Polypeptides having alkaline phosphatase activity for pets

Non-mammalian alkaline phosphatases in pet food address stability issues of CIAP, enhancing intestinal health and microbial balance, and preventing conditions like diabetes and dysbiosis in companion animals.

WO2026082822A1PCT designated stage Publication Date: 2026-04-23NOVOZYMES AS
View PDF 15 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-10-15
Publication Date
2026-04-23

AI Technical Summary

Technical Problem

Existing alkaline phosphatases, such as calf intestinal alkaline phosphatase (CIAP), are not suitable for in vivo use in pet food due to low gastric or pepsin stability, and there is a need for novel alkaline phosphatases with improved stability for maintaining intestinal health and microbial balance in companion animals.

Method used

The use of non-mammalian polypeptides, such as fungal or bacterial alkaline phosphatases, in pet food to maintain intestinal health, microbial balance, and prevent conditions like diabetes, dysbiosis, and inflammation by administering effective amounts of these polypeptides.

Benefits of technology

The polypeptides improve intestinal health, maintain microbial balance, prevent conditions like diabetes and dysbiosis, and enhance overall health in companion animals by restoring gut integrity and reducing inflammation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000017_0001
    Figure IMGF000017_0001
  • Figure IMGF000017_0002
    Figure IMGF000017_0002
  • Figure IMGF000035_0001
    Figure IMGF000035_0001
Patent Text Reader

Abstract

Pet food comprising an enzyme having alkaline phosphatase activity provides for improved intestinal health and other health benefits related to activity of the enzyme on lipopolysaccharides.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] POLYPEPTIDES HAVING ALKALINE PHOSPHATASE ACTIVITY FOR PETS

[0002] Reference to a Sequence Listing

[0003] This application contains a Sequence Listing in computer readable form, which is incorporated herein by reference.

[0004] FIELD OF THE INVENTION

[0005] The present invention relates to the use of polypeptides having alkaline phosphatase activity in companion animals.

[0006] BACKGROUND OF THE INVENTION

[0007] ALP is an enzyme that removes phosphates from a variety of substrates. ALPs are active in diverse biological processes. ALPs are found in all tissues in the mammalian body but is mostly concentrated in the bones, kidneys, liver, intestines, and placenta. Intestinal alkaline phosphatase (IAP) has been most studied to date.

[0008] Calf intestinal alkaline phosphatase (CIAP) is a well-known and commercially available alkaline phosphatase. WO2022196538 discloses variants of a Calf Intestinal Alkaline Phosphatase (CIAP) with improved thermal stability. However, CIAP has low or no gastric or pepsin stability. CIAP is therefore not suitable for use in vivo such as in pet food. Accordingly, there is a need in the art for novel alkaline phosphatases.

[0009] Elanco (US20180326020) describes methods and compositions for reducing the environmental impact of animal waste using an alkaline phosphatase from Paenibacillus lentus. The alkaline phosphatase described in US20180326020 corresponds to SEQ ID NO:50 of the present invention. WO2023 / 102002 describes variants of a Paenibacillus lentus alkaline phosphatase with improved heat tolerance.

[0010] SUMMARY OF THE INVENTION

[0011] The invention is directed to a use of a polypeptide having alkaline phosphatase activity for the preparation of pet food and to a pet food comprising a polypeptide having alkaline phosphatase activity. Typically, the polypeptide is of non-mammalian origin, such as of fungal or bacterial origin. An aspect of the invention is directed to a pet food comprising a polypeptide having alkaline phosphatase activity for use in the maintenance or improvement of levels of commensal microbes in the intestines of companion animals and / or maintenance or improvement of intestinal health in a companion animal.

[0012] An aspect of the invention is directed to a method of maintaining or improving levels of commensal microbes in the intestines of companion animals and / or maintaining or improving intestinal health in a companion animal comprising feeding a companion animal a polypeptide having alkaline phosphatase activity such as a pet food comprising a polypeptide having alkaline phosphatase activity.

[0013] An aspect of the invention is directed to a method of maintaining general health in a companion animal by preventing or reducing inflammation of intestinal tissue in a companion animal, comprising feeding a companion animal a polypeptide having alkaline phosphatase activity such as a pet food comprising a polypeptide having alkaline phosphatase activity.

[0014] An aspect of the invention is directed to a method of preventing diabetes in an obese companion animal or near-obese companion animal or delaying the onset of diabetes in said animal, comprising feeding a companion animal a polypeptide having alkaline phosphatase activity such as a pet food comprising a polypeptide having alkaline phosphatase activity.

[0015] An aspect of the invention is directed to a method of preventing diabetes in a pet or a companion animal, or delaying the onset of diabetes in said animal, comprising feeding a companion animal a polypeptide having alkaline phosphatase activity such as a pet food comprising a polypeptide having alkaline phosphatase activity.

[0016] An aspect of the invention is directed to a method of reducing symptoms associated with aging in a companion animal comprising feeding a companion animal a polypeptide having alkaline phosphatase activity such as a pet food comprising a polypeptide having alkaline phosphatase activity.

[0017] An aspect of the invention is directed to a method of maintaining intestinal integrity or reducing gut leakage in a companion animal comprising feeding a companion animal a polypeptide having alkaline phosphatase activity such as a pet food comprising a polypeptide having alkaline phosphatase activity.

[0018] An aspect of the invention is directed to a method of preventing Irritable Bowel Syndrome (IBS), or reducing the frequency or severity of diarrhea in a companion animal comprising feeding a companion animal a polypeptide having alkaline phosphatase activity such as a pet food comprising a polypeptide having alkaline phosphatase activity.

[0019] An aspect of the invention is directed to a method of improving post antibiotic recovery in a companion animal or reducing the likelihood or preventing post antibiotic Clostridium difficile infection prevention, said method comprising feeding a companion animal a polypeptide having alkaline phosphatase activity such as a pet food comprising a polypeptide having alkaline phosphatase activity. Another aspect of the invention is a method of preventing or reducing intestinal colonization or systemic translocation of unwanted bacteria, as well as addressing dysbiosis by altering the bacterial and / or archaeal balance of the intestinal microbiota in a a companion animal. Dysbiosis, characterized by an imbalance in microbial populations within the gut, can lead to various gastrointestinal, metabolic, or inflammatory disorders. The method achieves these effects by administering to companion animal an effective amount of a polypeptide with alkaline phosphatase activity or a composition comprising such a polypeptide.

[0020] In yet another aspect is a method of improving the gut health or gut integrity in a companion animal. The method achieves these effects by administering to the animal an effective amount of a polypeptide with alkaline phosphatase activity or a composition comprising such a polypeptide.

[0021] Intestinal alkaline phosphatase (IAP) plays a critical role in preserving intestinal homeostasis, particularly in aging individuals. It targets several key intestinal alterations that contribute to age-related health decline, including gut barrier dysfunction, dysbiosis, and endotoxemia. Gut barrier dysfunction is associated with increased intestinal permeability, commonly referred to as "leaky gut," which allows harmful substances such as lipopolysaccharides (LPS) and other bacterial toxins to enter systemic circulation. This condition can lead to chronic low-grade inflammation, also known as inflammaging, which is a significant driver of frailty and age-related diseases in pets. Dysbiosis, or the imbalance in the microbial populations of the gut, further exacerbates these issues by promoting the growth of pathogenic bacteria while depleting beneficial species. Endotoxemia, characterized by the presence of LPS in the bloodstream, is a direct consequence of both dysbiosis and gut barrier dysfunction and is a major contributor to systemic inflammation.

[0022] In addition to its application in treating dysbiosis, gut barrier dysfunction, and inflammation, a further aspect of the invention is directed to a method of preventing aging or the symptoms of aging in a companion animal. This method involves administering to the animal subject a functional pet food comprising the polypeptide with alkaline phosphatase activity as defined by the invention. Functional pet foods containing alkaline phosphatase represent a novel dietary intervention aimed at promoting gut health and preventing the chronic inflammation and systemic effects associated with aging. The incorporation of alkaline phosphatase into functional pet foods offers a convenient and non-invasive approach to preserving intestinal homeostasis and preventing the progression of frailty and age-related diseases.

[0023] The method has broad applications in prophylactic treatments in pets. As stated, it can be used to prevent or treat inflammatory bowel diseases in pets, where chronic inflammation and impaired barrier function are prominent features. By restoring epithelial integrity and reducing inflammation, the method alleviates symptoms and improves gut health. In metabolic disorders, including obesity, type 2 diabetes, and metabolic syndrome, the method contributes to rebalancing the gut microbiota and reducing systemic inflammation, which are key factors in improving metabolic outcomes.

[0024] The pet food of the invention is also beneficial in preventing sepsis by strengthening the intestinal barrier and reducing bacterial translocation in patients at risk due to surgery, trauma, or critical illness. Antibiotic-associated dysbiosis, which often results in overgrowth of opportunistic pathogens such as Clostridioides difficile or Escherichia coli, can also be addressed by the method, as it restores microbial balance and prevents infection recurrence.

[0025] Furthermore, the pet food of the invention may support the gut-brain axis, potentially benefiting pets with psychiatric symptoms linked to gut health, such as depression or neurodegenerative diseases.

[0026] BRIEF DESCRIPTION OF THE FIGURES

[0027] Figure 1 (Figure 1a, 1b, 1c) shows the sequence alignment of the variable regions of the thirteen polypeptides with high Template Modelling scores with the variable region of human intestinal ALP.

[0028] Figure 2 (Figure 2a, 2b, 2c) shows the sequence alignment of the variable regions of thirteen polypeptides with high Template Modelling scores with the variable region of human intestinal ALP.

[0029] Figure 3 is a phylogenetic tree of the bacterial full-length sequences of wt ALPs of the invention including vs human intenstinal ALP (hiALP; SWISSPROT P09923). The closest bacterial ALPs to hiALP are in the box.

[0030] Figure 4 shows the outcomes of ATP dephosphorylation by ALPs, including calf intestinal and microbial enzymes, showing OD620 readings for phosphate release at different enzyme concentrations.

[0031] Figure 5 shows the outcomes of ADP dephosphorylation by ALPs, including calf intestinal and microbial enzymes, showing OD620 readings for phosphate release at different enzyme concentrations.

[0032] Figure 6 shows the outcomes of AMP dephosphorylation by ALPs, including calf intestinal and microbial enzymes, showing OD620 readings for phosphate release at different enzyme concentrations. Figure 7 demonstrates the outcomes of LPS dephosphorylation by ALPs, including calf intestinal and microbial enzymes, showing OD620 readings for phosphate release at different enzyme concentrations.

[0033] Figure 8 displays a barplot of the measured concentrations (in pM) of adenosine generated from the dephosphorylation of ATP, ADP, and AMP substrates by ALPs after 60 minutes. Individual bars correspond to distinct ALPs as labeled on the x-axis.

[0034] Figure 9 shows the inhibitory effect of ATP on Ligilactobacillus salivarius Ls-33 growth and its restoration by ALP treatment, based on OD600 measurements over time.

[0035] BRIEF DESCRIPTION OF THE SEQUENCES

[0036] SEQ ID NO: 1 is a polypeptide obtained from Parageobacillus caldoxylosilyticus having alkaline phosphatase activity.

[0037] SEQ ID NO: 2 is a polypeptide obtained from Geobacillus thermoleovorans having alkaline phosphatase activity.

[0038] SEQ ID NO: 3 is a polypeptide obtained from Sporolactobacillus sp-63357 having alkaline phosphatase activity.

[0039] SEQ ID NO: 4 is a polypeptide obtained from Anoxybacillus caldiproteolyticus having alkaline phosphatase activity.

[0040] SEQ ID NO: 5 is a polypeptide obtained from Geobacillus thermoleovorans having alkaline phosphatase activity.

[0041] SEQ ID NO: 6 is a polypeptide obtained from Paenibacillus xylanexedens having alkaline phosphatase activity.

[0042] SEQ ID NO: 7 is a polypeptide obtained from Sporolactobacillus sp-63357 having alkaline phosphatase activity.

[0043] SEQ ID NO: 8 is a polypeptide obtained from Paenibacillus panacisoli having alkaline phosphatase activity.

[0044] SEQ ID NO: 9 is a polypeptide obtained from Collimonas pratensis having alkaline phosphatase activity.

[0045] SEQ ID NO: 10 is a polypeptide obtained from Paenibacillus illinoisensis having alkaline phosphatase activity.

[0046] SEQ ID NO: 11 is a polypeptide obtained from Neobacillus bataviensis having alkaline phosphatase activity.

[0047] SEQ ID NO: 12 is a polypeptide obtained from Aeromonas salmonicida subsp. salmonicida having alkaline phosphatase activity.

[0048] SEQ ID NO: 13 is a polypeptide obtained from Paenibacillus amylolyticus having alkaline phosphatase activity. SEQ ID NO: 14 is a polypeptide obtained from Serratia plymuthica having alkaline phosphatase activity.

[0049] SEQ ID NO: 15 is a polypeptide obtained from Cytobacillus firmus having alkaline phosphatase activity.

[0050] SEQ ID NO: 16 is a polypeptide obtained from Priestia megaterium having alkaline phosphatase activity.

[0051] SEQ ID N0:17 is a polypeptide obtained from Trichoderma citrinoviride having alkaline phosphatase activity.

[0052] SEQ ID NO: 18 is a polypeptide obtained from Truncatella angustata having alkaline phosphatase activity.

[0053] SEQ ID NO: 19 is a polypeptide obtained from Morchella semilibera having alkaline phosphatase activity.

[0054] SEQ ID NO: 20 is a polypeptide obtained from Serratia ficaria having alkaline phosphatase activity.

[0055] SEQ ID NO: 21 is a polypeptide obtained from a metagenome having alkaline phosphatase activity.

[0056] SEQ ID NO: 22 is a polypeptide obtained from a metagenome having alkaline phosphatase activity.

[0057] SEQ ID NO: 23 is a polypeptide obtained from a metagenome having alkaline phosphatase activity.

[0058] SEQ ID NO: 24 is a polypeptide obtained from a metagenome having alkaline phosphatase activity.

[0059] SEQ ID NO: 25 is a polypeptide obtained from a metagenome having alkaline phosphatase activity.

[0060] SEQ ID NO: 26 is a polypeptide obtained from a metagenome having alkaline phosphatase activity.

[0061] SEQ ID NO: 27 is a polypeptide obtained from Sporormia fimetaria having alkaline phosphatase activity.

[0062] SEQ ID NO: 28 is a polypeptide obtained from Thermoascus crustaceus having alkaline phosphatase activity.

[0063] SEQ ID NO: 29 is a polypeptide obtained from Thielavia australiensis having alkaline phosphatase activity.

[0064] SEQ ID NO: 30 is a polypeptide obtained from Chaetomium thermophilum var. thermophilum having alkaline phosphatase activity.

[0065] SEQ ID NO: 31 is a polypeptide obtained from Aspergillus sp. XZ2669 having alkaline phosphatase activity. SEQ ID NO: 32 is a polypeptide obtained from Colletotrichum sp-53045having alkaline phosphatase activity.

[0066] SEQ ID NO: 33 is a polypeptide obtained from a metagenome having alkaline phosphatase activity.

[0067] SEQ ID NO: 34 is a polypeptide obtained from a metagenome having alkaline phosphatase activity.

[0068] SEQ ID NO: 35 is a polypeptide obtained from Caulobacter sp-63731 having alkaline phosphatase activity.

[0069] SEQ ID NO: 36 is a polypeptide obtained from Caulobacter vibrioides having alkaline phosphatase activity.

[0070] SEQ ID NO: 37 is a polypeptide obtained from Serratia nematodiphila having alkaline phosphatase activity.

[0071] SEQ ID NO: 38 is a polypeptide obtained from Loktanella salsilacus having alkaline phosphatase activity.

[0072] SEQ ID NO: 39 is a polypeptide obtained from Sphingopyxis chilensis having alkaline phosphatase activity.

[0073] SEQ ID NO: 40 is a polypeptide obtained from Tolypocladium sp. XZ2657 having alkaline phosphatase activity.

[0074] SEQ ID NO: 41 is a polypeptide obtained from Penicillium vasconiae having alkaline phosphatase activity.

[0075] SEQ ID NO: 42 is a polypeptide obtained from Cladobotryum sp having alkaline phosphatase activity.

[0076] SEQ ID NO: 43 is a polypeptide obtained from Taifanglania sp. ZY039 having alkaline phosphatase activity.

[0077] SEQ ID NO: 44 is a polypeptide obtained from Achaetomium sp. ZY150 having alkaline phosphatase activity.

[0078] SEQ ID NO: 45 is a polypeptide obtained from Chaetomium sp. ZY474 having alkaline phosphatase activity.

[0079] SEQ ID NO: 46 is a polypeptide obtained from Fontibacillus aquaticus having alkaline phosphatase activity.

[0080] SEQ ID NO: 47 is a polypeptide obtained from Paenibacillus sp-19179 having alkaline phosphatase activity.

[0081] SEQ ID NO: 48 is a polypeptide obtained from Paenibacillus sp-62606 having alkaline phosphatase activity.

[0082] SEQ ID NO: 49 is a polypeptide obtained from Paenibacillus woosongensis having alkaline phosphatase activity. SEQ ID NO: 50 is a polypeptide obtained from Bacillus lentus / Lederbergia lenta having alkaline phosphatase activity and is the polypeptide described in LIS20180326020.

[0083] SEQ ID NO: 51 is a polypeptide obtained from a metagenome having alkaline phosphatase activity.

[0084] SEQ ID NO: 52 is a polypeptide obtained from Paenibacillus sp-62603 having alkaline phosphatase activity.

[0085] SEQ ID NO: 53 is a polypeptide obtained from Neobacillus bataviensis having alkaline phosphatase activity.

[0086] SEQ ID NO: 54 is a polypeptide obtained from Paenibacillus taohuashanense having alkaline phosphatase activity.

[0087] SEQ ID NO: 55 is a polypeptide obtained from Hyphomonas hirschiana having alkaline phosphatase activity.

[0088] SEQ ID NO: 56 is a polypeptide obtained from Hyphomonas oceanitis having alkaline phosphatase activity.

[0089] SEQ ID NO: 57 is a polypeptide obtained from Deinococcus radiodurans having alkaline phosphatase activity.

[0090] SEQ ID NO: 58 is a polypeptide obtained from Deinococcus gobiensis having alkaline phosphatase activity.

[0091] SEQ ID NO: 59 is a polypeptide obtained from Deinococcus pimensis having alkaline phosphatase activity.

[0092] SEQ ID NO: 60 is a polypeptide obtained from Deinococcus sp-17890 having alkaline phosphatase activity.

[0093] SEQ ID NO: 61 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0094] SEQ ID NO: 62 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0095] SEQ ID NO: 63 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0096] SEQ ID NO: 64 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0097] SEQ ID NO: 65 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0098] SEQ ID NO: 66 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity.

[0099] SEQ ID NO: 67 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity.

[0100] SEQ ID NO: 68 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity.

[0101] SEQ ID NO: 69 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity.

[0102] SEQ ID NO: 70 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity.

[0103] SEQ ID NO: 71 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity.

[0104] SEQ ID NO: 72 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity.

[0105] SEQ ID NO: 73 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity.

[0106] SEQ ID NO: 74 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 75 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity.

[0107] SEQ ID NO: 76 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity.

[0108] SEQ ID NO: 77 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity.

[0109] SEQ ID NO: 78 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity.

[0110] SEQ ID NO: 79 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0111] SEQ ID NO: 80 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0112] SEQ ID NO: 81 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0113] SEQ ID NO: 82 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0114] SEQ ID NO: 83 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0115] SEQ ID NO: 84 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0116] SEQ ID NO: 85 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0117] SEQ ID NO: 86 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0118] SEQ ID NO: 87 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity.

[0119] SEQ ID NO: 88 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity.

[0120] SEQ ID NO: 89 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity.

[0121] SEQ ID NO: 90 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity.

[0122] SEQ ID NO: 91 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity.

[0123] SEQ ID NO: 92 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity.

[0124] SEQ ID NO: 93 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity.

[0125] SEQ ID NO: 94 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity.

[0126] SEQ ID NO: 95 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0127] SEQ ID NO: 96 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0128] SEQ ID NO: 97 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0129] SEQ ID NO: 98 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0130] SEQ ID NO: 99 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0131] SEQ ID NO: 100 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0132] SEQ ID NO: 101 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0133] SEQ ID NO: 102 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0134] SEQ ID NO: 103 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0135] SEQ ID NO: 104 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0136] SEQ ID NO: 105 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0137] SEQ ID NO: 106 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity.

[0138] SEQ ID NO: 107 is the polypeptide described as SEQ ID NO: 1 in WO2023 / 102002, a variant of

[0139] SEQ ID NQ:50.

[0140] SEQ ID NO 108 is human intestinal alkaline phosphatase;

[0141] SEQ ID NO.109: is the ‘variable region’ of SEQ ID NQ:108, spanning from aa 370 to 460. SEQ ID NO:110: is the ‘variable region’ of SEQ ID NO:55, spanning from aa 370 to 479.

[0142] SEQ ID NO: 111 : is the ‘variable region’ of SEQ ID NO:38, spanning from aa 342 to 451.

[0143] SEQ ID NO:112: is the ‘variable region’ of SEQ ID NO:21 , spanning from aa 353 to 462.

[0144] SEQ ID NO:113: is the ‘variable region’ of SEQ ID NO:37 , spanning from aa 354 to 452. SEQ ID NO:114: is the ‘variable region’ of SEQ ID NO:56, spanning from aa 379 to 481.

[0145] SEQ ID NO: 115: is the ‘variable region’ of SEQ ID NQ:20, spanning from aa 354 to 452.

[0146] SEQ ID NO:116: is the ‘variable region’ of SEQ ID NO:14, spanning from aa 354 to 452.

[0147] SEQ ID NO: 117: is the ‘variable region’ of SEQ ID NO:36, spanning from aa 350 to 447.

[0148] SEQ ID NO: 118: is the ‘variable region’ of SEQ ID NO:35, spanning from aa 353 to 450.

[0149] SEQ ID NO: 119: is the ‘variable region’ of SEQ ID NO:34, spanning from aa 310 to 407.

[0150] SEQ ID NQ:120: is the ‘variable region’ of SEQ ID NO:39, spanning from aa 332 to 428.

[0151] SEQ ID NO:121 : is the ‘variable region’ of SEQ ID NO:12, spanning from aa 313 to 408.

[0152] SEQ ID NO:122: is the ‘variable region’ of SEQ ID NO:9, spanning from aa 317 to 418.

[0153] SEQ ID NOs: 123-128: are the sequences A to F.

[0154] SEQ ID Nos: 129 - 142: sequences depicted in Figure 1a-c.

