-1 promoter or CAG promoter, IL2 signal peptide, asprosin and / or an analogue thereof, WPRE, SV40poly(A) tail signal, and 3’-ITR.

[0138] Vectors can also comprise other components or functionalities that further modulate gene delivery and / or gene expression, or that otherwise provide beneficialproperties to the targeted cells. Such other include, for example, components that influence binding or targeting to cells (including components that mediate cell-type or tissue-specific binding); components that influence uptake of the vector nucleic acid by the cell; components that influence localization of the polynucleotide within the cell after uptake (such as agents mediating nuclear localization); and components that influence expression of the polynucleotide (such as one or more transcriptional regulatory sequences). Such components also might include markers, such as detectable and / or selectable markers that can be used to detect or select for cells that have taken up and are expressing the nucleic acid delivered by the vector. Such components can be provided as a natural feature of the vector (such as the use of certain viral vectors which have components or functionalities mediating binding and uptake), or vectors can be modified to provide such functionalities.

[0139] Selectable markers can be positive, negative or bifunctional. Positive selectable markers allow selection for cells carrying the marker, whereas negative selectable markers allow cells carrying the marker to be selectively eliminated. A variety of such marker genes have been described, including bifunctional (i.e., positive / negative) markers (see, e.g., Lupton, S., WO 92 / 08796, published May 29, 1992; and Lupton, S., WO 94 / 28143, published Dec.8, 1994). Such marker genes can provide an added measure of control that can be advantageous in gene therapy contexts. A large variety of such vectors are known in the art and are generally available.

[0140] In some embodiments, the vector can include an adenovirus (Ad) vector. An "adenovirus vector" refers to a recombinant vector derived from or comprising at least a portion of an adenovirus genome. Typically, an adenovirus vector can include the complete recombinant adenovirus genome on, for example, a plasmid, cosmid, or baculovirus vector. The nucleic acid molecules can be in the form of RNA or in the form of DNA obtained by cloning or produced synthetically. The DNA may be double-stranded or single-stranded.

[0141] One of ordinary skill will recognize that elements derived from multiple serotypes may be combined in a single adenoviral vector, such as a human or simian adenovirus. Thus, chimeric adenoviral vectors can be produced that combine desired properties from different serotypes. The adenovirus vector can be derived from one of adenovirus serotypes 2, 1, 5, 6, 19, 3, 11, 7, 14, 16, 21, 12, 18, 31, 8, 9, 10, 13, 15, 17, 19, 20, 22, 23, 24 to 30, 37, 40, 41, AdHu2, AdHu 3, AdHu4, AdHu24, AdHu26, AdHu34, AdHu35, AdHu36, AdHu37, AdHu41, AdHu48, AdHu49, AdHu50, AdC6 , AdC7, AdC69, bovine Adtype 3, canine Ad type 2, sheep Ad or type 3. In particular embodiments the adenovirus vector can include a serotype 5 adenovirus (Ad5) vector.

[0142] An adenovirus vector described herein may be based on any type of adenovirus, and in certain embodiments is a human adenovirus, which may belong to any group or serotype. In some embodiments, the recombinant adenovirus is based on a human adenovirus from group A, B, C, D, E, F or G. In other embodiments, the recombinant adenovirus is based on human adenovirus serotype 5, 11, 26, 34, 35, 48, 49, or 50.

[0143] Adenovirus vectors, methods of construction and propagation thereof are well known in the art and are described, for example, in U.S. Pat. Nos.5,559,099, 5,837,511, 5,846,782, 5,851,806, 5,994,106, 5,994,128, 5,965,541, 5,981,225, 6,040,174, 6,020,191 and 6,113,913, and Thomas Shunk, "Adenoviridae and their Replication" [adenovirus and replication thereof], M.S. Horwitz, "Adenoviruses" [ adenovirus ], chapters 67 and 68, respectively, in Virology, B.N.fields et al, 3rd edition, new York Raven Press, ltd., new York (1996), and other references mentioned herein.

[0144] In some embodiments, the vector can include an adeno-associated virus (AAV) viral vector. An AAV viral vector is an AAV DNase-resistant particle having an AAV protein capsid into which is packaged nucleic acid sequences for delivery to target cells. An AAV capsid is composed of 60 capsid (cap) protein subunits, VP1, VP2, and VP3, that are arranged in an icosahedral symmetry in a ratio of approximately 1:1:10 to 1:1:20, depending upon the selected AAV. AAV serotypes may be selected as sources for capsids of AAV viral vectors (DNase resistant viral particles) including, e.g., AAV1, AAV10, AAV106.1 / hu.37, AAV11, AAV114.3 / hu.40, AAV 12, AAV127.2 / hu.41, AAV127.5 / hu.42, AAV128.1 / hu.43, AAV128.3 / hu.44, AAV130.4 / hu.48, AAV145.1 / hu.53, AAV145.5 / hu.54, AAV145.6 / hu.55, AAV16.12 / hu.11, AAV16.3, AAV16.8 / hu.10, AAV161.10 / hu.60, AAV161.6 / hu.61, AAV1- 7 / rh.48, AAV1-8 / rh.49, AAV2, AAV2.5T, AAV2-15 / rh.62, AAV223.1, AAV223.2, AAV223.4, AAV223.5, AAV223.6, AAV223.7, AAV2-3 / rh.61, AAV24.1, AAV2-4 / rh.50, AAV2-5 / rh.51, AAV27.3, AAV29.3 / bb.1, AAV29.5 / bb.2, AAV2G9, AAV-2-pre-miRNA- 101, AAV3, AAV3.1 / hu.6, AAV3.1 / hu.9, AAV3-11 / rh.53, AAV3-3, AAV33.12 / hu.17, AAV33.4 / hu.15, AAV33.8 / hu.16, AAV3-9 / rh.52, AAV3a, AAV3b, AAV4, AAV4-19 / rh.55, AAV42.12, AAV42-10, AAV42-11, AAV42-12, AAV42-13, AAV42-15, AAV42-1b, AAV42-2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, AAV42-5b, AAV42-6b, AAV42- 8, AAV42-aa, AAV43-1, AAV43-12, AAV43-20, AAV43-21, AAV43-23, AAV43-25,AAV43-5, AAV4-4, AAV44.1, AAV46.2 / hu.28, AAV46.6 / hu.29, AAV4-8 / r 11.64, AAV4-8 / rh.64, AAV4-9 / rh.54, AAV5, AAV52.1 / hu.20, AAV52 / hu.19, AAV5-22 / rh.58, AAV5-3 / rh.57, AAV54.1 / hu.21, AAV54.2 / hu.22, AAV54.4R / hu.27, AAV54.5 / hu.23, AAV54.7 / hu.24, AAV58.2 / hu.25, AAV6, AAV6.1, AAV6.1.2, AAV6.2, AAV7, AAV7.2, AAV7.3 / hu.7, AAV8, AAV-8b, AAV-8h, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAVA3.3, AAVA3.4, AAVA3.5, AAV A3.7, AAV-b, AAVC1, AAVC2, AAVC5, AAVCh.5, AAVCh.5R1, AAVcy.2, AAVcy.3, AAVcy.4, AAVcy.5, AAVCy.5R1, AAVCy.5R2, AAVCy.5R3, AAVCy.5R4, AAVcy.6, AAV-DJ, AAV-DJ8, AAVF3, AAVF5, AAV-h, AAVH-1 / hu.1, AAVH2, AAVH-5 / hu.3, AAVH6, AAVhE1.1, AAVhER1.14, AAVhEr1.16, AAVhEr1.18, AAVhER1.23, AAVhEr1.35, AAVhEr1.36, AAVhEr1.5, AAVhEr1.7, AAVhEr1.8, AAVhEr2.16, AAVhEr2.29, AAVhEr2.30, AAVhEr2.31, AAVhEr2.36, AAVhEr2.4, AAVhEr3.1, AAVhu.1, AAVhu.10, AAVhu.11, AAVhu.12, AAVhu.13, AAVhu.14 / 9, AAVhu.15, AAVhu.16, AAVhu.17, AAVhu.18, AAVhu.19, AAVhu.2, AAVhu.20, AAVhu.21, AAVhu.22, AAVhu.23.2, AAVhu.24, AAVhu.25, AAVhu.27, AAVhu.28, AAVhu.29, AAVhu.29R, AAVhu.3, AAVhu.31, AAVhu.32, AAVhu.34, AAVhu.35, AAVhu.37, AAVhu.39, AAVhu.4, AAVhu.40, AAVhu.41, AAVhu.42, AAVhu.43, AAVhu.44, AAVhu.44R1, AAVhu.44R2, AAVhu.44R3, AAVhu.45, AAVhu.46, AAVhu.47, AAVhu.48, AAVhu.48R1, AAVhu.48R2, AAVhu.48R3, AAVhu.49, AAVhu.5, AAVhu.51, AAVhu.52, AAVhu.53, AAVhu.54, AAVhu.55, AAVhu.56, AAVhu.57, AAVhu.58, AAVhu.6, AAVhu.60, AAVhu.61, AAVhu.63, AAVhu.64, AAVhu.66, AAVhu.67, AAVhu68, AAVhu.7, AAVhu.8, AAVhu.9, AAVhu.t 19, AAVLG-10 / rh.40, AAVLG-4 / rh.38, AAVLG-9 / hu.39, AAVLG-9 / hu.39, AAV- LK01, AAV-LK02, AAVLK03, AAV-LK03, AAV-LK04, AAV-LK05, AAV-LK06, AAV- LK07, AAV-LK08, AAV-LK09, AAV-LK10, AAV-LK11, AAV-LK12, AAV-LK13, AAV- LK14, AAV-LK15, AAV-LK17, AAV-LK18, AAV-LK19, AAVN721-8 / rh.43, AAV-PAEC, AAV-PAEC11, AAV-PAEC12, AAV-PAEC2, AAV-PAEC4, AAV-PAEC6, AAV-PAEC7, AAV-PAEC 8, AAVpi.1, AAVpi.2, AAVpi.3, AAVrh.10, AAVrh.12, AAVrh.13, AAVrh.13R, AAVrh.14, AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.2, AAVrh.20, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVrh.2R, AAVrh.31, AAVrh.32, AAVrh.33, AAVrh.34, AAVrh.35, AAVrh.36, AAVrh.37, AAVrh.37R2, AAVrh.38, AAVrh.39, AAVrh.40, AAVrh.43, AAVrh.44, AAVrh.45, AAVrh.46,AAVrh.47, AAVrh.48, AAVrh.48, AAVrh.48.1.2, AAVrh.48.2, AAVrh.49, AAVrh.50, AAVrh.51, AAVrh.52, AAVrh.53, AAVrh.54, AAVrh.55, AAVrh.56, AAVrh.57, AAVrh.58, AAVrh.59, AAVrh.60, AAVrh.61, AAVrh.62, AAVrh.64, AAVrh.64R1, AAVrh.64R2, AAVrh.65, AAVrh.67, AAVrh.68, AAVrh.69, AAVrh.70, AAVrh.72, AAVrh.73, AAVrh.74, AAVrh.8, AAVrh.8R, AAVrh8R, AAVrh8R A586R mutant, AAVrh8R R533A mutant, BAAV, B P61 AAV, B P62 AAV, B P63 AAV, bovine AAV, caprine AAV, Japanese AAV10, true type AAV (ttAAV), UPENN AAV 10, AAV-LK 16, AAAV, AAV Shuffle 100-1, AAV Shuffle 100-2, AAV Shuffle 100-3, AAV Shuffle 100-7, AAV Shuffle 10-2, AAV Shuffle 10-6, AAV Shuffle 10-8, AAV SM 100-10, AAV SM 100-3, AAV SM 10-1, AAV SM 10-2, and / or AAV SM 10-8.

[0145] In other embodiments, the AAV serotypes may be selected AAV1, AAV2, AAV6, AAV8, AAV9, AAVrh74, AAVrh10, AAV5, AAV7, AAVS3, AAVHSC, AAV2.7m8, AAV-LK03, AAV8 / Olig001, AAV2i8, AAVhu37, AAV2tYF, AAVh1, AAVhu68, AAVrh.8, AAVrh9, AAV.PHP.B., AAV.PHP.eB, AAV.PHP.S, AAV / BBB, AAV-DJ, AAVr3.45, AAV-sh10, AAV2(Y444F), AAV4, AAV-RPF2, AAV3b, AAVrh64R1, or variants of any of the known or mentioned AAVs or AAVs yet to be discovered. See, e.g., US Published Patent Application No.2007-0036760-A1; US Published Patent Application No.2009-0197338-A1; EP 1310571. See also, WO 2003 / 042397 (AAV7 and other simian AAV), U.S. Pat. No.7,790,449 and U.S. Pat. No.7,282,199 (AAV8), WO 2005 / 033321 and U.S. Pat. No.7,906,111 (AAV9), and WO 2006 / 110689, and WO 2003 / 042397 (rh.10). In particular embodiments, the AAV viral vector is an AAV1 or AAV8 serotype AAV viral vector.

[0146] Alternatively, a recombinant AAV based upon any of the recited AAVs, may be used as a source for the AAV capsid. In some embodiments, an AAV cap for use in the viral vector can be generated by mutagenesis (i.e., by insertions, deletions, or substitutions) of one of the aforementioned AAV Caps or itsnucleic acid. In some embodiments, the AAV capsid is chimeric, comprising domains from two or three or four or more of the aforementioned AAV capsid proteins. In some embodiments, the AAV capsid is a mosaic of Vp1, Vp2, and Vp3 monomers from two or three different AAVs or recombinant AAVs. In some embodiments, an rAAV composition comprises more than one of the aforementioned Caps.

