Modular multiple DNA fragment assembly system

Abstract

The present invention relates to a multi-assembly platform capable of manufacturing a plurality of fragmented level 1 transcription units in a single reaction using connectors, and then assembling the plurality of level 1 transcription units at once by using yeast homologous recombination technology. The present invention has an effect of significantly improving assembly efficiency while simplifying procedures compared to existing methods. Therefore, the present invention can be effectively used in the synthetic biology and biofoundry fields requiring diverse and high-throughput gene cloning products.

Description

Modular multi-DNA fragment assembly system

[0001] [Cross-reference with related applications]

[0002] This application claims the benefit of priority based on Korean Patent Application No. 10-2024-0143229 dated October 18, 2024, and all contents disclosed in the document of said Korean patent application are incorporated herein as part of this specification.

[0003] [Technology Field]

[0004] The present invention relates to a modular multiple DNA fragment assembly system capable of efficiently assembling a plurality of DNA fragments.

[0005] With the recent advancements in genetic engineering and biotechnology, useful foreign proteins can be mass-produced using E. coli, yeast, and animal and plant cells, and these proteins are widely used as pharmaceuticals. Specifically, the development of production process technologies and industrialization are being promoted for pharmaceutical and research proteins, such as immunomodulators, enzyme inhibitors, and hormones, as well as industrial proteins, such as reaction addition enzymes. The genetic recombination technology used for this purpose involves cloning the nucleic acids of various target proteins into an expression vector to obtain a recombinant expression vector, and then transforming and culturing this vector into a suitable host cell to produce the target protein or target polypeptide.

[0006] Furthermore, with the advancement of synthetic biology and metabolic engineering technologies, numerous studies are being conducted to produce biosynthetic products via metabolic pathways—rather than simple proteins—from sources such as E. coli, yeast, and animal and plant cells. Various biosynthetic products are produced in cells through natural processes and are utilized in numerous industrial sectors, including the food, animal feed, cosmetics, food, and pharmaceutical industries. These substances, collectively referred to as fine chemicals / proteins, possess diverse chemical structures and biological activities, including organic acids, both proteinogenic and non-proteinogenic amino acids, nucleotides and nucleosides, lipids and fatty acids, diols, carbohydrates, aromatic compounds, vitamins and cofactors, proteins, and enzymes. All genes involved in the production, regulation, transport, and protection from harmful effects of specific substances required in each field are clustered in dense regions of the genome called biosynthetic gene clusters (BGCs), and these BGCs vary greatly in size, ranging from a few kilobases to over 100 kilobases. Therefore, in order to produce various biosynthetic products, it is very important to design and construct pathways capable of producing natural products at appropriate levels. However, constructing DNA of large pathways that operate in model strains for biosynthetic product production remains a difficult task. To construct DNA of large pathways, research on modular cloning systems (MoClo) that construct metabolic pathways stepwise has recently been actively underway; however, there is still a lack of systems that can efficiently and economically optimize the assembly of DNA fragments by simplifying the cloning steps and reducing the time required.

[0007] Golden Gate Assembly, one of the gene recombination technologies, is a method that uses IIS-type restriction enzymes and T4 DNA ligases to ligate complementary DNA overhang sequences. Compared to the conventional Gibson Assembly, it has a short ligation site (3-4 bp) and is usefully employed because it has the advantage of being able to specify ligation sites at various locations using a single type of restriction enzyme.

[0008] However, Golden Gate Assembly has several limitations when assembling multiple transcription units (promoter-gene-terminator). First, for Golden Gate Assembly, a single Level 1 transcription unit is produced by transforming Level 0 components, such as a promoter and a terminator, into E. coli or similar organisms. At this time, in order to produce a Level 2 plasmid containing multiple Level 1 transcription units, each Level 1 transcription unit must be produced as a separate plasmid. This results in inefficiency due to the need to perform Golden Gate Assembly and transformation reactions multiple times, as well as incurring unnecessary storage costs for Level 1 plasmids. Furthermore, when introducing each Level 1 transcription unit into a Level 2 plasmid, assembly efficiency decreases significantly as the number of Level 1 transcription unit fragments increases.

[0009] Under this technical background, the present invention aims to provide an efficient modular multi-assembly platform designed to assemble multiple transcription unit fragments at once by introducing homologous terminal sequences into the transcription unit and the target vector to use endogenous homologous recombination of yeast such as Saccharomyces cerevisiae.

[0010] The present invention aims to provide a method for recombining multiple DNA fragments, which simplifies the procedure compared to existing methods while significantly improving assembly efficiency.

[0011] In addition, the present invention aims to provide a composition for the recombination of multiple DNA fragments, which simplifies the procedure compared to existing methods while significantly improving assembly efficiency.

[0012] To achieve the above objective, one aspect of the present invention provides a method for recombinating a plurality of DNA fragments, comprising the step of introducing a plurality of transcription units, each comprising a 5'-homologous terminal sequence and a 3'-homologous terminal sequence; and a target vector into a host cell, wherein the 5'-homologous terminal sequence of any one of the plurality of transcription units and the 3'-homologous terminal sequence of any other of the plurality of transcription units are capable of homologous recombination with the target vector, and each of the plurality of transcription units is such that the 3'-homologous terminal sequence of any one of the transcription units is capable of homologous recombination only with the 5'-homologous terminal sequence of any other of the transcription units.

[0013] In addition, to achieve the above objective, another aspect of the present invention provides a composition for recombination of a plurality of DNA fragments, comprising: a plurality of transcription units each having a 5'-homologous terminal sequence and a 3'-homologous terminal sequence; and a target vector; wherein the 5'-homologous terminal sequence of any one of the plurality of transcription units and the 3'-homologous terminal sequence of any other of the plurality of transcription units are capable of homologous recombination with the target vector, and each of the plurality of transcription units is such that the 3'-homologous terminal sequence of any one of the transcription units is capable of homologous recombination only with the 5'-homologous terminal sequence of any other of the transcription units.

[0014] The present invention relates to a multi-assembly platform capable of manufacturing multiple fragmented Level 1 transfer units in a single reaction using a connector, and then assembling multiple Level 1 transfer units at once using homology recombination technology. Compared to existing methods, the procedure is simplified, while the assembly efficiency is significantly improved.

[0015] However, the effects of the present invention are not limited to those mentioned above, and other unmentioned effects will be clearly understood by those skilled in the art from the following description.

[0016] FIG. 1 schematically illustrates an embodiment of the modular multi-assembly platform (EffiModular) of the present invention for multi-transfer unit plasmid assembly.

[0017] FIG. 2 schematically illustrates a comparison between a module cloning method using a conventional Golden Gate assembly (Fig. 2A) and an embodiment of the modular multi-assembly platform of the present invention (Fig. 2B).

[0018] Figure 3 shows the results of verifying the modular multi-assembly platform of the present invention using the beta-carotene biosynthetic pathway. Figure 3A is a schematic diagram of the beta-carotene biosynthetic pathway through the expression of the crtYB, crtI, and crtE genes in yeast; Figure 3B shows an assembly method using a linearized vector and a Level 1 transcription unit fragment containing crtYB, crtI, and crtE; Figure 3C shows a quantitative analysis of the transformation results according to the molar ratio (1:1, 1:2, 1:4) of the target vector and the Level 1 transcription unit fragment; and Figure 3D shows an image of the yeast transformation plate results under the conditions of Figure 3C.

[0019] Figure 4 shows the results of verifying whether a Level 1 transcription unit fragment was formed. Figure 4A is a schematic diagram of the fabrication of a transcription unit fragment using distilled water (DW) or a Golden Gate Assembly (GGA) reaction mixture, Figure 4B shows the expected size of the connector and the crtYB, crtI, and crtE fragments, and Figure 4C is a gel electrophoresis result confirming the assembly of the Level 1 transcription unit fragment through direct analysis (left) or post-PCR analysis (right).

[0020] Figure 5 is a schematic diagram of the xylose metabolism and retinol biosynthesis pathways in engineered yeast.

[0021] Figure 6 shows the results of verifying the assembly of the xylose pathway (3 transcription units). Figure 6A is a schematic diagram of a xylose pathway plasmid of approximately 7.4 kb size assembled through the platform of the present invention, and Figure 6B shows the results of colony PCR performed on a total of 93 randomly selected colonies (31 each in 3 independent transformations), confirming the presence of the xylose pathway cassette.

[0022] Figure 7 shows the results of assembling and functionally verifying 3-transcription unit, 5-transcription unit, and 8-transcription unit metabolic pathways using the platform of the present invention. Figures 7A to 7C show the results of evaluating the assembly efficiency of a 3-transcription unit xylose utilization pathway composed of XR, XDH, and XK using colony PCR, and verifying its function through cell growth and xylose consumption of approximately 5 g / L in a xylose-containing medium. Figures 7D to 7F show the results of evaluating the assembly efficiency of a 5-transcription unit retinol biosynthesization pathway composed of crtYB, crtI, crtE, BCMO, and RDH12 using colony dye and PCR, and verifying its function through confirmation of retinoid production. FIGS. 7G to 7I are the results of evaluating the assembly efficiency of eight transcription units composed of crtYB, crtI, crtE, XR, XDH, XK, BCMO, and RDH12, including transcription units for selected markers, and verifying their function through the confirmation of xylose and retinoid production.

[0023] Figure 8 shows the results of verifying the assembly of the retinol production pathway of 5 transcription units. Figure 8A is a schematic diagram of the beta-carotene pathway plasmid assembled through the platform of the present invention, Figure 8B shows the colony phenotype of the beta-carotene-producing strain, Figure 8C is a schematic diagram of the retinol pathway plasmid, Figure 8D shows the colony phenotype of the retinol-producing strain, and Figure 8E shows the results of colony PCR performed on 45 colonies (15 each) randomly selected from three independent transformations, which confirms the presence of the retinol pathway cassette.

[0024] Figure 9 shows the verification results of the assembly of the xylose-utilizing and retinol-producing pathway (total 8 transcription units) that does not include the yeast selection marker transcription unit. Figure 9A is a schematic diagram of the assembly of a full pathway plasmid of approximately 20 kb size using the platform of the present invention, where the selection marker is located in the target vector. Figure 9B shows the results of colony PCR performed on a total of 30 colonies (10 each) randomly selected from three independent transformations, confirming the presence of two pathway cassettes, and numbers marked in red indicate incomplete or incorrectly assembled plasmids. Figure 9C shows the results of quantifying the total number of colonies and assembly efficiency for the 8 transcription unit constructs.