[0155] SEQ ID Nos: 143-146: are the InFusion insert primers.

[0156] SEQ ID Nos: 147 - 190: are the primer sequences of Table 29.

[0157] DETAILED DESCRIPTION OF THE INVENTION

[0158] Definitions

[0159] In accordance with this detailed description, the following definitions apply. Note that the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise.

[0160] Unless defined otherwise or clearly indicated by context, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0161] The term "companion animal" or “pet” are used interchangeably and refer to an animal selected from the group consisting of dog, cat, rabbit, ferret, and gerbil. The term "pet food composition" refers to a composition that can be ingested by a companion animal. Non-limiting examples of pet food compositions include supplements for a companion animal, dog food, cat food, treats, kibble, biscuits, raw hide, chews, fillers, gravy, sauce, beverage, supplemental water, and combinations thereof. The pet food composition can be wet, moist and / or dry. The term "kibble" alone includes a particulate pellet like component of animal feeds, such as dog and cat feeds, typically having a moisture content of less than 12% by weight. Kibbles may range in texture from hard to soft. Kibbles may range in internal structure from expanded to dense. The term complete and nutritionally balanced, unless otherwise specified, refers to a pet food composition, such as dog food or cat food, having all known required nutrients in proper amounts and proportions based upon the recommendation of recognized authorities in the field of animal nutrition.

[0162] Composition: The term “composition” refers to a composition comprising a carrier and at least one enzyme of the present invention. The compositions described herein may be mixed with a pet food and feed.

[0163] Direct Fed Microbial: The term “direct fed microbial” means live micro-organisms including spores which, when administered in adequate amounts, confer a benefit, such as improved digestion or health, on the host.

[0164] Effective amount / concentration / dosage: The terms “effective amount”, “effective concentration”, or “effective dosage” are defined as the amount, concentration, or dosage of the bacterial strain(s) / enzyme(s) sufficient to improve the digestion or yield of an animal. The actual effective dosage in absolute numbers depends on factors including: the state of health of the animal in question, other ingredients present. The “effective amount”, “effective concentration”, or “effective dosage” of the bacterial strain(s) / enzyme(s) may be determined by routine assays known to those skilled in the art.

[0165] Nutrient Digestibility: The term “nutrient digestibility” means the fraction of a nutrient that disappears from the gastro-intestinal tract or a specified segment of the gastro-intestinal tract, e.g. the small intestine. Nutrient digestibility may be measured as the difference between what is administered to the subject and what, comes out in the faeces of the subject, or between what is administered to the subject and what remains in the digesta on a specified segment of the gastro intestinal tract, e.g. the ileum.

[0166] Nutrient digestibility as used herein may be measured by the difference between the intake of a nutrient and the excreted nutrient by means of the total collection of excreta during a period of time; or with the use of an inert marker that is not absorbed by the animal, and allows the researcher calculating the amount of nutrient that disappeared in the entire gastro-intestinal tract or a segment of the gastro-intestinal tract. Such an inert marker may be titanium dioxide, chromic oxide or acid insoluble ash. Digestibility may be expressed as a percentage of the nutrient in the feed, or as mass units of digestible nutrient per mass units of nutrient in the feed. Nutrient digestibility as used herein encompasses starch digestibility, fat digestibility, protein digestibility, and amino acid digestibility.

[0167] Energy digestibility as used herein means the gross energy of the feed consumed minus the gross energy of the faeces or the gross energy of the feed consumed minus the gross energy of the remaining digesta on a specified segment of the gastro-intestinal tract of the animal, e.g. the ileum. Metabolizable energy as used herein refers to apparent metabolizable energy and means the gross energy of the feed consumed minus the gross energy contained in the faeces, urine, and gaseous products of digestion. Energy digestibility and metabolizable energy may be measured as the difference between the intake of gross energy and the gross energy excreted in the faeces or the digesta present in specified segment of the gastro-intestinal tract using the same methods to measure the digestibility of nutrients, with appropriate corrections for nitrogen excretion to calculate metabolizable energy of feed.

[0168] Stable: The term "stable" is a term that is known in the art, and in a preferred aspect, stable is intended to mean the ability of the microorganism to remain in a spore form until it is administered to an animal to improve the health of the animal.

[0169] Alkaline phosphatase The term “alkaline phosphatase” means an enzyme having EC number 3.1.3.1

[0170] Extension: The term “extension” means an addition of one or more amino acids to the amino and / or carboxyl terminus of a polypeptide, wherein the “extended” polypeptide has alkaline phosphatase activity.

[0171] Fragment: The term “fragment” means a polypeptide having one or more amino acids absent from the amino and / or carboxyl terminus of the mature polypeptide, wherein the fragment has alkaline phosphatase activity.

[0172] Fusion polypeptide: The term “fusion polypeptide” is a polypeptide in which one polypeptide is fused at the N-terminus and / or the C-terminus of a polypeptide of the present invention. A fusion polypeptide is produced by fusing a polynucleotide encoding another polypeptide to a polynucleotide of the present invention, or by fusing two or more polynucleotides of the present invention together. Techniques for producing fusion polypeptides are known in the art, and include ligating the coding sequences encoding the polypeptides so that they are in frame and that expression of the fusion polypeptide is under control of the same promoter(s) and terminator. Fusion polypeptides may also be constructed using intein technology in which fusion polypeptides are created post-translationally (Cooper et al., 1993, EMBO J. 12: 2575-2583; Dawson et al., 1994, Science 266: 776-779). A fusion polypeptide can further comprise a cleavage site between the two polypeptides. Upon secretion of the fusion protein, the site is cleaved releasing the two polypeptides. Examples of cleavage sites include, but are not limited to, the sites disclosed in Martin et al., 2003, J. Ind. Microbiol. Biotechnol. 3: 568-576; Svetina et al., 2000, J. Biotechnol. 7Q: 245-251 ; Rasmussen-Wilson et al., 1997, Appl. Environ. Microbiol. 63: 3488-3493; Ward et al., 1995, Biotechnology 13: 498-503; and Contreras et al., 1991 , Biotechnology 9: 378-381 ; Eaton eta / ., 1986, Biochemistry 25: 505-512; Collins-Racie etal., 1995, Biotechnology 13: 982-987; Carter et al., 1989, Proteins: Structure, Function, and Genetics 6: 240-248; and Stevens, 2003, Drug Discovery World 4: 35-48. Heterologous: The term heterologous means, with respect to a host cell, that a polypeptide or nucleic acid does not naturally occur in the host cell. The term "heterologous" means, with respect to a polypeptide or nucleic acid, that a control sequence, e.g., promoter, of a polypeptide or nucleic acid is not naturally associated with the polypeptide or nucleic acid, i.e., the control sequence is from a gene other than the gene encoding the mature polypeptide.

[0173] Healthy gut: The term “healthy gut” is one that functions efficiently, with a strong intestinal barrier, balanced microbiota, minimal inflammation, and optimal communication with other systems.

[0174] Gut integrity: The term “gut integrity” involves strengthening the gut lining, reducing inflammation, supporting the microbiome, and minimizing stressors to restore gut health and prevent systemic issues.

[0175] Isolated: The term “isolated” means a polypeptide, nucleic acid, cell, or other specified material or component that has been separated from at least one other material or component, including but not limited to, other proteins, nucleic acids, cells, etc. An isolated polypeptide, nucleic acid, cell or other material is thus in a form that does not occur in nature. An isolated polypeptide includes, but is not limited to, a culture broth containing the secreted polypeptide expressed in a host cell.

[0176] Mature polypeptide: The term “mature polypeptide” means a polypeptide in its mature form following N-terminal and / or C-terminal processing (e.g., removal of signal peptide).

[0177] Native: The term "native" means a nucleic acid or polypeptide naturally occurring in a host cell.

[0178] Purified: The term “purified” means a nucleic acid, polypeptide or cell that is substantially free from other components as determined by analytical techniques well known in the art (e.g., a purified polypeptide or nucleic acid may form a discrete band in an electrophoretic gel, chromatographic eluate, and / or a media subjected to density gradient centrifugation). A purified nucleic acid or polypeptide is at least about 50% pure, usually at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5%, about 99.6%, about 99.7%, about 99.8% or more pure (e.g., percent by weight or on a molar basis). In a related sense, a composition is enriched for a molecule when there is a substantial increase in the concentration of the molecule after application of a purification or enrichment technique. The term "enriched" refers to a compound, polypeptide, cell, nucleic acid, amino acid, or other specified material or component that is present in a composition at a relative or absolute concentration that is higher than a starting composition.

[0179] In one aspect, the term "purified" as used herein refers to the polypeptide or cell being essentially free from components (especially insoluble components) from the production organism. In other aspects, the term purified refers to the polypeptide being essentially free of insoluble components (especially insoluble components) from the native organism from which it is obtained. In one aspect, the polypeptide is separated from some of the soluble components of the organism and culture medium from which it is recovered. The polypeptide may be purified ( / .e., separated) by one or more of the unit operations filtration, precipitation, or chromatography.

[0180] Accordingly, the polypeptide may be purified such that only minor amounts of other proteins, in particular, other polypeptides, are present. The term "purified" as used herein may refer to removal of other components, particularly other proteins and most particularly other enzymes present in the cell of origin of the polypeptide. The polypeptide may be "substantially pure", i.e., free from other components from the organism in which it is produced, e.g., a host organism for recombinantly produced polypeptide. In one aspect, the polypeptide is at least 40% pure by weight of the total polypeptide material present in the preparation. In one aspect, the polypeptide is at least 50%, 60%, 70%, 80% or 90% pure by weight of the total polypeptide material present in the preparation. As used herein, a "substantially pure polypeptide" may denote a polypeptide preparation that contains at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at most 4%, more preferably at most 3%, even more preferably at most 2%, most preferably at most 1%, and even most preferably at most 0.5% by weight of other polypeptide material with which the polypeptide is natively or recombinantly associated.

[0181] It is, therefore, preferred that the substantially pure polypeptide is at least 92% pure, preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 97% pure, more preferably at least 98% pure, even more preferably at least 99% pure, most preferably at least 99.5% pure by weight of the total polypeptide material present in the preparation. The polypeptide of the present invention is preferably in a substantially pure form i.e., the preparation is essentially free of other polypeptide material with which it is natively or recombinantly associated). This can be accomplished, for example by preparing the polypeptide by well-known recombinant methods or by classical purification methods.

[0182] Recombinant: The term "recombinant" is used in its conventional meaning to refer to the manipulation, e.g., cutting and rejoining, of nucleic acid sequences to form constellations different from those found in nature. The term recombinant refers to a cell, nucleic acid, polypeptide or vector that has been modified from its native state. Thus, for example, recombinant cells express genes that are not found within the native (non-recombinant) form of the cell, or express native genes at different levels or under different conditions than found in nature. The term “recombinant” is synonymous with “genetically modified” and “transgenic”.

[0183] Recover: The terms "recover" or “recovery” means the removal of a polypeptide from at least one fermentation broth component selected from the list of a cell, a nucleic acid, or other specified material, e.g., recovery of the polypeptide from the whole fermentation broth, or from the cell-free fermentation broth, by polypeptide crystal harvest, by filtration, e.g. depth filtration (by use of filter aids or packed filter medias, cloth filtration in chamber filters, rotary-drum filtration, drum filtration, rotary vacuum-drum filters, candle filters, horizontal leaf filters or similar, using sheed or pad filtration in framed or modular setups) or membrane filtration (using sheet filtration, module filtration, candle filtration, microfiltration, ultrafiltration in either cross flow, dynamic cross flow or dead end operation), or by centrifugation (using decanter centrifuges, disc stack centrifuges, hyrdo cyclones or similar), or by precipitating the polypeptide and using relevant solidliquid separation methods to harvest the polypeptide from the broth media by use of classification separation by particle sizes. Recovery encompasses isolation and / or purification of the polypeptide.

[0184] Sequence identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter “sequence identity”.

[0185] For purposes of the present invention, the sequence identity between two amino acid sequences is determined as the output of “longest identity” using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 6.6.0 or later. The parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. In order for the Needle program to report the longest identity, the -nobrief option must be specified in the command line. The output of Needle labeled “longest identity” is calculated as follows:

[0186] (Identical Residues x 100) / (Length of Alignment - Total Number of Gaps in Alignment)

[0187] For purposes of the present invention, the sequence identity between two polynucleotide sequences is determined as the output of “longest identity” using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 6.6.0 or later. The parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NLIC4.4) substitution matrix. In order for the Needle program to report the longest identity, the nobrief option must be specified in the command line. The output of Needle labeled “longest identity” is calculated as follows:

[0188] (Identical Deoxyribonucleotides x 100) / (Length of Alignment- Total Number of Gaps in Alignment) Signal Peptide: A "signal peptide" is a sequence of amino acids attached to the N-terminal portion of a protein, which facilitates the secretion of the protein outside the cell. The mature form of an extracellular protein lacks the signal peptide, which is cleaved off during the secretion process.

[0189] Structural Similarity: The relatedness between two amino acid sequences has conventionally been described by the parameter “sequence identity”. However, since the biological function of a polypeptide is defined by its three-dimensional structure rather than its amino acid sequence, a better way of assessing a functional relationship between polypeptides is by comparing their three-dimensional structures. Thus, for the purposes of the present invention, the relatedness between the three-dimensional structure of two polypeptides is described by the parameter “structural similarity”.

[0190] A three-dimensional structure of any polypeptide may be obtained experimentally via, e.g., X-ray crystallography or using in silico methods such as AlphaFold (vide supra). The structural similarity between three-dimensional structures may then be determined by the TM-score, which is calculated using the following general formula (Zhang & Skolnick, Proteins 57:702-710, 2004):

[0191] TM-score where LN is the length of the native structure, LT is the length of the aligned residues to the template structure, d, is the distance between the / th pair of aligned residues and do is a scale to normalize the match difference. ‘Max’ denotes the maximum value after optimal spatial superposition.

[0192] For the purposes of the present invention, LN is always the length of the reference protein, indicating the use of a fixed reference length L to prevent artificially large TM-scores from alignment of substructures:

[0193] TM-score

[0194] A structural alignment of the three-dimensional structures of two polypeptides is necessary before the TM-score can be calculated. This is achieved via algorithms that optimize the structural overlap, and several methods are available, such as CEalign (Shindyalov and Bourne, Protein Eng., 11 , 739-747, 1998), DALI (Holm and Sander, Trends Biochem. Sci., 20, 478-480, 1995), or TM-align (Nucleic Acids Res. 33:2302-2309, 2005).

[0195] For the purposes of the present invention, TM-align is applied. For convenience, TM-score is integrated in the TM-align software, which is available from the author’s website. The version of TM-align is preferably updated 2019-08-22 or later, and the TM-score between a reference and a query protein is determined by running this command: TMalign <query . pdb> <ref erence . pdb> -L <length of reference>

[0196] Where <query.pdb> is the name of the PDB file containing coordinates of the query polypeptide, <reference.pdb> is the name of the PDB file containing coordinates of the reference polypeptide. The TM-score is calculated and reported in the output, along with several other parameters from the alignment.

[0197] The maximal TM-score is 1 , e.g., 1.0, corresponding to identical three-dimensional structures.

[0198] Subsequence: The term “subsequence” means a polynucleotide having one or more nucleotides absent from the 5' and / or 3' end of a mature polypeptide coding sequence; wherein the subsequence encodes a fragment having alkaline phosphatase activity.

[0199] Variant: The term “variant” means a polypeptide having alkaline phosphatase activity comprising a man-made mutation, i.e., a substitution, insertion (including extension), and / or deletion (e.g., truncation), at one or more positions. A substitution means replacement of the amino acid occupying a position with a different amino acid; a deletion means removal of the amino acid occupying a position; and an insertion means adding 1-5 amino acids (e.g., 1-3 amino acids, in particular, 1 amino acid) adjacent to and immediately following the amino acid occupying a position.

[0200] Wild-type: The term "wild-type" in reference to an amino acid sequence or nucleic acid sequence means that the amino acid sequence or nucleic acid sequence is a native or naturally- occurring sequence. As used herein, the term "naturally-occurring" refers to anything (e.g., proteins, amino acids, or nucleic acid sequences) that is found in nature. Conversely, the term "non-naturally occurring" refers to anything that is not found in nature (e.g., recombinant nucleic acids and protein sequences produced in the laboratory or modification of the wild-type sequence).

[0201] Alkaline Phosphatases of the Invention

[0202] The present invention relates to polypeptides having alkaline phosphatase activity for use in pet food or for administration to pets. The invention is directed to a pet food comprising a polypeptide having alkaline phosphatase activity, typically wherein the polypeptide is of non-mammalian origin, such as of fungal or bacterial origin.

[0203] An embodiment of the invention is directed to a pet food comprising a polypeptide having alkaline phosphatase activity, wherein the polypeptide is selected from the group consisting of a polypeptide having at least 70% sequence identity, such as at least 75% sequence identity, such as at least 80%, at least 85%, at least 90%, at least 95%, such as at least 96%, at least 97%, at least 98%, at least 99%, such as 100% sequence identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31 , SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 , SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51 , SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61 , SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71 , SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81 , SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91 , SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101 , SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105 and SEQ ID NO: 106. In an alternative embodiment, the alkaline phosphatase is SEQ ID NO: 107.

[0204] As can be seen from Table 1 , polypeptides of the invention have alkaline phosphatase activity, as measured by the relative specific activity. The activity of polypeptides of the invention typically greater or equal to the alkaline phosphatase of LIS20180326020, which corresponds to SEQ ID NQ:50. Accordingly, in one embodiment of the invention, the alkaline phosphatase activity of the polypeptides of the invention is greater or equal to the activity of SEQ ID NQ:50. Table 1

[0205] In a suitable embodiment, the polypeptide having alkaline phosphatase activity is of bacterial or fungal origin or is a variant of a polypeptide of bacterial or fungal origin, wherein the activity is greater or equal to the activity of SEQ ID NO:50, more preferably a polypeptide of bacterial origin or a variant of a polypeptide of bacterial origin, having alkaline phosphatase activity, wherein the activity is greater or equal to the activity of SEQ ID NO:50. Accordingly, a preferred embodiment of the invention is directed to polypeptides having alkaline phosphatase activity, selected from the group consisting of:

[0206] (a) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 11;

[0207] (b) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 13;

[0208] (c) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 14;

[0209] (d) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 16;

[0210] (e) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 19;

[0211] (f) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 20;

[0212] (g) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 21;

[0213] (h) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 29;

[0214] (i) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 36;

[0215] (j) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 37;

[0216] (k) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 39;

[0217] (l) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 61;

[0218] (m)a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 63;

[0219] (n) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 65;

[0220] (o) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 79;

[0221] (p) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 80;

[0222] (q) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 82;

[0223] (r) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 84;

[0224] (s) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 85;

[0225] (t) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 86;

[0226] (u) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 95;

[0227] (v) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 96;

[0228] (w) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 97;

[0229] (x) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 98;

[0230] (y) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 99;

[0231] (z) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 100;

[0232] (aa) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least

[0233] 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least

[0234] 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least

[0235] 98%, at least 99%, or 100% to SEQ ID NO: 101;

[0236] (bb) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least

[0237] 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least

[0238] 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least

[0239] 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least

[0240] 98%, at least 99%, or 100% to SEQ ID NO: 102;

[0241] (cc) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least

[0242] 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least

[0243] 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least

[0244] 98%, at least 99%, or 100% to SEQ ID NO: 103;

[0245] (dd) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least

[0246] 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least

[0247] 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least

[0248] 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least

[0249] 98%, at least 99%, or 100% to SEQ ID NO: 104; and

[0250] (ee) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 105; and

[0251] (ff) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least

[0252] 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least

[0253] 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least

[0254] 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least

[0255] 98%, at least 99%, or 100% to SEQ ID NO: 106.

[0256] In an alternative embodiment, the alkaline phosphatase selected from a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 107.

[0257] It has been found that a polypeptide having at least 70% sequence identity to SEQ ID NO: 11 , a polypeptide having at least 70% sequence identity to SEQ ID NO: 21 , and variants thereof, are particularly suitable in vivo and with the preferred activity. Accordingly, in a highly suitable embodiment of the invention, the polypeptide having alkaline phosphatase activity is selected from the group consisting of a) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 11 , b) a variant of SEQ ID NO: 11 having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 61 , SEQ ID NO: 62, SEQ ID NO: 63 , SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81 , SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101 , SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, and SEQ ID NO: 106; c) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 21 ; and d) a variant of SEQ ID NO: 21 having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71 , SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91 , SEQ ID NO: 92, SEQ ID NO: 93, and SEQ ID NO: 94; e) a polypeptide having at least 70% sequence identity to a mature polypeptide of polypeptide of (a) or (c); f) a polypeptide encoded by a polynucleotide having at least 70% sequence identity to the mature polypeptide coding sequence of a polypeptide of (a), (b), (c), or (d); g) a polypeptide derived from a polypeptide of (a), (b), (c), or (d); or a mature polypeptide of (e) by substitution, deletion or addition of 1 to 120 amino acids, such as 1 to 100, 1 to 80, 1 to 60 or 1 to 40 amino acids; h) a polypeptide derived from the polypeptide of (a), (b), (c), or (d) wherein the N- and / or C- terminal end has been extended by the addition of 1 to 50 amino acids, such as 1 to 40, 1 to 30 or 1 to 20 amino acids; and i) a fragment of the polypeptide of (a), (b), (c), (d), or (e); wherein the polypeptide is of bacterial origin or a variant thereof; and wherein the polypeptide of (a), (b), (c), (d), (e), (f), (g), or (h) or the fragment of (i) has alkaline phosphatase activity.

[0258] In a preferred embodiment, the pet food comprises a polypeptide having alkaline phosphatase activity selected from the group consisting of a) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 11 , b) a variant of SEQ ID NO: 11 having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 61 , SEQ ID NO: 62, SEQ ID NO: 63 , SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81 , SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101 , SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, and SEQ ID NO: 106; c) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 21 ; and d) a variant of SEQ ID NO: 21 having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71 , SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91 , SEQ ID NO: 92, SEQ ID NO: 93, and SEQ ID NO: 94.

[0259] In a further embodiment of the invention is directed to polypeptides having alkaline phosphatase activity, selected from the group consisting of:

[0260] (a) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 11 ;

[0261] (b) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 21.

[0262] The polypeptide may have an N-terminal and / or C-terminal extension of one or more amino acids, e.g., 1-5 amino acids.