[0147] For packaging an expression into virions, the ITRs are the only AAV components required in cis in the same construct as the gene. In one embodiment, the coding sequences for the replication (rep) and / or capsid (cap) are removed from the AAV genome and supplied in trans or by a packaging cell line in order to generate the AAV vector. For example, a pseudotyped AAV may contain ITRs from a source which differs from the source of the AAV capsid. Additionally, or alternatively, a chimeric AAV capsid may be utilized. Still other AAV components may be selected. Sources of such AAV sequences are described herein and may also be isolated or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, Va.). Alternatively, the AAV sequences may be obtained through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank, PubMed, or the like.

[0148] Methods for generating and isolating rAAV viral vectors that can be used for delivery to a subject are known in the art. See, e.g., U.S. Pat. No.7,790,449; U.S. Pat. No.7,282,199; WO 2003 / 042397; WO 2005 / 033321, WO 2006 / 110689; and U.S. Pat. No.7,588,772 B2]. In one system, a producer or host cell line is transiently transfected with an IL-Asp plasmid described herein, which encodes an expression cassette flanked by ITRs, a packaging / helper plasmid that encodes rep and cap genes, and a helper plasmid (e.g., Ad helper plasmid) to produce rAAV particles.

[0149] Examples of host cells include prokaryotes or eukaryotes (single-cell or multiple-cell), bacterial cells (e.g., strains of E. coli, Bacillus spp., Streptomyces spp), mycobacteria cells, fungal cells, yeast cells (e.g., S. cerevisiae, S. pombe, P. pastoris, P. methanolica), plant cells, insect cells (e.g., SF-9, SF-21, baculovirus-infected insect cells, or Trichoplusia ni), non-human animal cells, human cells, or cell fusions, such as hybridomas or quadromas. In some embodiments the host cell is a mammalian cell. In some embodiments, the host cell is a human, monkey, ape, hamster, rat, or mouse cell.

[0150] In some embodiments, the host cell is selected from a kidney cell (e.g., HEK293, 293 EBNA, MSR 293, MDCK, HaK, or BHK), CHO cell (e.g., CHO K1, DXB-11 CHO, or Veggie-CHO), HeLa cell, COS cell (e.g., COS-7), retinal cell, Vero cell, CV1 cell, HepG2 cell, WI38 cell, MRC 5 cell, Colo205 cell, HB 8065 cell, HL-60 cell (e.g., BHK21), Jurkat cell, Daudi cell, A431 cell (epidermal), CV-1 cell, U937 cell, 3T3 cell,L cell, C127 cell, SP2 / 0 cell, NS-0 cell, cell, Sertoli cell, BRL 3 A cell, HT1080 cell, myeloma cell, tumor cell, or a cell line derived from an aforementioned cell.

[0151] In some embodiments, the host cell comprises a kidney cell (e.g., HEK293, 293 EBNA, MSR 293, MDCK, HaK, or BHK). In certain embodiments, the host cell comprises a HEK293 cell. In some embodiments, the host cell (e.g., a HEK 293 cell) comprises or expresses an E1 polypeptide. In some embodiments, the host cell does not comprise or express an E1 polypeptide. In some embodiments, the host cell comprises a CHO cell (e.g., CHO-K, DXB-11 CHO, or Veggie-CHO). In certain embodiments, the host cell comprises a CHO-K cell. In certain embodiments, the host cell comprises a HeLa cell.

[0152] In another system, a packaging cell line that stably supplies rep and cap is transiently transfected with a IL2-Asp plasmid described herein encoding the transgene flanked by ITRs.

[0153] In each of these systems, AAV virions are produced in response to infection with helper adenovirus or herpesvirus, requiring the separation of the rAAVs from contaminating virus.

[0154] More recently, systems have been developed that do not require infection with helper virus to recover the AAV-the required helper functions (i.e., adenovirus E1, E2a, VA, and E4 or herpesvirus UL5, UL8, UL52, and UL29, and herpesvirus polymerase) are also supplied, in trans, by the system. In these newer systems, the helper functions can be supplied by transient transfection of the cells with constructs that encode the required helper functions, or the cells can be engineered to stably contain genes encoding the helper functions, the expression of which can be controlled at the transcriptional or posttranscriptional level. In yet another system, the expression cassette flanked by ITRs and rep / cap genes are introduced into insect cells by infection with baculovirus-based vectors. For reviews on these production systems, see generally, e.g., Zhang et al., 2009, "Adenovirus- adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production," Human Gene Therapy 20:922-929, the contents of each of which is incorporated herein by reference in its entirety. Methods of making and using these and other AAV production systems are also described in the following U.S. patents, the contents of each of which is incorporated herein by reference in its entirety: U.S. Pat. Nos.5,139,941; 5,741,683; 6,057,152; 6,204,059; 6,268,213; 6,491,907; 6,660,514; 6,951,753; 7,094,604; 7,172,893; 7,201,898; 7,229,823; and 7,439,065. See generally, e.g., Grieger & Samulski, 2005,"Adeno-associated virus as a gene therapy Vector development, production and clinical applications," Adv. Biochem. Engin / Biotechnol.99: 119-145; Buning et al., 2008, "Recent developments in adeno-associated virus vector technology," J. Gene Med.10:717- 733; and the references cited below, each of which is incorporated herein by reference in its entirety. The methods used to construct any embodiment described herein are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Green and Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (2012). Similarly, methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation on the present invention. See, e.g., K. Fisher et al, (1993) J. Virol., 70:520-532 and U.S. Pat. No.5,478,745.

[0155] In some embodiments, the vector used to transfect the host cell line is a circular AAV plasmid DNA that includes a backbone having a length of at least about 5000 bp or at least about 5500 bp. The term “backbone” refers to the section of the vector molecule beyond the expression cassette or, if present, the inverted terminal repeats (ITRs). In other words, the backbone of the vector is adjacent to the 5′ and 3′ termini of the expression cassette or ITRs, respectively, and forms the rest of the vector's nucleic acids besides the polynucleotide according to the invention.

[0156] In some embodiments, the AAV plasmid further includes a bacterial expression region. In some embodiments, the bacterial expressing region comprises a bacterial promoter and a nucleic acid that encodes a bacterial selecting region. In some embodiments, the nucleic acid that encodes the bacterial selecting region is operably linked to the bacterial promoter. In some embodiments, the nucleic acid that encodes the bacterial selecting region comprises a nucleic acid that encodes an antibiotic resistance gene or protein. In some embodiments, the antibiotic resistance gene or protein comprises an ampicillin resistance gene (AmpR) or a kanamycin resistance gene sequence (KanR).

[0157] The selection region of the backbone of the plasmid is at its 5′ and 3′ termini remotely spaced apart from the nucleic acid encoding asprosin and / or an analogue thereof, preferably maximally remotely spaced apart from the expression cassette, further preferably ≥1,000 bp, further preferably ≥1,500 bp, highly preferably ≥1,900 bp spaced apart from the expression cassette.

[0158] In some embodiments, the further comprises an origin of replication (ORI). The ORI can include, for example, a pUC18 ORI. In other embodiments, the ORI can include a CMV ORI. In some embodiments, the plasmid further includes a eukaryotic expressing region. In some embodiments, the eukaryotic expressing region includes a eukaryotic promoter and a nucleic acid that encodes a eukaryotic selecting region. In some embodiments, the nucleic acid that encodes a eukaryotic selecting region is operably linked to the eukaryotic promoter. In some embodiments, the eukaryotic promoter comprises nucleic catabolite activator protein (CAP) binding site or a lactose (lac) promoter. In some embodiments, the eukaryotic selecting region comprises a lac operator. In some embodiments the plasmid comprises an M13 reverse primer region.

[0159] In some embodiments, an AAV plasmid is provided that may be used to prepare a recombinant AAV viral particles having a recombinant genome that includes a nucleotide sequence encoding the asprosin or an analogue thereof operably linked to regulatory elements that promote expression in appropriate tissues. The plasmids provided herein generally have an origin of replication and selectable markers to permit reproduction of the plasmid and use in host cells for generating the recombinant AAV viral particles described herein.

[0160] Examples of AAV8 plasmids and AAV1 plasmids are depicted in Figs.1, 2, and 3. The plasmids provided herein include plasmids comprising the expression cassettes described herein. In particular, the AAV plasmids can have a nucleotide sequence of SEQ ID NO: 14, 15, or 16, which correspond respectively to AV0-BWS-IL2-Asp (SEQ ID NO: 14), AAV1-CAG-BWS-IL2-His-Asp (SEQ ID NO: 15), and AAV8(Kan)-BWS-IL2-Asp (SEQ ID NO: 16) described herein.

[0161] In certain embodiments, the AAV plasmid comprises a nucleic acid having a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 14, 15, 16; or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions, additions, deletions, or combinations thereof within.

[0162] AAV particles or rAAV particles produced using methods described herein may be of any AAV serotype. AAV serotypes generally have different tropisms to infect different tissues. In some embodiments, an AAV serotype is selected based on a tropism.

[0163] In certain embodiments, an comprises an AAV1 serotype or a variant thereof. In certain embodiments, an AAV particle comprises an AAV5 serotype or a variant thereof. In certain embodiments, an AAV particle comprises an AAV8 serotype or a variant thereof. In certain embodiments, an AAV particle comprises an AAV9 serotype or a variant thereof. In certain embodiments, an AAV particle comprises AAVhu68 or a variant thereof. In certain embodiments, an AAV particle comprises AAVrh10 or a variant thereof.

[0164] In some embodiment, a plurality of rAAV particles are produced with methods described herein at a higher titer, e.g., such there is improved rAAV particle production. In some embodiments, the improved production comprises a higher yield of the plurality of rAAV particles relative to a plurality of rAAV particles produced with a helper vector comprising a nucleic acid sequence of an antibiotic resistance gene other than KanR (e.g., an Ampicillin resistance gene). In some embodiments, a high titer is relative to AAV particles produced from a reference helper vector (e.g., an Ad5 vector, e.g., an Ad5 vector described herein), e.g., under otherwise identical conditions.

[0165] Optionally, the nucleic acid encoding asprosin and / or an analogue thereof described herein may be delivered via viral vectors other than rAAV or rAD. For example, other viral vectors that can be used herein include herpes simplex virus (HSV)-based vectors. HSV vectors deleted of one or more immediate early genes (IE) are advantageous because they are generally non-cytotoxic, persist in a state similar to latency in the target cell, and afford efficient target cell transduction. Recombinant HSV vectors can incorporate approximately 30 kb of heterologous nucleic acid.

[0166] Retroviruses, such as C-type retroviruses and lentiviruses, might also be used in the application. For example, retroviral vectors may be based on murine leukemia virus (MLV). See, e.g., Hu and Pathak, Pharmacol. Rev.52:493-511, 2000 and Fong et al., Crit. Rev. Ther. Drug Carrier Syst.17:1-60, 2000. MLV-based vectors may contain up to 8 kb of heterologous (therapeutic) DNA in place of the viral genes. The heterologous DNA may include a tissue-specific promoter and a nucleic acid encoding the asprosin and / or an analogue thereof. In methods of delivery to neural cells, it may also encode a ligand to a tissue specific receptor.

[0167] Additional retroviral vectors that might be used are replication-defective lentivirus-based vectors, including human immunodeficiency (HIV)-based vectors. See, e.g., Vigna and Naldini, J. Gene Med.5:308-316, 2000 and Miyoshi et al., J. Virol.72:8150-8157, 1998. Lentiviral vectors are in that they are capable of infecting both actively dividing and non-dividing cells.

[0168] Lentiviral vectors for use in the application may be derived from human and non-human (including SIV) lentiviruses. Examples of lentiviral vectors include nucleic acid sequences required for vector propagation as well as a tissue-specific promoter operably linked to an asprosin and / or an analogue thereof encoding nucleic acid. These former may include the viral LTRs, a primer binding site, a polypurine tract, att sites, and an encapsidation site.

[0169] In some embodiments, a lentiviral vector can be employed. Lentiviruses have proven capable of transducing different types of CNS neurons (Azzouz et al., (2002) J Neurosci.22: 10302-12) and may be used in some embodiments because of their large cloning capacity.

[0170] A lentiviral vector may be packaged into any lentiviral capsid. The substitution of one particle protein with another from a different virus is referred to as “pseudotyping”. The vector capsid may contain viral envelope proteins from other viruses, including murine leukemia virus (MLV) or vesicular stomatitis virus (VSV). The use of the VSV G-protein yields a high vector titer and results in greater stability of the vector virus particles.

[0171] Alphavirus-based vectors, such as those made from semliki forest virus (SFV) and sindbis virus (SIN) might also be used in the application. Use of alphaviruses is described in Lundstrom, K., Intervirology 43:247-257, 2000 and Perri et al., Journal of Virology 74:9802-9807, 2000.

[0172] Recombinant, replication-defective alphavirus vectors are advantageous because they are capable of high-level heterologous (therapeutic) gene expression, and can infect a wide target cell range. Alphavirus replicons may be targeted to specific cell types by displaying on their virion surface a functional heterologous ligand or binding domain that would allow selective binding to target cells expressing a cognate binding partner. Alphavirus replicons may establish latency, and therefore long-term heterologous nucleic acid expression in a target cell. The replicons may also exhibit transient heterologous nucleic acid expression in the target cell.

[0173] In many of the viral vectors compatible with methods of the application, more than one promoter can be included in the vector to allow more than one heterologous gene to be expressed by the vector. Further, the vector can comprise a sequence, which encodes asignal peptide or other moiety, which expression of the asprosin and / or an analogue thereof from the target cell.

[0174] To combine advantageous properties of two viral vector systems, hybrid viral vectors may be used to deliver a nucleic acid encoding an asprosin and / or an analogue thereof to a target cell, or tissue. Standard techniques for the construction of hybrid vectors are well- known to those skilled in the art. Such techniques can be found, for example, in Sambrook, et al., In Molecular Cloning: A laboratory manual. Cold Spring Harbor, N.Y. or any number of laboratory manuals that discuss recombinant DNA technology. Double-stranded AAV genomes in adenoviral capsids containing a combination of AAV and adenoviral ITRs may be used to transduce cells. In another variation, an AAV vector may be placed into a “gutless”, “helper-dependent” or “high-capacity” adenoviral vector. Adenovirus / AAV hybrid vectors are discussed in Lieber et al., J. Virol.73:9314-9324, 1999. Retrovirus / adenovirus hybrid vectors are discussed in Zheng et al., Nature Biotechnol. 18:176-186, 2000. Retroviral genomes contained within an adenovirus may integrate within the target cell genome and effect stable gene expression.