[0025] Figure 10 shows the verification results of the assembly of the xylose-utilizing and retinol-producing pathway (total 8 transcription units), including a yeast selection marker transcription unit. Figure 10A is a schematic diagram of the assembly of a full pathway plasmid of approximately 20 kb size using the platform of the present invention, with the selection marker located in the target vector. Figure 10B shows the results of colony PCR performed on a total of 30 colonies (10 each) randomly selected from three independent transformations, confirming the presence of two pathway cassettes, with numbers marked in red indicating incomplete or incorrectly assembled plasmids.

[0026] Figure 11 shows the results of high-throughput combinatorial assembly for 120 beta-carotene-producing yeast strains by integrating the platform of the present invention with a biofoundry workflow. Figure 11A is a schematic diagram of a combinatorial expression strategy using six different promoters (pTDH3, pPGK1, pHHF1, pALD6, pRNR1, pRNR2) for the crtYB, crtI, and crtE genes, excluding the duplicate use of the same promoter. Figure 11B shows a semi-automatic assembly pipeline in which Level 1 transcription unit fragments are assembled into GGA in a 96-well plate and introduced into yeast along with a linearized vector, in which the combinations of 120 strains were automatically processed by a liquid handler using a mapping file. Figure 11C shows a representative image of SC-Leu medium showing the colony arrangement of 120 strains, and the color change from yellow (light) to red (dark) reflects the difference in beta-carotene production depending on the promoter combination.

[0027] Figure 12 shows the identification of Level 1 transcription unit fragments of the crtYB, crtI, and crtE genes. Figure 12A shows the arrangement of Level 1 transcription unit fragments distributed in a 96-well plate. Figure 12B shows the results of gel electrophoresis analysis of the products amplified by PCR after Golden Gate assembly, confirming the expected size fragments of crtYB, crtI, and crtE, respectively.

[0028] FIG. 13 shows the aspiration and dispensing parameters for a Level 1 transfer unit for manufacturing a Level 2 plasmid, representing a portion of a mapping file that instructs the liquid handler to deliver the correct transfer unit fragment to each well (location) of a 96-deep-well plate (Asp.Rack: aspiration rack, Asp. Posi: aspiration location (well), Dsp. Rack: dispensing rack, Dsp.Posi: dispensing location (well), Volume: volume (μL)).

[0029] Figure 14 shows a backup cycle for cases of colony formation failure or misassembly. In Figure 11C, H5, L2, and N3 colonies were identified as misassembled and used in the backup cycle, and the crtYB, crtI, and crtE promoter combinations of each strain are listed in Tables 2 and 3.

[0030] Figure 15 shows the results of a quantitative analysis of beta-carotene production and promoter composition in 120 yeast strains assembled using the platform of the present invention. Figure 15A shows the beta-carotene production of all strains sorted in descending order, where each bar represents the average concentration and standard deviation obtained from independent biological replicates. Figure 15B compares the promoter composition of the top 20 strains and the bottom 20 strains in terms of production.

[0031] Figure 16 shows the results of colony spotting of 120 yeast strains arranged in order of beta-carotene production. Each strain has a different promoter combination, and "NC" refers to control colonies containing an empty vector without a beta-carotene biosynthetic pathway.

[0032] FIG. 17 illustrates the process and results of genomic integration within a chromosome using the platform of the present invention. FIG. 17A is a schematic diagram of the genomic integration workflow using the platform of the present invention, wherein EffiModular in FIG. 17A represents the selection marker being present on the integration fragment, and EffiModular_MT represents the selection marker being repositioned to be located on the Level 1 transcription unit. FIG. 17B shows the selection medium obtained after performing transformation by each method, and FIG. 17C represents the integration efficiency defined as the proportion of pigment-forming colonies among the total transformants (n=3).

[0033] The present invention will be described in detail below.

[0034]

[0035] 1. Method for recombination and expression of multiple DNA fragments

[0036] One aspect of the present invention provides a method for recombination and expression of multiple DNA fragments, in which the procedure is simplified compared to existing methods, while the assembly efficiency is significantly improved.

[0037] The above method for recombining a plurality of DNA fragments comprises the step of introducing a plurality of transcription units, each comprising a 5'-homologous terminal sequence and a 3'-homologous terminal sequence; and a target vector; into a host cell, wherein the 5'-homologous terminal sequence of any one of the plurality of transcription units and the 3'-homologous terminal sequence of any other of the plurality of transcription units are capable of homologous recombination with the target vector, and each of the plurality of transcription units is capable of homologous recombination only with the 5'-homologous terminal sequence of any one of the transcription units.

[0038] The above method for recombining a plurality of DNA fragments includes the step of introducing a plurality of transcription units, each comprising a 5'-homologous terminal sequence and a 3'-homologous terminal sequence; and a target vector; into a host cell, wherein the 5'-homologous terminal sequence of any one of the plurality of transcription units and the 3'-homologous terminal sequence of any other of the plurality of transcription units are capable of homologous recombination with the target vector, and each of the plurality of transcription units is capable of homologous recombination only with the 5'-homologous terminal sequence of any one of the transcription units.

[0039] FIG. 1 schematically illustrates an embodiment of a modular multi-assembly method (EffiModular) according to one aspect of the present invention. Referring to FIG. 1, the modular multi-assembly method of the present invention is designed to produce multiple fragmented Level 1 transcription units in a single reaction using a connector capable of homologous recombination by functioning as a recombination arm, and then to transform the multiple Level 1 transcription units into a single vector or long-chain DNA fragment using homologous recombination technology.

[0040] The existing module cloning method manufactures Level 1 transcription units containing a single promoter, target gene, and terminator as individual plasmids rather than fragments, which is time-consuming and costly, and has a problem where efficiency drops sharply during Level 2 plasmid assembly as the number of Level 1 transcription units increases.

[0041] In contrast, the method of the present invention, as described above, produces multiple fragmented level 1 transcription units in a single reaction and then assembles the multiple level 1 transcription units using homology recombination technology, thereby simplifying the procedure compared to existing methods while significantly increasing assembly efficiency, so it can be effectively utilized in the fields of synthetic biology and biofoundry that require diverse and large quantities of gene cloning products.

[0042] Specifically, the plurality of transcription units of the present invention include 5'-homologous terminal sequences and 3'-homologous terminal sequences, wherein the 5'-homologous terminal sequence of one of the transcription units is designed to be homologous recombination with a target vector, and the 3'-homologous terminal sequence of another transcription unit is designed to be homologous recombination with a target vector. The 5'-homologous terminal sequence of the other transcription unit is designed to be homologous recombination only with the 3'-homologous terminal sequence of any other transcription unit, so that the plurality of transcription units can be recombinated into a target vector at once.

[0043] For example, homologous recombination occurs between the left homologous end sequence of the target vector and the 5'-homologous end sequence of the first level 1 transcription unit fragment, homologous recombination occurs between the 3'-homologous end sequence of the first level 1 transcription unit fragment and the 5'-homologous end sequence of the second level 1 transcription unit fragment, and in the same way, homologous recombination occurs between the 3'-homologous end sequence of the last level 1 transcription unit fragment and the right homologous end sequence of the target vector, so that the level 1 transcription unit fragments are introduced into the target vector at once and can be assembled into a level 2 plasmid.

[0044] In addition, conventional module cloning methods require that each Level 1 transcription unit be produced in the form of a plasmid, making bacterial cloning and purification processes essential. On the other hand, since the method of the present invention introduces connector sequences at both ends, homologous recombination is possible, allowing fragmented Level 1 transcription units to be produced in a single reaction, thereby eliminating the bacterial cloning process and enabling direct transformation into a host cell.

[0045] In the present invention, the transcription unit refers to a Level 1 transcription unit comprising a promoter sequence, a base sequence encoding a target protein, and a terminator sequence, and can be manufactured by a Golden Gate assembly method in which a Level 0 plasmid comprising a promoter sequence, a base sequence encoding a target protein, or a terminator sequence, respectively, and a connector such as a recombinant arm are cleaved with a Type IIS restriction enzyme, an overhang sequence is adjusted, and then a junction enzyme is treated.

[0046] The aforementioned Golden Gate Assembly refers to a molecular cloning technique capable of assembling DNA fragments using Type IIS restriction enzymes and T4 DNA ligases. Additionally, the aforementioned overhang sequence refers to a sequence that protrudes unpaired from the ends of DNA; it can be generated when DNA is cleaved by a restriction enzyme and can be easily combined with other DNA overhang sequences by a ligase.

[0047] The above Type IIS (IIS-type) restriction enzyme refers to a restriction enzyme that recognizes a restriction enzyme recognition site and performs the role of cleaving the area outside said site. In the present invention, the above Type IIS restriction enzyme may be BsaI, AarI, Eco31I, Esp3I, Bpil, MnII, BsmI, Alw26I, MboII, or BseGI, but is not limited thereto as long as it is a known Type IIS restriction enzyme.

[0048] For example, if the above Type IIS restriction enzyme is BsaI, it can generate a 5'-NNNN overhang sequence by recognizing and cleaving the 5'-GGTCTCN-3' sequence and the 3'-CCAGAGNNNNN-5' sequence. By appropriately controlling the overhang sequence, desired DNA fragments can be accurately assembled at desired locations.

[0049] In the method for recombining a plurality of DNA fragments according to the present invention, the transcription units may have a lower limit of 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, or 10 or more, and may have an upper limit of 30 or fewer, 25 or fewer, 20 or fewer, 15 or fewer, 10 or fewer, or 5 or fewer. For example, the transcription units of the present invention may be 2 to 30, 2 to 20, 2 to 15, or 2 to 10, and in particular may be 3 to 8, and for example, the transcription units may be 3, 5, or 8.

[0050] In the present invention, the transfer unit may be n, and the plurality of transfer units may include a first transfer unit to an nth transfer unit. The number n is the same as described above regarding the number of transfer units.