[0263] The polypeptide of the invention preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31 , SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 , SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51 , SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61 , SEQ ID NO: 62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NQ:70, SEQ ID NO:71 , SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NQ:80, SEQ ID NO:81 , SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84 and SEQ ID NO:85, preferably SEQ ID NO: 61 , SEQ ID NO: 62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NQ:70, SEQ ID NO:71 , SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NQ:80, SEQ ID NO:81 , SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, SEQ ID NO:88, SEQ ID NO:89, SEQ ID NQ:90, SEQ ID NO:91 , SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO:98, SEQ ID NO:99, SEQ ID NQ:100, SEQ ID NQ:101 , SEQ ID NQ:102, SEQ ID NQ:103, SEQ ID NQ:104, SEQ ID NQ:105, and SEQ ID NQ:106. The polypeptide may have an N-terminal and / or C-terminal extension of one or more amino acids, e.g., 1-5 amino acids.

[0264] When measuring the activity of various wild-type alkaline phosphatases, certain polypeptides, including SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56, had higher activity in the dephosphorylation of LPS than others (see Table 9). This activity is physiologically highly relevant. These polypeptides were further investigated to try to understand the rationale for their relatively high activity, as measured by LPS dephosphorylation.

[0265] First, it was surprisingly determined that there was relatively low sequence identity among these sequences and also relatively low identity to human intestinal alkaline phosphatase.

[0266] In a continued attempt to understand the rationale for this high LPS dephosphorylation activity, these polypeptides were further investigated. Variants were made of SEQ ID NO: 21 , namely SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91 , SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94. These were also found to have high LPS dephosphorylation activity. Accordingly, in one embodiment, the polypeptide has least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a polypeptide selected from the group consisting of SEQ ID NO: 21 , namely SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71 , SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94.

[0267] As investigations continued, the wild-type alkaline phosphatases with high LPS dephosphorylation activity were found to have common properties. Surprisingly, the wild-type alkaline phosphatases of SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56 were found to have common ancestry according to phylogenetic tree and to also have a common feature in their three-dimensional structures as measured on AlphaFold™. Accordingly, in one embodiment, the polypeptide has least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a polypeptide selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, or SEQ ID NO: 56.

[0268] As part of the investigations to determine the rationale behind the high activity, the alkaline phosphatases were modelled using AlphaFold™. The Template Modelling™ score was calculated for the bacterial ALPs vs the human intestinal ALP (SEQ ID NO: 108 as described in Example 15). In one embodiment, the polypeptide of the invention has a Template Modelling score, as calculated in Example 15, versus human intestinal ALP (SEQ ID NO: 108), of from 0.70 to 0.90, such as from 0.72 to 0.88, such as from 0.74 to 0.88. Furthermore, the polypeptides comprise a variable region, which have high three-dimensional similarity with human intestinal ALP. The residues of this variable region will of course depend on the polypeptide but are all in the same region, such as from 353-462 from residue 353 to 462 in SEQ ID NO:21, as shown in the table in Example 16.

[0269] In an embodiment of the invention, the variable region of the polypeptide has a Template Modelling score, as calculated in Example 15, versus the human intestinal ALP (SEQ ID NO: 108) of at least 0.80, such as at least 0.85, such as from 0.80 to 0.96.

[0270] In a continued investigation of the polypeptides of the invention, it was surprisingly found that the polypeptides of the invention are clustered together in the phylogenetic tree and equally surprisingly, are close to human intestinal alkaline phosphatase in the phylogenetic tree. Accordingly, in an embodiment of the invention, the polypeptides of the invention have a distance in the phylogenetic tree relative to human intestinal alkaline phosphatase of between 1.0 and 2.0, such as from 1.1 to 1.9. This is measured by a method as described in Example 15.

[0271] An aspect of the invention is directed to pet food comprising a polypeptide having alkaline phosphatase activity, wherein the polypeptide is characterized as having at least two, such as at least three properties selected from the group consisting of; i. the polypeptide comprises a variable region from residue 355 to 462, according to the SEQ ID NO:21 numbering, wherein said variable region has a Template Modelling score, as calculated in Example 15, versus the human intestinal ALP (SEQ ID NO: 108) of at least 0.80, such as at least 0.85, such as from 0.80 to 0.96; ii. the polypeptide has from 40% to 50% sequence identity to human intestinal ALP (SEQ ID NQ:108); and iii. the polypeptide has a Template Modelling score, as calculated in Example15, versus human intestinal ALP (SEQ ID NO: 108), of from 0.70 to 0.90, such as from 0.72 to 0.88, such as from 0.74 to 0.86: iv. the polypeptide has a distance in the phylogenetic tree to human intestinal alkaline phosphatase of between 1.0 and 2.0, such as from 1.1 to 1.9; wherein the polypeptide is of bacterial origin or a variant thereof.

[0272] In an embodiment of the invention, the pet food comprises a polypeptide having alkaline phosphatase activity, wherein the polypeptide is characterized in that; i. the polypeptide comprises a variable region from residue 355 to 462, according to the SEQ ID NO:21 numbering, wherein said variable region has a Template Modelling score, as calculated in Example 15, versus the human intestinal ALP of at least 0.80, such as at least 0.85, such as from 0.80 to 0.96; ii. the polypeptide has from 40% to 50% sequence identity to human intestinal ALP (SEQ ID NO:108); and iii. the polypeptide has a Template Modelling score, as calculated in Example 15 versus human intestinal ALP (SEQ ID NO: 108), of from 0.70 to 0.90, such as from 0.72 to 0.88, such as from 0.74 to 0.86: iv. the polypeptide has a distance in the phylogenetic tree to human intestinal alkaline phosphatase of between 1.0 and 2.0, such as from 1.1 to 1.9; and wherein the polypeptide is of bacterial origin or a variant thereof.

[0273] In a typical embodiment, the polypeptide having alkaline phosphatase activity, is characterized in that: i. the polypeptide comprises a variable region from residue 355 to 462, according to the SEQ ID NO:21 numbering, wherein said variable region has a Template Modelling score, as calculated in Example 15, versus the human intestinal ALP of at least 0.80, such as at least 0.85, such as from 0.80 to 0.96; ii. the polypeptide has from 40% to 50% sequence identity to human intestinal ALP (SEQ ID NO: 108), and iii. the polypeptide has a Template Modelling score, as calculated in Example 15, versus human intestinal ALP (SEQ ID NO: 108), of from 0.70 to 0.90, such as from 0.72 to 0.88, such as from 0.74 to 0.86; and wherein the polypeptide is of bacterial origin or a variant thereof.

[0274] In a suitable embodiment, the polypeptide furthermore has a distance in the phylogenetic tree to human intestinal alkaline phosphatase of between 1 and 1.9, such as from 1.1 to 1.8, or from 1.1 to 1.7.

[0275] In another embodiment of the invention, the polypeptide having alkaline phosphatase activity, is characterized in that: i. the polypeptide has a distance in the phylogenetic tree to human intestinal alkaline phosphatase of between 1.0 and 2.0, such as from 1.1 to 1.9;, wherein the polypeptide is of bacterial origin or a variant thereof; and ii. the polypeptide has from 40% to 50% sequence identity to human intestinal ALP (SEQ ID NO: 108), wherein the polypeptide is of bacterial origin or a variant thereof.

[0276] In another embodiment of the invention, the polypeptide having alkaline phosphatase activity, is characterized in that: i. the polypeptide has a Template Modelling score, as calculated in Example 15, versus human intestinal ALP (SEQ ID NO: 108), of from 0.70 to 0.90, such as from 0.72 to 0.88, such as from 0.74 to 0.86; ii. the polypeptide has from 40% to 50% sequence identity to human intestinal ALP (SEQ ID NO: 108), wherein the polypeptide is of bacterial origin or a variant thereof.

[0277] In another embodiment of the invention, the polypeptide having alkaline phosphatase activity, is characterized in that: i. the polypeptide comprises a variable region from residue 355 to 462, according to the SEQ ID NO:21 numbering, wherein said variable region has a Template Modelling score, as calculated in Example 15, versus the human intestinal ALP of at least 0.80, such as at least 0.85, such as from 0.80 to 0.96; ii. the polypeptide has from 40% to 50% sequence identity to human intestinal ALP (SEQ ID NO: 108), wherein the polypeptide is of bacterial origin or a variant thereof.

[0278] Furthermore, the folding temperature of the polypeptides of the invention were investigated and compared to prior art alkaline phosphatase.

[0279] In a preferred aspect of the invention, the polypeptide having alkaline phosphatase activity is thermostable. Thermostability allows for good pelleting stability. As seen in Example 12, several of the molecules having a variable region have a high thermostability (Tm) at different pHs, between 50-72 °C at pH4 between 66-80 °C at pH5 and 65- 86 °C at pH7 in the presence of ions Zn, Ca and Mg.

[0280] SEQ ID NO:21 has a Tm at pH 7 of notably higher than SEQ ID NQ:50, at different pH levels as seen in Table 11. From Table 12, it is demonstrated that SEQ ID NO: 21 has a Tm of 77 °C at pH 7, SEQ ID NO: 14 has a Tm of 80 °C at pH 7, SEQ ID NO: 34 has a Tm of 72°C at pH 8, SEQ ID NO: 35 has a Tm of 75 °C at pH 7 , SEQ ID NO: 36 has a Tm of 69 °C at pH 7, SEQ ID NO: 37 has a Tm of 79 °C at pH 7, SEQ ID NO: 38 has a Tm of 88 °C at pH 7, SEQ ID NO: 39 has a Tm of 71 °C at pH 7, SEQ ID NO: 55 has a Tm of 62 °C at pH 7, and SEQ ID NO: 56 has a Tm of 76 °C at pH 7; Accordingly, an aspect of the invention is directed to a pet food comprising a polypeptide having alkaline phosphatase activity selected from the group consisting of a. a polypeptide having at least 70% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56; b. a polypeptide having at least 70% sequence identity to a mature polypeptide of polypeptide of (a) c. a polypeptide encoded by a polynucleotide having at least 70% sequence identity to the mature polypeptide coding sequence of a polypeptide of (a) or (b); d. a polypeptide derived from a polypeptide of (a) or (c), or a mature polypeptide of (b) by substitution, deletion or addition of 1 to 120 amino acids, such as 1 to 100, 1 to 80, 1 to 60 or 1 to 40 amino acids; e. a polypeptide derived from the polypeptide of (a), (b), (c), or (d) wherein the N- and / or C-terminal end has been extended by the addition of 1 to 50 amino acids, such as 1 to 40, 1 to 30 or 1 to 20 amino acids; and f. a fragment of the polypeptide of (a), (b), (c), (d), or (e); wherein the polypeptide is of bacterial origin or a variant thereof; and wherein the polypeptide of (a), (b), (c), (d), or (e) or the fragment of (f) has alkaline phosphatase activity.

[0281] In one embodiment, the polypeptide has at least 75% sequence identity to a polypeptide which is a variant SEQ ID NO: 21, namely SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71 , SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91 , SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94.

[0282] In one embodiment the polypeptide having alkaline phosphatase activity is a polypeptide having at least 80% sequence identity to a polypeptide selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56. In one embodiment, the polypeptide having alkaline phosphatase activity selected from the group consisting of a polypeptide having at least 70% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56.

[0283] In one embodiment, the polypeptide having alkaline phosphatase activity selected from the group consisting of a polypeptide having at least 75% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56.

[0284] In one embodiment, the polypeptide having alkaline phosphatase activity selected from the group consisting of a polypeptide having at least 80% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56.

[0285] In one embodiment, the polypeptide having alkaline phosphatase activity selected from the group consisting of a polypeptide having at least 85% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56.

[0286] In one embodiment, the polypeptide having alkaline phosphatase activity selected from the group consisting of a polypeptide having at least 90% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56.

[0287] In one embodiment, the polypeptide having alkaline phosphatase activity selected from the group consisting of a polypeptide having at least 95% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56, such as at least 96%, at least 97%, at least 98%, such as at least 99% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56. In one embodiment, the polypeptide having alkaline phosphatase activity is selected from the group consisting of a polypeptide having at least 90% sequence identity SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56, such as at least 95%, at least 96%, at least 97%, at least 98%, such as at least 99% sequence identity to SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56.

[0288] In one embodiment, the polypeptide having alkaline phosphatase activity is selected from the group consisting of a polypeptide having at least 80% sequence identity, such as at least 90%, such as at least 95%, at least 96%, at least 97%, at least 98%, such as at least 99% sequence identity to SEQ ID NO: 21 , SEQ ID NO: 37, and SEQ ID NO: 104.

[0289] As stated, an aspect of the invention is directed to polypeptides having alkaline phosphatase activity. In an aspect of the invention, the polypeptides have alkaline phosphatase activity and are gastric stable, that is to say are either stable at low pH or stable at low pH in the presence of pepsin (henceforth referred to as pepsin stable). In a preferred embodiment, the polypeptides having alkaline phosphatase activity are both stable at pH below 5 and are pepsin stable.

[0290] As can be seen from Table 8, neither CIAP nor SEQ ID NO: 50 are pepsin stable.

[0291] Pepsin stable is intended to mean that the polypeptide retains at least 1% of its activity after treatment to gastric conditions, such as at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, or at least 35% of its activity after a gastric challenge, either at alkaline or acid pH.

[0292] According, in an aspect of the invention, the polypeptide has alkaline phosphatase activity, is of bacterial or fungal origin or a variant of a polypeptide of bacterial or fungal origin, wherein the activity is greater than the activity of SEQ ID NQ:50, and wherein the polypeptide is gastric stable or pepsin stable.

[0293] The activity assay to determine the residual activity of alkaline phosphatase after a gastric challenge involved incubation of a polypeptide of the invention in artificial gastric juice (AGJ) for 15 min at 38 °C to simulate the gastric challenge and is described in detail in Example 8. The residual activity (%) of an ALP after a gastric challenge was determined using Equation 4 AG J whereMis the EC50 of an ALP obtained after the 15-minute incubation in AGJ and

[0294] „ ALP AS is the EC50 of an alkaline phosphatase obtained after a 15-minute incubation in assay solution.

[0295] Table 2 In a preferred embodiment, the polypeptide has alkaline phosphatase activity, is of bacterial or fungal origin or a variant of a polypeptide of bacterial or fungal origin, and wherein the polypeptide is pepsin stable such as at least at least 20% of its alkaline phosphatase activity remains after a gastric challenge, more preferably at least 25% activity, such as at least 30% activity, such as at least 40% activity, such as at least 50% activity. In a preferred embodiment, the polypeptide has alkaline phosphatase activity, is of bacterial or fungal origin or a variant of a polypeptide of bacterial or fungal origin, wherein the polypeptide has at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to a polypeptide selected from the group consisting of SEQ ID NO:18, SEQ ID NO:30, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:80, SEQ ID NO:84, SEQ ID NO:86, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO:98, SEQ ID NO:99, SEQ ID NQ:100, SEQ ID NQ:101 , SEQ ID NQ:102, SEQ ID NQ:103, SEQ ID NQ:104, SEQ ID NQ:105 and SEQ ID NQ:106. In a more preferred embodiment, the polypeptide has alkaline phosphatase activity, is of bacterial or fungal origin or a variant of a polypeptide of bacterial or fungal origin, wherein the polypeptide has at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to a polypeptide selected from the group consisting of SEQ ID NO: 18, SEQ ID NQ:30, SEQ ID NQ:40, SEQ ID NO:44, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO:98, SEQ ID NO:99, SEQ ID NQ:100, SEQ ID NQ:101 , SEQ ID NQ:102, SEQ ID NQ:103, SEQ ID NQ:104, SEQ ID NQ:105 and SEQ ID NQ:106.

[0296] As can be seen from Table 8, variants of SEQ ID NO:11 have high pepsin or gastric stability. That is to say that variants of SEQ ID NO:11 are stable a low pH and stable at low pH in the presence of pepsin. Accordingly, in an embodiment of the invention, the polypeptide having alkaline phosphatase activity is a variant of SEQ ID NO: 11, having at least 70% sequence identity but less than 100% sequence identity to SEQ ID NO:11. In an embodiment of the invention, the polypeptide has alkaline phosphatase activity and gastric stability and is selected from the group consisting of a) a polypeptide having at least 70% sequence identity but less than 100% sequence identity to SEQ ID NO:11; b) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:61 ; c) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:62; d) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:63; e) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:64; f) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:65; g) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:79; h) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NQ:80; i) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:81 ; j) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:82; k) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:83; l) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:84; m) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:85; n) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:86; o) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:95; p) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:96; q) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:97; r) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:98; s) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:99; t) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NQ:100; u) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NQ:101 ; v) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NQ:102; x) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NQ:103; y) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 104; z) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NQ:105; and aa) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 106.

[0297] In connection to its use in an animal host or body, gastric stability is important and alkaline phosphatase activity at physiological pH is most relevant for enzymes in pet food. Accordingly, it is important for the use in pet food for the polypeptides having alkaline phosphatase activity demonstrate activity at physiological pH, that is to say around pH 7 or 8. In applications other than in pet food, an activity at pH 7 to 11 is relevant such as in relation to compositions with alkaline ingredients. In one embodiment of the invention, the polypeptides having alkaline phosphatase activity demonstrate an activity at least equal to the activity of CIAP at a pH of 7, 8, 9, 10 or 11 , preferably at a pH of 7, 8 or 9, according to the method described in Example 9. The values given for each pH in the range of 7.0 - 11.0 is the absorbance at 405 nm (A405) divided by the phosphatase concentration in ppm (determined by A280 of a purified sample and the calculated Extinction Coefficients of the phosphatase). Table 3- Absorbance at 405 nm (A405) divided by the phosphatase concentration in ppm (determined by A280 of a purified sample and the calculated Extinction Coefficients of the phosphatase).

[0298] As can be seen from Table 3, the polypeptides of the invention have significant alkaline phosphatase activity at physiological pH.

[0299] As can be seen from Example 9, Table 10, Wildtypes SEQ ID NO:50 and SEQ ID NO:11 show no activity after the high gastric stress treatment. However, the prior art variant SEQ ID NO: 107, with a C-terminal histidine or when up-concentrated and SEQ ID NO: 104) retains part of its activity after gastric stress treatment. SEQ ID NO: 103 shows comparable activity after gastric stress treatment but SEQ ID NO: 104 shows both higher activity (73 OD / min / ppm) and higher percent residual activity (12%) compared to SEQ IDNQ:107 (21 OD / min / ppm and 6% respectively). As can be seen from Table 10, SEQ ID NO: 11 and the variants of SEQ ID NO: 11 have a high activity compared to SEQ ID NO: 50 and SEQ ID NO: 107. Furthermore, the residual activity of this high activity, in percentage, is higher than SEQ ID NO: 50 and SEQ ID NO: 10. This translates that even at comparable residual activity levels, the activity of SEQ ID NO: 11 and the variants of SEQ ID NO:11 after gastric challenge is notably higher. In an embodiment of the invention, the polypeptide has both an activity of at least 250 OD / min / ppm and a percent residual activity of at least 5%, such as at least 7%, such as at least 10% after gastric stress treatment.

[0300] 40 In a preferred aspect of the invention, the polypeptide having alkaline phosphatase activity is thermostable.

[0301] SEQ ID NO:50 has a Tm at pH 7 of approximately 48°C, as determined by the method according to Example 10. Preferably, the polypeptide having alkaline phosphatase activity has a Tm of at least 50°C at pH of 7, or at a pH of less than 7. More preferably, the polypeptide having alkaline phosphatase activity has a Tm of at least 50°C at pH of 7 and furthermore has a Tm of at least 50°C at pH of 4. In a most preferred embodiment, the polypeptide having alkaline phosphatase activity has a Tm of at least 60°C at pH of 7 and furthermore has a Tm of at least 60°C at pH of 4. In a further embodiment, the polypeptide having alkaline phosphatase activity has a Tm of at least 70°C at pH of 7. The tables below demonstrates that the polypeptides of the invention have a Tm of at least 70°C at pH of 7, using the nDSF method of Example 10.

[0302] Table 4 Table 5

[0303] As can be seen from Example 12, the polypeptides of the invention have similar or superior thermal stability as the reportedly thermal stability alkaline phosphatase of SEQ ID NO:1 from WO 2023 / 102002, as measured by the thermal shift assay method.

[0304] Methods and Pets Foods In some embodiments of the invention, the pet is generally healthy, and the pet food is administered to the companion animal for the maintenance of the general good health, healthy intestinal microflora or intestinal health. In some embodiments of the invention, the pet is generally healthy but may have age-related symptoms or is nearing an age where the onset of age-related conditions or symptoms. Age-related conditions or symptoms include incipient metabolic syndrome, being overweight, obesity, gut inflammation, dysbiosis, depression, neurodegenerative diseases and type II diabetes. Accordingly, some embodiments are related to the prevention, reducing or slowing the progression or delaying the onset of age-related conditions, such as those selected from the group consisting of incipient metabolic syndrome, being overweight, obesity, gut inflammation, dysbiosis, depression, neurodegenerative diseases and type II diabetes. The methods and uses of the invention are generally non-therapeutic and are directed to maintenance of good health, delaying onst

[0305] Targets for improving health: Lipopolysaccharide (LPS), Adenosine triphosphate (ATP) and Cellular Activity

[0306] The intestinal activity of alkaline phosphatase is related to intestinal inflammation. ALPs play a in limiting intestinal inflammation by detoxification of MAMPs (Lipopolysaccharide (LPS) and flagellin. ALP exerts its effects through dephosphorylation of proinflam matory molecules including lipopolysaccharide (LPS), flagellin, and adenosine triphosphate (ATP) released from cells during stressful events. ALP dephosphorylates bacterial LPS which leads to LPS detoxification preventing downstream activation of immune cells and subsequent inflammatory responses.

[0307] Intestinal alkaline phosphatase (IAP) is one of the most abundant animal proteins in stools and its activity has been speculated to correlate negatively with type 2 diabetes and intestinal inflammation. ALP has been shown to possess many roles in limiting intestinal inflammation: 1) Detoxification of MAMPs (LPS, flagellin), 2) De-phosphorylation of extracellular ATP, 3) Induction of autophagy 4) bacterial growth inhibition.

[0308] Without being bound to a particular theory, gut health relies on the microbiome and its coexistence with the host. Introduction of pathogenic bacteria to the microbiome creates a dysbiosis potentially leading to leaking barrier and immune cell activation. Free LPS from the gut bacteria may impose a health risk on the host by activation of immune cells. Especially under already compromised health conditions LPS may more freely enter the tissue and do damage. An aspect of the invention is directed to a method of maintaining or improving levels of commensal microbes in the intestines of companion animals and / or maintaining or improving intestinal health in a companion animal comprising feeding a companion animal a pet food comprising the polypeptide having alkaline phosphatase activity. A related aspect of the invention is directed to the use of a pet food comprising a polypeptide having alkaline phosphatase activity for the maintenance or for improving levels of commensal microbes in the intestines of companion animals and / or maintaining or improving intestinal health in a companion animal. Similarly, the invention is directed to a pet food comprising a polypeptide having alkaline phosphatase activity for use in the maintenance or for improving levels of commensal microbes in the intestines of companion animals and / or maintaining or improving intestinal health in a companion animal.