[0175] In addition to viral vector-based methods, non-viral methods may also be used to introduce a nucleic acid encoding asprosin and / or an analogue thereof into a target cell. A review of non-viral methods of gene delivery is provided in Nishikawa and Huang, Human Gene Ther.12:861-870, 2001. An example of a non-viral gene delivery method according to the application employs plasmid DNA to introduce a nucleic acid encoding a asprosin and / or an analogue thereof into a cell. Plasmid-based gene delivery methods are generally known in the art.

[0176] Synthetic gene transfer molecules can be designed to form multimolecular aggregates with plasmid DNA. These aggregates can be designed to bind to a target cell. Cationic amphiphiles, including lipopolyamines and cationic lipids, may be used to provide receptor-independent nucleic acid transfer into target cells.

[0177] In addition, preformed cationic liposomes or cationic lipids may be mixed with plasmid DNA to generate cell-transfecting complexes. Methods involving cationic lipid formulations are reviewed in Felgner et al., Ann. N.Y. Acad. Sci.772:126-139, 1995 and Lasic and Templeton, Adv. Drug Delivery Rev.20:221-266, 1996. For gene delivery, DNA may also be coupled to an amphipathic cationic peptide (Fominaya et al., J. Gene Med. 2:455-464, 2000).

[0178] Methods that involve both non-viral based components may be used according to the application. For example, an Epstein Barr virus (EBV)-based plasmid for therapeutic gene delivery is described in Cui et al., Gene Therapy 8:1508-1513, 2001. Additionally, a method involving a DNA / ligand / polycationic adjunct coupled to an adenovirus is described in Curiel, D. T., Nat. Immun.13:141-164, 1994.

[0179] Additionally, the nucleic acid encoding the asprosin and / or an analogue thereof can be introduced into the target cell by transfecting the target cells using electroporation techniques. Electroporation techniques are well known and can be used to facilitate transfection of cells using plasmid DNA.

[0180] The asprosin and / or an analogue thereof can be expressed for any suitable length of time within the target cell, including transient expression and stable, long-term expression. Advantageously, the asprosin and / or an analogue can be expressed in and secreted from hepatic cells using an AAV1 or AAV8 vector at a level or amount effective to increase plasma levels in the subject being treated. By enhancing plasma levels of asprosin, a hormone capable of autonomously traversing the blood-brain barrier, challenges associated with directly transducing neurons in the CNS can be circumvented, eliminating a significant obstacle in human gene therapy applications. Additionally, the use of AAV1 or AAV8 vectors allows for sustained, long-term elevation of plasma asprosin with a single administration, providing a practical and scalable therapeutic strategy.

[0181] In some embodiments, vectors encoding asprosin and analogues thereof, can be formulated with a pharmaceutically acceptable carrier to provide a pharmaceutical compositions that can delivered to a subject, for example, subcutaneously, intranasally, parenterally, intravenously, intramuscularly, intrathecally, orally, and or by inhalation.

[0182] The pharmaceutical forms that can be injectable include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In many cases the form can be sterile and fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol,propylene glycol, and liquid polyethylene and the like), suitable mixtures thereof, and / or vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, isotonic agents, for example, sugars or sodium chloride can be included. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0183] For administration of an injectable aqueous solution, for example, the solution can be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions can be suitable for intravenous, intramuscular, subcutaneous, intracerebroventricular, and intraperitoneal administration. In this connection, a sterile aqueous medium can be employed. For example, one dosage can be dissolved in 1 mL of isotonic NaCl solution and either added to 1000 mL of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, “Remington's Pharmaceutical Sciences” 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the host. The person responsible for administration will, in any event, determine the appropriate dose for the individual host.

[0184] Sterile injectable solutions can be prepared by incorporating the vectors in the required amount in the appropriate solvent with various of the other ingredients enumerated herein, as required, followed by filtered sterilization. Generally, dispersions can be prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the methods of preparation can be vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. As used herein, “carrier” includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. Supplementary active ingredients can also be incorporated into the compositions. The phrase“pharmaceutically-acceptable” refers to entities and compositions that do not produce an allergic or similar untoward reaction when administered to a host.

[0185] Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like, may be used for the introduction of the compositions of the present disclosure into suitable host cells. In particular, the AAV vector delivered transgenes can be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, or a nanoparticle or the like.

[0186] Such formulations can be used for the introduction of pharmaceutically acceptable formulations of the nucleic acids or the AAV constructs disclosed herein. The formation and use of liposomes is generally known to those of skill in the art. Recently, liposomes were developed with improved serum stability and circulation half-lives (U.S. Pat. No.5,741,516). Further, various methods of liposome and liposome like preparations as potential drug carriers have been described (U.S. Pat. Nos.5,567,434; 5,552,157; 5,565,213; 5,738,868 and 5,795,587).

[0187] Liposomes have been used successfully with a number of cell types that are normally resistant to transfection by other procedures. In addition, liposomes are free of the DNA length constraints that are typical of viral-based delivery systems. Liposomes have been used effectively to introduce genes, drugs, radiotherapeutic agents, viruses, transcription factors and allosteric effectors into a variety of cultured cell lines and animals. In addition, several successful clinical trials examining the effectiveness of liposome-mediated drug delivery have been completed.

[0188] Liposomes can be formed from phospholipids that can be dispersed in an aqueous medium and spontaneously form multilamellar concentric bilayer vesicles (also termed multilamellar vesicles (MLVs). MLVs generally have diameters of from 25 nm to 4 μm. Sonication of MLVs results in the formation of small unilamellar vesicles (SUVs) with diameters in the range of 200 to 500 Angstroms, containing an aqueous solution in the core.

[0189] Alternatively, nanocapsule formulations of the vectors can be used. Nanocapsules can generally entrap substances in a stable and reproducible way. To avoid side effects due to intracellular polymeric overloading, such ultrafine particles (sized around 0.1 p.m) should be designed using polymers able to be degraded in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use.

[0190] The pharmaceutical can be administered to any subject that can experience the beneficial effects of increasing or promoting one or more of Ptprd activity, Ptprd function, Ptprd signaling or Ptprd expression and / or decreasing Aβ induced inhibition of Ptprd activity, Ptprd function, or Ptprd signaling. Foremost among such animals are humans, although the present invention is not intended to be so limited.

[0191] In some embodiments, the vector encoding asprosin and / or an analogue thereof can be used in a method of treating cognitive decline and / or memory deficits in a subject in need thereof. The method can include administering to the subject a therapeutically effective amount of the vector encoding asprosin and / or an analogue thereof to directly or indirectly enhance, increase, and / or promote one or more of Ptprd activity, Ptprd function, Ptprd signaling or Ptprd expression and / or decrease Aβ induced inhibition of Ptprd activity, Ptprd function, or Ptprd signaling in the subject. The memory deficits treated can include, for example, associative memory deficits and novel object recognition memory deficits associated with AD and / or Aβ mediated neurological pathogenesis.

[0192] In some embodiments, the vectors can express an amount of asprosin and / or an analogue in the subject effective to increase Ptprd dephosphorylation of signal transducer and activator of transcription 3 (STAT3) and / or decrease Aβ induced STAT3 transcriptional activity in the cerebellum and, particularly Purkinje neurons of the subject. For example, the vector can express asprosin and / or an analogue thereof an amount effective to increase Ptprd dephosphorylation of STAT3 in the cerebellum of the subject at least about 35%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 105%, at least about 110%, at least about 115%, at least about 120%, at least about 125%, at least about 130%, at least about 140%, at least about 150%, at least about 160%, at least about 170%, at least about 180%, at least about 190%, or at least about 200% compared to Ptprd dephosphorylation of STAT3 in the cerebellum of the subject prior to administration of the vector. Increased levels may be by about 10% to about 200%, about 20% to about 200%, about 40% to about 200%, about 50% to about 200%, about 70% to about 200%, about 80% to about 200%, about 90% to about 200%, about 100% to about 200%, about 110% to about 200%, about 120% to about 200%, about 130% to about 200%, about 150% to about 200%, about 160% to about 200%, about 170% to about 200% or about 180% to about 200% compared to Ptprddephosphorylation of STAT3 in the of the subject prior to administration of the vector.

[0193] In another example, the vector can express an amount of asprosin and / or an analogue thereof is a subject effective to decrease Aβ induced STAT3 transcriptional activity in the cerebellum of the subject at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99% compared to Aβ induced STAT3 transcriptional activity in the cerebellum the subject prior to administration of the vector.

[0194] In one embodiment, the vector can express an amount of asprosin and / or an analogue thereof in a subject effective to enhance, increase, and / or promote one or more of the activity, signaling, and / or function of the Ptprd and / or decrease Aβ induced inhibition of Ptprd activity, Ptprd function, or Ptprd signaling in the subject.

[0195] In some embodiments, individuals to be treated have or are at risk of AD, cognition deficiency disorder, age-associated memory impairment, and / or dementia. For example, cognition deficiency disorder can relate to cognitive impairment leading to problems with a patient’s ability to think, learn, remember, use judgement, and make decisions. Signs of cognitive impairment include memory loss and trouble concentrating, completing tasks, understanding, remembering, following instructions, and solving problems.

[0196] In specific embodiments, the individuals to be treated have cognitive decline and / or memory deficits. Memory deficits can include associative memory deficits and / or novel object recognition memory deficits. Associative memory can refer to the ability to learn and remember the relationship between unrelated items or concepts. Novel object recognition memory can include a subject’s ability to recognize a novel object in the environment. In some embodiments, novel object recognition memory can be indicative of alterations in the working memory, attention, anxiety, and innate preference for novelty in a subject. In some embodiments, subjects to be treated in accordance with a method described herein that are suffering from a progressive decline in several forms of memory, including associative memory and / or novel object recognition, can also have Alzheimer’s disease.

[0197] Cognitive may be determined by art-accepted methods, including, but not limited to, validated instruments that assess global cognition (e.g., the Modified Mini Mental State Examination (3MS-E)), and specific domains such as visual and verbal memory (e.g., the Brief Visuospatial Memory Test (Revised) (BVMT-R) and the Hopkins Verbal Learning Test (Revised) (HVLT-R), respectively), language (e.g., the Generative Verbal Fluency Test (GVFT)) and executive function and attention (e.g., the Digit Span Test (DST)).

[0198] The vectors encoding asprosin and / or an analogue thereof described herein can also be used in methods and compositions for treating or preventing Aβ mediated neurological pathogenesis in a subject. Aβ monomers are easily self-assembled into oligomers, protofibrils and beta-sheet-rich fibers, and are related to the pathogenesis of neurotoxicity. The Aβ mediated neurological pathogenesis can encompass the development all neurological diseases that may be caused by the aggregation and / or accumulation of Aβs. Examples of the Aβ mediated neurological pathogenesis related diseases include, but are not limited to, dementia (e.g., AD, vascular dementia, etc.), mild cognitive impairment, cerebral amyloid angiopathy, Down's syndrome, amyloid stroke, systemic amyloid bodies (DLB), multi-infarct dementia (MID), frontotemporal lobar degeneration (FTLD), Pick's disease, corticobasal degeneration (CBD), progressive supranuclear palsy (PSP), Parkinson's disease, Huntington's disease, and the like. The beta-amyloid mediated neurological pathogenesis- related disease may be selected from all diseases resulting from the aggregation and / or accumulation of beta-amyloids disease, Dutch amyloidosis, tauopathy, dementia with Lewy.

[0199] An important pathological feature of AD, which is a representative neurodegenerative disease, is the formation of peptide aggregates called "senile plaques", which causes synaptic dysfunction and neuronal death. The main component of these senile plaques is Aβ, which is 40 to 42 amino acids in length.

[0200] Therefore, in some embodiments, the pharmaceutical compositions described herein can be administered to a subject for the treatment of AD. Unambiguous diagnosis of AD requires clinical findings of cognitive deficits consistent with AD and post-mortem identification of brain pathologies consistent with AD. The term “probable AD” is used when a subject demonstrates clinical characteristics of AD and when other possible biological causes of dementia (e.g. Parkinson's disease or stroke) are excluded. There are a variety of art-accepted methods for diagnosing probable AD. Typically, methods of diagnosing AD areused in combination. These methods an individual's ability to carry out daily activities and identifying changes in behavior and personality. Dementia of the AD type is also typically characterized by an amnestic presentation (memory deficit) or language, visuospatial or executive function deficits.

[0201] In some embodiments, the individuals to be treated may be in need of an increase in body weight, such as an increase in adipose mass and / or skeletal muscle mass. The individual may be in need of weight gain for a variety of reasons, including because of a medical condition or state or another reason. In cases wherein the individual is in need of weight gain because of a medical condition, the medical condition may or may not be a genetic condition and may or may not be an inherited condition. The cause of being in need of weight gain may be from genetics, metabolism, and / or illness.

[0202] In specific embodiments, an individual in need of weight gain is underweight (BMI of 18.5 or less). The individual that is subjected to methods and compositions of the disclosure may first be identified by a medical practitioner as in need of weight gain, and a therapeutic composition comprising at least one agent described herein may be delivered to the individual for the specific purpose of increasing weight.

[0203] In some embodiments, an individual is determined to be in need of weight gain, such as by measuring their weight and / or by measuring their BMI and / or having an MRI and / or DEXA scan for assessment of adipose mass. The individual may be known to be in need of weight gain or suspected of being in need of weight gain or at risk for being in need of weight gain. An individual may determine themselves that they are in need of weight gain and / or it may be determined by a suitable medical practitioner.