[0051] In one embodiment, when there are three transcription units (i.e., when n is 3), the plurality of transcription units may include a first transcription unit to a third transcription unit. In this case, the left homologous terminal sequence of the target vector may be capable of homologous recombination with the 5'-homologous terminal sequence of the first transcription unit, the 3'-homologous terminal sequence of the first transcription unit may be capable of homologous recombination only with the 5'-homologous terminal sequence of the second transcription unit, the 3'-homologous terminal sequence of the second transcription unit may be capable of homologous recombination only with the 5'-homologous terminal sequence of the third transcription unit, and the 3'-homologous terminal sequence of the third transcription unit may be capable of homologous recombination with the right homologous terminal sequence of the target vector, thereby allowing the three transcription units to be introduced into the target vector at once.

[0052] In the manner described above, a larger number of Level 1 transcription units can be additionally introduced into the target vector, and thus multiple DNA fragments can be expressed at once in a single target vector.

[0053] In the present invention, a plurality of transcription units may each comprise a 5'-homologous terminal sequence, a gene construct, and a 3'-homologous terminal sequence, and the gene construct may comprise a promoter sequence, a base sequence encoding a target protein, and a terminator sequence. More specifically, the promoter sequence may be operably linked to the base sequence encoding the target protein in a sense orientation, and the terminator sequence may be operably linked to the base sequence encoding the target protein.

[0054] The above promoter may be used without restriction as long as it can mediate the expression of the target protein in the host cell. For example, the above promoter is TDH3 promoter, PGK1 promoter, HHF1 promoter, ALD6 promoter, RNR1 promoter, RNR2 promoter, xlnA promoter, xyn1 promoter, xyn2 promoter, xyn3 promoter, xyn4 promoter, bxl1 promoter, cbh1 promoter, cbh2 promoter, egl1 promoter, egl2 promoter, egl3 promoter, egl4 promoter, egl5 promoter, glaA promoter, agdA promoter, gpdA promoter, gpd1 promoter, AOX1 promoter, GAP1 promoter, MET3 promoter, ENO1 promoter, GPD1 promoter, PDC1 promoter, TEF1 promoter, AXE1 promoter, CIP1 promoter, The promoter may be one or more selected from the group consisting of the GH61 promoter, PKI1 promoter, RP2 promoter, ADH1 promoter, CUP1 promoter, GAL1 promoter, YPT1 promoter, LAC4 promoter, LAC4-PB1 promoter, FLD1 promoter, MOX promoter, DAS1 promoter, DAS2 promoter, GAP1 promoter, STR3 promoter, ADH3 promoter, GUT2 promoter, CYC1 promoter, PGL1 promoter, ADH2 promoter, HXT7 promoter, CLB1 promoter, and PHO5 promoter, and functional parts and combinations thereof; more specifically, the promoter may be the TDH3 promoter, PGK1 promoter, HHF1 promoter, ALD6 promoter, RNR1 promoter, RNR2 promoter, and functional parts and combinations thereof. It may be one or more selected from the military, but is not limited thereto.

[0055] In the present invention, the destination vector refers to a carrier into which level 1 transcription unit fragments containing a target gene can be introduced, and by including a homologous terminal sequence capable of homologous recombination with the level 1 transcription unit fragment, level 1 transcription unit fragments can be introduced through homologous recombination.

[0056] The above homologous recombination refers to a process in which homologous DNA sequences are recombined with each other upon DNA cleavage, and the homologous recombination of the present invention may refer to Transformation-Associated Recombination (TAR). The above TAR refers to a homologous recombination mechanism that occurs within yeast cells such as Saccharomyces cerevisiae, and unlike homologous recombination in E. coli, it has the advantage of being able to efficiently recombine even long DNA fragments.

[0057] In the present invention, the target vector may be prepared and purified using standard recombinant DNA technology. The type of the target vector is not particularly limited as long as it functions to express a desired gene and produce a desired protein in various host cells of prokaryotic and eukaryotic cells, but it may be a vector capable of producing the target protein in large quantities while possessing a promoter exhibiting potent activity and strong expression power, but is not limited thereto. For example, the target vector may be a vector composed of plasmids, cosmids, artificial chromosomes, liposomes, retroviruses, adenoviruses, adenovirus-associated virus (AAV), vaccinia viruses, herpes viruses, lentiviruses, or spumaviruses, but is not limited thereto. In the present invention, the target vector may be a long-chain DNA fragment that can be inserted into another genome, or it may be a chromosome within another cell.

[0058] In the present invention, the target vector may further include a promoter, a start codon, and a stop codon terminator. In addition, the vector may appropriately further include, but is not limited to, DNA encoding a signal peptide, an enhancer sequence, non-translating regions on the 5th and 3rd sides of the desired gene, a selection marker region, or a replicable unit.

[0059] In the present invention, the host cell can be used without limitation as long as it is a cell that can be transformed into a target gene using the vector.

[0060] For example, the host cell may be a microorganism, a prokaryote, or a eukaryote, specifically a fungus or a bacterium, and more specifically a fungus, but is not limited thereto.

[0061] In addition, the host cell in the present invention may have an intrinsic homologous recombination mechanism.

[0062] For example, the host cell may be yeast, specifically may be of the genus Saccharomyces, Pichia, or Yarrowia, and more specifically may be Saccharomyces cerevisiae, but is not limited thereto.

[0063] In one embodiment, the host cell may be yeast, and the transcription units of the present invention may undergo homologous recombination with the yeast chromosome, and the target vector may include a partial sequence of the yeast chromosome. In this case, the design may be such that homologous recombination with the transcription units occurs by deleting a portion of the yeast chromosome and introducing a 5'-homologous terminal sequence and a 3'-homologous terminal sequence.

[0064] The transcription units used in the present invention include homologous terminal sequences capable of homologous recombination by functioning as recombinant arms at both ends, so that multiple fragmented Level 1 transcription units can be produced in a single reaction without undergoing a separate bacterial cloning step, and then multiple Level 1 transcription units can be assembled using homologous recombination technology.

[0065] Therefore, the method of recombination of multiple DNA fragments according to the present invention may not perform a bacterial cloning step.

[0066] In the present invention, the target gene is a gene encoding an external product to be expressed, and may be a gene encoding any type of protein that can be expressed as a recombinant protein. For example, the target gene may be a gene encoding a protein involved in a natural metabolic process (biosynthetic pathway), and the biosynthetic product may be an organic acid, proteogenic and non-proteogenic amino acid, nucleotide, nucleoside, lipid, fatty acid, diol, carbohydrate, aromatic compound, vitamin, cofactor, protein, or enzyme, etc., and may be, for example, beta-carotene, retinol, xylose, etc., but is not limited to any substance that can be biosynthesized within a host cell.

[0067] In addition, the above-mentioned target gene may be a gene encoding any one or more proteins selected from the group consisting of interleukin, transcription factor, membrane protein, insulin, cytokinin, growth factor, toxin protein, hormone, hormone analog, cytokine, movement protein, lysozyme, vaccine, enzyme, enzyme inhibitor, transport protein, structural protein, receptor, receptor fragment, biological defense inducer, storage protein, reporter protein, antigen, antibody, and antibody fragment.

[0068] Meanwhile, through the DNA fragment recombination method of the present invention, a plurality of transcription units containing a target gene can be introduced into a host cell, and in this case, a target product encoded by the target gene can be efficiently produced using the host cell. The target product is a protein encoded by the nucleic acid fragment encoding the target gene, and may be any type of protein capable of being expressed as a recombinant protein, or may be a biosynthetic product produced by inducing a natural metabolic process (biosynthetic pathway) by the nucleic acid fragment encoding the target gene.

[0069] That is, through the DNA fragment recombination method of the present invention, multiple transcription units containing a target gene are introduced into a host cell, and since various genes can all be expressed within a single cell, the method of the present invention can effectively express and produce biosynthetic products produced by inducing a natural metabolic process (biosynthetic pathway) by a nucleic acid fragment encoding a target gene.

[0070]

[0071] 2. Composition for the recombination of multiple DNA fragments

[0072] In addition, another aspect of the present invention provides a composition for the recombination of multiple DNA fragments, in which the procedure is simplified compared to existing methods, while the assembly efficiency is significantly improved.

[0073] The duplicate description is the same as that described above in '1. Method for Recombination and Expression of Multiple DNA Fragments,' so it is omitted.

[0074] The composition for recombination of the plurality of DNA fragments comprises: a plurality of transcription units each having a 5'-homologous back sequence and a 3'-homologous end sequence; and a target vector; wherein the 5'-homologous end sequence of any one of the plurality of transcription units and the 3'-homologous end sequence of any other of the plurality of transcription units are capable of homologous recombination with the target vector, and each of the plurality of transcription units is capable of homologous recombination only with the 5'-homologous end sequence of any one of the transcription units.

[0075] In the composition for recombination of a plurality of DNA fragments according to the present invention, the transcription units may have a lower limit of 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, or 10 or more, and may have an upper limit of 30 or fewer, 25 or fewer, 20 or fewer, 15 or fewer, 10 or fewer, or 5 or fewer. For example, the transcription units of the present invention may be 2 to 30, 2 to 20, 2 to 15, or 2 to 10, and in particular may be 3 to 8, and for example, the transcription units may be 3, 5, or 8.

[0076] In the present invention, the transfer unit may be n, and the plurality of transfer units may include a first transfer unit to an nth transfer unit. The number n is the same as described above regarding the number of transfer units.

[0077] In one embodiment, when there are three transcription units (i.e., when n is 3), the plurality of transcription units may include a first transcription unit to a third transcription unit. In this case, the left homologous terminal sequence of the target vector may be capable of homologous recombination with the 5'-homologous terminal sequence of the first transcription unit, the 3'-homologous terminal sequence of the first transcription unit may be capable of homologous recombination only with the 5'-homologous terminal sequence of the second transcription unit, the 3'-homologous terminal sequence of the second transcription unit may be capable of homologous recombination only with the 5'-homologous terminal sequence of the third transcription unit, and the 3'-homologous terminal sequence of the third transcription unit may be capable of homologous recombination with the right homologous terminal sequence of the target vector, thereby allowing the three transcription units to be introduced into the target vector at once.

[0078] In the manner described above, a larger number of Level 1 transcription units can be additionally introduced into the target vector, and thus multiple DNA fragments can be expressed at once in a single target vector.

[0079] In the present invention, a plurality of transcription units may each include a 5'-homologous terminal sequence, a gene construct, and a 3'-homologous terminal sequence, and the gene construct may include a promoter sequence, a base sequence encoding a target protein, and a terminator sequence.

[0080]

[0081] The present invention will be explained in detail below through examples.

[0082] However, the following examples are intended to specifically illustrate the present invention, and the content of the present invention is not limited by the following examples.