[0309] ATP is produced by some bacteria and has growth inhibitory action on certain other bacteria. Literature indicates that ATP secretion may be more typical for Gram-negative species, whereas growth inhibition is characteristic for Gram-positive bacteria. ATP is produced by immune cells during their activation and by dying cells and functions as an alarm molecule to warn their surroundings to prepare for e.g. infection. This results in the activation of other immune cells adding to the ongoing inflammation. Specifically, ATP activates the inflammasome, which causes release of the pro-inflammatory cytokine IL-1 p. During a chronic state of mild intestinal inflammation (which may be the situation in livestock) increased levels of both free LPS and intestinal ATP would add on the inflammatory process and increase risk of disease.

[0310] An aspect of the invention is directed to detoxification of LPS and / or ATP by ALP mediated dephosphorylation. This leads to a to decrease in ongoing intestinal inflammation by limiting health risk factors. Potential health benefits include decreased infectious disease, leading to higher survival rates. A further aspect is directed to a method of maintaining general health in a companion animal by preventing or reducing inflammation of intestinal tissue in a companion animal, comprising feeding the animal a polypeptide of the invention. A related aspect is directed to the use of the pet food of the invention for maintaining the general health in a companion animal by preventing or reducing inflammation of intestinal tissue in a companion animal. A further related aspect is directed to a pet food of the invention for use in maintaining the general health in a companion animal by preventing or reducing inflammation of intestinal tissue in a companion animal. Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of the detoxification of lipopolysaccharide in an animal comprising feeding said animal the polypeptide, the composition or pet food of the invention.

[0311] Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of reducing the immune response in an animal, said method comprising feeding said animal the polypeptide, the composition or pet food of the invention.

[0312] Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of reducing inflammation in an animal, said method comprising feeding said animal the polypeptide, the composition or pet food of the invention.

[0313] Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of reducing IL or TNF response in an animal, said method comprising feeding said animal the polypeptide, the composition or pet food of the invention.

[0314] Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of maintaining or supporting intestinal health, or improving intestinal health promoting growth of commensal bacteria, in an animal, said method comprising feeding said animal the polypeptide, the composition or pet food of the invention.

[0315] Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method for the maintenance of an effective gut barrier comprising feeding said animal the polypeptide, the composition or pet food of the invention.

[0316] Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of preventing colitis or the inflammation of the lining of the colon in an animal, said method comprising feeding said animal the polypeptide or a pet food of the invention. Similarly, an aspect of the invention is directed to the alkaline phosphatases of the invention for use, typically by ATP de-phosphorylation, to maintain gut health including but not limited to maintaining gut barrier function, reducing leaky gut and reducing or preventing intestinal inflammation.

[0317] Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of preventing or reducing intestinal colonization or systemic translocation of unwanted bacteria, or for “dysbiosis”, namely for changing of the bacterial and / or archaeal balance of the intestinal microbiota, said method comprising feeding said animal the polypeptide, the composition or pet food of the invention. An aspect of the invention is directed to a a pet food comprising a polypeptide having alkaline phosphatase activity, as described herein, for use in the maintenance or improvement of levels of commensal microbes in the intestines of companion animals and / or maintenance or improvement of intestinal health in a companion animal.

[0318] Lipopolysaccharides as a target for Alkaline Phosphatase of the invention

[0319] The intestinal activity of alkaline phosphatase is related to intestinal inflammation. ALPs play a in limiting intestinal inflammation by detoxification of MAMPs (Lipopolysaccharide (LPS), flagellin. ALP exerts its effects through dephosphorylation of proinflam matory molecules including lipopolysaccharide (LPS), flagellin, and adenosine triphosphate (ATP) released from cells during stressful events.

[0320] Increased LPS stimulation of the intestinal tissue increases inflammation and compromises general health. Lipopolysaccharide (LPS) contains a Lipid A structure, which has two PO4 groups attached. These are essential for binding to TLR4 and MD2 during cell stimulation. In the present invention, LPS de-phosphorylation was measured with the Malachite Green Phosphate Detection kit, which detects free PO4. E. coli LPS was treated with titration of ALP followed by detection of released PO4. Results showed LPS-dephosphorylation by polypeptides having alkaline phosphatase of the invention.

[0321] One aspect of the invention is directed to an ALP of the invention dephosphorylates bacterial LPS which leads to LPS detoxification thereby preventing downstream activation of immune cells and subsequent inflammatory responses in a companion animal. According, the invention is directed to a method of dephosphorylating bacterial LPS in the intestine of a companion animal using an ALP of the invention. The invention is also directed to a method of detoxifi eating LPS in the intestine of a companion animal by dephosphorylation using an ALP of the invention. A further aspect of the invention is directed to reducing the activation of immune cells in a companion animal comprising the ingestion by said companion animal of an ALP of the invention. A further aspect of the invention is directed to reducing or preventing an inflammatory response or reducing or preventing an inflammation in a companion animal comprising the ingestion of an ALP of the invention.

[0322] An aspect of the invention is directed to a method of improving post antibiotic recovery in a companion animal or reducing the likelihood or preventing post antibiotic Clostridium difficile infection, said method comprising feeding the animal a pet food comprising a polypeptide of the invention

[0323] An aspect of the invention is directed to detoxification of LPS through ALP mediated dephosphorylation in a companion animal. This leads to a to decrease in ongoing intestinal inflammation in a companion animal by limiting health risk factors. Potential health benefits include decreased infectious disease, leading to increased overall health. Accordingly, an embodiment of the invention is directed to a method of maintaining overall health in a companion animal comprising feeding the animal a polypeptide of the invention having alkaline phosphatase activity.

[0324] Adenosine triphosphate (ATP) and cellular activity as a target

[0325] ATP can suppress Gram-positive bacteria growth. Suppression of intestinal Gram-positive bacteria favours growth of pathogenic Gram-negatives. The polypeptides of the invention eliminate or reduce this effect since ALP dephosphorylates ATP, thereby promoting commensal bacterial growth. Accordingly, ALPs of the invention reduce or eliminate the suppressive role of ATP on Gram-positive bacteria.

[0326] A further aspect of the invention is therefore directed to the use of the ALPs of the invention to promote the growth of Gram positive bacteria and / or suppress the growth of pathogenic Gramnegative bacteria. Accordingly, an aspect of the invention is directed a method of maintaining or improving levels of commensal microbes in the intestines of companion animals and / or maintaining or improving intestinal health in a companion animal.

[0327] Example 12 shows the growth Gram-negative and Gram-positive bacteria were in the presence of ATP, ADP, AMP or adenosine.

[0328] ALP suppresses ATP-induced LPS activity on IL-1 / 3 secretion

[0329] ATP also plays a role in the activity of LPS in the formation of Pro-IL- ip. Increased LPS stimulation of the intestinal tissue increases inflammation and compromises general health. In an aspect of the invention, an ALP of the invention reduces ATP-induced LPS activity on I L-1 p secretion.

[0330] Accordingly, an aspect of the invention is directed to a method of maintaining general health in a companion animal by preventing or reducing inflammation of intestinal tissue in a companion animal. An embodiment of the invention relates to a method of preventing or reducing inflammation of intestinal tissue in a companion animal comprising feeding the animal a polypeptide of the invention having alkaline phosphatase activity.

[0331] ALP suppresses ATP induced IL-1 / 3 secretion; ALP to suppress inflammation

[0332] ATP is also involved in activation of the inflammasome, leading to secretion of I L-1 p. This is a rapid danger signal that increases inflammation, which is useful during infection but may be harmful under chronic conditions. In the Examples , it is demonstrated that treatment with the ALPs of invention suppresses the ATP induced inflammasome activation. ALP dephosphorylates ATP promoting commensal bacterial growth. Accordingly, an aspect of the invention is directed to supporting or promoting commensal bacterial growth in companion animals, such as a dog or cat, comprising feeding the animal a polypeptide of the invention.

[0333] Similarly, a further aspect of the invention is directed a method of suppressing, reducing or preventing inflammation in an animal comprising administering an ALP as defined herein. Accordingly, an aspect of the invention is directed to a method of suppressing, reducing or preventing inflammation by lowering the levels of I L-1 p in an animal comprising administering an ALP as defined herein. A further aspect of the invention is directed to an ALP as defined herein for use in the suppression, reduction or prevention of inflammation in an animal. A further aspect of the invention is directed to the use of an ALP of the invention for the suppression, prevention or reduction of ALP in an animal. Preferably, the inflammation is chronic or associated with a chronic condition.

[0334] A further aspect of the invention is directed to a method of maintaining intestinal integrity or reducing gut leakage in a companion animal comprising feeding the animal a food comprising a polypeptide of the invention.

[0335] ALP suppresses TNF-a; ALP to suppress inflammation

[0336] The inflammasome activating effect of ATP is not a capability held by its de-phosphorylation products ADP, AMP or adenosine. In fact, the inventors have found adenosine possess immunosuppressive potential. The inventors have found that by converting ATP to ADP, AMP or adenosine, ALP suppresses, reduces or prevents inflammation. The inventors have found that the ALPs of the invention suppresses the secretion of IL-8 by means of adenosine suppression of the secretion of IL-8.

[0337] An increase in the levels of adenosine, the de-phosphorylated product of ATP, led to decreased levels of TNF-a. Accordingly, an aspect of the invention is directed to a method of suppressing, reducing or preventing inflammation by lowering the levels of TNF-a in an animal comprising administering an ALP as defined herein. Accordingly, an aspect of the invention is directed to a method of suppressing, reducing or preventing inflammation in an animal comprising administering an ALP as defined herein. A further aspect of the invention is directed to an ALP as defined herein for use in the suppression, reduction or prevention of inflammation in an animal. A further aspect of the invention is directed to their use of an ALP of the invention for the suppression, prevention or reduction of TNF-a in a companion animal, such as a dog or cat, particularly an aging dog or cat. A further aspect of the invention is directed to a method of preventing Irritable Bowel Syndrome (IBS), or reducing the frequency or severity of diarrhea in a companion animal comprising feeding the animal a pet food comprising a polypeptide of the invention.

[0338] The polypeptides of the invention have activity against key targets for the prevention of Type 2 Diabetes Mellitus (T2DM). Diabetes patients have very low levels of alkaline phosphatase (BMJ Open Diab Res Care 2022;10). High level of alkaline phosphatase plays protective role against Type 2 Diabetes Mellitus (T2DM), particularly in the case of obesity. Accordingly, an aspect of the invention is directed a method of preventing diabetes in pet or companion animal, or delaying the onset of diabetes in an animal, comprising feeding the animal a food comprising a polypeptide of the invention having alkaline phosphatase activity, more typically to a method of preventing diabetes in an obese animal or near-obese animal, or delaying the onset of diabetes in an animal, comprising feeding the animal a food comprising a polypeptide of the invention having alkaline phosphatase activity. A method of preventing diabetes in pet or companion animal, or delaying the onset of diabetes in said animal, comprising feeding the animal a food comprising a polypeptide of the invention.

[0339] Similarly, a low level of ALP in healthy animals is indicative of having the incipient (latent) metabolic syndrome, including diabetes. It has been speculated that temporal IAP profiling could diagnose incipient metabolic syndrome. Incipient metabolic syndrome is age related. Accordingly, a method of the invention is directed to a method reducing symptoms associated with aging in a companion animal comprising feeding the animal a food comprising a polypeptide of the invention. An embodiment of the invention is directed to a pet food for use in senior pets to prevent or delay the onset of aging complications or symptoms thereof including obesity, gut inflammation, and type II diabetes.

[0340] The pet food may be a conventional pet food wherein the polypeptide of the invention is added as an additional ingredient. The pet food typically comprises ingredients selected from the group consisting of meat meals, animal fats, animal digests, animal palatinates, fish oils, vitamin premixes, and combinations thereof. For example, the pet food composition may comprise meat, such as emulsified meat. Examples of suitable meat include poultry, beef, pork, lamb and fish, especially those types of meats suitable for pets. The meat can include any additional parts of an animal including offal. Additionally or alternatively, vegetable protein can be used, such as pea protein, corn protein (e.g., ground corn or corn gluten), wheat protein (e.g., ground wheat or wheat gluten), soy protein (e.g., soybean meal, soy concentrate, or soy isolate), rice protein (e.g., ground rice or rice gluten) and the like. The pet food composition may comprise vegetable oil, a flavorant, a colorant and water. Suitable vegetable oils include soybean oil, corn oil, cottonseed oil, sunflower oil, canola oil, peanut oil, safflower oil, and the like. Examples of suitable flavorants include yeast, tallow, rendered animal meals (e.g., poultry, beef, lamb, pork), flavor extracts or blends (e.g., grilled beef), and the like. Suitable colorants include FD&C colors, such as blue no. 1 , blue no. 2, green no. 3, red no. 3, red no. 40, yellow no. 5, yellow no. 6, and the like; natural colors, such as caramel coloring, annatto, chlorophyllin, cochineal, betanin, turmeric, saffron, paprika, lycopene, elderberry juice, pandan, butterfly pea and the like; titanium dioxide; and any suitable food colorant known to the skilled artisan.

[0341] The pet food composition can optionally include additional ingredients, such as other grains and / or other starches additionally or alternatively to flour, amino acids, fibers, sugars, animal oils, aromas, other oils additionally or alternatively to vegetable oil, humectants, preservatives, polyols, salts, oral care ingredients, antioxidants, vitamins, minerals, probiotic microorganisms, bioactive molecules or combinations thereof.

[0342] Suitable starches include a grain such as corn, rice, wheat, barley, oats, soy and the like, and mixtures of these grains, and can be included at least partially in any flour. Suitable humectants include salt, sugars, propylene glycol and polyhydric glycols such as glycerin and sorbitol, and the like. Examples of preservatives that can be used include potassium sorbate, sorbic acid, methyl para-hydroxybenzoate, calcium propionate and propionic acid. Suitable oral care ingredients include alfalfa nutrient concentrate containing chlorophyll, sodium bicarbonate, phosphates (e.g., tricalcium phosphate, acid pyrophosphates, alkaline pyrophosphates, tetrasodium pyrophosphate, metaphosphates, and orthophosphates), peppermint, cloves, parsley, ginger and the like. Examples of suitable antioxidants include butylated hydroxyanisole ("BHA") and butylated hydroxytoluene ("BHT"), vitamin E (tocopherols), and the like. Examples of vitamins that can be used include Vitamins A, B-complex (such as B-1 , B-2, B-6 and B-12), C, D, E and K, niacin and acid vitamins such as pantothenic acid and folic acid and biotin. Suitable minerals include calcium, iron, zinc, magnesium, iodine, copper, phosphorus, manganese, potassium, chromium, molybdenum, selenium, nickel, tin, silicon, vanadium, boron and the like.

[0343] Specific amounts for each additional ingredient in the pet food composition will vary, as known to the person skilled in the art, depending on a variety of factors such as the species of animal; the animal's age, body weight, general health, sex, and diet; the animal's consumption rate; the purpose for which the food product is administered to the animal. Therefore, the components and their amounts may vary widely.

[0344] The concentration of polypeptide having alkaline phosphatase activity in the pet food will vary also depending on the type of pet food, such as whether it is wet or dry pet food, a kibble, treat or otherwise). It will also vary species of animal and the animal s age and body weight. It may also vary with the animal’s general health, sex, and diet; the animal's consumption rate. The concentration of polypeptide having alkaline phosphatase activity in the pet food will be sufficient for the purpose for which the pet food product is administered.

[0345] EXAMPLES

[0346] Example 1 : Cloning, expression and fermentation of fungal ALP

[0347] Materials and Methods

[0348] Strains

[0349] Escherichia coli Top-10 strain purchased from TIANGEN (TIANGEN Biotech Co. Ltd., Beijing, China) was used to propagate our expression vector.

[0350] Aspergillus oryzae strain MT3568 (described in WO2015040159) was used for heterologous expression of the genes described in Table 6.

[0351] Aspergillus oryzae strain DAU785 (described in WO2018 / 113745) was used for heterologous expression of the genes described in the Table 7.

[0352] Media

[0353] Dap4C medium was composed of 11 g MgSO^FW, 1 g KH2 O4, 2.2 g Citric acidTW, 20 g glucose, 10 g maltose, 5.2 g K3PO4 H2O, 0.5 g yeast extract, 1.25 g CaCOs, 0.5 ml AMG Trace element solution and deionized water to 1 liter. After autoclave, 3.3 ml of 20% Lactic Acid (autoclaved) and 9.3 ml of 50% (NH4)2HPO4 (sterile filtered) were added to every 400 ml above medium. AMG Trace element solution was composed of 6.8 g ZnCh, 2.5 g CUSO4.5H2O, 0.24 g NiCl2'5H2O, 13.9 g FeSO4.7H2O, 13.6 g MnSO4.5H2O, 3 g Citric acidTW, and deionised water to 1000 ml.

[0354] LB plates were composed of 10 g of Bacto-tryptone, 5 g of yeast extract, 5 g of sodium chloride, 15g of Bacto-agar, and deionised water to 1000 ml. LB medium was composed of 10g of Bacto- tryptone, 5 g of yeast extract, and 5 g of sodium chloride, and deionised water to 1000 ml. COVE sucrose plates were composed of 342 g of sucrose, 20 g of agar powder, 20 ml of COVE salt solution, and deionized water to 1 liter. The medium was sterilized by autoclaving at 15 psi for 15 minutes. For the transformation of MT3568, 10 mM acetamide was added, when the medium was cooled to 60°C. For the transformation of Dau785, simply add 10ml of 1 M NaNOs instead of acetamide. TOP agar was composed of 6g SeaKem GTG agarose, 20ml of COVE salt solution, 342g sucrose in a final volume of 1 L with ddH2O. After autoclaving, add 10ml of 1M Acetamide for the transformation selection of MT3568 or add 10ml of 1 M NaNCh for the transformation selection of Dau785.

[0355] COVE-2 plate / tube for isolation: 30 g / L sucrose, 20 ml / L COVE salt solution, 10 mM acetamide (for transformation of MT3568) or 10mM NaNO3 (for transformation of Dau785), 30 g / L noble agar (Difco, Cat#214220). COVE salt solution was composed of 26 g of MgSO^FW, 26g of KCL, 76g of KH2PO4, 50 ml of COVE trace metal solution, and deionised water to 1000 ml. COVE trace metal solution was composed of 0.04g of Na2B40y 10H20, 0.4g of CUSO4 5H2O, 0.8g of FeSO4'7H2O, 0.8g of MnSO4'H2O, 0.8g of Na2MoO4'2H2O, 8g of ZnSO4'7H2O, and deionised water to 1000 ml.

[0356] The alkaline phosphatase (ALP) genes derived from fungal strains isolated from environmental samples by standard microbiological isolation techniques. Strains were identified, and taxonomy was assigned based on DNA sequencing of the ITS (Table 6 and Table 7).

[0357] Table 6:

[0358] Table 7:

[0359] Chromosomal DNA from individual strains (Table 6 and Table 7) was isolated by DNeasy® Plant Maxi Kit (Qiagen, Hilden, Germany). 5 pg of chromosomal DNA were sent for full genome sequencing using Illumina technology. Genome sequencing, the subsequent assembly of reads and the gene discovery (i.e. annotation of gene functions) is known to the person skilled in the art and the service can be purchased commercially. The genome sequences were analyzed for putative ALP from the PFAM database families PF00245. This analysis identified genes encoding putative ALP, which were subsequently cloned and recombinantly expressed in Aspergillus oryzae.

[0360] The ALP genes were amplified by PCR respectively from above isolated genomic DNA. The purified PCR product was cloned into the previously digested pCaHj505 (for the genes listed in Table 6) or pDAU724 (for the genes listed in Table 7) by ligation with an IN-FUSION™ CF Drydown Cloning Kit (Clontech Laboratories, Inc., Mountain View, CA, USA) according to the manufacturer's instructions. The ligation mixture was used to transform E. coli TOP10 chemically competent cells (described in Strains). Colonies containing the corresponding ALP genes were selected and verified by DNA sequencing (by SinoGenoMax Company Limited, Beijing, China). The correct ALP containing colony was cultivated overnight in 3 ml of LB medium supplemented with 100 pg of ampicillin per ml. Plasmid DNA was purified using a Qiagen Spin Miniprep kit (Cat. 27106) (QIAGEN GmbH, Hilden, Germany) according to the manufacturer’s instructions.

[0361] Protoplasts of Aspergillus oryzae MT3568 were prepared according to WQ95 / 002043. Protoplasts of Aspergillus oryzae DAU785 were prepared according to WQ2018 / 113745. 100 pl of protoplasts were mixed with 2.5-10 pg of the Aspergillus expression vector (above extracted plasmid) comprising the ALP gene and 250 pl of 60% PEG 4000, 10mM CaCh, and 10mM Tris- HCI pH7.5 and gently mixed. The mixture was incubated at 37°C for 30 minutes and the protoplasts were spread onto COVE sucrose plates for selection. After incubation for 4-7 days at 37°C spores of 4 transformants were inoculated into 3 ml of Dap4C medium.

[0362] After 3 days cultivation at 30°C, the culture broths were analyzed by SDS-PAGE using Novex® 4-20% Tris-Glycine Gel (Invitrogen Corporation, Carlsbad, CA, USA) to identify the transformants producing the largest amount of recombinant ALP with respective estimated mature peptide size. Spores of the best expressed transformant were spread on COVE-2 plates for re-isolation in order to isolate single colonies. Then a single colony was spread on a COVE-2 tube until sporulation. Spores from the best expressed transformant were cultivated in 1600-2400 ml of Dap4C medium in shake flasks during 3 days at a temperature of 30°C under 80 rpm agitation. Culture broth was harvested by filtration using a 0.22 pm filter device. The filtered fermentation broth was used for enzyme characterization.