[0204] Once the individual is known to be in need of weight gain or known to be at risk or susceptible to being in need of weight gain, they may be given a suitable and effective amount of a composition including at least one agent described herein. In specific embodiments, the therapeutic agent is provided to the individual, such as in a composition or in multiple compositions. A composition comprising the agent may be specifically formulated for a particular therapeutic application.

[0205] The individual may or may not be monitored by a medical practitioner during the course of the therapeutic agent regimen. The individual may cease to take the therapeutic agent once a desirable weight is achieved and may resume taking the agent if the individual becomes in need of gaining weight at a later point in time. In the event that an individualexceeds a suitable amount of the agent too much weight is gained, the individual may decrease their weight by any suitable means, including by decreasing caloric intake.

[0206] In specific embodiments, the individual to be treated has cachexia, also referred to as “wasting syndrome”. Cachexia is typically characterized by anorexia and loss of fat and muscle mass and is known to be associated with several end‐stage organ diseases and advanced dementia. In cases wherein the individual is in need of weight gain because of cachexia, the cachexia can be associated with a chronic disease, such as but not limited to heart failure, inflammatory conditions such as chronic obstructive pulmonary disease (COPD), rheumatoid arthritis, cancer, human immunodeficiency virus, sepsis, renal and hepatic failure, dementia, and AD.

[0207] In certain embodiments, the cachexia is associated with the subject having or being at an increased risk of AD. Weight loss associated with AD is a multifactorial event, related not only to the cognitive impairment that is associated with loss of appetite and reduced food intake but also to AD‐linked alterations of energy consumption due to hypothalamic feeding dysregulation, olfactory changes and psycho‐behavioral disturbances, and the dysphagia (apraxia of swallowing) that is a common feature in the later stages of the disease, and which may also worsen malnutrition.

[0208] It will be appreciated that the amount, volume, concentration, and / or dosage of the vector encoding the asprosin and / or an analogue thereof, that is administered to any one animal or human depends on many factors, including the subject’s size, body surface area, age, the particular composition to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently. Specific variations of the above-noted amounts, volumes, concentrations, and / or dosages of the vector encoding the asprosin and / or an analogue thereof can readily be determined by one skilled in the art using the experimental methods described below.

[0209] By way of example, vectors encoding asprosin and / or an analogue thereof can often be administered less frequently than other types of therapeutics. For example, an effective amount of such a vector can range from about 0.01 mg / kg to about 5 or 10 mg / kg, inclusive; administered daily, weekly, biweekly, monthly or less frequently.

[0210] In some embodiments, the subject can be administered a fixed vector genome copy (GC) dose of purified viral vector including >99% of fully packaged viral particles. The fixed vector GC dose of a purified viral vector described herein can range from about 1x109GCs to about 1x1014GCs / kilogram In an exemplary embodiment, a subject is administered AAV8-IL2-Asprosin or AAV1-IL2-Asprosin at a fixed vector GC dose of about 1 x 1012GC / kg.

[0211] In some aspects, administering the vector described to a subject can promote or increase plasma levels of asprosin and / or an analogue thereof compared to a control. In some aspects, administering the vector described herein to a subject increase plasma levels of asprosin and / or an analogue thereof by 5-fold to 100-fold compared to control (e.g., 5-fold to 10-fold, 10-fold to 15-fold, 10-fold to 20-fold, 15-fold to 25-fold, 20-fold to 30-fold, 25-fold to 35-fold, 30-fold to 40-fold, 35-fold to 45-fold, 40-fold to 60-fold, 50-fold to 75-fold, 60- fold to 80-fold, 75-fold to 100-fold compared to a control).

[0212] In some embodiments, a therapeutically effective dose of the vector is delivered to a subject in need thereof at least once daily or at least once weekly for at least two consecutive days or weeks. In one aspect, a therapeutically effective dose of the vector is delivered to subject in need thereof at least once daily or at least once weekly for at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive days or weeks. In one aspect, a therapeutically effective dose of the vector is delivered to subject in need thereof at least once daily or at least once weekly for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 consecutive weeks. In one aspect, a therapeutically effective dose of the vector is delivered to subject in need thereof at least once daily or at least once weekly for at most 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive days or weeks. In one aspect, a therapeutically effective dose of the vector is delivered to subject in need thereof at least once daily or at least once weekly for at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 consecutive weeks or months. In one aspect, a therapeutically effective dose of the vector is delivered to subject in need thereof is administered at least once for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 consecutive months or years, chronically for a subject's entire life span, or an indefinite period of time. In one aspect, a therapeutically effective dose of the vector is delivered to subject in need thereof once a year for 2 consecutive years, 3 consecutive years, or 5 consecutive years. In one aspect, a therapeutically effective dose of the vector is delivered to subject in need thereof once a year for 2 consecutive years. In one aspect, a therapeutically effective dose of the vector is delivered to subject in need thereof once a year for 3 consecutive years. In one aspect, a therapeutically effective dose of the vector is delivered to subject in need thereof once a year for 5 consecutive years.

[0213] In some embodiments, a effective dose of the vector achieves a remission, cure, response rate, or resolution rate of cognitive decline and / or memory deficits, such as associative and novel object recognition memory deficits, of at least about 50%. The term “remission”, “cure,” or “resolution rate” refers to the percentage of subjects in need thereof that are cured or obtain remission or complete resolution of cognitive decline or memory deficits in response to a therapeutically effective dose vector. As used herein, the term “response rate” refers to the percentage of subjects in need thereof that respond positively (e.g., reduced severity or frequency of one or more symptoms, such as cognitive decline or memory deficits) to a therapeutically effective dose of the vector.

[0214] In one aspect, a therapeutically effective dose eliminates, reduces, slows, or delays, cognitive decline or memory deficits, such as associative and novel object recognition memory deficits.

[0215] In other embodiments, a therapeutically effective dose of the vector achieves remission, cure, response rate, or resolution rate of cognitive decline or memory deficits, such as associative and novel object recognition memory deficits, of between about 10% and about 99% or more. In one aspect, a therapeutically effective dose achieves remission, cure, response rate, or resolution rate of a cognitive decline or memory deficits between 10% and 100%, such as between 10% and 15%, between 10% and 20%, between 10% and 25%, between 15% and 20%, between 15% and 25%, between 15% and 30%, between 20% and 25%, between 20% and 30%, between 20% and 35%, between 25% and 30%, between 25% and 35%, between 25% and 40%, between 30% and 35%, between 30% and 40%, between 35% and 45%, between 35% and 50%, between 40% and 45%, between 40% and 50%, between 40% and 55%, between 45% and 50%, between 45% and 55%, between 45% and 60%, between 50% and 55%, between 50% and 60%, between 50% and 65%, between 55% and 60%, between 55% and 65%, between 55% and 70%, between 60% and 65%, between 60% and 70%, between 60% and 75%, between 65% and 70%, between 65% and 75%, between 65% and 80%, between 70% and 75%, between 70% and 80%, between 70% and 85%, between 75% and 80%, between 75% and 85%, between 75% and 90%, between 80% and 85%, between 80% and 90%, between 80% and 95%, between 85% and 90%, between 85% and 95%, between 85%and 100%, between 90% and 95%, between 90% and 100%, or between 95% and 100%.

[0216] In another embodiment, a effective dose of the vector eliminates, reduces, slows, or delays, one or more cognitive decline or memory deficits symptoms between 10% and 100%, such as between 10% to about 15%, between 10% and 20%, between 10% and 25%, between 15% and 20%, between 15% and 25%, between 15% and 30%, between 20% and 25%, between 20% and 30%, between 20% and 35%, between 25 and 30%, between 25% and 35%, between 25% and 40%, between 30% and 35%, between 30% and 40%, between 35% and 45%, between 35% and 50%, between 40% and 45%, between 40% and 50%, between 40% and 55%, between 45% and 50%, between 45% and 55%, between 45% and 60%, between 50% and 55%, between 50% and 60%, between 50% and 65%, between 55% and 60%, between 55% and 65%, between 55% and 70%, between 60% and 65%, between 60% and 70%, between 60% and 75%, between 65% and 70%, between 65% and 75%, between 65% and 80%, between 70% and 75%, between 70% and 80%, between 70% and 85%, between 75% and 80%, between 75% and 85%, between 75% and 90%, between 80% and 85%, between 80% and 90%, between 80% and 95%, between 85% and 90%, between 85% and 95%, between 85% and 100%, between 90% and 95%, between 90% and 100%, or between 95% and 100%.

[0217] In another embodiment, cognitive decline or memory deficits are assessed on the day of treatment, 1 day post treatment, 3 months post treatment, 6 months post treatment, 1 year post treatment and every year thereafter post treatment.

[0218] In other embodiments, cognitive decline or memory deficits are assessed between 1 day post treatment and 7 days post treatment. In one aspect, symptoms can be assessed between 1 day post treatment and 2 days post treatment, between 1 day post treatment and 3 days post treatment, between 1 day post treatment and 4 days post treatment, between 2 days post treatment and 3 days post treatment, between 2 days post treatment and 4 days post treatment, between 2 days post treatment and 5 days post treatment, between 3 days post treatment and 4 days post treatment, between 3 days post treatment and 5 days post treatment, 3 days post treatment and 6 days post treatment, between 4 days post treatment and 5 days post treatment, between 4 days post treatment and 6 days post treatment, between 4 days post treatment and 7 days post treatment, between 5 days post treatment and 6 days post treatment, between 5 days post treatment and 7 days post treatment, or between 6 days post treatment and 7 days post treatment. In one aspect, symptoms can be assessed between 1 week post treatment and 4 weeks post treatment. In one aspect, symptoms can be assessedbetween 1 week post treatment and 2 treatment, between 1 week post treatment and 3 weeks post treatment, between 1 week post treatment and 4 weeks post treatment, between 2 weeks post treatment and 3 weeks post treatment, between 2 weeks post treatment and 4 weeks post treatment, or between 3 weeks post treatment and 4 weeks post treatment. In one aspect, symptoms can be assessed between 1 month post treatment and 12 months post treatment. In one aspect, symptoms can be assessed between 1 month post treatment and 2 months post treatment, between 1 month post treatment and 3 months post treatment, between 1 month post treatment and 4 months post treatment, between 2 months post treatment and 3 months post treatment, between 2 months post treatment and 4 months post treatment, between 2 months post treatment and 5 months post treatment, between 3 months post treatment and 4 months post treatment, between 3 months post treatment and 5 months post treatment, between 3 months post treatment and 6 months post treatment, between 4 months post treatment and 5 months post treatment, between 4 months post treatment and 6 months post treatment, between 4 months post treatment and 7 months post treatment, between 5 months post treatment and 6 months post treatment, between 5 months post treatment and 7 months post treatment, between 5 months post treatment and 8 months post treatment, between 6 months post treatment and 7 months post treatment, between 6 months post treatment and 8 months post treatment, between 6 months post treatment and 9 months post treatment, between 7 months post treatment and 8 months post treatment, between 7 months post treatment and 9 months post treatment, between 7 months post treatment and 10 months post treatment, between 8 months post treatment and 9 months post treatment, between 8 months post treatment and 10 months post treatment, between 8 months post treatment and 11 months post treatment, between 9 months post treatment and 10 months post treatment, between 9 months post treatment and 11 months post treatment, between 9 months post treatment and 12 months post treatment, between 10 months post treatment and 11 months post treatment, between 10 months post treatment and 12 months post treatment, or between 11 months post treatment and 12 months post treatment. In one aspect, symptoms can be assessed between 1 year post treatment and about 20 years post treatment. In one aspect symptoms can be assessed between 1 year post treatment and 5 years post treatment, between 1 year post treatment and 10 years post treatment , between 1 year post treatment and 15 years post treatment, between 5 years post treatment and 10 years post treatment, between 5 years post treatment and 15 years post treatment, between 5 years post treatmentand 20 years post treatment, between 10 treatment and 15 years post treatment, between 10 years post treatment and 20 years post treatment, or between 15 years post treatment and 20 years post treatment.

[0219] Still other embodiments described herein relate to kits comprising any of the vectors described herein. In some aspects, any of the vectors disclosed herein can be assembled into pharmaceutical or diagnostic or research kits to facilitate their use in therapeutic, diagnostic or research applications. A kit can include one or more containers housing the components of the disclosure and instructions for use. Specifically, such kits may include one or more vectors described herein, along with instructions describing the intended application and the proper use of these vectors. In some aspects, the vectors in a kit can be in a pharmaceutical formulation and dosage suitable for a particular application and for a method of administration of the vectors. Kits for research purposes can contain the components in appropriate concentrations or quantities for running various experiments.

[0220] Also disclosed herein are kits for producing vectors, such as AAV vectors. In some aspects, the kit can comprise a container housing an isolated nucleic acid encoding an asprosin protein or an analogue thereof. In some aspects, the kits can further comprise instructions for producing the vector (e.g., AAV vector). In some aspects, the kit further comprises at least one container housing a recombinant vector, wherein the recombinant vector comprises a transgene (i.e., asprosin transgene).

[0221] In some aspects, the kits can include a container housing a recombinant vector as described supra. In some aspects, the kits can further comprises a container housing a pharmaceutically acceptable carrier. For example, a kit can comprise one container housing a vector and a second container housing a buffer suitable for injection of the vector into a subject. In some aspects, the container can be a syringe.

[0222] In some embodiments, the kits can be designed to facilitate use of the methods described herein by researchers and can take many forms. Each of the compositions of the kit, where applicable, may be provided in liquid form (e.g., in solution), or in solid form, (e.g., a dry powder). In some aspects, some of the compositions can be constitutable or otherwise processable (e.g., to an active form), for example, by the addition of a suitable solvent or other species (for example, water or a cell culture medium), which may or may not be provided with the kit. As used herein, “instructions” can define a component of instruction and / or promotion, and typically involve written instructions on or associated withpackaging of the disclosure. Instructions include any oral or electronic instructions provided in any manner such that a user will clearly recognize that the instructions can be associated with the kit, for example, audiovisual (e.g., videotape, DVD, etc.), internet, and / or web-based communications, etc. The written instructions can be in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which instructions can also reflect approval by the agency of manufacture, use or sale for animal administration.