[0083]

[0084] [Example 1]

[0085] Design and Verification of an Efficient Modular Multi-Assembly Platform

[0086] 1-1. Design of the platform of the present invention for multi-transfer unit assembly

[0087] In the present invention, an efficient modular multi-assembly platform (EffiModular) capable of constructing multiple transcription unit (TU) plasmids was designed by combining the precision of in vitro assembly with the efficiency of yeast in vivo recombination (Fig. 1). Meanwhile, the platform of the present invention was designed to maintain compatibility with existing toolkits such as the Yeast Modular Cloning (MoClo) kit and the Multiplex Yeast Toolkit (MYT).

[0088] First, a Level 1 transcription unit (TU) fragment (Left arm-Promoter-CDS-Terminator-Right arm) is assembled via Golden Gate Assembly (GGA) using a standardized Level 0 plasmid on the platform of the present invention (Fig. 1). To enable smooth multi-fragment assembly in yeast subsequently, short homologous sequences (hereinafter referred to as connectors) are present at the junctions corresponding to both ends of the fragments in the above step. These connectors function as recombination arms, allowing multiple TU fragments to be assembled precisely and sequentially through homologous recombination within yeast. In the case of the existing module cloning method using Golden Gate Assembly, there is a problem in that each Level 1 transcription unit must first be assembled and cloned into a plasmid, and then introduced into yeast only after undergoing bacterial transformation, colony selection, plasmid purification, and restriction enzyme cleavage steps (Fig. 2). On the other hand, the platform of the present invention enables direct transformation into yeast by assembling a Level 1 transcription unit into a linear fragment, thereby bypassing the bacterial cloning process.

[0089] Next, after the Level 1 TU fragments are prepared on the platform of the present invention, they are co-transformed into yeast with a linearized destination vector containing respective selection markers and replication origins for yeast (Saccharomyces cerevisiae) and bacteria (Escherichia coli). By homologous recombination within yeast, the fragments are assembled into a complete Level 2 plasmid containing a plurality of TUs.

[0090] 1-2. Verification of the Platform of the Present Invention: Assembly of the Beta-Carotene Metabolic Pathway

[0091] To verify the functionality and efficiency of the efficient modular multi-assembly platform of the present invention, the beta-carotene (β-carotene) biosynthetic pathway was used as a multi-gene assembly model (Fig. 3A). Beta-carotene is a carotenoid pigment whose biosynthetic pathway in the yeast Saccharomyces cerevisiae is well-identified, and it provides a visually traceable phenotype in the form of colony coloration, allowing for the rapid qualitative evaluation of the success of pathway reconstruction.

[0092] First, a Level 0 plasmid was generated, and a Level 1 transcription unit fragment was constructed using this via Golden Gate Assembly. Specifically, since the beta-carotene metabolic pathway consists of three essential genes, namely crtYB, crtI, and crtE, a Level 0 plasmid was generated by individually cloning each into a Level 0 entry vector. The Level 1 transcription unit fragments of each gene were constructed via Golden Gate Assembly, and connector sequences were introduced at both ends to facilitate subsequent homologous recombination.

[0093] To verify whether the Level 1 transcription unit fragment was accurately assembled from the Level 0 fragment, the reaction was compared based on the presence or absence of GGA reaction reagents (restriction enzymes and ligases) (Fig. 4A). As a result, in the presence of the GGA reaction reagents, Level 1 transcription unit fragments corresponding to crtYB, crtI, and crtE were successfully assembled and exhibited the expected band sizes. In contrast, in the absence of the GGA reaction reagents, only an unassembled Level 0 plasmid and a separated 338 bp connector sequence were identified. Next, to confirm the specificity of the assembly, PCR primers specific to the junction between the gene and the connector region were designed. As shown in Figs. 4B and 4C, transcription unit-specific bands were amplified only in GGA-positive samples, while only the connector region was detected in the negative control. These results confirmed that GGA with introduced connectors efficiently generates transcription unit fragments with defined structures and sizes.

[0094] Next, a Level 2 plasmid was constructed by transforming the above-described Level 1 transcription unit fragments into yeast. Specifically, the assembled Level 1 transcription unit fragments of crtYB, crtI, and crtE were co-transformed into the yeast Saccharomyces cerevisiae (S. cerevisiae) together with a linearized target vector having S and E homologous regions on both sides, and in vivo assembly was performed (Figs. 1 and 3B). By using the platform of the present invention, the above steps were performed without an intermediate purification process of the Level 1 transcription unit fragments or the target vector, thereby significantly simplifying the overall workflow.

[0095] Meanwhile, to optimize the efficiency of transformation into yeast, the molar ratio of the target vector to the level 1 transcription unit fragment was tested at 1:1, 1:2, and 1:4. As a result, the number of colonies and assembly efficiency improved as the ratio of the transcription unit fragment increased, reaching a maximum efficiency of about 90% at a ratio of 1:4 (Figs. 3C and 3D). This ratio was used in all subsequent examples.

[0096] To verify whether the Level 2 plasmid was correctly assembled from the Level 1 transcription unit fragment, sequencing analysis was performed on constructs produced from 12 randomly selected colonies. As a result, 10 were correctly assembled without mutations, but two were found to have substitution or deletion variations in the terminator region of the crtI transcription unit fragment, respectively (Table 1). Considering that both GGA and homologous recombination rely on predefined homologous regions, these sequence variations are believed to have originated from a mutated template within the partial plasmid stock rather than being errors caused during the assembly process.

[0097] Metabolic Pathway Plasmid Size No. Mutation Site Beta-carotene biosynthesis 12,802bp 1Perfect match-2Perfect match-3Perfect match-4Perfect match-5Perfect match-6Perfect match-75831C-TpYTK05685819△TTTTTGAATATACATAAATACTACCGTTTTTCTGCpYTK0569Perfect match-10Perfect match-11Perfect match-12Perfect match-Xylose utilization 11,818bp 1Perfect match-2Perfect match-3Perfect match-4Perfect match-5Perfect match-6Perfect match-7Perfect match-8Perfect match-9Perfect match-Retinol biosynthesis 16,908bp 18469*CrtETU 1 copypYTK0122Perfect match-3Perfect match-4Perfect match-5Perfect match-6Perfect match-7Perfect match-8Perfect match-9Perfect match-Xylose utilization and retinol biosynthesis (including yeast selection marker TU)24,315bp15966T-CpYTK0562Perfect match-3Perfect match-Xylose utilization and retinol biosynthesis (excluding yeast selection marker TU)24,157bp15849*TpYTK0562Perfect match-3Perfect match-

[0098] The functionality and efficiency of the platform designed in the present invention were verified through the above results. The modularized Level 1 transcription unit fragments in the platform of the present invention can be efficiently and accurately assembled into functional multiple gene constructs through homologous recombination in yeast. Since the platform of the present invention simultaneously achieves high assembly accuracy and simplicity of operation, it can be used as a platform for the rapid prototyping of biosynthetic metabolic pathways.

[0099]

[0100] [Example 2]

[0101] Expansion of the platform of the present invention: Assembly and verification of various metabolic pathways

[0102] To evaluate the scalability of the modular multi-assembly platform (EffiModular) of the present invention, multi-transcription unit plasmids were constructed for three representative biosynthetic pathways. Specifically, Level 2 plasmids were assembled containing 3, 5, and 8 transcription units corresponding to the xylose utilization pathway, the retinol biosynthetic pathway, and the combination pathway of these pathways, respectively (Fig. 5).

[0103] The first construct constitutes the xylose utilization pathway and includes three transcription units encoding XR, XDH, and XK (Fig. 7A). Thirty-one colonies were randomly selected from each of the three independent transformations, resulting in a total of 93 colonies selected by colony PCR (Fig. 6). The assembly efficiency, based on the proportion of colonies representing the expected size of the PCR product, was estimated to be approximately 80% (Fig. 7B). Functional verification results showed that the engineered strain consumed approximately 5 g / L of xylose when cultured with xylose as the sole carbon source and exhibited corresponding cell growth (Fig. 7C).

[0104] The second construct constitutes the retinol biosynthetic pathway and includes five transcription units comprising crtYB, crtI, crtE, BCMO, and RDH12 (Fig. 7D). The initial assembly efficiency was estimated by quantifying the number of pigmented colonies attributable to carotenoid accumulation, which showed an efficiency of approximately 60% (Fig. 7E). However, since the expression of crtYB, crtI, and crtE alone generates β-carotene and induces pigmentation (Figs. 8A to 8D), additional colony PCR was performed to confirm whether all five transcription units were fully assembled. Analysis using colonies possessing only the β-carotene biosynthetic pathway (i.e., colonies possessing only crtYB, crtI, and crtE) as a control verified that all pigmented colonies observed in the 5-transcription unit assembly possessed the complete retinol biosynthetic pathway (Fig. 8E). Additionally, functional analysis confirmed the production of retinoids in the engineered strain (Fig. 7F).

[0105] Next, as a third construct, a more complex construct consisting of eight transcription units integrating the xylose utilization pathway and the retinol biosynthesis pathway was assembled (Fig. 7G). Initially, compared to the assembly with fewer transcription units, the assembly efficiency decreased to about 50%, and the number of colonies also decreased significantly (Figs. 7B, 7E vs. Fig. 9C). This decrease was correlated with an increase in the number of transcription units, suggesting that efficiency decreases as complexity increases. In response to this, the inventors hypothesized that the occurrence of false-positive colonies due to non-homologous end joining (NHEJ) and the persistence of selection markers in empty vectors within the target vector contributed to the decrease in efficiency.

[0106] To address the problem of reduced efficiency in the third construct described above, the inventors redesigned the target vector by relocating the selection marker to one of the transcription unit fragments instead of the plasmid backbone. According to this design, only correctly assembled constructs contained both the origin of replication and the selection marker, thereby reducing background and improving assembly accuracy. As a result of using this modified system, the assembly efficiency of the 8-transcription unit construct increased to approximately 80% (Fig. 7H). Colony PCR analysis of 30 randomly selected colonies confirmed correct assembly in most cases (Fig. 10).

[0107] Analysis of the functional characteristics of the 8-transcription unit construct revealed successful xylose utilization and retinoid production (Fig. 7I). In particular, strains possessing the integrated xylose-retinol pathway showed slightly improved retinoid production compared to strains possessing only the 5-transcription unit retinol biosynthetic plasmid. This improvement is attributed to an increased supply of acetyl-CoA precursors derived from xylose catabolism (Figs. 7F, 7I, and 5).