[0363] Example 2: Cloning and expression of bacterial alkaline phosphatase polypeptides

[0364] Examples of the polypeptide having alkaline phosphatases of bacterial, annotated with the IPR001952 domain as defined in the InterPro database (Blum et al., 2021 ; Nucleic Acids Research, D344-D354) were identified from either isolated bacterial strains or metagenomes subjected to full genome Next Generation Sequencing or from public databases (Table 8). Table 8:

[0365] The DNA encoding sequences of the alkaline phosphatase mature peptides were ordered as synthetic genes at Twist Bioscience. The synthetic DNA fragments were directionally assembled to a Bacillus expression vector described in WO12 / 025577 by the standard Golden Gate cloning method using Bsal and T4 DNA ligase enzymes. Briefly, the DNA encoding the mature peptide of the gene was cloned in frame to a Bacillus clausii secretion signal (BcSP; with the following amino acid sequence: MKKPLGKIVASTALLISVAFSSSIASA (SEQ ID NO: E, SEQ ID NO: 27). BcSP replaced the native secretion signal in the gene. Downstream of the BcSP sequence, an affinity tag sequence was introduced to ease the purification process (His-tag; with the following amino acid sequence: HHHHHHPR (SEQ ID NO: F, SEQ ID NO: 28). The gene that was expressed therefore comprised the BcSP sequence followed by the His-tag sequence followed by the mature wild type alkaline phosphatase gene sequence. The final expression plasmid (BcSP-His-tag-alkaline phosphatase) was transformed into a Bacillus subtilis expression host. The alkaline phosphatase BcSP-fusion gene was integrated by homologous recombination into the Bacillus subtilis host cell genome upon transformation. The gene construct was expressed under the control of a triple promoter system (as described in WO 99 / 43835). The gene coding for chloramphenicol acetyltransferase was used as marker (as described in Diderichsen et al., 1993, Plasmid 30: 312-315)). Transformants were selected on LB media agar supplemented with 6 microgram of chloramphenicol per ml. One recombinant Bacillus subtilis clone containing the alkaline phosphatase expression construct was selected and was cultivated on a rotary shaking table in 500 ml baffled Erlenmeyer flasks each containing 100 ml yeast extract-based media. After 3 days cultivation time at 30 °C, the enzyme containing supernatant was harvested by centrifugation and the enzyme was purified by His-tag purification.

[0366] Example 3: Cloning and expression of fungal ALPs Sequences

[0367] SEQ ID NO: 17 from Trichoderma citrinoviride

[0368] SEQ ID NO: 18 from Truncatella angustata

[0369] SEQ ID NO: 19 Morchella semilibera

[0370] Cloning and expression of SEQ ID NO: 17 from Trichoderma citrinoviride

[0371] Strains

[0372] Escherichia coli Top-10 strain purchased from Invitrogen (Life Technologies, Carlsbad, CA, USA) was used to propagate our expression vectors encoding for alkaline phosphatase polypeptides. Aspergillus oryzae strain MT3568 was used for heterologous expression of the alkaline phosphatase polypeptide encoding sequences. A. oryzae MT3568 is an amdS (acetamidase) disrupted gene derivative of Aspergillus oryzae JaL355 (WO 2002 / 40694) in which pyrG auxotrophy was restored by disrupting the A. oryzae acetamidase (amdS) gene with the pyrG gene.

[0373] Media

[0374] DAP4C-1 medium was composed of 0.5g yeast extract, 15g Maltodextrin, 15g Glucose, 11g magnesium sulphate heptahydrate, 1g dipotassium phosphate, 2g citric acid monohydrate, 5.2g potassium phosphate tribasic monohydrate, 1mL Dowfax 63N10 (antifoaming agent), 2.5g calcium carbonate, supplemented with 1mL KU6 metal solution, and deionised water to 1000mL.

[0375] KU6 metal solution was composed of 6.8g ZnCh, 2.5g CUSO4.5H2O, 0.13 g NiCh, 13.9g FeSO4.7H2O, 8.45g MnSO4.H2O, 3g CeHsOy.FLO, and deionised water to 1000mL.

[0376] YP 2% glucose medium was composed of 10g yeast extract, 20g Bacto-peptone, 20g glucose, and deionised water to 1000mL.

[0377] LB plates were composed of 10g of Bacto-tryptone, 5g of yeast extract, 10g of sodium chloride, 15g of Bacto-agar, and deionised water to 1000 mL. LB medium was composed of 10g of Bacto-tryptone, 5g of yeast extract, and 10g of sodium chloride, and deionised water to lOOOmL. COVE-Sucrose-T plates were composed of 342g of sucrose, 20g of agar powder, 20mL of COVE salt solution, and deionised water to lOOOmL. The medium was sterilized by autoclaving at 15psi for 15 minutes (Bacteriological Analytical Manual, 8th Edition, Revision A, 1998). The medium was cooled to 60°C and 10mM acetamide, Triton X-100 (50pL / 500mL) were added. COVE-N-Agar tubes were composed of 218g Sorbitol, 10g Dextrose, 2.02g KNO3, 25g agar, 50mL Cove salt solution, and deionised water up to 1000mL. COVE salt solution was composed of 26g of MgSO4'7H2O, 26g of KCL, 26g of KH2PO4, 50mL of COVE trace metal solution, and deionised water to 1000mL. COVE trace metal solution was composed of 0.04g of Na2B4O7-10H2O, 0.4g of CuSO4'5H2O, 1.2g of FeSO4'7H2O, 0.7g of MnSO4H2O, 0.8g of Na2MoO4'2H2O, 10g of ZnSO4'7H2O, and deionised water to 1000mL.

[0378] The SEQ ID NO: 17 polypeptide coding sequence was cloned from Trichoderma citrinoviride DNA by PCR. Trichoderma citrinoviride was cultivated in 100 ml of YP + 2% glucose medium in 1000 ml Erlenmeyer shake flasks for 5 days at 20°C. Mycelia were harvested from the flasks by filtration of the medium through a Buchner vacuum funnel lined with MIRACLOTH® (EMD Millipore, Billerica, MA, USA). Mycelia were frozen in liquid nitrogen and stored at -80C until further use. Genomic DNA was isolated using a DNEASY® Plant Maxi Kit (QIAGEN GMBH, Hilden Germany) according to the manufacturer’s instructions.

[0379] Genomic sequence information was generated by Illumina MySeq (Illumina Inc., San Diego, CA). 5 pgs of the isolated Trichoderma citrinoviride genomic DNA was used for library preparation and analysis according to the manufacturer’s instructions. A 300 bp, paired end strategy was employed with a library insert size of 200-500 bp. The reads were subsequently fractionated to 25% followed by trimming (extracting longest sub-sequences having Phred- scores of 10 or more). These reads were assembled using Idba version 0.18. Contigs shorter than 200 bp were discarded. Genes were called using GeneMark.hmm ES version 2.3c and identification of the catalytic domain was made using " Alk_Phosphatase PF00245 " Hidden Markov Model provided by Pfam. The polypeptide coding sequence for the entire coding region was cloned from Trichoderma citrinoviride genomic DNA by PCR using the primers (SEQ ID NO: A / SEQ ID NO: 23 and SEQ ID NO: BZ SEQ ID NO: 24) described below.

[0380] 5’-ACACAACTGGGGATCCACCATGATTGCCAAGCTCGGA-3’ (SEQ ID NO: 23, SEQ ID NO: A)

[0381] 5’-AGATCTCGAGAAGCTTACTAGTAGCTCTCCTTGCC-3’ (SEQ ID NO: 24, SEQ ID NO: B)

[0382] Bold letters represent Trichoderma citrinoviride enzyme coding sequence. Restriction sites are underlined. The sequence to the left of the restriction sites is homologous to the insertion sites of pDau109 (WO 2005 / 042735).

[0383] In-Fusion™ Advantage PCR Cloning Kit Cat, nr 639620

[0384] The amplification reaction (50 pl) was performed according to the manufacturer’s instructions (Thermo Scientific) with the following final concentrations:

[0385] 1X Phusion HC buffer

[0386] 200uM dNTP

[0387] 2.0 mM MgCh

[0388] 0.5uM of each primer of SEQ ID NO: 3 + 4 10ng of Trichoderma citrinoviride genomic DNA.

[0389] The PCR reaction was incubated in a DYAD® Dual-Block Thermal Cycler (BioRad, USA) programmed for 1 cycle at 98°C for 30 seconds; 30 cycles each at 98°C for 10 seconds, 57°C for 20 seconds and 72°C for two minutes followed by 1 cycle at 72°C for 5 minutes. Samples were cooled to 10°C before removal and further processing. Five l of the PCR reaction were analyzed by 1% agarose gel electrophoresis using 40 mM Tris base, 20 mM sodium acetate, 1 mM disodium EDTA (TAE) buffer. A major band of about 2,3 kb was observed. The remaining PCR reaction was purified directly with an ILLUSTRA™ GFX™ PCR DNA and Gel Band Purification Kit (GE Healthcare, Piscataway, NJ, USA) according to the manufacturer's instructions.

[0390] Two pg of plasmid pDau109 was digested with Bam HI and Hind III and the digested plasmid was run on a 1% agarose gel using 50 mM Tris base-50 mM boric acid-1 mM disodium EDTA (TBE) buffer in order to remove the stuffer fragment from the restricted plasmid. The bands were visualized by the addition of SYBR® Safe DNA gel stain (Life Technologies Corporation, Grand Island, NY, USA) and use of a 470 nm wavelength transilluminator. The band corresponding to the restricted plasmid was excised and purified using an ILLUSTRA™ GFX™ PCR DNA and Gel Band Purification Kit. The plasmid was eluted into 10 mM Tris pH 8.0 and its concentration adjusted to 20 ng per pl. An IN-FUSION® PCR Cloning Kit (Clontech Laboratories, Inc., Mountain View, CA, USA) was used to clone the 2.3 kb PCR fragment into pDau109 digested with Bam HI and Hind III (20 ng). The IN-FUSION® total reaction volume was 10 pl. The IN-FUSION® total reaction volume was 10 pl. The IN-FUSION® reaction was transformed into FUSION-BLUE™ E. coli cells (Clontech Laboratories, Inc., Mountain View, CA, USA) according to the manufacturer’s protocol and plated onto LB agar plates supplemented with 50 pg of ampicillin per ml. After incubation overnight at 37°C, transformant colonies were observed growing under selection on the LB plates supplemented with 50 pg of ampicillin per ml.

[0391] Several colonies were selected for analysis by colony PCR using the pDau222 pDau109 vector primers described below. Four colonies were transferred from the LB plates supplemented with 50 pg of ampicillin per ml with a yellow inoculation pin (Nunc A / S, Denmark) to new LB plates supplemented with 50 pg of ampicillin per ml and incubated overnight at 37°C.

[0392] Primer 8653: 5’-GCAAGGGATGCCATGCTTGG-3’ (SEQ ID NO: 25 / SEQ ID NO: C)

[0393] Primer 8654: 5’-CATATAACCAATTGCCCTC-3’ (SEQ ID NO: 26 / SEQ ID NO: D)

[0394] Each of the three colonies were transferred directly into 200 pl PCR tubes composed of 5 pl of 2X Thermo Scientific Dream Taq™ PCR Master Mix (Thermo Fisher Scientific, Rockford, IL, USA), 0.5 pl of primer 8653 (10 pm / pl), 0.5 pl of primer 8654 (10 pm / pl), and 4 pl of deionized water. Each colony PCR was incubated in a DYAD® Dual-Block Thermal Cycler programmed for 1 cycle at 94°C for 60 seconds; 30 cycles each at 95°C for 30 seconds, 60°C for 45 seconds, 72°C for 120 seconds, 68°C for 10 minutes, and 10°C for 10 minutes. Four l of each completed PCR reaction were submitted to 1% agarose gel electrophoresis using TAE buffer. All four E. coli transformants showed a PCR band of about 2,3 kb. Plasmid DNA was isolated from each of the four colonies using a QIAprep Spin Miniprep Kit (QIAGEN GMBH, Hilden Germany). The resulting plasmid DNA was sequenced with primers 8653 and 8654 using an Applied Biosystems Model 3730 Automated DNA Sequencer using version 3.1 BIG-DYE™ terminator chemistry (Applied Biosystems, Inc., Foster City, CA, USA).

[0395] The plasmid was chosen for transforming Aspergillus oryzae MT3568. A. oryzae MT3568 is an amdS (acetamidase) disrupted gene derivative of Aspergillus oryzae JaL355 (WO 2002 / 40694) in which pyrG auxotrophy was restored by inactivating the A. oryzae amdS gene. Protoplasts of A. oryzae MT3568 were prepared according to the method described in European Patent, EP0238023, pages 14-15.

[0396] E. coli 190 containing the plasmid was grown overnight according to the manufacturer’s instructions (Genomed) and plasmid DNA was isolated using a Plasmid Midi Kit (Genomed JETquick kit, cat.nr. 400250, GENOMED GmbH, Germany) according to the manufacturer’s instructions. The purified plasmid DNA was transformed into Aspergillus oryzae MT3568. A. oryzae MT3568 protoplasts were prepared according to the method of Christensen et al., 1988, Bio / Technology 6: 1419-1422. The selection plates consisted of COVE sucrose with +10 mM acetamide +15 mM CsCI + TRITON® X-100 (50pl / 500ml). The plates were incubated at 37°C. Briefly, 8uls of plasmid DNA representing 3ugs of DNA was added to 100uls MT3568 protoplasts. 250 ul of 60% PEG solution was added and the tubes were gently mixed and incubate at 37° for 30 minutes. The mix was added to 10 ml of pre- melted Cove top agarose (The top agarose melted and then the temperature equilibrated to 40 C in a warm water bath before being added to the protoplast mixture). The combined mixture was then plated on two Cove-sucrose selection petri plates with 10mM acetamide. The plates are incubated at 37°C for 4 days. Single Aspergillus transformed colonies were identified by growth on the selection acetimide as a carbon source. Each of the four A. oryzae transformants were inoculated into 750 pl of YP medium supplemented with 2% glucose and also 750 pl of 2% maltodextrin and also DAP4C in 96 well deep plates and incubated at 37°C stationary for 4 days. At same time the four transformants were restreaked on COVE-2 sucrose agar medium.

[0397] Culture broth from the Aspergillus oryzae transformants were then analyzed for production of the P63TNK ALP polypeptide by SDS-PAGE using NUPAGE® 10% Bis-Tris SDS gels (Invitrogen, Carlsbad, CA, USA) according to the manufacturer. A single band at approximately 90 kDa was observed for each of the Aspergillus oryzae transformants. The larger than predicted size of 69 kDa is most likely due to glycosylation. One A. oryzae transformant producing the SEQ ID NO: 17 was designated A oryzae EXP08508. A. oryzae EXP13030 was cultivated in 1000 ml Erlenmeyer shake flasks containing 100 ml of DAP4C medium at 30°C for 3 days with agitation at 150 rpm.

[0398] Cloning and expression of SEQ ID NO:18 from Truncatella angustata and SEQ ID NO:18 from Morchella semilibera were performed exactly in the above description with the following specifics:

[0399] Primers used for PCR amplification of InFusion inserts:

[0400] ACACAACTGGGGATCCACCATGTTCAGCCGACTAGCC (SEQ ID NO: 143)

[0401] AGATCTCGAGAAGCTTACTATTTCTGGCAAGATCCAC (SEQ ID NO: 144)

[0402] PCR fragment size produced: 2,2 kb

[0403] Aspergillus recombinant protein size: 70,5 kDA, observed: approx. 85 kDa

[0404] ACACAACTGGGGATCCACCATGAACGTCAACAGCCTG (SEQ ID NO: 145)

[0405] AGATCTCGAGAAGCTTATTAGTGATGGAAGTGAGTAAGA (SEQ ID NO: 146)

[0406] PCR fragment size produced: 1,8 kb

[0407] Aspergillus recombinant protein size: 53,3 kDA, observed: approx. 55 kDa.

[0408] Example 4: Purification of alkaline phosphatase

[0409] Typically, the purification process for alkaline phosphatase (ALP) from culture broth was firstly applied with hydrophobic interaction chromatography on AKTA Chromatography system (Cytiva), then if needed, ion exchange chromatography was applied. The difference for all the molecules was buffer type, pH, and salt concentration.

[0410] The conductivity of culture supernatant of recombinant ALP was adjusted to about 190 mS / cm by adding ammonium sulfate, then the culture broth was loaded into Phenyl Sepharose High Performance column (Cytiva, 17108203) equilibrated with 20mM Tris-HCI at pH7.0 containing 2.0M ammonium sulfate. A gradient decrease of ammonium sulfate concentration from 2.0M to 0 was set up as elution condition. The elution fractions and flow-through faction were assayed by SDS-PAGE. ALP activity was determined as described below.

[0411] Ion exchange chromatography process was applied for further purification. The fractions with ALP activity were pooled together and dialyzed with 20mM Tris-HCI at pH8.0, then loaded into a MonoQ HR16 / 10 (Cytiva, 17050601) or CaptoQ column (Cytiva, 17547003) equilibrated with 20mM Tris-HCI at pH8.0. A gradient increase of NaCI concentration from 0 to 1M with 20mM Tris-HCI at pH8.0 was set up as elution process. The elution fractions and flow-through fraction were assayed for SDS-PAGE and ALP activity.

[0412] Finally, the fractions with enzyme activity were pooled together and then diafiltrated with 20mM PBS at pH7.0. The protein concentration was determined by Qubit™ Protein Assay Kit (Invitrogen, Q33212).

[0413] Example 5: His tag purification method

[0414] His-tagged alkaline phosphatases were purified by immobilized metal chromatography (IMAC) using Ni2+as the metal ion on 5 mL HisTrap Excel columns (GE Healthcare Life Sciences). The purification took place at pH 7 and the bound protein was eluted with imidazole. The purity of the purified enzymes was checked by SDS-PAGE and the concentration of the enzyme determined by Absorbance 280 nm after a buffer exchange in 50mM HEPES, 100mM NaCI pH7.0 Ref: “The InterPro protein families and domains database: 20 years on". Blum M1 , Chang HY1 , Chuguransky S1 , Grego T1 , Kandasaamy S1 , Mitchell A1 , Nuka G1 , Paysan-Lafosse T1 , Qureshi M 1 , Raj S1 , Richardson L1 , Salazar GA1 , Williams L1 , Bork P2, Bridge A3, Gough J4, Haft DH5, Letunic I6, Marchler-Bauer A5, Mi H7, Natale DA8, Necci M9, Orengo CA10, Pandurangan AP4, Rivoire C3, Sigrist CJA3, Sillitoe 110, Thanki N5, Thomas PD7, Tosatto SCE9, Wu CH8, Bateman A1 , Finn RD1. Nucleic Acids Research, 01 Jan 2021 , 49(D1):D344- D354

[0415] Example 6: Activity assay to determine the relative specific activity of alkaline phosphatases Alkaline phosphatase (ALP) (0,4 - 8 pg / ml) candidate was incubated in assay solution (AS) for 15 min at 38 °C. After incubation, the alkaline phosphatase candidate was diluted in a 10-step 2-fold dilution series and the substrate p-Nitrophenyl phosphate added to a final concentration of 50.0 pg / ml. After 60 minutes at 40°C, the absorbance was measured at 405 nm, the wavelength at which the enzymatic p-Nitrophenyl phosphate catalysis into p-Nitrophenol by alkaline phosphatase can be followed. Pepsin was added to the assay solution to ensure an identical background during the absorbance measurement, thereby allowing comparison to the results from the activity assay to determine the residual activity of alkaline phosphatase after a gastric challenge.

[0416] Data analysis

[0417] Background corrected absorbance values (Abscorr405Abs405corr) were plotted as a function of the logarithm of the enzyme concentration ([Enz] in %). The data was described by a 4- parametric, logarithmic Hill formula (Equation 1): where a describes the growth rate, / / ’describes the inflection point, cdescribes the lower asymptote and c / describes the upper asymptote. EQ0(pgEP / ml) values were calculated from the inflection point (IP) obtained from Equation 1 using the following equation:

[0418] Equation 2

[0419] Here, cMax (in pg EP / ml) describes the highest enzyme concentration used in the assay. The relative specific activity (Pe . spec actin %) was calculated from the ECS0value of a given ALP candidate relative to the ECS0of the alkaline phosphatase CIAP using Equation 3:

[0420] M.spw act

[0421] Example 7: Identification of stabilized variants

[0422] The stabilized variants of SEQ ID 11 , SEQ ID NO:61 to SEQ ID NO: 85, were identified by site saturation. Libraries were and screened as described below. After improved substitutions were identified, the improved substitutions were combined using SOE PCR, transformed into bacillus subtilis, and the resulting variants screened in the same assay to identify the stabilized combination variants.

[0423] Cultivation of variants for assay

[0424] Variants are inoculated in 2.2mL deep-well plates with 600 pL CAL18 medium and grown for 2 days at 37C, 700 RPM. The cells are spun down and the supernatant is used for the assay.

[0425] Screening of variants for identification of stabilized variants

[0426] In this example, variants were stressed at pH 4.0. This was used to identify the stabilizing substitutions. To identify stabilizing combinations and rank the top hits, pH was lowered to pH 3.4, pH 3.2 and pH 3.0. The supernatant sample is split in two, called “stressed” and “unstressed” sample. The stressed sample is diluted 8 pL into 70 pL of pH 4.0 buffer (660ml 1 M Citric acid + 340 ml 1 M Na-citrate). The unstressed sample is diluted 8 pL into 255 pL pH 8.0 buffer (200mM Tris pH 8, 0,1 mM CaCh, 10uM ZnCh, 5uM MgCh, 0,01 % Tween). Both samples are incubated for 60 minutes at room temperature while shaking. After incubation the stressed sample is diluted by first adding 78 pL of the stressed ample into 185 pL pH 8 buffer, and then from there diluting 35 pL into 175 mL of pH 8 buffer. The unstressed sample is similarly diluted by adding 35 pL into 175 pL pH 8.0 buffer. After mixing reading is done by adding 10 pL diluted sample (stressed or unstressed) to a 385-well reader plate. Then 40 pL pNP-phosphate disodium salt hexahydrate, CAS 333338-18-4, 2mg / ml in 100mM Tris pH8,0, 0,01% tween, 0,1 mM CaCh is added to each well, and the plate is immediately put in the reader for data collection. We used a BioTek Neo2 plate-reader. Absorbance is measured at 405 nm over 30 minutes, and the activity of each well is determined by the maximal slope of the kinetic curve. Hits are variants showing a higher residual activity (activity of stressed sample divided by activity of unstressed sample) than the reference and an unstressed activity not lower than the reference.

[0427] Example 8 : Lipopolysaccharide (LPS) Activity

[0428] A titration of alkaline phosphatase was mixed with 300 pg / mL LPS in 50 mM HEPES buffer supplemented with 0.0% Triton X-100. The mixture was incubated shaking for 60 min at 40 degrees C. Free phosphate was detected with Malachite Green Phosphate Detection Kit (R&D Systems) following manufactures protocol.

[0429] In short, 10 pL of Reagent A (ammonium molybdate in 3 M sulfuric acid) was added to all samples followed by 10 min incubation. Then 10 pL of Reagent B (malachite green oxalate and polyvinyl alcohol) was added and samples were incubated for an additional 20 min. The plate was read at OD620. Background from individual components (alkaline phosphatase, LPS, buffer) was subtracted to reveal OD values from only LPS dephosphorylation. From the measured levels of free phosphate by the alkaline phosphatase titration a non-linear curve fitting was done and EC50 calculated.