[0223] The kits disclosed herein can also contain any one or more of the components described herein in one or more containers. In some aspects, the kits can include instructions for mixing one or more components of the kit and / or isolating and mixing a sample and applying to a subject. The kits can include a container housing vectors described herein. The vectors can be in the form of a liquid, gel or solid (powder). The vectors can be prepared sterilely, packaged in syringe and shipped refrigerated. Alternatively, it can be housed in a vial or other container for storage. A second container can have other vectors prepared sterilely. Alternatively, the kits can include the active vectors premixed and shipped in a syringe, vial, tube, or other container. The kits can have one or more or all of the components required to administer the vectors to an animal, such as a syringe, topical application devices, or iv needle tubing and bag, particularly in the case of the kits for producing specific somatic animal models.

[0224] The kits disclosed can have a variety of forms, such as a blister pouch, a shrink wrapped pouch, a vacuum sealable pouch, a sealable thermoformed tray, or a similar pouch or tray form, with the accessories loosely packed within the pouch, one or more tubes, containers, a box or a bag. The kits can be sterilized after the accessories are added, thereby allowing the individual accessories in the container to be otherwise unwrapped. The kits can be sterilized using any appropriate sterilization techniques, such as radiation sterilization, heat sterilization, or other sterilization methods known in the art. The kits can also include other components, depending on the specific application, for example, containers, cell media, salts, buffers, reagents, syringes, needles, a fabric, such as gauze, for applying or removing a disinfecting agent, disposable gloves, a support for the agents prior to administration etc.

[0225] The invention is further illustrated by the following example, which is not intended to limit the scope of the claims.Example 1

[0226] This Example describes plasmids encoding IL2-ASP.

[0227] Fig.1 illustrates a map of the plasmid AV0-BWS-IL2-His-Asp (SEQ ID NO: 1) which includes two AAV inverted terminal repeats (ITRs) flanking an expressing region comprising nucleic acids encoding an EF-1 promoter (SEQ ID NO: 4), an IL-2 signal peptide (SEQ ID NO: 3), asprosin (SEQ ID NO: 2), a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (SEQ ID NO: 5), and an SV40 polyadenylation signal sequence (SEQ ID NO: 6). The plasmid further comprises an ampicillin resistance gene (AmpR).

[0228] Fig.2 illustrates a map of the plasmid AAV1-CAG-BWS-IL2-His-Asp (SEQ ID NO: 15), which includes two AAV inverted terminal repeats (ITRs) flanking an expressing region comprising nucleic acids encoding a CAG promoter (SEQ ID NO: 13), IL-2 signal peptide (SEQ ID NO: 3), asprosin (SEQ ID NO: 2), a woodchuck hepatitis virus post- transcriptional regulatory element (WPRE) (SEQ ID NO: 5), and an SV40 polyadenylation signal sequence (SEQ ID NO: 6). The plasmid further comprises a kanamycin resistance (KanR) gene.

[0229] Fig.3 illustrates a map of the plasmid AAV8(Kan)-BWS-IL2-Asp (SEQ ID NO: 16), which includes two AAV inverted terminal repeats (ITRs) flanking an expressing region comprising nucleic acids encoding an EF-1 promoter (SEQ ID NO: 4), an IL-2 signal peptide (SEQ ID NO: 3), asprosin (SEQ ID NO: 2), a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (SEQ ID NO: 5), and an SV40 polyadenylation signal sequence (SEQ ID NO: 6). The plasmid further comprises a kanamycin resistance (KanR) gene.

[0230] Using the provided nucleotide sequence, PCR primers were designed:

[0231] Forward: Gtgaggaattggatccgccaccatgtacaggatgc (SEQ ID NO: 9).

[0232] Reverse: ATTATCGATAGAATTCTATTAATGAAGCAAAACCTGGATT (SEQ ID NO: 10).

[0233] The PCR product was purified over 1% agarose gel and cloned into the BamHI / EcoRI sites of AV0.1-BWS (EF1 or CAG promoter, WPRE and SV40 polyA) using a kit (In-Fusion Cloning kit, Clontech). As for control AAV, 2.8 kb C346 BamHI / EcoRIwas first cloned into pLPBL-1, excised by AscI digestion and then cloned into AV0.1.

[0234] The integrity of ITR was tested by SmaI digestion. AAV was packaged by 3 plasmids transfection (plasmid encoding IL2-ASP, Rep / Cap, AdΔF6 helper plasmid) into 293T cells by iMFectin (GenDepot). 20 x 15-cm dish for each construct were transfected andcell associated and media secreted AAV separately 3 days after transfection. Cell associated AAV was recovered by cell lysis and media secreted AAV was precipitated by PEG. They were combined and purified by iodixanol density gradient.

[0235] The titer of the AAV vectors were quantified with the primers corresponding to 5IEE (partial sequence of 5’ integration efficiency element in wild type AAV) The following QPCR primers were used:

[0236] Forward: TGCTCTAGAGTGGAGTCGTGACGTGAATTAC (SEQ ID NO: 11).

[0237] Reverse: TGCTCTAGAACGCGTAATGGAGACCCTGCGTGCTC (SEQ ID NO: 12). Example 2

[0238] In this example, we demonstrate that Purkinje neuron asprosin-Ptprd signaling is essential for associative memory and identify its disruption as a key pathological feature of AD. Utilizing two independent AD mouse models, the 5xFAD transgenic mice and the APPNL-G-Fknock-in mice, we show that peripheral asprosin supplementation reactivates Ptprd signaling in Purkinje neurons and fully restores associative memory deficits. These findings establish asprosin-Ptprd signaling as a critical regulator of cognitive function and introduce a novel therapeutic paradigm that links peripheral metabolic signals to central memory processes.

[0239] By uncovering an unexpected role for the cerebellum in memory restoration, our work highlights it as an untapped therapeutic frontier in neurodegenerative diseases. This study not only identifies a new molecular pathway underlying cognitive decline but also lays the groundwork for a scalable and clinically translatable intervention. The ability to restore associative memory deficits through peripheral administration of asprosin opens new avenues for the treatment of AD and potentially other neurodegenerative disorders characterized by cognitive decline. Methods Mouse Models

[0240] WT C57BL / 6 mice (WT mice; Jackson Laboratory, JAX #:000664), AgRP- IRES-cre (C57BL / 6-Agrptm1(cre)Lowl, Jackson Laboratory JAX #: 012899), Pcp2-cre (B6.129-Tg(Pcp2-Cre)2Mpin / j, Jackson Laboratory, JAX #:004146 ) and CaMKIIα-cre(B6.Cg-Tg(Camk2a-cre)T29-1Stl / J, JAX #: 005359) were purchased from Jackson Laboratories. Alzheimer’s mouse models 5xFAD mice (B6.Cg- Tg(APPSwFlLon,PSEN1*M146L*L286V) 6799Vas / Mmjax, Jackson Laboratory, JAX #034848-JAX) were purchased from Jackson Laboratories and AppNL-G-Fmice were obtained from RIKEN, Japan.

[0241] Homozygous conditionally ready Ptprd floxed mice (Ptprd tm2c(KOMP)Wtsi) were mated with AgRP-IRES-cre (C57BL / 6-Agrptm1(cre)Lowl) to create AgRP neuron specific knock-out of Ptprd. Homozygous conditionally ready Ptprd floxed mice (Ptprd tm2c(KOMP)Wtsi) were mated with Pcp2-cre (B6.129-Tg(Pcp2-Cre)2Mpin / j) to create Purkinje neuron specific knock-out of Ptprd. Homozygous conditionally ready Ptprd floxed mice (Ptprd tm2c(KOMP)Wtsi) were mated with CaMKIIα-cre (B6.Cg-Tg(Camk2a-cre)T29- 1Stl / J) to create CaMKIIα-neuron specific knock-out of Ptprd.

[0242] Mice were housed in micro ventilators on a 12-hour light cycle (6am-6pm) in an animal facility maintained at 20-25°C and 40-60% humidity. Mice had ad libitum access to water and normal chow. Animal housing, husbandry, experiments, and euthanasia were conducted under animal protocols approved by the Case Western Reserve University Institutional Animal Care and Use Committee (protocol# 2018-0042). General health of mice was monitored by the CWRU animal resource center. Human Biofluid Samples

[0243] De-identified cerebrospinal fluid and plasma samples were obtained from the Cleveland Clinic Lou Ruvo Center for Brain Health Aging and Neurodegeneration Biobank (CBH-biobank) which is approved by the Cleveland Clinic Institutional Review Board for sharing human biospecimens for research purposes. This study was reviewed and approved by the Case Western Reserve University Institutional Review Board for utilization of de- identified human biospecimens. CBH-biobank research participants undergo clinical evaluation, including neurological examination and neuropsychological testing, as well as collection of blood and cerebrospinal fluid for research purposes. The CBH-biobank cerebrospinal fluid and plasma samples obtained for our study included; 20 cognitively normal older adults, 20 mildly cognitively impaired adults, 19 Alzheimer’s disease patients, 20 Parkinson disease patients and 1 Frontal Temporal Dementia patient for a total of 80 unique participant samples. Altogether, 160 samples were tested for asprosin levels.Viral Vectors for Asprosin Overexpression

[0244] Six-month old C57BL / 6J 5xFAD or APPNL-G-Fmice were injected intravenously via tail-vein with adeno-associated virus, serotype 8 (AAV8) dissolved in 150 µl USP-grade sterile saline. Control mice injected with AAV8-empty (1 × 1012GC / mouse), while experimental mice received AAV8-Asprosin (1 × 1012GC / mouse), containing a construct encoding N-terminal his-tagged human asprosin, preceded by an IL2 signal peptide and driven by the EF1α promoter. Body weight was measured three months post-injection to evaluate weight gain as an indicator of elevated plasma asprosin levels. Asprosin ELISA

[0245] A custom-built sandwich ELISA was employed to measure plasma asprosin levels in both humans and mice with Alzheimer's disease, as well as in their respective control groups. For this assay, 25 µL of plasma or 50 µL of CSF was used, with asprosin captured by a fully human anti-asprosin monoclonal antibody, which was developed from a naïve human phage display antibody library by panning against recombinant full-length human asprosin (Texas Therapeutics Institute at the University of Texas Health Science Center at Houston). A mouse anti-asprosin monoclonal antibody, targeting human asprosin amino acids 106-134 (corresponding to human profibrillin amino acids 2838-2865), served as the detection antibody. An HRP-linked anti-mouse secondary antibody was used to generate the detection signal. To create a standard curve, recombinant mouse asprosin produced in mammalian cells (AdipoGen AG-40B-0174T-C010) was used. The blocking, coating, substrate, and stop solutions were purchased from SeraCare. Western Blot Analysis

[0246] Snap-frozen cerebellar tissue from both WT and 5xFAD mice, as well as from humans with Alzheimer’s disease (AD) and unaffected controls, was homogenized using N- PER Neuronal Protein Extraction Reagent (Thermo Fisher Scientific, 87792) supplemented with protease inhibitor (Thermo Fisher Scientific, 78429) and phosphatase inhibitor (Thermo Fisher Scientific, 78420) to produce protein lysates. Protein concentrations were quantified using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, 23227).

[0247] Subsequently, 25 µg of protein lysate was loaded onto a 4-12% Bolt Bis-Tris Protein Gel (Thermo Fisher Scientific, NW04127BOX) and electrophoresed for approximately 1.5 hours using Bis-Tris running buffer. Precision Plus Protein Kaleidoscope(Bio-Rad, 1610375) was used as the weight ladder. Proteins were transferred onto nitrocellulose membranes using the Invitrogen Power Blotter System for 10 minutes at room temperature.

[0248] Membranes were blocked with Clear Milk Blocking Buffer (Thermo Fisher Scientific, 37587), diluted 1X in TBST, for 1 hour at room temperature. Primary antibodies were diluted in the same blocking buffer and incubated with the membranes overnight at 4°C. Following primary antibody incubation, membranes were washed with 1X TBST and then incubated with HRP-conjugated mouse or rabbit secondary antibodies, diluted in 1X TBST, for 2 hours at room temperature. Chemiluminescent signals were detected using a 1:1 ratio of HRP substrates (Thermo Fisher Scientific, 34577 and 34094).

[0249] For all western blots, molecular weight markers and experimental samples were run on the same gel. Membranes were cut at approximately 50 kDa, allowing separate incubation of the segments with antibodies against PTPRD and β-actin. Primary antibodies used were Rabbit Polyclonal anti-PTPRD (1:500; ABclonal, A15713) and Mouse Monoclonal anti-β-actin (1:2000; Cell Signaling, 8H10D10). Secondary antibodies included HRP-conjugated anti-rabbit IgG (1:10,000; Cytiva, NA934) and HRP-conjugated anti-mouse IgG (1:10,000; GeneTex, GTX213112-01). Cell Culture and Luciferase Assays

[0250] HEK293T cells were cultured at 37°C in 5% CO₂ in DMEM supplemented with 10% fetal bovine serum (FBS; HyClone) and 100 µg / ml penicillin-streptomycin. For all experiments, HEK293T cells were transfected with the 4xM67 pTATA-TK-Luc plasmid (Addgene, 8688), which contains Stat3-response elements driving luciferase expression.

[0251] To evaluate the effects of amyloid β (Aβ) on PTPRD activity, HEK293T cells seeded at 10,000 cells / well in 96-well plates were transfected with 2 µg of the 4xM67 pTATA-TK-Luc plasmid. The following day, 300 nM of recombinant Aβ1-40(Sigma Aldrich, A1075), Aβ1-42Sigma Aldrich, PP69), reverse-sequence Aβ40-1 (Sigma Aldrich, A2326), or recombinant green fluorescent protein (GFP; USBiological, G8965-10E) was added to the cells. After 24 hours, Stat3-mediated luciferase activity was measured.