[0108] Through the above results, it was verified that the platform designed in the present invention is a scalable platform capable of efficiently assembling complex multi-gene constructs applicable to various synthetic metabolic pathways.

[0109]

[0110] [Example 3]

[0111] High-throughput multiple gene assembly and metabolic flux optimization using the platform of the present invention

[0112] 3-1. Evaluation of Potential for High-Throughput Multiple Gene Assembly

[0113] The platform of the present invention is expected to be utilized more efficiently for multi-gene assembly in biofoundries, as it simplifies the process compared to the existing Golden Gate assembly method while offering superior assembly efficiency. Accordingly, an experiment was conducted to verify whether high-throughput multi-gene assembly is actually possible using the platform of the present invention.

[0114] Specifically, six promoters with different expression levels were used for the beta-carotene biosynthetic pathway genes CrtYB, CrtI, and CrtE, and the same promoter was not used for each gene, thereby producing Saccharomyces cerevisiae strains with a total of 120 different promoter combinations (Figs. 11A, 11B, Tables 2 and 3).

[0115] No.CrtYBCrtICrtENo.CrtYBCrtICrtE1(P) TDH3(P) PGK1(P) HHF131(P) PGK1(P) ALD6(P) RNR12(P) TDH3(P) PGK1(P) ALD632(P) PGK1(P) ALD6(P) RNR23(P) TDH3(P) PGK1(P) RNR133(P) PGK1(P) RNR1(P) TDH34(P) TDH3(P) PGK1(P) RNR234(P) PGK1(P) RNR1(P) HHF15(P) TDH3(P) HHF1(P) PGK135(P) PGK1(P) RNR1(P) ALD66(P) TDH3(P) HHF1(P) ALD636(P) PGK1(P) RNR1(P) RNR27(P) TDH3(P) HHF1(P) RNR137(P) PGK1(P) RNR2(P) TDH38(P) TDH3(P) HHF1(P) RNR238(P) PGK1(P) RNR2(P) HHF19(P) TDH3(P) ALD6(P) PGK139(P) PGK1(P) RNR2(P) ALD610(P) TDH3(P) ALD6(P) HHF140(P) PGK1(P) RNR2(P) RNR111(P) TDH3(P) ALD6(P) RNR141(P) HHF1(P) TDH3(P) PGK112(P) TDH3(P) ALD6(P) RNR242(P) HHF1(P) TDH3(P) ALD613(P) TDH3(P) RNR1(P) PGK143(P) HHF1(P) TDH3(P) RNR114(P) TDH3(P) RNR1(P) HHF144(P) HHF1(P) TDH3(P) RNR215(P) TDH3(P) RNR1(P) ALD645(P) HHF1(P) PGK1(P) TDH316(P) TDH3(P) RNR1(P) RNR246(P) HHF1(P) PGK1(P) ALD617(P) TDH3(P) RNR2(P) PGK147(P) HHF1(P) PGK1(P) RNR118(P) TDH3(P) RNR2(P) HHF148(P) HHF1(P) PGK1(P) RNR219(P) TDH3(P) RNR2(P) ALD649(P) HHF1(P)ALD6(P) TDH320(P) TDH3(P) RNR2(P) RNR150(P) HHF1(P) ALD6(P) PGK121(P) PGK1(P) TDH3(P) HHF151(P) HHF1(P) ALD6(P) RNR122(P) PGK1(P) TDH3(P) ALD652(P) HHF1(P) ALD6(P) RNR223(P) PGK1(P) TDH3(P) RNR153(P) HHF1(P) RNR1(P) TDH324(P) PGK1(P) TDH3(P) RNR254(P) HHF1(P) RNR1(P) PGK125(P) PGK1(P) HHF1(P) TDH355(P) HHF1(P) RNR1(P) ALD626(P) PGK1(P) HHF1(P) ALD656(P) HHF1(P) RNR1(P) RNR227(P) PGK1(P) HHF1(P) RNR157(P) HHF1(P) RNR2(P) TDH328(P) PGK1(P) HHF1(P) RNR258(P) HHF1(P) RNR2(P) PGK129(P) PGK1(P) ALD6(P) TDH359(P) HHF1(P) RNR2(P) ALD630(P) PGK1(P) ALD6(P) HHF160(P) HHF1(P) RNR2(P) RNR1

[0116] No.CrtYBCrtICrtENo.CrtYBCrtICrtE61(P) ALD6(P) TDH3(P) PGK191(P) RNR1(P) HHF1(P) ALD662(P) ALD6(P) TDH3(P) HHF192(P) RNR1(P) HHF1(P) RNR263(P) ALD6(P) TDH3(P) RNR193(P) RNR1(P) ALD6(P) TDH364(P) ALD6(P) TDH3(P) RNR294(P) RNR1(P) ALD6(P) PGK165(P) ALD6(P) PGK1(P) TDH395(P) RNR1(P) ALD6(P) HHF166(P) ALD6(P) PGK1(P) HHF196(P) RNR1(P) ALD6(P) RNR267(P) ALD6(P) PGK1(P) RNR197(P) RNR1(P) RNR2(P) TDH368(P) ALD6(P) PGK1(P) RNR298(P) RNR1(P) RNR2(P) PGK169(P) ALD6(P) HHF1(P) TDH399(P) RNR1(P) RNR2(P) HHF170(P) ALD6(P) HHF1(P) PGK1100(P) RNR1(P) RNR2(P) ALD671(P) ALD6(P) HHF1(P) RNR1101(P) RNR2(P) TDH3(P) PGK172(P) ALD6(P) HHF1(P) RNR2102(P) RNR2(P) TDH3(P) HHF173(P) ALD6(P) RNR1(P) TDH3103(P) RNR2(P) TDH3(P) ALD674(P) ALD6(P) RNR1(P) PGK1104(P) RNR2(P) TDH3(P) RNR175(P) ALD6(P) RNR1(P) HHF1105(P) RNR2(P) PGK1(P) TDH376(P) ALD6(P) RNR1(P) RNR2106(P) RNR2(P) PGK1(P) HHF177(P) ALD6(P) RNR2(P) TDH3107(P) RNR2(P) PGK1(P) ALD678(P) ALD6(P) RNR2(P) PGK1108(P) RNR2(P) PGK1(P) RNR179(P) ALD6(P) RNR2(P)HHF1109(P) RNR2(P) HHF1(P) TDH380(P) ALD6(P) RNR2(P) RNR1110(P) RNR2(P) HHF1(P) PGK181(P) RNR1(P) TDH3(P) PGK1111(P) RNR2(P) HHF1(P) ALD682(P) RNR1(P) TDH3(P) HHF1112(P) RNR2(P) HHF1(P) RNR183(P) RNR1(P) TDH3(P) ALD6113(P) RNR2(P) ALD6(P) TDH384(P) RNR1(P) TDH3(P) RNR2114(P) RNR2(P) ALD6(P) PGK185(P) RNR1(P) PGK1(P) TDH3115(P) RNR2(P) ALD6(P) HHF186(P) RNR1(P) PGK1(P) HHF1116(P) RNR2(P) ALD6(P) RNR187(P) RNR1(P) PGK1(P) ALD6117(P) RNR2(P) RNR1(P) TDH388(P) RNR1(P) PGK1(P) RNR2118(P) RNR2(P) RNR1(P) PGK189(P) RNR1(P) HHF1(P) TDH3119(P) RNR2(P) RNR1(P) HHF190(P) RNR1(P) HHF1(P) PGK1120(P) RNR2(P) RNR1(P) ALD6

[0117] Level 0 plasmids containing a promoter, a coding sequence (CDS), and a terminator were prepared using the Yeast Toolkit (YTK) or by direct synthesis. Subsequently, these parts and connector sequences were dispensed into a 96-well plate, and Level 1 transcription unit fragments were assembled using Golden Gate Assembly. Gel electrophoresis was then performed to confirm that the fragmented Level 1 transcription units for each gene were successfully assembled (Fig. 12, Tables 4 and 5).

[0118] Location 96-well Level 1 TU Fragment Volume (μL) Location 96-well Level 1 TU Fragment Volume (μL) 1A1(P) TDH3 - CrtYB5019C3(P) RNR1 - CrtYB502B1(P) TDH3 - CrtYB5020D3(P) RNR1 - CrtYB503C1(P) TDH3 - CrtYB5021E3(P) RNR2 - CrtYB504D1(P) TDH3 - CrtYB5022F3(P) RNR2 - CrtYB505E1(P) PGK1 - CrtYB5023G3(P) RNR2 - CrtYB506F1(P) PGK1 - CrtYB5024H3(P) RNR2 - CrtYB507G1(P) PGK1 - CrtYB5025A4(P) TDH3 - CrtI508H1(P) PGK1 - CrtYB5026B4(P) TDH3 - CrtI509A2(P) HHF1 - CrtYB5027C4(P) TDH3 - CrtI5010B2(P) HHF1 - CrtYB5028D4(P) TDH3 - CrtI5011C2(P) HHF1 - CrtYB5029E4(P) PGK1 - CrtI5012D2(P) HHF1 - CrtYB5030F4(P) PGK1 - CrtI5013E2(P) ALD6 - CrtYB5031G4(P) PGK1 - CrtI5014F2(P) ALD6 - CrtYB5032H4(P) PGK1 - CrtI5015G2(P) ALD6 - CrtYB5033A5(P) HHF1 - CrtI5016H2(P) ALD6 - CrtYB5034B5(P) HHF1 - CrtI5017A3(P) RNR1 - CrtYB5035C5(P) HHF1 - CrtI5018B3(P) RNR1 - CrtYB5036D5(P) HHF1 - CrtI50