[0430] MAMP - Detoxification Assays

[0431] LPS de-phosphorylation was measured with the Malachite Green Phosphate Detection kit, which detects free PO4. E. coli LPS was treated with titration of ALP followed by detection of released PO4. LPS, flagellin and bacteria de-toxification was measured in: TLR4 reporter cells, HT-29 epithelial cell line and Primary immune cells.

[0432] ALP-treated LPS was added to cells and luminescence (for reporter cells) or cytokines were measured for evaluation of stimulatory capacity of LPS and flagellin

[0433] LPS: Malachite green phosphate detection kit - Results 300 pg / mL E. coli 0111:B4 LPS is treated with titration of ALPs for 1 hour at 40 °C. Buffer: 50 mM HEPES with 0.01% Triton X-100. Background from LPS, ALP and buffer is subtracted. CIAP is from Sigma and is used as reference.

[0434] Table 9

[0435] Example 9: Activity assay to determine the residual activity of alkaline phosphatase after a gastric challenge (ALP Gastric Conditions Stress Assay)

[0436] Assay purpose This protocol describes the assay used to determine the stability of Alkaline Phoshatase (ALP) wild type enzymes and variants under gastric stress conditions. Gastric condition stress is defined as: 15 min at pH 3, 40 °C, with exposure to Pepsin protease. Stability of ALP is evaluated by measuring ALP activity before and after exposure to stress. Results are given as percent Residual Activity (%RA) defined as the activity of a given sample after stress relative to the same samples’ unstressed activity, i.e. activity before stress is defined as 100%.

[0437] Assay protocol

[0438] Dilute each enzyme sample in Milli-Q water, 0.01 vol% TritonX-100 to a concentration of 2.4 ppm. Split each sample in three different aliguots and dilute to 1.2 ppm in Universal Stress Buffer (100 mM acetic acid, 100 mM MES, 100 mM HEPES, 100 mM Glycine, 1 mM MgCh, 1 mM CaCh, 1 mM ZnCh) at both pH 8, and pH 3 + pepsin (550 U / mL) each in a total volume of

[0439] 100 pL. Heat samples for 15 min at 40 °C in a PCR incubator. After heat exposure, measure activity of all three samples by mixing 30 pL heat-treated sample with 170 pL Activity Assay Solution (1 mM 4-Nitrophenyl phosphate disodium salt hexahydrate (CAS: 333338-18-4) in 100mM acetic acid, 100 mM MES, 100 mM HEPES, 100 mM Glycine, pH8) and immediately start reading change in absorbance at 405 nm for 30 min.

[0440] Materials

[0441] Assay Solution (AS, pH 8) 500 ll / rnl pepsin 1.17 - 1.53 mM HCI

[0442] 10 mM Tris (5.8 mM base, 4.2 mM acid)

[0443] 100 mM NaCI

[0444] 0.01% (w / v) Tween 20

[0445] Deionized, microfiltered water

[0446] Artificial gastric juice (AG J, pH 3) 550 ll / rnl pepsin 1.3 - 1.7 mM HCI 100 mM NaCI 0.01% (w / v) Tween 20 Deionized, microfiltered water

[0447] Neutralizing buffer (pH 8)

[0448] 100 mM Tris

[0449] 100 mM NaCI

[0450] 0.01% (w / v) Tween 20

[0451] Deionized, microfiltered water

[0452] An alkaline phosphatase candidate (0,4 - 8 pg / ml) was incubated in artificial gastric juice (AGJ) for 15 min at 38 °C to simulate the gastric challenge. After incubation, the pH was adjusted to pH8 with neutralizing buffer. The alkaline phosphatase candidate was diluted in a 10-step 2-fold dilution series and the substrate p-Nitrophenyl phosphate added to a final concentration of 50.0 pg / ml. After 60 minutes at 40°C, the absorbance was measured at 405 nm, the wavelength at which the enzymatic p-Nitrophenyl phosphate catalysis into p-Nitrophenol by alkaline phosphatase can be followed.

[0453] Data analysis

[0454] Background corrected absorbance values were plotted as a function of the logarithm of the enzyme concentration (in %). The data was described by a 4-parametric, logarithmic Hill formula (see: Eguation 1). EQ0(pgEP / ml) values were calculated from the inflection point ( / P) obtained from Equation 1 using Equation 2. The residual activity (%) of an ALP after a gastric challenge was determined using Equation 4 where ECA^P,AG}is the EC5o of an ALP obtained after the 15-minute incubation in AGJ and ECAQP,ASis the ECso of an ALP obtained after a 15-minute incubation in AS. Data analysis

[0455] Determine the initial rate (OD / min) for each sample and calculate percent Residual Activity (%RA) using the initial rate for the sample dissolved at pH 8 as index 100%.

[0456] Residual Activity of samples after 15 min stress at 40 degC with varying pH and incl / excl pepsin protease. Wildtypes SEQ ID NO:50 and SEQ ID NO:11 show no activity after the high gastric stress treatment. However, the prior art variant SEQ ID NO: 107, with a C-terminal histidine or when upconcentrated and SEQ ID NO: 104) retains part of its activity after gastric stress treatment. SEQ ID NO: 103 shows comparable activity after gastric stress treatment but SEQ ID NQ:104 shows both higher activity (73 OD / min / ppm) and higher percent residual activity (12%) compared to SEQ ID NO: 107 (21 OD / min / ppm and 6% respectively).

[0457] Table 10

[0458] Example 10: Determination of phosphatase activity at pH 7.0

[0459] 75 microliter phosphatase-containing enzyme solution (diluted in MQ water with 0.01 % (v / w) Triton X-100) is dispensed in a microtiter plate well, e. g. NUNC 269620 96-well plate, and 75 microliter substrate is added (for preparing the substrate, two 5 mg p-nitrophenyl phosphate tablets (Sigma-Aldrich, Cat.No. 20-106) are dissolved in 10 ml 50 mM Hepes, 100 mM NaCI, 1 mM CaCh, 1 mM MgCh, 1 mM ZnCh, pH 7.0). The plate is sealed and incubated 15 minutes, shaken with 750 rpm at 37°C. After the incubation time 75 microliter stop-reagent (0.5 M NaOH) is added and the absorbance at 405 nm is measured in a microtiter plate spectrophotometer. A blank (75 microliter 0.01 % (v / w) Triton X-100 + 75 microliter substrate solution (descripted above) is also incubated for 15 minutes, added 75 microliter stop-reagent and absorbance at 405 nm measured. This value is subtracted from the phosphatase readings. One phosphatase unit is defined as the enzyme activity that releases 1 micromol phosphate / min under the given reaction conditions (buffer blind subtracted). The absorbance of 1 micromol p-nitrophenol is determined to be 56 AU (AU= absorbancy units) under assay conditions.

[0460] Determination of the phosphatase pH profile

[0461] The pH profile was determined at 37°C in the pH range of 6.0 to 11.0 (in 1.0 pH-unit steps) as described above in the section “Determination of phosphatase activity”, except that a buffer cocktail (100 mM glycine, 100 mM acetic acid, 100 mM MES and 100 mM Hepes, 1 mM CaCh, 1 mM MgCh, 1 mM ZnCh, adjusted to relevant pH) was used instead of the Hepes pH 7.0 buffer. The results are summarized in Table 3. The values given for each pH in the range of 6.0 - 11.0 is the absorbance at 405 nm (A405) divide by the phosphatase concentration in ppm (determined by A280 of a purified sample and the calculated Extinction Coefficients of the phosphatase).

[0462] Example 11 : Thermostability (nDSF method)

[0463] Nano differential scanning fluorimetry (nDSF) was utilized to determine thermal stability of alkaline phosphatases of the invention at different pHs. Purified samples were diluted to 0.4 mg / mL in 250 mM HEPES (4-(2-hydroxyethyl)-1 -piperazineethanesulfonic acid), 250 mM Glycine, 250 mM Acetic acid, 250 mM MES (2-(N-morpholino) ethanesulfonic acid), pH 3, pH 4, pH 5, pH 7, pH 9, and pH 11.

[0464] The instrument utilized for nDSF experiments, was a Prometheus NT-Plex with autosampler from Nanotemper Technologies GmbH, Germany). Samples were loaded in the Prometheus NT.Plex using capillary chips (PR-AC002). The experiments were conducted from 20 to 95 °C with a temperature gradient of 3.3 °C / min. The melting temperatures (Tm-values) were obtained from peak values derived from the first-derivative of the signal trace (350 / 330 nm fluorescence ratio or 330 nm fluorescence) using PR-ThermControl software. Results are listed in Table 4.

[0465] Example 12: Thermostability (Thermal shift assay method) Protein thermal unfolding analysis (TSA, Thermal shift assay)

[0466] Protein thermal unfolding of alkaline phosphatase polypeptides was monitored with Sypro Orange (Invitrogen, S-6650) using a real-time PCR instrument (Applied Biosystems; Step-One-Plus). Purified enzyme samples were diluted to 0.8 mg / mL in 100 mM glycine, 100 mM acetic acid, 100 mM MES and 100 mM HEPES, adjusted to pH, 3.0, 4.0, 5.0, 7.0, 8.0, 9.0, 10.0 and 11.0 with and without 1mM CaCh, 1 mM MgCh, 1 mM ZnCh. Next, 15 l enzyme sample diluted in a buffer solution adjusted to relevant pH, was mixed (1:1) with Sypro Orange (Cone. = 10X; stock solution from supplier = 5000X) in water.

[0467] The plate was sealed with an optical PCR seal. The PCR instrument was set at a scanrate of 76°C per hour, starting at 25°C and finishing at 96°C. Fluorescence was monitored every 20 seconds using in-built LED blue light for excitation and ROX-filter (610 nm, emission). Tm- values were calculated as: The temperature causing the maximum value of the first derivative (dF / dK) (Gregory et al., 2009, J. Biomol. Screen. 14: 700). Results are listed in Tables 11-13. As can be seen at pH 7 and all other tested pHs, the polypeptides of the invention are more thermal stable than SEQ ID NO:50.

[0468] Table 11

[0469] The experiment was redone after the publication of WO2023 / 102002, with all backbones having a His tag Table 12

[0470] The purified enzymes, including SEQ ID NO: 1 of WO2023 / 102002, were expressed with no His tag and tested at pH 3.0. Accordingly, SEQ ID NO:104 has comparable thermostability to SEQ ID NO: 107, which was developed according to WQ2023 / 102002 for its thermostability.

[0471] Table 13

[0472] Example 13: Preventing inflammation by lowering the levels of IL-13

[0473] THP-1 cells were cultured in RPMI 1640 medium supplemeted with 10 mM HEPES, 10% FBS and 1% penicillin / streptomycin. THP-1 cells were seeded 2x105 cells / well in flat-bottom plate and stimulated with 10 ng / mL PMA (Phorbol 12-myristate 13-acetate) for 24 hours to induce macrophage phenotype. THP-1 macrophages were washed twice with pre-warmed PBS followed by 6 hours incubation in fresh complete medium to rest. Then cells were stimulated for 18 hours with 1 pg / mL LPS followed by additional washing in pre-warmed PBS. Alkaline phosphatase and ATP were mixed and incubated 1 hour with shaking at 40 degrees C before being added to the LPS stimulated THP-1 macrophages. After 1 hour incubation supernatants were harvested and analyzed for IL-1 by Cytometric Bead Array (CBA) analysis.

[0474] Table 14 This demonstrates that alkaline phosphatases of the invention significantly reduced levels of IL- 10.

[0475] Example 14 : Determination of the Phylogenetic Tree

[0476] A phylogenetic tree of all bacterial full-length sequences of wild type ALPs vs human iALP was designed using the MUSCLE [1], FastTree [2] and FigTree [4] software application.

[0477] The ancestral distance matrix between each pair of sequences constructed by measuring the distances of the different nodes in the phylogenetic tree. The resulting distance matrix listed below includes scores for each of the different pairs of bacterial ALPS versus hiALP.

[0478] The closest ones to hiALP with lowest scores between 1 ,0 and 2,0 are marked in the box, namely SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 55, and SEQ ID NO: 56. The 13 closest bacterial ALPs to hiALP are highlighted in a box in figure 3 and the calculation to generate the phylogenetic tree depicted in figure 3 is described in the following.

[0479] Calculation of ancestral distances

[0480] The calculation of ancestral distances requires several steps. This section describes these steps from a collection of sequences, which must include SEQ ID

[0481] NQ:108 (SWISSPRQT:P09923) and SEQ ID NO:21. The sequences are saved in the commonly used Fasta format.

[0482] In brief, the creation of a phylogenetic tree is state of the art and widely used. First a multiple sequence alignment is performed. From this, the tree is calculated and the newick file exported, which can be visualized in any common phylogenetic tree software. This file contains the ancestral distances of one leaf to another. The distance to SEQ ID NO: 108 can then be calculated by hand or using python by summing up the distance. For detailed instructions, see protocol below.

[0483] All software mentioned are available for the Ubuntu Linux operating system version 20.04 and the examples below are run from the command line here.

[0484] 1. Create multiple alignment

[0485] Multiple sequence alignments are well known in the art. Here we used the software “muscle” version 3.8.1551 [1] mus cle -in all sequences . fasta -out all sequences align . fasta

[0486] 2. Creating the tree (Newick file) from multiple sequence alignment Creating phylogenetic trees is well known in the art. Here, the software “FastTree” version

[0487] 2.1.11 [2] is used to create a tree file: fasttree all sequences align . fasta > all sequences . newick

[0488] 3. Calculate the ancestral distances between all sequences in the tree

[0489] From the tree file, ancestral distances between sequences can be calculated using the ete3 Python package version 3.1.3 [3]

[0490] The calculation requires a Python script that reads the tree file and writes a table with all pairwise ancestral distances (Excel format in this example): from ete3 import Tree import pandas as pd

[0491] # Load the tree from a Newick file t = Tree ( "all sequences . newick" ) nodellist= [ ] node21ist= [ ] distlist= [ ]

[0492] # Calculate and print distances between all pairs of leaves for nodel in t . iter leaf names ( ) : for node2 in t . iter leaf names ( ) : i f nodel ! = node2 : distance = t . get distance ( nodel , node2 ) else : distance=0 node Hi st . append ( nodel ) node21ist . append ( node2 ) distlist . append ( distance ) df = pd . DataFrame ( { ' Nodel nodellist , ' Node2 ' : node21ist , ' Distance ' : distlist } ) df . to excel ( "ancestral distances . xlsx" )

[0493] From this table, which contains ancestral distances between all nodes, the distances between

[0494] SEQ ID NO: 108 (SWISSPROT:P09923) and all other nodes are extracted.

[0495] [1] MUSCLE v3.8.1551: Edgar, R.C. Nucleic Acids Res 32(5), 1792-97.

[0496] [2] Fasttree: Price, M.N., Dehal, P.S., and Arkin, A.P. (2010) FastTree 2 -- Approximately Maximum-Likelihood Trees for Large Alignments. PLoS ONE, 5(3):e9490. doi: 10.1371 / journal. pone.0009490

[0497] [3] ete Python package: Jaime Huerta-Cepas, Frangois Serra and Peer Bork. "ETE 3: Reconstruction, analysis and visualization of phylogenomic data." Mol Biol Evol (2016) doi: 10.1093 / molbev / msw046

[0498] [4] FigTree: FigTree v1.4.4, 2006-2018; Tree Figure Drawing Tool; Andrew Rambaut; Institute of Evolutionary Biology, University of Edinburgh

[0499] The closest bacterial ALPs to hiALP are marked in bold. The corresponding distance scores are between 1 ,4 and 1 ,9, with a clear gap of 0.8 lower than the rest of the molecules. Table 15

[0500] Example 15. Template Modeling (TM) Score of ALPs vs hiALP:

[0501] The Template Modeling ™ score was calculated based on AlphaFold™. As described, a structural alignment of the three-dimensional structures of two polypeptides is necessary before the TM-score can be calculated. This is achieved via algorithms that optimize the structural overlap, and several methods are available, such as CEalign (Shindyalov and Bourne, Protein Eng., 11 , 739-747, 1998), DALI (Holm and Sander, Trends Biochem. Sci., 20, 478-480, 1995), or TM-align (Nucleic Acids Res. 33:2302-2309, 2005).

[0502] For the purposes of the present invention, TM-align is applied. For convenience, TM-score is integrated in the TM-align software, which is available from the author’s website. The version of TM-align is preferably updated 2019-08-22 or later, and the TM-score between a reference and a query protein is determined by running this command:

[0503] TMalign <query . pdb> <ref erence . pdb> -L <length of reference>

[0504] Where <query.pdb> is the name of the PDB file containing coordinates of the query polypeptide, <reference.pdb> is the name of the PDB file containing coordinates of the reference polypeptide. The TM-score is calculated and reported in the output, along with several other parameters from the alignment.

[0505] The maximal TM-score is 1 , e.g., 1.0, corresponding to identical three-dimensional structures.

[0506] For the bacterial ALPs of the invention versus the human intestinal ALP (SWISSPROT: P09923; SEQ ID 108), the resulted scores are listed below.

[0507] The resulting scores are listed below. In bold are the 13 backbones that have a low ancestral distance are having scores between 0.74 and 0.86 indicating that the molecules exhibit a remarkable structural similarity. In bold the 13 backbones that contain a variable region having scores between 0,74 and 0,86 indicating that the molecules exhibit a remarkable structural similarity.

[0508] Table 16

[0509] Example 16. PyMol Structural Analysis and identification of ‘Variable Region’ 3-Dimensional structures of the ALP sequences are calculated using AlphaFold. The structures are then inspected using a common 3D protein visualization tool, here PyMol [3.1] was used. After applying the align function within PyMol, a common ‘variable region’ is identified in 13 WT bacterial backbones This ‘variable region’ spans from aa 370 to 460 in hiALP.

[0510] To identify the ALPs that share a common fold of the ‘variable region’, all structures are visually inspected and grouped. The same regions and sequences can be obtained by extracting the ‘variable region’ sequences at position 495 to 634 in the multiple sequence alignment which contains the identified ‘variable region’ of hiALP. Residues 493 - 634 of the alignment corresponds to the complete variable region spanning from aa 370 to 460 in hiALP. The resulting 13 variable regions are listed in Table 17. Cutting out the variable region from the alignment

[0511] Knowing the start and end of the variable region in the alignment, we can use the software “seqkit” (version 0.16.1) to extract that region. seqkit subseq -r 495:634 all sequences align. fasta > vr.fasta (Figure 1a-c) seqkit subseq -r 493:634 all sequences align. fasta > vr.fasta (Table 17 and Figure 2a-c)

[0512] Table 17: Structural analysis using PyMol identified 13 WT bacterial backbones containing a common variable region

[0513] Reference:

[0514] [3.1] PyMol by Schrodinger (https: / / pymol.org)

[0515] [3.2] Seqkit: Shen W, Le S, Li Y, Hu F (2016) SeqKit: A Cross-Platform and Ultrafast Toolkit for FASTA / Q File Manipulation. PLoS ONE 11(10): e0163962. doi:10.1371 / journal.pone.0163962

[0516] Example 17: Template Modeling (TM) Score of ‘variable regions’ of ALPs vs hiALP:

[0517] The Template Modeling ™ score was calculated as described in Example 15 but only the structure of the variable region of all ALPs was used.

[0518] To extract the structure of the ‘variable region’ of all ALPs, the following steps were performed:

[0519] 1. As described in Example 15, the full-length structures of the sequences is calculated using Alphafold.

[0520] 2. The structures are loaded into a visualization software, such as PyMol and aligned by applying PyMols align function (see Example 15 for details).

[0521] 3. Remove the amino acid sequences that are not part of the ‘variable region’ (use the amino acid coordinates and sequence as previously defined in Example 15). This leaves only the ‘variable region’. Save the structures as .pdb files (world standard format for structures).

[0522] 4. Calculate the TM-score of the ‘variable region’ structures of all ALP vs the ‘variable region’ of hiALP.

[0523] The resulting scores are listed below in Table 18. In bold are the 13 backbones that have a low ancestral distance are having scores between 0.85 and 0.95 indicating that the ‘variable region’ of the molecules exhibit a remarkable structural similarity and has a conserved structural conformation.

[0524] Table 18

[0525] Example 18: Sequence Identity of bacterial ALPs vs hiALP

[0526] Percent sequence identity is calculated of hiALP to all ALP sequences as described in the method above The backbones that have a low ancestral distance to hiALP have a low % sequence identity to hiALP.

[0527] Table 19

[0528]

[0529] Example 19: Cell Assay ATP Activity

[0530] Bacteria were inoculated in broth (S. aureus in LB broth and Ls33 in MRS broth) and cultured over-night. Bacteria were re-inoculated in fresh broth and cultured for additional 24 hours to secure high growth capacity. Bacteria were diluted in fresh broth and seeded in plate. Alkaline phosphatase and ATP were mixed in 100 mM HEPES buffer and incubated with shaking for 1 hour at 40 degrees C before being added to bacteria in plate. Concentrations indicated in table are final concentrations in bacteria plate. OD600 was measured immediately and after 24 hours. Bacterial growth without additions was set to 100%. Table 20

[0531] Table 21

[0532] Table 22

[0533] Table 23

[0534] Example 20: LPS challenge of rat Objective:

[0535] To assess Alkaline Phosphatase’s (ALP) effectiveness in reducing immune response to Lipopolysaccharide (LPS) challenge. LPS is an endotoxin that elicits strong immune responses in animals stimulating the innate immune response and culminates in the synthesis and secretion of proinfl am matory cytokines, such as tumor necrosis factor alpha (TNF-a). LPS injection into mice results in elevated inflammatory cytokine levels, including those of

[0536] TNF-a, which peak at 1.5 hours post-injection, and IL-6, which peak 1.5 to 2.5 hours post injection (Zuckerman, 1989; Hanamura, 1997). Compounds that inhibit production of inflammatory cytokines can be evaluated using experimental conditions in which compounds are given 0.5 to 1 hour prior to the LPS challenge, depending on the pharmacokinetics of the compound (Zuckerman, 1989).

[0537] The efficacy of ALP treatments was evaluated in a model of LPS-induced cytokine production in male Lewis rats.

[0538] Experimental design:

[0539] A total of 10 male Lewis rats approximately 230 to 294 grams (mean of 256 g) were assigned randomly to each treatment group. The animals were acclimated for 9 days prior to being placed in the study. During the acclimation and study periods, the animals were housed in a laboratory environment with temperatures ranging from 19°C to 25°C and relative humidity of 30% to 70%. Automatic timers provided 12 hours of light and 12 hours of dark. Animals were allowed access ad libitum to Envigo Teklad 8640 diet and fresh municipal tap water.