[0252] To investigate competition between Aβ and asprosin, HEK293T cells transfected with 2 µg of the 4xM67 pTATA-TK-Luc plasmid were transfected with 400 ng of either an asprosin-expressing plasmid or an empty vector control. Twenty-four hours post-transfection, 300 nM Aβ1-40 (Sigma or GFP was added in fresh media. After 6 hours, Stat3-driven luciferase activity was measured.

[0253] To assess the effect of PTPRD loss on Stat3 activity, HEK293T cells transfected with 2 µg of the 4xM67 pTATA-TK-Luc plasmid were transfected with either 25 nM PTPRD-specific siRNA or pooled scrambled siRNA (Dharmacon, T-2001-02) using the manufacturer’s protocol. Twenty-four hours after siRNA transfection, cells were treated with Aβ1-40 or GFP. Forty-eight hours post-transfection (24 hours after protein treatment), cells were lysed to assess siRNA knockdown efficiency, measure phospho-Stat3 levels via western blot, and quantify Stat3-mediated luciferase activity.

[0254] Transfection of HEK293T cells was performed using FuGENE HD transfection reagent (Promega, E2312) according to the manufacturer’s instructions. Cells were lysed using Reporter Lysis 5X Buffer (Promega, E3971), and luciferase activity was measured using Luciferase Assay Reagent (Promega, E1483). All assays were performed following standard manufacturer protocols. Surface plasmon resonance (SPR)

[0255] Surface plasmon resonance (SPR) studies were performed using Biacore T200 (Cytivia) with PTPRD (Acro Biosystems, PTD-H52H9) covalently immobilized on an S series CM5 sensor chip via amine coupling. Recombinant human Aβ1-42 in HFIP (Sigma Aldrich AG968-1MG) was dissolved in PBSP+ (Cytiva) and flowed over the PTPRD bound sensor chips at serial dilution concentrations (1000nM, 500 nM, 250 nM, 125 nM, 62.5 nM, 31.25 nM, 15.625 nM). Recombinant asprosin concentrations from 18.75nM to 300nM in series dilution were co-injected with 25nM of Aβ at 30 μL / min over the Ptprd bound sensor chip at 25ºC to assess competitive binding. Surface was regenerated with Glycine, pH 1.5 for 30s at 30 μL / min. Two different recombinant asprosin preparations were tested (Novus Biologicals NBP3-18164; Biobyrt, orb1784787). Data were analyzed using BiaEvaluation software and redrawn with Origin Software. Immunohistochemistry Staining

[0256] Mice were deeply anesthetized with a ketamine-xylazine cocktail, confirmed by a toe pinch, and transcardially perfused with 30 mL of 1x phosphate-buffered saline (PBS) followed by 30 mL of 4% paraformaldehyde (PFA) in PBS. Brains were extracted, post- fixed in 4% PFA for 24 hours at 4°C, and cryoprotected in 20% sucrose in PBS.

[0257] Brains were sectioned into thick coronal slices using a Leica SM2010 R Sliding Microtome. Sections were stored in cryoprotectant solution (30% ethylene glycol, 20% glycerol in PBS) at -20°C until further use. Prior to staining, sections were rinsed in PBS to remove cryoprotectant, treated with 0.3% H₂O₂ in PBS for 30 minutes, washed, and blocked in 10% Normal Donkey Serum (Jackson ImmunoResearch, AB_2337258) for 1 hour.

[0258] Sections were incubated overnight at 4°C with primary antibodies diluted in 1% Normal Donkey Serum: Rabbit anti-p-Stat3 (1:1000; Cell Signaling, 9145L) and Monoclonal anti-calbindin (1:500; Sigma-Aldrich, C9848-100UL). The next day, sections were washed and exposed to secondary antibodies (1:200 dilution): goat anti-mouse Alexa 488 (Thermo Fisher, A32723) and goat anti-rabbit Alexa 594 (Thermo Fisher, A32740). Following PBS washes, sections were stained with 300 nM DAPI in PBS, rinsed, mounted onto slides, and sealed with Vectashield mounting medium (H-1000).

[0259] Fluorescently labeled sections were imaged using a Zeiss Axio Scan.Z1 slide scanner with consistent acquisition settings across all samples for quantitative analysis. Immunohistochemistry Analysis

[0260] Similar Regions of Interest for analysis and quantification were selected using image processing software (ImageJ). Cerebellar regions were cropped and analyzed for simultaneous expression of phosphorylated Stat3 (red color channel) and Calbindin (green color channel). In the cerebellum, calbindin only stains Purkinje neurons. Each image was filtered to remove noise using non-local means filtering. Pixels containing expression of phosphorylated Stat3 and calbindin were determined through Otsu thresholding. This isolated the cells and removed the background fluorescence present in the images. The overlap of expression between the two channels was determined by counting the number of pixels that passed the Otsu threshold in both channels. The sum total of these pixels represents the total overlap between the two channels within cells. Overlap was calculated by dividing the total number of pixels by the size of the image, generating a measure for expression per unit area.Behavioral Assays Open Field

[0261] The open field assay was used to evaluate general motor activity and anxiety- like behavior, following established protocols. Mice were tested in a 4-arena (50 cm x 50 cm) system (ANYmaze, Stoelting) for 15 minutes, with their order randomized. The apparatus was cleaned with 70% ethanol between trials to minimize olfactory cues. Novel Object Recognition

[0262] The same apparatus as the open field assay was used for the novel object recognition (NOR) test to assess recognition memory. Testing occurred the day after the open field assay. On Day 1, mice were exposed to two identical objects (50 mL Falcon tubes). On Day 2, one object was replaced with a novel object (three 15 mL Falcon tubes attached together). Interaction times with each object on Day 2 were recorded in a blinded manner. The recognition index was calculated as Recognition Index = 100 × (novel object interaction time / total interaction time). The apparatus was cleaned with 70% ethanol between trials. Barnes Maze

[0263] The Barnes maze consisted of a 92 cm diameter circular platform with 20 evenly spaced 5 cm holes, one of which served as the target escape hole under an escape box. The maze was elevated 75 cm above the floor, with uniform illumination at 800 lux. During habituation, each mouse was placed in the maze center under a glass cylinder for 30 seconds before being guided to the escape box, where they explored for 2 minutes and then stayed for 1 minute. Training consisted of three trials on Day 1 and two trials on Day 2. Mice started under a covered box in the maze center and were allowed 2 minutes to find the escape hole. If successful, mice stayed in the escape box for 1 minute; if unsuccessful, they were guided to it. Visual cues around the room aided spatial orientation. A probe trial was conducted 48 hours after training to assess spatial memory. The escape box was removed, and mice explored for 120 seconds. Time spent in the target quadrant and the number of holes searched were recorded.Fear Conditioning

[0264] Fear conditioning was performed using conditioning chambers (20 cm x 20 cm x 30 cm; Med Associates) with three metal walls, a transparent front, a grid floor for foot shocks, and a speaker for auditory cues. Chambers were cleaned with 70% ethanol between subjects.

[0265] On Day 1, mice were acclimated to the chamber for 3 minutes. During the next 30 seconds, a conditioned stimulus (CS; 5000 Hz tone, 80 dB) was presented, co-terminating with an unconditioned stimulus (US; 0.5 mA foot shock, 1 second). This pairing was repeated four times with 60-second inter-trial intervals. Mice were returned to their home cages 60 seconds after the last shock.

[0266] On Day 2, cued fear memory or contextual memory was assessed. For cued, mice were placed in a novel context (different chamber with distinct visual and olfactory cues) for 3 minutes to acclimate. Subsequently, the auditory CS tone was presented twice for two 30 second periods with an inter-trial interval of 60 seconds. Freezing during the CS presentation was recorded and averaged.

[0267] For contextual memory, mice were placed in the original chamber (identical to Day 1) for 5 minutes without auditory cues. Freezing behavior was recorded as an indicator of contextual fear memory. After the session, mice were returned to their home cages, and the apparatus was thoroughly cleaned to remove any odors or residues.

[0268] All fear conditioning data were collected under blinded conditions. 5xFAD mice were injected with AAV and tested by Bijoya Basu at Case Western Reserve University on Med Associates fear Conditioning Apparatus, base dimensions: 20cm x 20cm. Apparatus was cleaned with 70% ethanol in between animals. APPNL-G-Fmice were injected with AAV and tested at Baylor College of Medicine by Hesong Liu on Fusion Stimulus Hub with SuperFlex Open Field system (OmniTech Electronics, Inc), base dimensions: 60cm X 60cm. The chambers were cleaned with soapy water between animals. Quantification and Statistical Analysis

[0269] Data was graphed and analyzed using GraphPad Prism (Version 9 and higher). Minimal sample sizes and statistical analysis were planned before the study based on the nature of experiments and preliminary findings. All results are presented as mean ± standard error of the mean (SEM.) and individual data points. Statistical significance of continuousdata was tested using unpaired Student’s t- or Analysis of Variance (one-way and two- way ANOVA, when appropriate) followed by the Bonferroni multiple test corrections post- hoc analysis using GraphPad Prism 7. Appropriate nonparametric tests were run when data did not meet parametric assumptions. Repeated measures analysis was used in experiments that involved multiple measures of the same variable. Age- and sex-matched mice were randomly assigned to groups for all experiments. Immunohistochemistry and behavioral analysis studies were done in a blinded fashion. Alpha (a) for statistical significance was set at 0.05. Results Purkinje neuron-specific Ptprd is necessary for mammalian associative memory

[0270] We investigated whether the absence of Ptprd specifically in Purkinje neurons affects cognitive function. To that end, we generated mice with Ptprd ablation in Purkinje neurons (Pcp2-cre;PtprdFlox / Flox) by crossing PtprdFlox / Floxmice with mice expressing Cre recombinase under the control of the Purkinje cell protein 2 (Pcp2) promoter. This genetic approach ensured that Ptprd was specifically ablated in Purkinje neurons while remaining intact in other cell types.

[0271] We began by assessing associative memory using a classical cued fear conditioning paradigm (Fig.4A). Mice underwent four training sessions where a neutral auditory cue (80^dB, 5000^Hz, 30^seconds) co-terminated with a mild foot shock (0.5^mA, 1^second) in a conditioning chamber. After training, mice were returned to their home cages with ad libitum access to food and water. The following day, we evaluated memory retention through two tests: (1) Contextual Memory Test: Mice were placed back into the original conditioning environment for 5^minutes without any auditory cues. Freezing behavior was recorded to assess memory of the context associated with the aversive stimulus. (2) Cued Memory Test: Mice were placed in a novel environment and exposed to the auditory cue without the foot shock. Freezing behavior was measured to evaluate the association between the cue and the aversive event, independent of the context.

[0272] Our results revealed that male Pcp2-cre;PtprdFlox / Floxmice exhibited significantly impaired cued fear-conditioned memory compared to control groups (Pcp2- cre;Ptprd+ / +and PtprdFlox / Floxmice), despite normal fear acquisition during training (Fig.4B– E). No significant differences were observed in contextual fear-conditioned memory betweenthe groups. A similar impairment in cued memory was observed in female mice, indicating that the effect is not sexually dimorphic (Figs.4F–I).

[0273] To determine whether the loss of Ptprd in Purkinje neurons affected other cognitive functions, we conducted additional behavioral assays. In the Barnes maze test, which assesses spatial learning and memory, and the Novel Object Recognition (NOR) test, which evaluates recognition memory, Pcp2-cre;PtprdFlox / Floxmice performed comparably to control mice (Figs.9C, D, G, H). Additionally, assessments of anxiety-like behavior and locomotor activity using the Open Field test revealed no significant differences between groups (Figs.9A, B, E, F). We have previously shown that Purkinje neuron-specific Ptprd ablation has no impact on motor learning, locomotion and coordination via an extensive battery of tests under baseline and challenge paradigms, nor does it have any impact on Purkinje neuron morphology. Furthermore, no differences were observed between the two control groups (Pcp2-cre;Ptprd+ / +and PtprdFlox / Floxmice), indicating that neither the Cre recombinase expression nor the floxed Ptprd alleles independently affect the behavioral outcomes (Fig.10).

[0274] The reciprocal effects of Purkinje neuron-specific Ptprd and Stat3 ablation provide strong evidence for the functional antagonism between Ptprd and Stat3 in regulating associative memory. The specific deficit in cued associative memory, without affecting contextual memory, spatial learning, recognition memory, anxiety-like behavior, or locomotor function, highlights the specialized role of Ptprd-mediated signaling in Purkinje neurons for associative learning processes. Hypothalamic AgRP neuron-specific or forebrain excitatory neuron-specific Ptprd is dispensable for mammalian associative memory

[0275] We sought to determine whether Ptprd expression in AgRP neurons also plays a role in regulating memory, akin to its critical function in Purkinje neurons. To investigate this possibility, we generated mice with a constitutive knockout of Ptprd specifically in AgRP neurons (AgRP-cre;PtprdFlox / Flox) by crossing PtprdFlox / Floxmice with those expressing Cre recombinase under the control of the AgRP promoter. AgRP-cre;PtprdFlox / Floxmice did not demonstrate any differences in associative memory measured via the cued fear conditioning assay when compared to AgRP-cre;Ptprd+ / +mice (Figs.10A-C). These findings demonstrate that Ptprd expression in hypothalamic AgRP neurons is dispensable for mammalian associative memory, in stark contrast to its essential role in Purkinje neurons.