[0119] 위치96well레벨 1 TU 단편부피(μL)위치96well레벨 1 TU 단편부피(μL)37E5(P) ALD6 - CrtI5055G7(P) PGK1 - CrtE5038F5(P) ALD6 - CrtI5056H7(P) PGK1 - CrtE5039G5(P) ALD6 - CrtI5057A8(P) HHF1 - CrtE5040H5(P) ALD6 - CrtI5058B8(P) HHF1 - CrtE5041A6(P) RNR1 - CrtI5059C8(P) HHF1 - CrtE5042B6(P) RNR1 - CrtI5060D8(P) HHF1 - CrtE5043C6(P) RNR1 - CrtI5061E8(P) ALD6 - CrtE5044D6(P) RNR1 - CrtI5062F8(P) ALD6 - CrtE5045E6(P) RNR2 - CrtI5063G8(P) ALD6 - CrtE5046F6(P) RNR2 - CrtI5064H8(P) ALD6 - CrtE5047G6(P) RNR2 - CrtI5065A9(P) RNR1 - CrtE5048H6(P) RNR2 - CrtI5066B9(P) RNR1 - CrtE5049A7(P) TDH3 - CrtE5067C9(P) RNR1 - CrtE5050B7(P) TDH3 - CrtE5068D9(P) RNR1 - CrtE5051C7(P) TDH3 - CrtE5069E9(P) RNR2 - CrtE5052D7(P) TDH3 - CrtE5070F9(P) RNR2 - CrtE5053E7(P) PGK1 - CrtE5071G9(P) RNR2 - CrtE5054F7(P) PGK1 - CrtE5072H9(P) RNR2 - CrtE50

[0120] Next, yeast transformation was performed to prepare a Level 2 plasmid by introducing fragmented Level 1 transcription units into a target vector. First, a linearized target vector was prepared for subsequent assembly. During the transformation step, a mapping file was generated to instruct a liquid handling robot to deliver the correct transcription unit fragments to each well of a 96-deep-well plate, ensuring that the specified promoter configuration of each strain was accurately implemented (Fig. 13). For example, strain 1 was designed so that crtYB, crtI, and crtE were controlled by the pTDH3, pPGK1, and pHHF1 promoters, respectively; to achieve this, Level 1 transcription unit fragments were taken from positions A1, E4, and A8 of the 96-well assembly plate and delivered to well A1 of the 96-deep-well plate.

[0121] After yeast transformation, all assembled strains were drop cultured on selective media. The resulting colonies displayed various colors ranging from yellow to deep red depending on the expression level of beta-carotene, indicating that the level of beta-carotene production varied depending on the promoter combination (Fig. 11C). Initially, no colonies were formed in three strains, but they were successfully recovered in the second transformation round (Fig. 14).

[0122] Through these results, it was confirmed that automated, high-throughput gene assembly is possible when the platform of the present invention is applied to a biofoundry environment. Therefore, the present invention is expected to be effectively utilized in the fields of synthetic biology and biofoundry, which require diverse and large quantities of gene cloning products.

[0123] 3-2. Assessment of Potential for Metabolic Flux Optimization: Evaluation of Beta-Carotene Production Levels and Promoter Impact

[0124] To determine whether the platform of the present invention can be utilized for metabolic flux optimization, the level of beta-carotene production was evaluated using 120 S. cerevisiae strains containing beta-carotene biosynthetic pathway genes with different promoter combinations constructed earlier.

[0125] Specifically, to evaluate beta-carotene production across the 120 S. cerevisiae strains, each mutant strain was cultured individually, and beta-carotene was subsequently extracted and quantified. The strains were ranked according to their beta-carotene titer, and representative colonies were spot-cultured on agar media to compare color intensity as a phenotypic indicator (Figs. 15A and 16).

[0126] To explore the correlation between promoter composition and beta-carotene production levels, the top 20 and bottom 20 strains were selected based on measured beta-carotene yields, and their promoter compositions were analyzed (Fig. 15B). As a result, it was found that most high-production strains possessed a strong promoter upstream of crtI, whereas most low-production strains showed that crtI was expressed by a weak promoter. This trend was observed even when crtYB and crtE were expressed by a strong promoter.

[0127] These results suggest that crtI expression plays a central role in pathway flux and beta-carotene production, which is consistent with previous reports identifying crtI as a major bottleneck gene in the carotenoid biosynthetic pathway.

[0128] Through the above results, it was confirmed that the platform of the present invention is effectively integrated with biofoundry workflows, enabling high-throughput systematic metabolic flux optimization. It was confirmed that the platform of the present invention can be effectively utilized as a scalable and modular platform capable of maximizing the production of target metabolites through combinatorial library construction and functional screening.

[0129]

[0130] [Example 4]

[0131] Intrachromosomal integration of genes using the platform of the present invention

[0132] Experiments were conducted to determine whether the platform of the present invention could be applied to genomic integration within yeast chromosomes, rather than to episome plasmids.

[0133] The β-carotene biosynthetic pathway was utilized as a model system, and the CRISPR-Cas9 cleavage system was applied to induce cleavage and integration of the target site. Connector sequences were used in the same manner as in the plasmid assembly step, and an integration vector was constructed and used instead of a destination vector.

[0134] The above integration vector was cleaved by restriction enzyme treatment to form an integration module (5′HA-S, E-Marker-3′HA) that induces insertion into a specific region within the chromosome (Fig. 17A). The chromosome integration efficiency obtained in the initial experiment was confirmed to be approximately 25%, which was determined to be due to the non-selective integration of the selection marker. Accordingly, to improve the integration efficiency, the position of the selection marker was changed to between the expression cassettes, and the sequence of the homologous arm was redesigned using 5′HA-R1 and L3-3′HA connectors. Following these structural improvements, it was confirmed that the integration efficiency improved to approximately 65% ​​(Figs. 17B and 17C).

[0135] Therefore, from the above results, it was proven that the platform of the present invention is applicable not only to assembly using plasmids but also to integration within chromosomes, and it was confirmed that structural design factors such as the position of the selected marker and the design of the homologous arm play an important role in optimizing integration efficiency.

[0136]

[0137] The following is a description of the experimental methods used in Examples 1 to 4 above.

[0138]

[0139] [Experimental Method]

[0140] 1. Strains and Media

[0141] The strains and plasmids used in the embodiments of the present invention are shown in Table 6. The E. coli DH5α strain was used for plasmid cloning. All cloning processes were performed by adding an appropriate antibiotic to lysogeny broth medium composed of 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L sodium chloride. In all embodiments, the Saccharomyces cerevisiae FY834 strain (MATα ura3-52 his3-△200 leu2-△1 lys2-△202 trp1-△63) was used as the yeast. For nonselective culture, YPD medium composed of 10 g / L yeast extract, 20 g / L peptone, and 20 g / L glucose was used. For plasmid selection, SC-Leu medium composed of 6.7 g / L amino acid-free yeast nitrogen base, 0.7 g / L DO supplement -LEU (Takara), and 20 g / L glucose was used. Additionally, for strains possessing plasmids containing XYL1, XYL2, and XYL3 genes, SCXyl-Leu medium composed of 6.7 g / L amino acid-free yeast nitrogen base, 0.7 g / L DO supplement -LEU (Takara), and 20 g / L xylose was used.

[0142] Strain name or plasmid name Genotype or description S. cerevisiae FY834 MATα his3△200 ura3-52 leu2△1 lys2△202 trp1△63 E. coli DH5αF - endA1 glnV44thi-1recA1 relA1 gyrA96 deoR nupG purB20 ϕ80dlacZ△M15 △(lacZYA-argF) U169, hsdR17(r K - m K+ ), l -pYTK-CrtYBCrtYB(Xanthophyllomyces dendrorhous)pYTK-CrtICrtI(Xanthophyllomyces dendrorhous)pYTK-CrtECrtE(Xanthophyllomyces dendrorhous)pYTK-XRXYL1(Scheffersomyces stipites)pYTK-XDHXYL2(Scheffersomyces stipites)pYTK-XKXYL3(Scheffersomyces stipites)pYTK-BCMOcoBlh(Marine bacterium 66A03)pYTK-RDH12RDH12(Human)pYTK001Part plasmid entry vectorpYTK002ConLS, Type 1pYTK003ConL1, Type 1pYTK004ConL2, Type 1pYTK005ConL3, Type 1pYTK006ConL4, Type 1pYTK007ConL5, Type 1pYTK008ConLS', Type 1pYTK009pTDH3, Type 2pYTK010pCCW12, Type 2pYTK011pPGK1, Type 2pYTK012pHHF2, Type 2pYTK013pTEF1, Type 2pYTK014pTEF2, Type 2pYTK015pHHF1, Type 2pYTK016pHTB2, Type 2pYTK018pALD6, Type 2pYTK021pRNR1, Type 2pYTK023pRNR2, Type 2pYTK036Cas9, Type 3pYTK047GFP dropout, Type 234pYTK048Spacer, Type 234pYTK050sgRNA dropout, Type 234pYTK053tADH1, Type 4pYTK054tPGK1, Type 4pYTK055tENO2, Type 4pYTK056tTDH1, Type 4pYTK067ConR1, Type 5pYTK068ConR2, Type 5pYTK069ConR3, Type 5pYTK070ConR4, Type 5pYTK071ConR5, Type 5pYTK072ConRE, Type5pYTK073ConRE', Type 5pYTK075LEU2, Type 6pYTK081CEN6 / ARS4, Type 7pYTK083AmpR-ColE1, Type 8pYTK086URA33' Homology, Type 7pYTK090KanR-ColE1, Type 8apYTK092URA35' Homology, Type 8bpYTK095AmpR-ColE1, Type 678pMYT025tTDH3, Type 4pMYT026tTEF1, Type 4pMYT027tTDH2, Type 4pMYT028tPDC1, Type 4pYTK-ConR6ConR6 from pMYT067pYTK-ConL6ConL6 from pMYT069pYTK-ConR7ConR7 from pMYT069pYTK-ConL7ConL7 from pMYT071pYTK-ConR8ConR8 from pMYT071pYTK-ConL8ConL8 from pMYT073Modified pYTK048Opposite orientation of the BsaI site in pYTK048.pConnector_LS-R1Template plasmid for constructing connector LS-R1pConnector_L1-R2Template plasmid for constructing connector L1-R2pConnector_L2-RETemplate plasmid for constructing connector L2-REpConnector_L2-R3Template plasmid for constructing connector L2-R3pConnector_L3-R4Template plasmid for constructing connector L3-R4pConnector_L4-RETemplate plasmid for constructing connector L4-REpConnector_L4-R5Template plasmid for constructing connector L4-R5pConnector_L5-R6Templateplasmid for constructing connector L5-R6pConnector_L6-R7Template plasmid for constructing connector L6-R7pConnector_L7-RETemplate plasmid for constructing connector L7-REpConnector_L7-R8Template plasmid for constructing connector L7-R8pConnector_L8-RETemplate plasmid for constructing connector L8-REpConnector_URA35' Homology-R1Template plasmid for constructing connectorURA35' Homology-R1pConnector_L3-URA33' HomologyTemplate plasmid for constructing connector L3-URA33' HomologyModified pYTK073Alteration of the right BsaI site of pYTK073 from 5'-TACA-3' to 5'-GAGT-3'Modified pYTK075Alteration of the BsaI sites in pYTK075 from 5'-TACA-3' (left) and 5'-GAGT-3' (right) to 5'-AACG-3' (left) and 5'-GCTG-3' (right), respectivelyDestination vectorLEU2marker, CEN6 / ARS4, NotI siteDestination vector without yeast selection markerCEN6 / ARS4, NotI sitepCas9pTDH3-Cas9-tTDH3, AmpR-ColE1psgRNA dropoutsgRNA dropout, AmpR-ColE1Level 2 destination vectorRFP dropout, KanR-ColE1pCas9-sgRNA dropoutCas9-sgRNAdropout, KanR-ColE1pCas9-sgRNA (URA3target)Cas9-sgRNA (URA3target), KanR-ColE1Integration vectorURA35' Homology, GFP dropout,URA33' Homology, KanR-ColE1, 4 NotI sites