[0540] On the day of study, the rats were fasted for 4 hours followed by intraperitoneal (IP) dosing at 2-minute intervals (timed) with lipopolysaccharide (LPS serotype 0127:B8, Sigma L4516), 1 mg / kg), or enzyme treatments calf intestinal alkaline phosphatase (CIAP Sigma 79390, diluted to 0.025 mg / kg), bovine intestinal alkaline phosphatase (BIAP Sigma P0114, diluted to 0.025 mg / kg), SEQ ID NO: 18 (0.025 mg / kg), or SEQ ID NO:21 (0.025 mg / kg) with or without LPS (IP). Positive control rats (group 4) were dosed with dexamethasone (VetOne, NDC 13985-037- 02 - 1 mg / kg, IP) 1 hour prior to LPS (IP) challenge. Groups 1 and 2 served as naive and saline- only (IP) control animals. All challenged animals received an intraperitoneal injection of lipopolysaccharide (E. coli 0127: B8, LPS) as part of the challenge. Blood samples were collected from the animals at 90 minutes and 180 minutes post-challenge for subsequent analysis. Pro- inflammatory cytokines, including TNFa and IL-6, will be measured using Illumina technology to assess inflammatory responses using an EMD Milliplex® MAP Rat Cytokine / Chemokine Magnetic Panel (kit catalog No. RCYTMAG65K27PMX) according to the kit instructions.

[0541] All animals survived to study termination

[0542] Table 24: Rat treatment groups and challenge dosages for LPS and enzyme:

[0543] Results

[0544] • IL-6 response to LPS was significantly reduced (57% less IL-6 than LPS alone) by SEQ ID NO:21 90 min after challenge and numerically reduced (45% less IL-6 vs LPS alone) 180 min after challenge (Table 26).

[0545] • TNF-a response to LPS was significantly reduced (67% less TNF-a than LPS alone) by SEQ ID NO:21 90 min after challenge and numerically reduced 39% less TNF-a vs LPS alone) 180 min after challenge (Table 24 and 26).

[0546] • SEQ ID NO: 18, BIAP and CIAP did not attenuate the_proinflammatory cascade stimulated by IP LPS significantly as SEQ ID NO:21.

[0547] • SEQ ID NO: 18 attenuate the proinflammatory cascade stimulated by IP LPS numerically better than BIAP and CIAP 90 minutes after challenge (Table 24 and 26).

[0548] • Treatment with dexamethasone in LPS-challenged rats resulted in statistically reduced serum IL-6 and TNF-a concentrations at both timepoints as compared to LPS control rats. Table 25. Summary of Data

[0549] Values represent group means and standard errors (SE)

[0550] *p < 0.05 ANOVA (w / Dunnett’s post-test) vs. Saline + LPS (1 mg / kg, Group 3) tp < 0.05 ANOVA (w / Tukey’s post-test) vs. Saline + LPS (1 mg / kg, Group 3) §p < 0.05 Student's t-test vs. Saline + LPS (1 mg / kg, Group 3)

[0551] #p < 0.05 ANOVA (w / Dunnett’s post-test) vs. Saline + Saline (Group 2)

[0552] Table 26: IL-6 and TNF-a response to IP LPS challenge % decrease vs. LPS % decrease vs LPS abcP<0.05Tukeys Multiple range test

[0553] Conclusions:

[0554] Alkaline phosphatase SEQ ID NO:21 can attenuate the proinflammatory cascade stimulated by IP LPS challenge in rats. Intraperitoneal treatment with SEQ ID NO:21 (0.025 mg / kg) in LPS-challenged rats resulted in statistically significant reductions in serum IL-6 and TNF-a concentrations 90 minutes post challenge. In comparison attenuation of the proinflammatory cascade after treatment with CIAP, SEQ ID NO:18, or BIAP on LPS-induced cytokine production were not significant. Yet the attenuation 90 minutes after challenge was numerically after SEQ ID NO: 18 treatment compared to BIAP and CIAP.

[0555] Example: 21 Heat stress

[0556] Background

[0557] Different stress factors inevitably influence the animal’s physiology and performance with varying degrees during the production period. High ambient temperature is one of the most common stressors in modern poultry production resulting in reduced feed intake, body weight gain, and increased mortality. Because of their physiological state and greater metabolic activity, broilers are more susceptible to temperature-associated environmental challenges. In addition to its effect on bird performance, the adverse effects of heat stress can range from minimal discomfort to multi-organ damage and failure, including alteration of gut permeability and function due to weakened tight junctions of the epithelial layer. Therefore, heat stress-induced disturbance of gut integrity may lead to leaky gut syndrome thus increasing the susceptibility of birds to enteric pathogens that may lead to systemic bacterial infections. Moreover, heat stress can cause oxidative damage by increasing the formation of reactive oxygen species.

[0558] Hypothesis and objective

[0559] The central hypothesis is that the adverse effects of heat stress on performance and health of chickens can be mitigated by incorporating effective feed additives into poultry diets. Certain compounds that can alter the dysregulating effects of heat stress may help in maintaining gut integrity and function. Therefore, the main objective is to alleviate the impact of heat stress challenge on performance and overall health of broilers by timely supplementation of the nondrug dietary additive, Alkaline Phosphatase (ALP). The results below are shown for SEQ ID NO: 21.

[0560] Experimental design

[0561] Birds and Management:

[0562] A 35-day trial with only male Cobb 500 broiler chicks were run in floor pens with eight replicate pens per treatment and 20 birds / pen. Birds are randomly assigned to treatment groups in a 2 x 4 factorial arrangement that includes heat stress (optimal or high heat) and dietary treatments (basal diet or feed additives) as per Table 27. A total of 4 animal rooms is used (2 controls and 2 heat stress) each housing half the replicate pens (n = 4) per group.

[0563] The starter and grower diets were based on corn-soybean formulations and provided to the birds from 0 to 21 and 22 to 35 d of age, respectively (Table 27). All diets were formulated to meet or exceed the NRC (1994) nutrient recommendations. Enzymes stocks were mixed with water and were sprayed uniformly into the mixer, directly into the feed with a micro-fluid nostril applicator. Each pen was equipped with a manual plastic bucket feeder and an automatic nipple drinker. Water and experimental diets (in mash form) were provided ad libitum throughout the study period. All chicks were weighed on per pen basis and feed intake (Fl) was recorded at weekly intervals. Any mortality was removed and recorded (including bird weight) twice daily. Body weight gain (BWG), Fl, and feed conversion ratio (FCR) were subsequently calculated to evaluate growth performance.

[0564] Table 27. Treatment groups including controls and challenge from d 28 to 35 (heat stress) are as follows: Heat Stress Protocol:

[0565] Heat stress protocol is performed as planned during the finisher feeding phase (d 28 to d 35). For the heat stress groups, temperature was maintained at 35 ± 1°C (10°C above the recommended temp.) and applied once daily from 10 am to 2 pm, then reduced again to 25 °C + / - 1 for the remainder of the day. Relative humidity was monitored and maintained at RH < 50%. Birds in the separate ‘optimal heat’ group are kept under normal constant recommended temperatures (25°C + / -1).

[0566] Table 28. Basal diet formulation for Starter and Grower phases.

[0567]

[0568] Statistical analysis Data were subjected to a 2-way ANOVA using the GLM procedure of JMP (Pro13). The models included heat stress (optimal and high heat) and dietary treatments (basal diet or feed (additives) as the main factors, and the 2-way interactions. Post-hoc testing was only carried out for significant interactions and was performed using simple effect analysis. The probability P < 0.05 was considered significant unless otherwise noted.

[0569] Sampling procedure:

[0570] Intestinal (jejunum) tissue samples were taken on d 27 (1 / pen), d 28 (2 / pen) and d 35 (2 / pen) from birds with average pen weight for qPCR analyses.

[0571] RNA extraction and reverse transcription:

[0572] Total RNA Extraction and Reverse Transcription Total RNA was extracted intestinal tissues using the Direct-zol RNA Kits (Zymo Research) according to the manufacturer’s recommendations. Tissue samples were removed from -80°C and placed on ice. A 20-30 mg aliquot of each sample was weighed, placed into a 2-mL microcentrifuge tube, and kept on ice until homogenization. Total RNA concentration was determined at optical density (OD) of 260 (NanoDrop-1000, Thermo Fisher Scientific, Waltham, MA), and RNA purity was verified by evaluating the 260 / 280 OD ratios. Total RNA was diluted to 0.2 pg / pL in nuclease-free water. Reverse transcription was accomplished using the high-capacity cDNA Reverse Transcription kit (Applied Biosystems, Carlsbad, CA) following the manufacturer’s protocol and the cDNA was stored at -20°C.

[0573] Quantitative Real-Time PCR

[0574] Quantitative real-time PCR (qRT-PCR) was performed using an ABI 7500 Fast Real- Time PCR System (Applied Biosystems). The cDNA was diluted 1 :20 in nuclease-free water, and 1 pL of the diluted cDNA was added to each well of a 96-well plate. Next, 9 pL of RT-PCR master mix containing 5 pL of Fast SYBR Green Master Mix (Applied Biosystems), 0.5 pL each of 2 pM forward and reverse primers, and 3 pL of sterile nuclease-free water per reaction were added to each well for a final volume of 10 pL. During the PCR reaction, samples were subjected to an initial denaturation phase of 95°C for 20 s followed by 40 cycles of denaturation at 95°C for 3 s and annealing and extension at 60°C for 30 s. Gene expression was analyzed using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an endogenous control. Each reaction was duplicate. Results from qRT-PCR were analyzed using the 7500 Real-Time PCR software (Applied Biosystems). The primer pairs used are shown in Table 29. Average gene expressions relative to the GAPDH endogenous control for each sample were calculated using the 2 -AACt method (Livak and Schmittgen, 2001) Table 29. Primer sequences for qPCR analysis (SEQ ID NOs: 147 - 190) Results:

[0575] Table 30. Effect of feed additives on broiler performance between d 0-7

[0576] Table 31. Effect of feed additives on broiler performance between d 7-14

[0577] Table 32. Effect of feed additives on broiler performance between d 0-27

[0578]

[0579] Table 33. Effect of feed additives on broiler performance between d 27-35

[0580] Table 34. Effect of feed additives on broiler performance between d 0-35

[0581] • ALP increased feed intake day 0-7 and significantly for the high dose ALP.

[0582] • ALP increased Body Weight Gain (BWG) significantly increased d 7-14 for medium and high ALP dose groups. • ALP increased BWG day 0-27 for ALP dose groups before heat stress.

[0583] • ALP increased BWG in broilers day 0-35 with a significant increase in the medium ALP dose group.

[0584] • ALP increased feed intake during heat stress for medium and high ALP dose groups

[0585] • General mortality was reduced in broilers fed with ALP additive and independently of heat stress.

[0586] • ALP significantly increased the expression of the Occludin gene on day 35 for birds supplemented with the low dose of ALP, while the expression was numerically increased in the medium and high dose groups.

[0587] • ALP numerically increased ZO-1, Muc2, TFF-2 and decreased TNF-a in ALP supplemented birds measured on day 35.

[0588] Table 35. Effect of feed additives on jejunum gene expression on d 35 - Gene expression (Fold Change)

[0589] Table 36. Effect of feed additives on jejunum gene expression on d 35 - Gene expression (Fold Change). Conclusion:

[0590] ALP can alleviate the negative effects of heat stress to a certain extent and improve broiler performance during the overall experiment period of 35 days.

[0591] Example 22: E. coli challenge

[0592] Objective: To test if Alkaline Phosphatase (ALP) can reduce the severity of Escherichia coli (E. coli) challenge for weaned piglets. Recovery is compared to negative control (NC), and positive control (PC)provided with Zink Oxide (ZnO).

[0593] Experimental Unit:

[0594] Piglets were individually housed in a total of 36 pens, with 9 replicates per treatment across 4 treatment groups.

[0595] Piglet Source: Mixed sex, 21 days old piglets and screened pre-weaning for blood type. Pigs with blood group O were selected based on their sensitivity to F18 E. coli. Only pigs that are F18 negative were chosen for the trial.

[0596] Feed Type: The basal corn / SBM mash diet is shown in table 37 and both feed and water were offered ad libitum. Phase 1 is for day 0-7 and phase 2 day 8-21. Test material is added to the feed beginning on Day 0 and continuing through Day 21 (table 39 below).

[0597] Table 37 - Diet Formulation

[0598]

[0599] *Enzymes will be applied over the top.

[0600] Table 38: Treatments (Days 21-42)

[0601] Table 39: Test measurements

[0602] Oral E. coli challenge: The 36 pigs weaned at 21 days of age and housed in biosafety level rooms were orally administered with sub-clinical dose (6.7 x 108CFU / ml) of F18 strain of E. coli using a needleless syringe on day 1 or 3 of the study and fed the 4 experimental diets for 21 days.

[0603] Oral gavage of enzymes: Pigs were orally administered with a single dose of enzymes on day 1 and day 3 prior to ETEC challenge. Piglets were given an oral gavage of 10 ml to each of the 9 pigs in a treatment group:

[0604] - Low dose: An oral gavage of 10 ml (30 ppm) to each of the 9 pigs in the low dose treatment group.

[0605] - High dose: An oral gavage of 10 ml (300 ppm) to each of the 9 pigs in the high dose treatment group.

[0606] Results:

[0607] Experimental results are shown in Table 40 and can be summarized as follows:

[0608] - ALP increased Average Daily Gain (ADG) from day 7 to 14 after E. coli challenge in both low and high dose supplemented piglets compared to NC, with growth similar to PC during this period.

[0609] - BWG was numerically improved day 21 after E. coli challenge for both low and high dose supplemented piglets compared to NC.

[0610] - G:F is significantly improved day 14-21 after E. coli challenge for the high dose supplemented piglets compared to NC and ZnO-supplemented piglets.

[0611] - The G:F is numerically better for the day 0-12 in the low and the high dose compared to the NC.

[0612] - Fecal score is numerically improved on the day 14-21 after E. coli challenge for high dose supplemented piglets compared to NC and significantly improved for the day 0-21.

[0613] Table 40. Growth performance (day 21) with diet and gender effects

[0614] Low- High-

[0615] NC PC enzyme enzyme SEM P-value

[0616] Body weight, kg

[0617] Initial 7.52 7.51 7.50 7.51 0.251 1.0000

[0618] Day 3 7.17 7.44 7.29 7.22 0.086 0.1413

[0619] Day 7 7.03 7.66 7.28 7.28 0.181 0.1276

[0620] Day 14 8.47b10.43a8.56b9.13b0.371 0.0029 Day 21 11.49b14.40a12.14b12.54b0.574 0.0071

[0621] ADG, g

[0622] Day 0-3 -115 -22 -72 -98 28.8 0.1414

[0623] Day 3-7 -34 55 -2 17 36.9 0.4035

[0624] Day 0-7 -68 22 -32 -32 25.9 0.1276

[0625] Day 7-14 206b396a183b272b39.1 0.0028

[0626] Day 0-14 69b209a76b116b26.5 0.0029

[0627] Day 14-21 334b564a496a488a38.1 0.0026

[0628] Day 0-21 189b328a220b239b27.3 0.0071

[0629] ADFI, g

[0630] Day 0-3 42 63 40 65 10.4 0.2095

[0631] Day 3-7 152 161 123 140 19.1 0.5386

[0632] Day 0-7 105 119 88 108 12.7 0.3908

[0633] Day 7-14 322B439A307B375AB38.3 0.087

[0634] Day 0-14 214B279A198B242AB22.8 0.085

[0635] Day 14-21 489 680 550 510 60.0 0.1166

[0636] Day 0-21 312 413 316 332 32.9 0.1134

[0637] G:F ratio

[0638] Day 0-3 -5.923 -1.828 -3.194 -2.472 1.4094 0.2041

[0639] Day 3-7 -0.313 -0.006 -0.301 0.012 0.3882 0.8881

[0640] Day 0-7 -0.731 -0.179 -0.717 -0.555 0.4325 0.7884

[0641] Day 7-14 0.583B0.946A0.556B0.725AB0.1097 0.070

[0642] Day 0-14 0.282b0.753a0.330b0.411b0.1145 0.0303

[0643] Day 14-21 0.767b0.853b0.932ab0.966a0.0447 0.021

[0644] Day 0-21 0.643B0.802A0.703B0.713AB0.0408 0.0677abWithin a row, means without a common superscript differ (P < 0.05).

[0645] ABWithin a row, means without a common superscript differ (0.05< P < 0.10).

[0646] Table 41. Fecal score (daily average value, 2 trained investigator)

[0647] NC PC Low-enzyme High-enzyme SEM P-value

[0648] Fecal score*

[0649] D O-3 0.52 0.44 0.46 0.21 0.138 0.4194

[0650] D 3-7 2.07 1.82 1.52 1.62 0.311 0.6200

[0651] D O-7 1.89 1.14 0.99 0.91 0.203 0.5684

[0652] D 7-14 2.18ab0.53c2.39a1.53b0.221 <0.0001

[0653] D O-14 1.73a0.84c1.66ab1.11bc0.192 0.0058

[0654] D 14-21 1.26a0.20b1.13a0.58ab0.278 0.0395

[0655] D O-21 1.53a0.66c1.47ab0.94bc0.192 0.0068

[0656] *Fecal score is the mean fecal consistency score: 0, normal; 1 , soft feces; 2, mild diarrhea;

[0657] 3, severe diarrhea. Pigs with a fecal score of <1 were considered not to have diarrhea (Marquardt et al., 1999).abcWithin a row, means without a common superscript differ (P < 0.05).

[0658] Conclusion:

[0659] ALP reduces diarrhea severity in E. co / / -challenged piglets and speeds up recovery, leading to greater average daily gain versus negative control. Example 23: Dephosphorylation of substrates ATP, ADP and AMP by alkaline phosphatase (ALP) This study evaluates the dephosphorylation of ATP, ADP, and AMP by alkaline phosphatases (ALPs), including calf intestinal alkaline phosphatase (CIAP) and microbial alkaline phosphatases with SEQ ID 21 , 37, 104 and 107. ALP activity is quantified using a defined assay that measures the release of inorganic phosphate with Malachite Green reagents under controlled reaction conditions.

[0660] Alkaline phosphatases were titrated and mixed with a final concentration of 50 pM substrate being ATP (Adenosine 5’-triphosphate disodium salt hydrate, Cat#A7699-1G, Sigma- Aldrich) ADP (Adenosine 5’-diphosphate sodium salt, Cat#A2754, Sigma-Aldrich) or AMP (Adenosine 5’-monophosphate disodium salt, Cat#01930, Sigma-Aldrich) in 50 mM HEPES pH 7 supplemented with 0.01% Triton-X. The mixture was incubated for 10 min at 40 degrees C shaking (500 rpm). Free phosphate was quantified with the Malachite Green Phosphate Kit (R&D Systems, DY996) following the manufacturer's protocol. A serial dilution of standard phosphate was also used.

[0661] In detail, reaction was stopped by adding 10 pL of reagent A (ammonium molybdate in 3 M sulfuric acid) and the sample was incubated at room temperature shaking (500 rpm) for 30 min. Next, 10 pL of reagent B (malachite green oxalate and polyvinyl alcohol) was added, and the sample was incubated at room temperature shaking (500 rpm) for 10 min. 620 nm absorption was measured using a spectrofluorometer plate reader. Controls including only buffer and substrates were used to subtract background from all data and measure absorption only from substrate de-phosphorylation. From the measured levels of free phosphate by the alkaline phosphatase titration a non-linear curve fitting was done and EC50 calculated.

[0662] Results:

[0663] ATP dephosphorylation

[0664] The results for ATP dephosphorylation by ALPs, CIAP, SEQ ID 21 , 37, 104 and 107, are summarized in Table 42 below. The table displays the effective concentration (EC50) values for each enzyme tested, normalized EC50 values relative to CIAP, and the optical density (OD620) measurements at two different enzyme concentrations, reflecting the extent of free phosphate released.

[0665] These values enable direct comparison of the catalytic efficiency and phosphate release between samples.

[0666] Table 42: Increasing release of free phosphate during ATP dephosphorylation by ALP.

[0667] Figure 4: This graph displays the outcomes of ATP dephosphorylation by alkaline phosphatase (ALP).

[0668] In table 42 the effective concentration (EC50) for each enzyme tested and the optical density (OD620) measured at two enzyme concentrations (0.2 pg / mL and 2 pg / mL) are shown.

[0669] The OD620 values reflect the amount of free phosphate released during the reaction, enabling direct comparison of catalytic efficiency and phosphate release among enzyme samples. These results show that the CIAP and the microbial ALPs, SEQ ID 21 , 37, 104 and 107, were able to release phosphate from ATP substrate. ADP dephosphorylation

[0670] The results for ADP dephosphorylation by ALP, CIAP, SEQ ID 21 , 37, 104 and 107, are summarized in Table 43 below. The table displays the effective concentration (EC50) values for each enzyme tested, normalized EC50 values relative to CIAP, and the optical density (OD620) measurements at two different enzyme concentrations, reflecting the extent of free phosphate released.

[0671] These values enable direct comparison of the catalytic efficiency and phosphate release between samples.

[0672] Table 43: Increasing release of free phosphate during ADP dephosphorylation by ALP.

[0673] Figure 5: This graph displays the outcomes of ADP dephosphorylation by alkaline phosphatase (ALP).

[0674] In Table 43 effective concentration (EC50) for each enzyme tested and the optical density (OD620) measured at two enzyme concentrations (0.2 pg / mL and 2 pg / mL) are shown. The OD620 values reflect the amount of free phosphate released during the reaction, enabling direct comparison of catalytic efficiency and phosphate release among enzyme samples. These results show that CIAP and the microbial ALPs, SEQ ID 21 , 37, 104 and 107, were able to release phosphate from ADP substrate. AMP dephosphorylation

[0675] The results for AMP dephosphorylation by ALP, CIAP, SEQ ID 21 , 37, 104 and 107, are summarized in Table 44 below.

[0676] The table displays the effective concentration (EC50) values for each enzyme tested, normalized EC50 values relative to CIAP, and the optical density (OD620) measurements at two different enzyme concentrations, reflecting the extent of free phosphate released.

[0677] These values enable direct comparison of the catalytic efficiency and phosphate release between samples.

[0678] Table 44: Increasing release of free phosphate during AMP dephosphorylation by ALP.

[0679] Figure 6: This graph displays the outcomes of AMP dephosphorylation by alkaline phosphatase (ALP).

[0680] In table 44 the effective concentration (EC50) for each enzyme tested and the optical density (OD620) measured at two enzyme concentrations (0.2 pg / mL and 2 pg / mL) are shown. The OD620 values reflect the amount of free phosphate released during the reaction, enabling direct comparison of catalytic efficiency and phosphate release among enzyme samples. These results show that CIAP and the microbial ALPs, SEQ ID 21 , 37, 104 and 107, were able to release phosphate from AMP substrate.