[0276] Forebrain excitatory neurons, those in the hippocampus and cerebral cortex, play well-established roles in various forms of learning and memory, including spatial, contextual, and declarative memory. The hippocampus is crucial for the formation and retrieval of contextual and spatial memories, while the cortex is involved in the storage and processing of complex associative information. Given the significance of cortical and hippocampal excitatory neurons in memory regulation, and the robust expression of Ptprd within both brain structures, we investigated whether Ptprd expression in these neurons influences associative memory as assessed by the cued fear conditioning paradigm. To this end, we generated mice with a conditional knockout of Ptprd in forebrain excitatory neurons using the CaMKIIα-cre mouse line, which drives Cre recombinase expression predominantly in excitatory neurons of the forebrain, including the hippocampus and cortex. Importantly, this model spares the cerebellum entirely allowing a rigorous comparison with Purkinje neuron-specific deletion of Ptprd. Behavioral assessments of CaMKIIα-cre;PtprdFlox / Floxmice revealed no significant deficits in associative memory compared with controls, as measured by the cued fear conditioning assay (Figs.11D-F), suggesting that Ptprd expression in forebrain excitatory neurons is not essential for cued associative memory. Ptprd activity is downregulated in Alzheimer’s disease

[0277] Given that deficits in associative memory are a hallmark of Alzheimer's disease (AD), we investigated whether components of the asprosin-Ptprd signaling axis are perturbed in rodent models or human subjects afflicted by the disease. Initially, we measured asprosin levels in plasma and cerebrospinal fluid (CSF) from human donors with AD and mild cognitive impairment (MCI), comparing them to unaffected control subjects. Our analyses revealed that asprosin concentrations in both plasma and CSF were unchanged in AD and MCI patients relative to controls (Figs.5A–B). Similarly, in the 5xFAD mouse model of AD, plasma asprosin levels were comparable to those of age- and sex-matched WT littermates at 6 months of age (Fig.5E).

[0278] Next, we assessed Ptprd protein expression in cerebellar lysates from 5xFAD mice and human AD donors. Consistent with our findings for plasma and CSF asprosin, Ptprd protein levels in the cerebellum were unaltered in 5xFAD mice compared to WT controls, as well as in human AD donors compared to age- and sex-matched unaffected individuals (Figs.5C-D, F).

[0279] Considering the critical role phosphatase activity in neuronal signaling, we evaluated Ptprd activity specifically in Purkinje neurons of the cerebellum. For this, we measured levels of phosphorylated Stat3 (p-Stat3) in Purkinje neurons of 5xFAD mice and WT littermates at 6 months of age. Ptprd dephosphorylates Stat3 at Tyrosine 705, leading to decreased Stat3 transcriptional activity. Our previous studies demonstrated that mice with elevated circulating asprosin exhibit significantly reduced hypothalamic p-Stat3 levels, whereas Ptprd- / -mice and mice with plasma asprosin sequestration using an anti- asprosin monoclonal antibody show increased hypothalamic p-Stat3 levels compared to WT mice. These findings establish p-Stat3 levels as a robust and reliable, bidirectional indicator of Ptprd activity in vivo.

[0280] In this context, we found that 5xFAD mice exhibited significantly higher levels of p-Stat3 in the Purkinje cell layer of the cerebellum (Figs.5G–L), suggesting a downregulation of Ptprd activity in these neurons. This increase in p-Stat3 was consistent across multiple cerebellar regions implicated in associative memory, including Crus I, Crus II, and lobules VI and IX. Functional MRI studies have increasingly highlighted the cerebellum's role in associative memory, particularly within the framework of fear conditioning and learning. Regions such as Crus I and Crus II show significant activation in response to conditioned stimuli during both acquisition and extinction phases, while lobule VI is prominently engaged during the recall of fear memories. The observed elevation of p- Stat3 in Purkinje neurons across key cerebellar regions strongly suggests that Ptprd activity, which normally dephosphorylates Stat3, is significantly reduced in the 5xFAD mouse model of AD. Asprosin Outcompetes Aβ to Restore Ptprd Activity

[0281] To elucidate the mechanism by which Alzheimer's disease (AD) affects Ptprd activity, and to assess whether asprosin can restore Ptprd function under these conditions, we investigated the interaction between β-amyloid (Aβ) and Ptprd. Given that extracellular Aβ aggregates play a central role in AD pathogenesis, we hypothesized that Aβ may impair Ptprd activity by directly interacting with the extracellular domain of the receptor.

[0282] We conducted in vitro experiments using HEK293T cells, which naturally express both Ptprd and Stat3, transfected with Stat3 response element driven luciferase, allowing a readout of Stat3 transcriptional activity. The cells were exposed to either recombinant Aβ1-40or an inactive control peptide, the reverse-sequence Aβ40-1. Given ourprevious demonstration that Ptprd and inextricably functionally linked, measuring Stat3 transcriptional activity allowed us to infer changes in Ptprd activity. Our results demonstrated that cells treated with Aβ exhibited significantly higher Stat3 transcriptional activity compared to those exposed to the reverse-sequence Aβ control (Fig.6A), suggesting that Aβ impairs Ptprd activity, leading to enhanced phosphorylation and transcriptional activity of Stat3.

[0283] To determine whether asprosin could rescue Ptprd activity in the presence of Aβ, we enhanced asprosin levels in the culture medium. This was achieved by transfecting cells with a mammalian expression plasmid encoding human asprosin, equipped with an IL-2 signal peptide to promote secretion. Upon elevating media asprosin levels, we observed a significant reversal of the Aβ-induced increase in Stat3 transcriptional activity (Fig.6B). This indicates that asprosin can restore Ptprd function despite the presence of Aβ. To validate these findings, we repeated the experiments using recombinant green fluorescent protein (GFP) as an additional protein control and obtained consistent results (Figs.6C–D). To confirm that Stat3 transcriptional activity accurately reflects Ptprd activity, we performed Ptprd knockdown using small interfering RNA (siRNA). Knocking down Ptprd increased baseline Stat3 activity, and abolished any Aβ-induced increase (Fig.6E), reinforcing that the observed effects are specifically mediated through Ptprd. We found that Aβ1-42, the major pathogenic form of Aβ, mirrored Aβ1-40 in its ability to robustly enhance Stat3 transcriptional activity (Fig.6F).

[0284] Further, we investigated the binding interactions between Aβ, asprosin, and Ptprd using surface plasmon resonance (SPR) analysis. SPR revealed that Aβ1-42directly binds to the extracellular (ligand-binding) domain of Ptprd with a dissociation constant (KD) of 47.44^nM, comparable to the binding affinity previously reported for asprosin (Fig.5H). In contrast, the reverse-sequence Aβ control peptide showed no binding to Ptprd (Fig.5G). Importantly, introducing recombinant asprosin resulted in a dose-dependent decrease in the binding affinity of Aβ for Ptprd, with a half-maximal inhibitory concentration (IC₅₀) of 15.23^nM (Fig.5I), indicating that asprosin can effectively outcompete Aβ for Ptprd binding at relatively low concentrations. While asprosin binding itself would be expected to increase the SPR signal due to its larger molecular weight, the observed decrease in signal reflects Aβ shedding. This suggests that Aβ likely binds Ptprd in a multivalent or high-stoichiometry manner, with potentially hundreds of Aβ molecules interacting with each Ptprd receptor.When asprosin binds, it dislodges molecules rather than replacing them in a strict 1:1 manner. SPR, however, cannot differentiate between signal reductions caused by Aβ shedding versus increases from asprosin binding. These findings align with our earlier functional results (Figs.6A-F) and further emphasize asprosin's ability to effectively displace Aβ from Ptprd through competitive binding. This dynamic interaction underscores the mechanistic basis for asprosin's capacity to restore Ptprd function, even in the presence of substantial Aβ interference. Plasma asprosin elevation restores Purkinje neuron Ptprd activity in mice with AD

[0285] Building upon our in vitro findings that asprosin can rescue Ptprd activity impaired by Aβ, we investigated whether asprosin supplementation could restore Ptprd function in Purkinje neurons of 5xFAD mice – a well-established Alzheimer's disease model characterized by elevated Aβ levels. To elevate plasma asprosin levels, we employed an adeno-associated virus serotype 8 vector encoding human asprosin linked to an interleukin-2 signal peptide driven by an EF1α promoter (AAV8-Asprosin). This strategy does not lead to central nervous system (CNS) transduction as AAV8 exhibits minimal tropism for the CNS. Instead, it increases human asprosin levels in the periphery by targeting the liver for transgene expression, followed by secretion into the bloodstream facilitated by the IL-2 signal peptide. Asprosin has been previously demonstrated to cross the blood-brain barrier, allowing it to reach and activate its endogenous receptors in the brain without the need for direct CNS transduction. Mice treated with AAV8-Asprosin showed a significant reduction in p-Stat3 levels within Purkinje neurons across multiple cerebellar regions implicated in associative memory, including Crus I, Crus II, and lobules VI, VIII and IX (Figs.7A-F). This decrease in p-Stat3 suggests a reactivation of Ptprd phosphatase activity in these neurons.

[0286] Our findings indicate that elevating plasma asprosin is effectively able to overcome the AD-induced downregulation of Ptprd activity to restore receptor function and normalize downstream signaling in vivo, similar to that observed in in vitro models. Asprosin gene therapy restores associative memory in AD

[0287] To investigate whether asprosin could rescue AD-associated memory deficits secondary to reactivation of its receptor, we assessed 5xFAD mice treated with AAV8- Asprosin or AAV8-Empty control. Both male and female 5xFAD mice treated with AAV8-Asprosin demonstrated a significant plasma asprosin levels and a restoration of associative memory, performing at levels comparable to WT mice treated with AAV8-Empty (Figs.8E-J, Figs.12I, J), indicating a complete recovery of associative memory function (Figs.8E-J). Importantly, no significant differences were observed between treated and control 5xFAD mice in other memory assessments, including the Barnes Maze and Novel Object Recognition tests, or in anxiety and locomotion as measured by the Open Field assay (Figs.12A-H). This specificity underscores the targeted effect of the asprosin-Ptprd pathway on associative memory.

[0288] To further validate these findings, we replicated the experiment using the APPNL-G-Fmouse model of AD at an independent laboratory with a different experimenter. This model avoids amyloid precursor protein (APP) overexpression by employing a knock-in strategy that maintains APP expression at WT levels. Despite normal APP expression, these mice produce elevated levels of pathogenic Aβ due to three familial AD-linked mutations and also exhibit tau pathology. The APPNL-G-Fmice treated with AAV8-Asprosin exhibited significant improvements in associative memory compared to those treated with the AAV8- Empty control (Figs.8C, D). These results confirm that asprosin plays a unique role in modulating the associative memory pathway and demonstrate that associative memory deficits in diverse AD models are recoverable through plasma asprosin supplementation.

[0289] Consistent with asprosin's known orexigenic properties, asprosin supplementation resulted in a significant increase in body weight in both AD mouse models (Figs.8A,B). Unintended weight loss is a common feature in individuals with AD and is associated with increased morbidity and mortality. Our data indicate that asprosin supplementation could serve as a dual therapy for recovery of associative memory deficits and unintended weight loss in individuals with AD.

[0290] Our findings highlight the cerebellum's significant contribution to associative memory and its potential involvement in AD-related cognitive decline. By demonstrating that Ptprd deletion in Purkinje neurons impairs associative memory, we reveal a specific cerebellar mechanism that may be disrupted in AD. This challenges the traditional view that cognitive deficits in AD are solely due to hippocampal and cortical dysfunction and suggests that cerebellar circuits play a more pivotal role in certain forms of memory than previously appreciated. Notably, our experiments showed that Ptprd deletion in forebrain excitatory neurons did not impair associative memory, despite the well-established roles of thehippocampus and cortex in memory This specificity underscores the unique contribution of cerebellar Purkinje neurons to associative learning. Furthermore, the differential impact of Ptprd deletion depending on the neuronal population emphasizes the importance of cell-type-specific expression of Ptprd in cognitive functions. Thus, while forebrain excitatory neurons are crucial for certain memory types, Ptprd's role in associative memory is predominantly mediated through Purkinje neurons in the cerebellum.

[0291] Mechanistically, we found that Aβ directly binds to the extracellular domain of Ptprd, causing receptor deactivation. Asprosin, a natural agonist of Ptprd, can outcompete Aβ and reactivate the receptor both in vitro and in vivo. Remarkably, plasma asprosin supplementation was sufficient to fully recover associative memory deficits in two independent AD mouse models. Although plasma and CSF asprosin levels are unchanged in AD, the pathological accumulation of Aβ interferes with asprosin-Ptprd signaling by binding to Ptprd and inhibiting its activity. This suggests that normal asprosin levels are insufficient to activate Ptprd in the presence of Aβ. Our findings demonstrate that elevating asprosin concentrations can outcompete Aβ for Ptprd binding, restoring receptor activity and normalizing downstream signaling pathways. Therefore, the therapeutic benefit of asprosin supplementation in AD arises not from correcting an asprosin deficiency but from overcoming Aβ-mediated inhibition of Ptprd.

[0292] Aβ’s extracellular accumulation positions it to directly disrupt hormone-receptor signaling pathways that originate outside the cell. For example, Aβ has been shown to compete with insulin for binding to the insulin receptor (IR), impairing brain insulin signaling and leading to downregulation of IR activity. Similarly, the observed interaction between Aβ and Ptprd reflects a broader mechanism where Aβ interferes with ligand-receptor signaling, undermining pathways critical for neuronal function. This dual role – extracellular plaque formation and active disruption of signaling – highlights Aβ’s multifaceted contribution to neuronal dysfunction in Alzheimer’s disease.

[0293] To rigorously assess asprosin supplementation as a therapeutic strategy across different AD contexts, we utilized two distinct transgenic mouse models: 5xFAD and APPNL-G-F. The 5xFAD model emphasizes Aβ pathology through overexpression of mutant APP and presenilin-1 proteins, leading to rapid and aggressive plaque formation. In contrast, the APPNL-G-Fmodel employs a knock-in strategy that maintains APP expression at WT levels while introducing three familial AD-linked mutations, resulting in elevated levels ofpathogenic Aβ and tau pathology, offering degrees of relevance to human AD. The success of AAV8-asprosin gene therapy in restoring associative memory across both models enhances confidence in its potential translatability to human patients.