[0143]

[0144] 2. 효모 형질전환

[0145] Yeast transformation was performed using dimethyl sulfoxide (DMSO). A single yeast colony was cultured overnight in YPD medium until saturation, then inoculated into 50 mL of fresh YPD medium diluted at a ratio of 1:100 (initial optical density at 600 nm [OD600] = approx. 0.15). Subsequently, the cells were cultured for 4–6 hours until the OD600 value reached approx. 0.8. The cells were harvested, washed once with half the volume of a LiOAc solution consisting of 0.1 M lithium acetate, 10 mM Tris-HCl (pH 8.0), and 1 mM EDTA, and then resuspended in 500 μL of the LiOAc solution. For transformation, 100 μL of the yeast suspension was dispensed into a 1.5 mL microtube. The transformation mixture contained Level 1 TU fragments, a destination vector, 10 μL of boiled salmon sperm DNA (Sigma), and 600 μL of PEG-LiOAc solution (50% PEG 3350 in LiOAc solution). The mixture was vortexed gently for 5 seconds and then reacted at 30°C for 30 minutes. Subsequently, 70 μL of DMSO (Sigma) was added and the solution was mixed by inversion, followed by heat shock treatment in a 42°C water bath for 15 minutes. Cells were centrifuged at 14,000 µg for 3–5 seconds to precipitate, resuspended in 100 μL of YPD medium, and plated on SC-Leu medium.

[0146]

[0147] 3. Fabrication of connectors

[0148] The primers used in the embodiments of the present invention are shown in Table 7. The connector was constructed using the yeast MoClo kit. The pYTK048 plasmid (Type 234) was modified by reversing the direction of the BsaI recognition sequence from inside to outside, and this was referred to as modified pYTK048. To construct the connector plasmid, a Golden Gate Assembly (GGA) was performed with the following composition: 1 μL of Type 1 part plasmid (e.g., ConLS), 1 μL of modified pYTK048 (Type 234), 1 μL of Type 5 part plasmid (e.g., ConR1), 1 μL of pYTK095 (Type 678), 0.5 μL of T4 DNA ligase (M0202, NEB), 1 μL of T4 DNA ligase buffer (NEB), 0.5 μL of BsaI-HFv2 (R3733, NEB), and the addition of nuclease-free water to make the final volume 10 μL. The reaction was carried out in a thermocycler for 25 cycles (42°C for 2 minutes, 16°C for 5 minutes), followed by final digestion at 60°C for 10 minutes and enzyme inactivation at 80°C for 10 minutes. The resulting connector plasmid was transformed into E. coli. After purifying the plasmid, primers were designed to surround the CON regions at both ends of the connector plasmid, and the connector was isolated through PCR amplification. Detailed information regarding the connector, connector plasmid, and primers used in the embodiments of the present invention is listed in Table 8.

[0149]

[0150] Connector Size (bp) Connector Plasmid Primer LS-R1 388pConnector_LS-R1ConLS_FWConR1_BWL1-R2 388pConnector_L1-R2ConL1_FWConR2_BWL2-RE388pConnector_L2-REConL2_FWConRE_BWL2-R3 388pConnector_L2-R3ConL2_FWConR3_BWL3-R4 388pConnector_L3-R4ConL3_FWConR4_BWL4-RE388pConnector_L4-REConL4_FWConRE_ BWL4-R5388pConnector_L4-R5ConL4_FWConR5_BWL5-R6377pConnector_L5-R6ConL5_FWConR6_BWL6-R7345pConnector_L6-R7ConL6_FWConR7_BWL7 -RE356pConnector_L7-REConL7_FWConRE_BWL7-R8345pConnector_L7-R8ConL7_FWConR8_BWL8-RE356pConnector_L8-REConL8_FWConRE_BWURA35' Homology-R1733pConnector_URA3 5' Homology-R1URA3_FWConR1_BWL3-URA33' Homology754pConnector_L3-URA3 3' HomologyConL3_FWURA3_BW

[0151] 4. Plasmid fabrication using the platform (EffiModular) of the present invention

[0152] The list of Level 0 parts, connectors, and destination vectors used in the embodiments of the present invention is listed in Table 9. First, Level 1 transcription unit fragments were prepared by assembling Level 0 fragments (promoter, CDS, terminator) and connectors via Golden Gate Assembly (GGA). All Level 0 part plasmids and connectors were stored at a concentration of 100 fmol, and a reaction solution was prepared by mixing 2 μL of each component, 0.5 μL of T4 DNA ligase (M0202, NEB), 1 μL of T4 DNA ligase buffer (NEB), and 0.5 μL of BsaI-HFv2 (R3733, NEB). The reaction was repeated in cycles of 5 minutes at 42°C and 5 minutes at 16°C, followed by final digestion at 60°C for 10 minutes and enzyme inactivation at 80°C for 10 minutes. The target vector was constructed by assembling the components of the yeast MoClo kit. The components used were pYTK008 (Type 1, ConLS'), pYTK047 (Type 234, GFP dropout), pYTK073 (Type 5, ConRE'), pYTK075 (Type 6, LEU2), pYTK081 (Type 7, CEN6 / ARS4), and pYTK083 (Type 8, AmpR-ColE1). NotI recognition sites were introduced on both sides of the GFP dropout to enable ligation with the Level 1 TU fragment. The target vector was stored at a concentration of 50 fmol and digested with NotI-HF (R3189L, NEB) in a 10 μL reaction (1 μL vector, 0.5 μL NotI-HF, 1 μL rCutSmart buffer, 7.5 μL sterile distilled water) at 37°C for 4.5 hours, followed by inactivation at 65°C for 30 minutes. Additionally, the BsaI cleavage site was modified to use a yeast selector as a level 1 TU fragment.For example, the BsaI cleavage site of pYTK075 (LEU2) was replaced with a Type 234 sequence. Similarly, to remove the selection marker from the target vector, the BsaI cleavage site of pYTK073 (ConRE) was replaced with a Type 56 sequence. After GGA and restriction enzyme reactions, all Level 1 TU fragments and target vectors were directly transformed into yeast without intermediate purification, and this was applied equally regardless of the number of Level 1 TUs.

[0153] Metabolic Pathway TU Level 0 Part (promoter, CDS, terminator) Connector Purpose Vector Beta-carotene Biosynthesis 1 pYTK010, pYTK-CrtYB, pYTK055 LS-R1 Purpose Vector 2 pYTK009, pYTK-CrtI, pYTK056 L1-R2 3 pYTK011, pYTK-CrtE, pYTK054 L2-RE Xylose Utilization 1 pYTK010, pYTK-XR, pYTK053 LS-R1 Purpose Vector 2 pYTK012, pYTK-XDH, pMYT027 L1-R2 3 pYTK013, pYTK-XK, pMYT028 L2-RE Retinol Biosynthesis 1 pYTK010, pYTK-CrtYB, pYTK055LS-R1 Objective Vector 2pYTK009, pYTK-CrtI, pYTK056L1-R2 3pYTK011, pYTK-CrtE, pYTK054L2-R3 4pYTK012, pYTK-RDH12, pMYT027L3-R4 5pYTK013, pYTK-BCMO, pMYT028L4-RExylose utilization and retinol biosynthesis (including yeast selection marker TU) 1pYTK010, pYTK-CrtYB, pYTK055LS-R1 Objective Vector (excluding yeast selection marker) 2pYTK009, pYTK-CrtI, pYTK056L1-R2 3pYTK011, pYTK-CrtE, pYTK054L2-R34Modified pYTK075L3-R45pYTK014, pYTK-XR, pYTK053L4-R56pYTK015, pYTK-XDH, pMYT025L5-R67pYTK016, pYTK-XK, pMYT026L6-R78pYTK012, pYTK-RDH12, pMYT027L7-R89pYTK013, pYTK-BCMO, pMYT028L8-RExylose utilization and retinol biosynthesis (yeast selection marker TU excluded)1pYTK010, pYTK-CrtYB, pYTK055LS-R1Objective vector2pYTK009, pYTK-CrtI, pYTK056L1-R23pYTK011, pYTK-CrtE, pYTK054L2-R34pYTK014, pYTK- XR, pYTK053L3-R45pYTK015, pYTK-XDH, pMYT025L4-R56pYTK016,pYTK-XK, pMYT026L5-R67pYTK012, pYTK-RDH12, pMYT027L6-R78pYTK013, pYTK-BCMO, pMYT028L7-RE,

[0154]

[0155] 5. Culture Conditions and Retinoid Quantification

[0156] Strains possessing the retinol biosynthetic pathway were first inoculated into 10 mL of SC-Leu medium supplemented with 2% (w / v) glucose in a 50 mL bioreactor and cultured at 30°C for 48 hours. For the main culture step, cells were inoculated into 50 mL of SC-Leu medium containing 2% (w / v) glucose in a 250 mL baffle flask, and after setting the initial OD600 value to 0.1, the cells were cultured at 30°C for 72 hours. For strains possessing the xylose reductase pathway, 2% (w / v) xylose was additionally added to the medium. To facilitate retinoid extraction, 10 mL of dodecane was overlaid on top of the culture medium during the main culture. Cell growth was monitored by measuring OD600 using a spectrophotometer (Ultrospec 8000; GE Healthcare, Uppsala, Sweden). After incubation, the dodecane layer was recovered, and the aqueous phase was separated to measure the concentrations of glucose, xylose, and ethanol. These metabolites were quantified using high-performance liquid chromatography (HPLC, 1200 series; Agilent Technologies, Santa Clara, CA, USA) equipped with a refractive index detector and an Aminex HPX-87H column (300 x 7.8 mm; Bio-Rad Laboratories). The column was eluted using 4 mM sulfuric acid (H2SO4) as the mobile phase at a flow rate of 0.5 mL / min and a temperature of 50°C. The retinoid content of the recovered dodecane phase was quantified using HPLC (Agilent 200 series) with a ZORBAX Eclipse Plus C18 column (4.6 x 150 mm, 3.5 μm particle size) at 30°C. The mobile phase was composed of 95% methanol and 5% acetonitrile and was supplied at a flow rate of 1 mL / min. Retinal (R2500; Sigma-Aldrich) and retinol (R7632; Sigma-Aldrich) were used as standards to construct a standard calibration curve.Both compounds were detected at 352 nm, and the retention times of retinol and retinal were approximately 2.58 minutes and 2.76 minutes, respectively.