[0681] Conclusion:

[0682] The results demonstrate that the ALPs assessed in this study, including CIAP and the microbial ALPs SEQ ID 21 , 37, 104 and 107, effectively catalyze the dephosphorylation of all three tested substrates ATP, ADP and AMP. Across both enzyme concentrations, the observed EC50 and OD620 values indicate that the catalytic efficiency and phosphate release of the ALP samples are comparable to those of the reference CIAP. Therefore, within the tested concentration range, the ALPs exhibit robust and consistent dephosphorylation activity similar to the established benchmark.

[0683] Example 24: Dephosphorylation of LPS by ALP enzymes

[0684] An alkaline phosphatase titration assay was conducted to measure LPS dephosphorylation activity in a HEPES buffer with specific ions, yielding EC50 values and OD620 readings for various microbial ALPs, SEQ ID21 , 37 104 and 107 compared to calf intestinal alkaline phosphatase (CIAP), with results indicating LPS dephosphorylation activities among tested ALPs. By specifically detecting released inorganic phosphate, the Malachite assay shows that the ALP enzymes can dephosphorylate LPS.

[0685] A titration of alkaline phosphatase was mixed with 300 pg / mL LPS (Lipopolysaccharide from E. coli 0111 :B4, Sigma-Aldrich, Cat#L4391-1MG) in 50 mM HEPES buffer pH 7 supplemented with 1 mM CaCh, 1 mM MgCh, 1 mM ZnCh and 0.01 % Triton X-100. The mixture was incubated shaking for 60 min at 40 degrees C. Free phosphate was detected with Malachite Green Phosphate Detection Kit (R&D Systems, DY996) following manufactures protocol. In short, 10 pL of Reagent A (ammonium molybdate in 3 M sulfuric acid) was added to all samples followed by 10 min incubation. Then 10 pL of Reagent B (malachite green oxalate and polyvinyl alcohol) was added and samples were incubated for an additional 20 min. Absorbance at 620 nm was read (OD620). Background from individual components (alkaline phosphatase, LPS, buffer) was subtracted to reveal OD values from only LPS dephosphorylation. From the measured levels of free phosphate by the alkaline phosphatase titration a non-linear curve fitting was done and EC50 calculated.

[0686] Results: The results are summarized in Table 45 and figure 7 comparing LPS dephosphorylation activity of different microbial ALPs, SEQ ID 21 , 37, 104 and 107 relative to CIAP. Key metrics include LPS EC50 values, EC50 ratios relative to CIAP, and OD620 readings at two concentrations (1.67 pg / mL and 15 pg / mL).

[0687] Table 45.

[0688] Conclusion:

[0689] This assay detects release of inorganic phosphate as a result of LPS dephosphorylation by ALPs. All microbial enzymes SEQ ID 21 , 37, 104 and 107 including reference (CIAP) demonstrated dephosphorylation activity on LPS in the tested enzyme concentrations. Example 25: LC-MS / MS analysis of ATP, ADP and AMP dephosphorylation by alkaline phosphatases (ALP) enzymes

[0690] Alkaline phosphatases including calf intestinal phosphatase (CIAP) and microbial ALPs SEQ ID 21 , 37, 104 and 107 were tested for their activity in converting ATP, ADP, AMP, and adenosine substrates by measuring released adenosine using Liquid Chromatography-Tandem Mass Spectrometry (LC-MS / MS). The study involved incubation of enzymes with substrates followed by chromatographic separation and mass spectrometry detection to quantify adenosine release. Results showed varying levels of adenosine released depending on the substrate and ALP enzyme tested.

[0691] Alkaline phosphatases at a concentration of 10 pg / mL were mixed with a final concentration of 10 pM substrate being ATP (Adenosine 5’-triphosphate disodium salt hydrate, Cat#A7699-1G, Sigma-Aldrich) ADP (Adenosine 5’-diphosphate sodium salt, Cat#A2754, Sigma- Aldrich), AMP (Adenosine 5’-monophosphate disodium salt, Cat#01930, Sigma-Aldrich) or adenosine (A4036-5G, Sigma-Aldrich) in 50 mM HEPES pH 7 supplemented with 0.01 % Triton- X. A control sample (Ctrl) was included as a reference where no ALP was added. The mixture was incubated for 60 min at 40 degrees C shaking (500 rpm) and samples were stored at -20 degrees C.

[0692] LC-MS / MS analysis: detection of released adenosine

[0693] The samples were analyzed undiluted using a Waters Acquity Premier UPLC system (Waters, Milford, MA, USA) equipped with a Synergi Fusion-RP column (2.1 * 100 mm, 2.5 pm) and coupled to a Xevo TQ-S micro mass spectrometer (Waters, Milford, MA, USA). For chromatographic separation, 5 pL of the prepared samples were injected into the LC-MS / MS system. The column temperature was maintained at 30 °C throughout the analysis, while the samples were kept at 5 °C. The mobile phase consisted of water (mobile phase A) and acetonitrile (mobile phase B), both containing 0.15 % formic acid as modifier. A gradient elution program was used as follows: 0-1 min, 99 % A; 1-6 min, 75 % A; 6.1-7 min, 5 % A; 7.1-9 min, 99 % A. The total run time for the chromatographic analysis was 9.0 min, and the flow rate of the mobile phase was maintained at 0.25 mL / min. The mass spectrometer operated in MRM (multiple reaction monitoring) mode with electrospray ionization in positive ion mode. The following mass spectrometry parameters were applied: capillary voltage: 3.0 kV; source temperature: 150 °C; desolvation temperature: 500 °C; desolvation gas flow: 650 L / h; cone gas flow: 20 L / h. Adenosine was detected using the following mass transition: m / z=268.1 > 136.1 .

[0694] Results: Table 46: Concentration of released adenosine detected by LC-MS in pM or % of maximum detected adenosine in Control (Ctrl) sample.

[0695] The barplot in Figure 8 displays the measured concentrations (in pM) of adenosine generated from the dephosphorylation of ATP, ADP, and AMP substrates by ALPs after 60 minutes. Individual bars correspond to distinct ALPs as labeled on the x-axis.

[0696] Conclusion:

[0697] The data indicates that ALPs, CIAP and microbial ALPs SEQ ID 21 , 37, 104 and 107 can dephosphorylate a diverse range of substrates, as reflected by the measured values. Notably, the technique employed in this study specifically measured adenosine as a product, providing direct evidence of dephosphorylation activity. In this study, ALPs dephosphorylated the three phosphorylated substrates, ATP, ADP and AMP, within 60 min. Overall, the findings highlight the broad substrate specificity of ALPs for ATP, ADP and AMP as well as the enzymes’ efficient catalytic activity across these substrates. Example 26: Inhibitory effect of ATP on bacterial growth mitigated by microbial alkaline phosphatases

[0698] Intestinal alkaline phosphatase (IAP) has been reported to play a crucial role in maintaining gut homeostasis (Malo et al. 2010). Furthermore, ATP has been shown to exert a growth inhibitory effect on various bacterial species, while ALP promotes the growth of commensal bacteria by dephosphorylating ATP and reducing its suppressive impact (Malo et. 2014). In this study we investigate whether the inhibitory effect of ATP on Ligilactobacillus salivarius (Ls 33) can be restored by alkaline phosphatase, such as Calf Intestinal Alkaline Phosphatase (CIAP) and microbial alkaline phosphatases SEQ ID 21 , 37, 104 and 107, which hydrolyze ATP and thereby mitigate its impact on bacterial growth.

[0699] Assay description:

[0700] Day 1 :

[0701] The following solutions were prepared in 100mM HEPES buffer:

[0702] • ATP+Enzyme solutions: 80mM ATP (Sigma Aldrich, A7699-1G) combined with alkaline phosphatase at final concentration of 200ppm for CIAP (Sigma-Aldrich; #79390) and 1000ppm of purified microbial alkaline phosphatase (SEQ ID 21 , 37, 104 and 107).

[0703] • ATP-Only solution: 80mM ATP without enzyme

[0704] • Enzyme-Only solutions: alkaline phosphatases without ATP at final concentration of 200ppm for CIAP and 1000ppm for microbial alkaline phosphatase (SEQ ID 21 , 37, 104 and 107).

[0705] All samples were incubated 1 hr at 37 °C . Following incubation, each sample was diluted 1 :1 with MRS medium (Difco 288130) and subseguently stored at -20 °C.

[0706] The Ligilactobacillus salivarius (Ls 33; ATCC-SD5208) strain was cultured in 25 mL MRS medium inside a Thermo Fisher ScientificTM Rectangular AnaeroBoxTM Container under microaerophilic conditions using an AnaeroGen 2.5 L gas-generating bag (Thermo Fisher Scientific #AN0025A). Cultures were incubated overnight at 37°C without shaking.

[0707] Day 2:

[0708] Sample preparation of bacterial Ls 33 culture:

[0709] 1mL of overnight bacterial Ls 33 culture was diluted in 24 mL MRS media. The resulting diluted culture was then mixed in a 1 :1 ratio with ATP and enzyme solutions (225 pL + 225 pL) which had been thawed after preparation the previous day. This resulted in final concentrations of 20mM ATP and either 50 ppm CIAP or 250ppm microbial alkaline phosphatase (SEQ ID 21 , 37, 104 and 107) in the culture.

[0710] Control samples were prepared as follows: a negative control consisting of MRS growth medium without bacterial Ls 33 culture, and a positive control consisting of MRS growth medium inoculated with Ls 33 diluted at the same extent as the experimental samples.

[0711] Subsequently, 200 pL of each sample was dispensed in duplicate into a 96-well microtiter plate (Nunclon Delta surface Thermo Fisher Scientific #167008). The growth of the Ls 33 culture was monitored over time under microaerophilic conditions at 37°C without shaking as previously described. Optical density at 600 nm (OD600) was measured at 0, 1 , 2, 3, 4, 5, 6 and 7 hours. The recorded OD600 values are presented in Table 47 and illustrated in Figure 9.

[0712] Table 47. OD600Measurements of Ls-33 growth under ATP and alkaline phosphatase treatments.

[0713] Figure 9: Inhibitory effect of ATP on Ls-33 growth. Alkaline phosphatase treatment of ATP restores growth.

[0714] Conclusion:

[0715] The results show that bacterial Ls-33 culture exposed to ATP alone exhibited no growth. However, when ATP was co-incubated with alkaline phosphatase such as CIAP or SEQ ID 21 , 37, 104 and 107, bacterial growth was restored, indicating that these enzymes can reverse ATP’s inhibitory effect. Notably, enzymes alone had no impact on Ls-33 growth.

[0716] Example 27: Anti-inflammation by inhibition of TNF- a secretion

[0717] Adenosine is known to possess anti-inflammatory function by reducing secretion of TNF- a, a pro-inflammatory cytokine (Fotheringham et al. 2004). Complete de-phosphorylation of ATP by alkaline phosphatase would generate adenosine and hence result in inhibition of TNF-a during inflammation.

[0718] To demonstrate the inhibition of TNF-a by adenosine THP-1 cells (ATCC, cat#: TIB-202) were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin (complete medium). THP-1 cells were seeded 2x105cells / well in flatbottom 48-well plate and stimulated with 10 ng / mL PMA (Phorbol 12-myristate 13-acetate) (Merck, cat#: P8139) for 24 hours to induce macrophage phenotype. THP-1 macrophages were washed twice with pre-warmed phosphate buffered saline (PBS) followed by 24 hours incubation in fresh complete medium to rest. Then cells were washed in pre-warmed PBS to remove secreted cytokines from the PMA stimulation. Both adenosine (Merck, cat#: A4036) and lipopolysaccharide (LPS) (Merck, cat#: L4391) solutions were prepared in complete medium before simultaneously being added to the cells. Adenosine had a final concentration of 1 mM and 0.1 mM, and LPS had a final concentration of 100 ng / mL. After two hours stimulation at 37 °C, 5% CO2, supernatants were collected and analyzed for TNF-a by CBA analysis (BD Biosciences, Franklin Lakes, NJ, USA). As shown in table 48, addition of adenosine during LPS stimulation demonstrates dose dependent suppression of TNF-a secretion. This shows that adenosine has anti-inflammatory function during inflammation.

[0719] Table 48: Suppression of TNF-a by adenosine

[0720] ATP treatment with alkaline phosphatase is suspected to result in complete dephosphorylation, generating adenosine as the product. This was analyzed by Liquid Chromatography-Mass Spectrometry (LC-MS) for ATP treated with the alkaline phosphatases (ALPs) of the invention. LC-MS was performed as described in Example 25, 50 pg / mL ALP and 5 mM ATP were mixed in RPMI 1640 cell culture medium without

[0721] FBS and incubated 1 hour with shaking at 40 °C followed by analysis by LC-MS.

[0722] As presented in table 49, LC-MS analysis clearly demonstrates that all ALPs of the invention completely de-phosphorylate ATP down to adenosine. Table 49: LC-MS detection of ATP, ADP, AMP, and adenosine in ALP treated ATP Additionally, the same samples were evaluated for TNF-a suppressing capability as described for adenosine above. The ALP treated ATP samples were added together with 100 ng / mL LPS (Merck, cat#: L4391) to rested and washed THP-1 macrophages and supernatants were analyzed by CBA for TNF-a after two hours stimulation at 37 °C, 5% CO2. As shown in Table 50, all ALPs of the invention demonstrated that their dephosphorylation of ATP leads to suppression of LPS induced TNF-a. Suppression of TNF-a was also observed for untreated ATP, which is known from literature. This can be due to dephosphorylation of ATP by the extracellular cell-bound ATP hydrolases CD39 and CD73 generating adenosine (Antonioli et al. 2013) but can also be due to ATP mediated redirection of cytokine trafficking, leading to TNF-a being released in microvesicles indetectable by standard

[0723] ELISA methods (Soni et al. 2019). However, when level of TNF-a secreted from untreated ATP is set to 100%, it is demonstrated that all ALP treated ATP possess a more pronounced suppression of TNF-a.

[0724] Table 50: Inhibition of TNF-a by ALP treated ATP

[0725] Example 28: Preventing inflammation by lowering the levels of IL-1 3

[0726] IL-1 p is a pro-inflammatory cytokine, which secretion reguires two signals. For immune cells extracellular ATP is recognized as a danger signal and it can act as the second signal, leading to secretion of IL-1 p. Thus, removal of extracellular ATP would reduce IL-1 p during inflammation.

[0727] THP-1 cells (ATCC, cat#: TIB-202) were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin (complete medium). THP-1 cells were seeded 2x105cells / well in flat-bottom 48-well plate and stimulated with 10 ng / mL PMA (Phorbol 12-myristate 13-acetate) (Merck, cat#: P8139) for 24 hours to induce macrophage phenotype. THP-1 macrophages were washed twice with pre-warmed phosphate buffered saline (PBS) followed by 6 hours incubation in fresh complete medium to rest. Then cells were stimulated for 18 hours with 1 pg / mL lipopolysaccharide (LPS) (Merck, cat#: L4391) followed by additional washing in pre-warmed PBS. 50 pg / mL alkaline phosphatase and 5 mM ATP (Merck, cat#: A7699) were mixed in complete cell culture medium and incubated 1 hour with shaking at 40 °C before being added to the LPS stimulated THP-1 macrophages. After 1 hour incubation at

[0728] 37 °C, 5% CO2, cell supernatants were harvested and analyzed for IL-1 by Cytometric Bead Array (CBA) analysis (BD Biosciences, Franklin Lakes, NJ, USA).

[0729] Results are shown in Table 51 , where levels of IL-1 secreted from cells exposed to untreated ATP are set to 100% and levels from unexposed cells are set to 0%. As demonstrated, alkaline phosphates of the invention prevent levels of IL-1 secretion induced by ATP in activated immune cells. For all tested alkaline phosphatases nearly 100% prevention of IL-1 secretion was observed.

[0730] Table 51 : Reduction of IL-1 by ALP treated ATP (one experiment of two)

[0731] LIST OF REFERENCES

[0732] Antonioli, Luca, et al. “CD39 and CD73 in Immunity and Inflammation.” Trends in Molecular Medicine, vol. 19, no. 6, Jun. 2013, pp. 355-67. PubMed, https: / / doi.Org / 10.1016 / j.molmed.2013.03.005.

[0733] Fotheringham, Julie A., et al. “Activation of Adenosine Receptors Inhibits Tumor Necrosis Factor- a Release by Decreasing TNF-a mRNA Stability and P38 Activity.” European Journal of Pharmacology, vol. 497, no. 1 , Aug. 2004, pp. 87-95. DOI.org (Crossref), https: / / doi.Org / 10.1016 / j.ejphar.2004.06.029.

[0734] Hanamura, T., et al. “Macrophage Colony-Stimulating Factor (M-CSF) Augments Cytokine Induction by Lipopolysaccharide (LPS)-Stimulation and by Bacterial Infections in Mice.” Immunopharmacology, vol. 37, no. 1 , Aug. 1997, pp. 15-23. PubMed, https : / / do i . org / 10.1016 / s0162-3109(96)00166-x.

[0735] Livak, K. J., and T. D. Schmittgen. “Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method.” Methods (San Diego, Calif), vol. 25, no. 4, Dec. 2001 , pp. 402-08. PubMed, https: / / doi.org / 10.1006 / meth.2001.1262.

[0736] Malo, M. S., et al. “Intestinal Alkaline Phosphatase Preserves the Normal Homeostasis of Gut Microbiota.” Gut, vol. 59, no. 11 , Nov. 2010, pp. 1476-84. PubMed, https: / / d0i.0rg / l 0.1136 / gut.2O10.211706.

[0737] Malo, Madhu S., et al. “Intestinal Alkaline Phosphatase Promotes Gut Bacterial Growth by Reducing the Concentration of Luminal Nucleotide Triphosphates.” American Journal of Physiology. Gastrointestinal and Liver Physiology, vol. 306, no. 10, May 2014, pp. G826-838.

[0738] PubMed, https: / / doi.Org / 10.1152 / ajpgi.00357.2013. Marquardt, Ronald R, et al. “Passive Protective Effect of Egg-Yolk Antibodies against Enterotoxigenic Escherichia Coli K88+ Infection in Neonatal and Early- Weaned Piglets.” FEMS Immunology & Medical Microbiology, vol. 23, no. 4, Apr. 1999, pp. 283-88. DOI.org (Crossref), https: / / doi.Org / 10.1111 / j.1574-695X.1999. tb01249.x. Soni, Sanooj, et al. “ATP Redirects Cytokine Trafficking and Promotes Novel Membrane TNF Signaling via Microvesicles.” FASEB Journal: Official Publication of the Federation of American Societies for Experimental Biology, vol. 33, no. 5, May 2019, pp. 6442-55. PubMed, https: / / doi.org / 10.1096 / fj.201802386R.

[0739] Zuckerman, S. H., and A. M. Bendele. “Regulation of Serum Tumor Necrosis Factor in Glucocorticoid-Sensitive and -Resistant Rodent Endotoxin Shock Models.” Infection and

[0740] Immunity, vol. 57, no. 10, Oct. 1989, pp. 3009-13. PubMed, https: / / doi.org / 10.1128 / iai.57.10.3009-3013.1989.

Claims

CLAIMS1. A pet food comprising a polypeptide having alkaline phosphatase activity.

2. The pet food according to claim 1 , wherein the polypeptide is of non-mammalian origin, such as of fungal or bacterial origin.

3. The pet food according to claims 1 or 2, wherein the polypeptide is selected from the group consisting of a polypeptide having at least 70% sequence identity, such as at least 75% sequence identity, such as at least 80%, at least 85%, at least 90%, at least 95%, such as at least 96%, at least 97%, at least 98%, at least 99%, such as 100% sequence identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 , SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31 , SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 , SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51 , SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61 , SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71 , SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81 , SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91 , SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101 , SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105 and SEQ ID NO: 106.

4. The pet food according to claims 1 to 3 wherein the polypeptide having alkaline phosphatase activity is selected from the group consisting ofa) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 11 , b) a variant of SEQ ID NO: 11 having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 61 , SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81 , SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101 , SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, and SEQ ID NO: 106; c) a polypeptide having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 21 ; and d) a variant of SEQ ID NO: 21 having at least 70% sequence identity, e.g., at least 75%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71 , SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91 , SEQ ID NO: 92, SEQ ID NO: 93, and SEQ ID NO: 94.

5. The pet food according to any of the preceding claims, wherein the pet is a dog or cat or rabbit, preferably dog or cat, namely wherein the pet food is dog food or cat food.

6. The pet food according to any of the preceding claims, further comprising a protein source.

7. The pet food according to any of the preceding claims selected from the group consisting of a dog food, cat food, a dog or cat treats, kibble, biscuit, raw hide or chews.

8. A method of maintaining or improving levels of commensal microbes in the intestines of companion animals and / or maintaining or improving intestinal health in a companion animal comprising feeding a companion animal a pet food as defined in any of claims 1 to 7.

9. A method of maintaining general health in a companion animal by preventing or reducing inflammation of intestinal tissue in a companion animal, comprising feeding the animal a polypeptide as defined in any of claims 1 to 7.

10. A method of preventing diabetes in an obese companion animal or near-obese companion animal or delaying the onset of diabetes in said animal, comprising feeding the animal food comprising a polypeptide as defined by any of claims 1 to 7.11 . A method of preventing diabetes in a pet or a companion animal, or delaying the onset of diabetes in said animal, comprising feeding the animal a food comprising a polypeptide as defined by any of claims 1 to 7.

12. A method of reducing symptoms associated with aging in a companion animal comprising feeding the animal a food comprising a polypeptide as defined by any of claims 1 to 7.

13. A method of maintaining intestinal integrity or reducing gut leakage in a companion animal comprising feeding the animal a food comprising a polypeptide as defined by any of claims 1 to 7.

14. A method of preventing Irritable Bowel Syndrome (IBS), or reducing the frequency or severity of diarrhea in a companion animal comprising feeding the animal a food comprising a polypeptide as defined by any of claims 1 to 7.

15. A method of improving post antibiotic recovery in a companion animal or reducing the likelihood or preventing post antibiotic Clostridium difficile infection prevention, said method comprising feeding the animal a food comprising a polypeptide as defined by any of claims 1 to 7.

6. A pet food comprising a polypeptide having alkaline phosphatase activity for use in the maintenance or improvement of levels of commensal microbes in the intestines of companion animals and / or maintenance or improvement of intestinal health in a companion animal.128

Citation Information

Patent Citations

  • Process for the production of protein products in Aspergillus oryzae and a promoter for use in Aspergillus

    EP0238023A2

  • Methods and compositions for reducing the environmental impact of animal waste

    US20180326020A1

  • DNA encoding an enzyme with endoglucanase activity from trichoderma harzianum

    WO1995002043A1

  • Methods for producing a polypeptide in a bacillus cell

    WO1999043835A2

  • Heterologous expression of taxanes

    WO2002040694A3