[0294] Our findings may also illuminate the sundowning phenomenon observed in AD, where patients experience clearer thinking in the morning and worsening symptoms later in the day. This pattern aligns with the circadian rhythm of plasma asprosin, which peaks after an overnight fast. The higher morning levels of asprosin could potentially explain the improved memory seen in AD patients during this time. Additionally, this connection may help explain why intermittent fasting, which elevates asprosin levels, has been shown to enhance memory and cognitive function in AD models.

[0295] Importantly, we developed a novel gene therapy using an adeno-associated virus to successfully restore associative memory in two independent AD mouse models, with full recovery observed in both male and female 5xFAD mice. This peripheral gene therapy approach offers several advantages. By enhancing plasma levels of asprosin, a hormone capable of autonomously traversing the blood-brain barrier, we circumvent the challenges associated with directly transducing neurons in the CNS, a significant obstacle in human gene therapy applications. Additionally, the use of AAV8 vectors allows for sustained, long-term elevation of plasma asprosin with a single administration, providing a practical and scalable therapeutic strategy. Additionally, given asprosin’s orexigenic properties, this therapeutic approach led to a significant increase in body weight in both AD models. Since AD progression is often accompanied by unintended weight loss and cachexia, contributing to patient frailty and increased morbidity, asprosin therapy could serve as a dual intervention – ameliorating cognitive deficits while also addressing metabolic and nutritional challenges. Example 3 Asprosin Gene Therapy Restores Associative and Recognition Memory in APPNL-GFAlzheimer’s Model

[0296] We replicated our findings in 5xFAD mice using the APPNL-G-Fmouse model of AD at an independent laboratory. This model avoids amyloid precursor protein (APP) overexpression by employing a knock-in strategy that maintains APP expression at WT levels. Despite normal APP expression, these mice produce elevated levels of pathogenic Aβ due to three familial AD-linked mutations and also exhibit tau pathology. The APPNL-G-Fmice treated with AAV8-Asprosin exhibited significant improvements in associative memorycompared to those treated with the AAV8- control (Figs.13F, G) and in recognition memory (Fig.13B). These results confirm that asprosin plays a role in modulating the associative memory pathway and demonstrate that associative memory deficits in diverse AD models are recoverable through plasma asprosin supplementation.

[0297] Interestingly, the rescue of recognition memory observed in the APPNL-G-Fmodel was absent in the 5xFAD model. Given the greater severity of hippocampal damage in 5xFAD mice, this result suggests that asprosin’s effects on memory recovery may depend on the timing of intervention.

[0298] Consistent with asprosin's known orexigenic properties, asprosin supplementation resulted in a significant increase in body weight in both AD mouse models (Fig.13A). Unintended weight loss is a common feature in individuals with AD and is associated with increased morbidity and mortality. Our data indicate that asprosin supplementation could serve as a dual therapy for recovery of associative memory deficits and unintended weight loss in individuals with AD. Methods Mouse Models

[0299] AppNL-G-Fmice were obtained from RIKEN, Japan. Viral Vectors for Asprosin Overexpression

[0300] Six-month old APPNL-G-Fmice were injected intravenously via tail-vein with adeno-associated virus, serotype 8 (AAV8) dissolved in 150 µl USP-grade sterile saline. Control mice injected with AAV8-empty (1 × 1012GC / mouse), while experimental mice received AAV8-Asprosin (1 × 1012GC / mouse), containing a construct encoding N-terminal his-tagged human asprosin, preceded by an IL2 signal peptide and driven by the EF1α promoter. Body weight was measured three months post-injection to evaluate weight gain as an indicator of elevated plasma asprosin levels. Behavioral Assays Novel Object Recognition

[0301] The same apparatus as the open field assay was used for the novel object recognition (NOR) test to assess recognition memory. Testing occurred the day after the open field assay. On Day 1, mice were exposed to two identical objects (50 mL Falcontubes). On Day 2, one object was a novel object (three 15 mL Falcon tubes attached together). Interaction times with each object on Day 2 were recorded in a blinded manner. The recognition index was calculated as Recognition Index = 100 × (novel object interaction time / total interaction time). The apparatus was cleaned with 70% ethanol between trials. Barnes Maze

[0302] The Barnes maze consisted of a 92 cm diameter circular platform with 20 evenly spaced 5 cm holes, one of which served as the target escape hole under an escape box. The maze was elevated 75 cm above the floor, with uniform illumination at 800 lux. During habituation, each mouse was placed in the maze center under a glass cylinder for 30 seconds before being guided to the escape box, where they explored for 2 minutes and then stayed for 1 minute. Training consisted of three trials on Day 1 and two trials on Day 2. Mice started under a covered box in the maze center and were allowed 2 minutes to find the escape hole. If successful, mice stayed in the escape box for 1 minute; if unsuccessful, they were guided to it. Visual cues around the room aided spatial orientation. A probe trial was conducted 48 hours after training to assess spatial memory. The escape box was removed, and mice explored for 120 seconds. Time spent in the target quadrant and the number of holes searched were recorded. Y Maze

[0303] The Y maze used in this study was made from opaque plastic and featured three identical arms (designated A, B, and C), each measuring 35 cm in length, 5.7 cm in width, and 14.6 cm in height, converging symmetrically at a central junction. During each trial, mice were placed at the end of arm A and allowed to explore the maze freely for a period of 5 minutes. Arm entries into were recorded to assess spontaneous alternation behavior, defined as consecutive entries into all three arms without repeating any arm. To eliminate olfactory cues, the maze was thoroughly cleaned with 70% ethanol between trials. Fear Conditioning

[0304] Fear conditioning was performed using conditioning chambers (20 cm x 20 cm x 30 cm; Med Associates) with three metal walls, a transparent front, a grid floor for foot shocks, and a speaker for auditory cues. Chambers were cleaned with 70% ethanol between subjects.

[0305] On Day 1, mice were the chamber for 3 minutes. During the next 30 seconds, a conditioned stimulus (CS; 5000 Hz tone, 80 dB) was presented, co-terminating with an unconditioned stimulus (US; 0.5 mA foot shock, 1 second). This pairing was repeated four times with 60-second inter-trial intervals. Mice were returned to their home cages 60 seconds after the last shock.

[0306] On Day 2, cued fear memory or contextual memory was assessed. For cued, mice were placed in a novel context (different chamber with distinct visual and olfactory cues) for 3 minutes to acclimate. Subsequently, the auditory CS tone was presented twice for two 30 second periods with an inter-trial interval of 60 seconds. Freezing during the CS presentation was recorded and averaged.

[0307] For contextual memory, mice were placed in the original chamber (identical to Day 1) for 5 minutes without auditory cues. Freezing behavior was recorded as an indicator of contextual fear memory. After the session, mice were returned to their home cages, and the apparatus was thoroughly cleaned to remove any odors or residues.

[0308] All fear conditioning data were collected under blinded conditions. APPNL-G-Fmice were injected with AAV and tested at Baylor College of Medicine by Hesong Liu on Fusion Stimulus Hub with SuperFlex Open Field system (OmniTech Electronics, Inc), base dimensions: 60cm X 60cm. The chambers were cleaned with soapy water between animals.

[0309] From the above description of the invention, those skilled in the art will perceive improvements, changes and modifications. Such improvements, changes and modifications within the skill of the art are intended to be covered by the appended claims. All references, publications, and patents cited in the present application are herein incorporated by reference in their entirety.

Claims

Having described the invention, we 1. A polynucleotide comprising: an expression cassette that includes a nucleic acid encoding asprosin and / or an analogue thereof, operably linked to one or more regulatory elements that promote expression of the asprosin and / or an analogue thereof coding sequence, wherein the one or more regulatory elements include a nucleic acid promoter, a polyadenylation (poly(A)) tail signal, and / or posttranscriptional regulatory element.

2. The polynucleotide of claim 1, wherein the nucleic acid encoding asprosin and / or the analogue thereof has a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 2 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 2 or a reverse complementary sequence thereof.

3. The polynucleotide of claim 1 or claim 2, wherein the regulatory element includes a nucleic acid encoding polyadenylation (poly(A)) tail signal.

4. The polynucleotide of claim 3, wherein the poly(A) tail signal comprises a simian virus 40 (SV40) poly(A) tail signal or a bovine growth hormone pA (BGH pA).

5. The polynucleotide of claim 3 or claim 4, wherein the nucleic acid encoding polyadenylation (poly(A)) tail signal has a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 6 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, orcombinations thereof within the of SEQ ID NO: 6 or a reverse complementary sequence thereof.

6. The polynucleotide of any of claims 1 to 5, wherein the regulatory elements include a nucleic acid encoding elongation factor-1 (EF-1) promoter, cytomegalovirus promoter, or cytomegalovirus enhancer (CMV) / chicken β actin promoter (CAG promoter).

7. The polynucleotide of claim 6, wherein the nucleic acid encoding the EF-1 promoter has a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 4 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 4 or a reverse complementary sequence thereof.

8. The polynucleotide of claim 6, wherein the nucleic acid encoding the CAG promoter has a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 13 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 13 or a reverse complementary sequence thereof.

9. The polynucleotide of any of claims 1 to 8, wherein the regulatory elements include a nucleic acid encoding a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE).

10. The polynucleotide of claim the nucleic acid encoding the WPRE has a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 5 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 5 or a reverse complementary sequence thereof.

11. The polynucleotide of any of claims 1 to 10, wherein the expression cassette further comprises a nucleic acid encoding an IL2 signal peptide.

12. The polynucleotide of claim 11, wherein the nucleic acid encoding the IL2 signal peptide has a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 3 or 1, 2, 3, 4, 5, 6, 7, 8, or 9 substitutions additions, deletions, or combinations thereof within the nucleotide sequence of SEQ ID NO: 3 or a reverse complementary sequence thereof.

13. The polynucleotide of any of claims 1 to 12, wherein the expression cassette includes an arrangement order (e.g., 5’ to 3’ arrangement order) of nucleic acids encoding an EF-1 promoter, an IL2 signal peptide, asprosin and / or the analogue thereof, WPRE, and a SV40poly(A) tail signal.

14. The polynucleotide of any of claims 1 to 12, wherein the expression cassette includes an arrangement order (e.g., 5’ to 3’ arrangement order) of nucleic acids encoding a CAG promoter, an IL2 signal peptide, asprosin and / or the analogue thereof, WPRE, and a SV40poly(A) tail signal.

15. The polynucleotide of any 6 to 14, further comprising a nucleic acid encoding inverted terminal repeats (ITRs) flanking the expression cassette, wherein at least one ITR is adjacent to the EF-1 or CAG promoter (5’-ITR) and at least one ITR is adjacent to the poly(A) tail signal (3’-ITR).

16. The polynucleotide of clam 15, wherein the ITRs are derived from AAV serotype 2.

17. The polynucleotide of any of claims 15 or 16, comprising an arrangement order of nucleic acids encoding the L-ITR, EF-1 promoter or CAG promoter, IL2 signal peptide, asprosin and / or an analogue thereof, WPRE, SV40poly(A) tail signal, and R-ITR.

18. A nucleic acid vector comprising the polynucleotide of any of claims 1 to 17.

19. The vector of claim 18, wherein the vector is an adenoviral vector, an adeno- associated viral vector, or a lentiviral vector.

20. The vector of claim 19, wherein the adeno-associated viral vector comprises at least one of AAV1, AAV2, AAV6, AAV8, AAV9, AAVrh74, AAVrh10, AAV5, AAV7, AAVS3, AAVHSC, AAV2.7m8, AAV-LK03, AAV8 / Olig001, AAV2i8, AAVhu37, AAV2tYF, AAVh1, AAVhu68, AAVrh.8, AAVrh9, AAV.PHP.B., AAV.PHP.eB, AAV.PHP.S, AAV / BBB, AAV-DJ, AAVr3.45, AAV-sh10, AAV2(Y444F), AAV4, AAV- RPF2, or AAV3b.

21. The vector of claim 19 or claim 20, wherein the adeno-associated viral vector comprises AAV1 or AAV8.

22. The vector of 18, which is a circular plasmid further comprising a backbone having a length of at least about 5000 bp or at least about 5500 bp.

23. The vector of claim 22, the backbone includes a selection marker selected from an antibiotic resistance encoding nucleic acid or a kanamycin resistance (KanR) encoding nucleic acid.

24. The vector of claim 22 or 23, wherein the backbone further comprises a pUC18 origin of replication (ORI).

25. The vector of any of claims 22 to 24 comprises a polynucleotide having a nucleotide sequence at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to SEQ ID NO: 14, 15, or 16.

26. The vector of any of claims 18 to 25, configured to promote expression of asprosin and / or an analogue thereof in liver of a subject upon systemic administration to the subject.

27. A pharmaceutical composition comprising the vector of any of claims 18 to 26 and a pharmaceutically acceptable carrier.

28. The pharmaceutical composition of claim 27, formulated for intramuscular or intravenous delivery.

29. The vector of any of claims 18 to 26 or the pharmaceutical composition of claim 27 or 28 for use in treating cognitive decline and / or memory deficits in a subject in need thereof.

30. The vector or the pharmaceutical composition of claim 29, where the memory deficits include associative memory deficits and novel object recognition memory deficits.

31. The vector of any of claims 26 or the pharmaceutical composition of claim 27 or 28, for use in treating Aβ mediated neurological pathogenesis in a subject in need thereof.

32. The vector of any of claims 18 to 26 or the pharmaceutical composition of claim 27 or 28, for use in treating cachexia in a subject in need thereof.

33. The vector or the pharmaceutical composition of claim 32, wherein the subject has or is at increased risk of Alzheimer’s disease, cognition deficiency disorder, age- associated memory impairment, or dementia.

34. The vector of any of claims 18 to 26 or the pharmaceutical composition of claim 27 or 28, for use in treating Alzheimer’s disease in a subject in need thereof.

Images