[0157]

[0158] 6. Combination of promoters using biofoundry automation

[0159] 6-1. Preparation of Level 1 Warrior Unit Fragments

[0160] To construct a combinatorial promoter library for a total of 120 yeast strains, all components except the promoters, including CDS, terminators, connectors, and GGA mixtures, were pre-mixed. Promoter combinations for the crtYB, crtI, and crtE genes are listed in Tables 2 and 3. The mixed components were dispensed into 96-well plates using a JANUS liquid handler (PerkinElmer, Waltham, MA, USA). Subsequently, six different promoters were added to each well according to the designed combinations. After the GGA reaction, the generated Level 1 transcription unit fragments were transferred to 96-deep-well plates according to specific promoter combinations. Information on the Level 1 transcription unit fragments corresponding to each well is listed in Tables 4 and 5, and the ingestion and dispensing parameters of the Level 1 transcription unit fragments are shown in Figure 13.

[0161] 6-2. Semi-automated yeast transformation

[0162] In the embodiments of the present invention, yeast transformation was performed using a modified well-plate-based yeast transformation protocol. Specifically, competent yeast cells in a transformable state were prepared manually, and 10 μL of each level 1 transcription unit fragment, 10 μL of target vector, 5 μL of boiled salmon sperm DNA, and 600 μL of PEG-LiOAc solution were mixed with 100 μL of competent cells. The plates were incubated at 30°C for 30 minutes, after which 70 μL of DMSO was added and heat shock treatment was performed at 42°C for 15 minutes. Subsequently, the cells were centrifuged and resuspended in 100 μL of YPD, and 5 μL was spotted onto an SC-Leu plate.

[0163]

[0164] 7. Beta-carotene Extraction and Quantification

[0165] A total of 120 transgenic strains were inoculated with 500 μL of SC-Leu medium into each well of a 96-deep-well plate and cultured at 30°C for 24 hours. Subsequently, the 1% inoculum was subinoculated with 500 μL of fresh SC-Leu medium and cultured for an additional 72 hours. Beta-carotene extraction was performed according to the following procedure. Cells were centrifuged to precipitate, the supernatant was removed, and the cell pellets were freeze-dried. Each pellet was resuspended in 800 μL of DMSO and mixed at room temperature for 1 hour. Then, 800 μL of hexane was added and mixed vigorously. The hexane layer containing β-carotene was transferred to a new tube and evaporated at 40°C. The dried β-carotene extract was dissolved in 100 μL of acetone and quantitatively analyzed using HPLC (Agilent 200 series). Separation was performed at 30°C using a ZORBAX Eclipse Plus C18 column (4.6 x 150 mm, 3.5 μm). The mobile phase consisted of a mixture of methanol, acetonitrile, and dichloromethane in a ratio of 21:21:8 (v / v / v), and the flow rate was maintained at 1 mL / min.

[0166]

[0167] 8. Intrachromosomal integration of the platform (EfiiModular)-mediated gene of the present invention

[0168] 8-1. Construction of Cas9-sgRNA and Integrating Plasmid

[0169] Cas9-sgRNA and the integration plasmid were constructed using the yeast MoClo kit. The URA3 locus was selected as the integration target site. To construct the Cas9-sgRNA dropout plasmid, two Level 1 TU plasmids (Cas9 plasmid and sgRNA dropout plasmid) and one Level 2 destination vector were assembled. The Cas9 plasmid was assembled into GGA using pYTK002 (Type 1, ConLS), pYTK009 (Type 2, pTDH3), pYTK036 (Type 3, Cas9), pYTK056 (Type 4, tTDH3), pYTK067 (Type 5, ConR1), and pYTK095 (Type 678, AmpR-ColE1). The sgRNA dropout plasmids pYTK003 (Type 1, ConL1), pYTK050 (Type 234, sgRNA dropout), pYTK072 (Type 5, ConRE), and pYTK095 (Type 678, AmpR-ColE1) were assembled using the same method. The sgRNA dropout plasmids contain the GFP gene, while Type 678 contains only AmpR-ColE1. To facilitate the efficient selection of Cas9-sgRNA dropout plasmids, the RFP and KanR-ColE1 sequences were amplified by PCR and used to construct Level 2 target vectors. The final Level 2 target vector was assembled into a GGA using pYTK008 (Type 1, ConLS′), RFP PCR fragment (Type 234), pYTK073 (Type 5, ConRE′), and KanR-ColE1 PCR fragment (Type 678). Subsequently, the Cas9 plasmid, sgRNA dropout plasmid, and Level 2 target vector were combined into a BsmBI-based GGA to generate the Cas9-sgRNA dropout plasmid.The URA3 target spacer sequence (5′-TTGATTATGACACCCGGTGT-3′) was designed to include BsmBI recognition sequences at both ends and was assembled with a Cas9-sgRNA dropout plasmid and a BsmBI-based GGA to construct the final Cas9-sgRNA (URA3 target) plasmid. The integration vector was assembled with GGA using pYTK008 (Type 1, ConLS′), pYTK047 (Type 234, GFP dropout), pYTK073 (Type 5, ConRE′), pYTK086 (Type 7, URA3 3′ Homology), pYTK090 (Type 8a, KanR-ColE1), and pYTK092 (Type 8b, URA3 5′ Homology). The pYTK047 plasmid contains NotI recognition sites on both sides of the GFP sequence.

[0170] 8-2. Platform-mediated gene integration of the present invention

[0171] The assembly of Level 1 TU fragments was performed in the same manner as previously described. The integrated plasmid and Cas9-sgRNA plasmid were each prepared at a concentration of 50 fmol and cleaved using NotI-HF (R3189L, NEB) in 10 μL of reaction mixture (1 μL each plasmid, 0.5 μL NotI-HF, 1 μL rCutSmart buffer, 6.5 μL sterile distilled water) at 37°C for 4.5 hours. Subsequently, they were inactivated at 65°C for 30 minutes. The cleaved plasmids and Level 1 TU fragments were mixed without further purification and directly transformed into yeast.

[0172] 8-3. Platform-mediated gene integration of the present invention with relocated selection markers

[0173] To relocate the selection marker into the Level 1 TU fragment, a modified pYTK075 (LEU2) was used. Additionally, instead of using an integrated plasmid, two new connectors, "URA3 5′ Homology-R1" and "L3-URA3 3′ Homology", were constructed in the same manner as described above. Unlike the method of 8-2, the method of 8-3 did not use an integrated plasmid; therefore, only the Cas9-sgRNA plasmid was cleaved with NotI-HF and co-transformed into yeast along with the Level 1 TU fragments. The strain or plasmid information and primer information used in the methods of 8-1 to 8-3 are as described in Tables 6 to 8 above.

[0174]

[0175] Although representative embodiments of the present invention have been described above by way of example, the scope of the present invention is not limited to such specific embodiments, and those skilled in the art will be able to make appropriate modifications within the scope described in the claims of this application.

Claims

1. A plurality of transcription units comprising 5'-homologous terminal sequences and 3'-homologous terminal sequences; and a target vector; are introduced into a host cell, comprising the step of introducing these into a host cell, The 5'-homologous terminal sequence of any one of the plurality of transcription units and the 3'-homologous terminal sequence of any other of the plurality of transcription units are capable of homologous recombination with the target vector, and A method for recombining multiple DNA fragments, wherein each of the above multiple transcription units is capable of homologous recombination only with the 3'-homologous terminal sequence of one transcription unit and the 5'-homologous terminal sequence of another transcription unit.

2. In Claim 1, A method in which the plurality of warrior units are 2 to 30.

3. In Claim 1, A method in which the plurality of warrior units are 3 to 8.

4. In Claim 1, A method in which each of the plurality of transcription units comprises a 5'-homologous terminal sequence, a gene construct, and a 3'-homologous terminal sequence.

5. In Claim 4, A method in which the gene construct comprises a promoter sequence, a base sequence encoding a target protein, and a terminator sequence.

6. In Claim 1, The above-mentioned transfer unit is manufactured in the Golden Gate Assembly method.

7. In Claim 1, The above host cell is yeast, method.

8. In Claim 1, The above method is a method that does not perform a bacteria cloning step.

9. A transcription unit comprising a plurality of 5'-homologous terminal sequences and 3'-homologous terminal sequences; and a target vector; comprising, The 5'-homologous terminal sequence of any one of the plurality of transcription units and the 3'-homologous terminal sequence of any other of the plurality of transcription units are capable of homologous recombination with the target vector, and A composition for recombination of multiple DNA fragments, wherein each of the above-mentioned plurality of transcription units is capable of homologous recombination only with the 3'-homologous terminal sequence of one transcription unit and the 5'-homologous terminal sequence of another transcription unit.

10. In Claim 9, A composition in which the plurality of transfer units are 2 to 30.

11. In Claim 9, A composition in which the plurality of transfer units are 3 to 8.

12. In Claim 9, A composition in which each of the above plurality of transcription units comprises a 5'-homologous terminal sequence, a gene construct, and a 3'-homologous terminal sequence.

13. In Claim 9, A composition in which the gene construct comprises a promoter sequence, a base sequence encoding a target protein, and a terminator sequence.

Images