3' untranslated region sequences for extending messenger ribonucleic acids half-life

By integrating specific 3' UTR sequences and TENT recruiting sequences, mRNA stability and expression duration are improved, addressing the limitations of existing mRNA technologies in potency and durability.

WO2026085234A1PCT designated stage Publication Date: 2026-04-23MODERNATX INC
View PDF 47 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
MODERNATX INC
Filing Date
2025-10-15
Publication Date
2026-04-23

AI Technical Summary

Technical Problem

Existing mRNA technologies focus on optimal sequence design for the open reading frame (ORF) but fail to enhance potency and durability of mRNA expression by exploiting RNA biology.

Method used

Incorporation of a 3' UTR with specific nucleotide sequences, such as CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCGG (SEQ ID NO:91), and N1-methylpseudouracils, along with TENT recruiting sequences, to stabilize mRNA at the endoplasmic reticulum or mitochondria, and inclusion of miRNA binding sites to regulate expression.

Benefits of technology

Enhances the half-life and duration of mRNA expression, particularly for polypeptides translated at the endoplasmic reticulum or mitochondria, by stabilizing the mRNA and regulating its expression effectively.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025051094_23042026_PF_FP_ABST
    Figure US2025051094_23042026_PF_FP_ABST
Patent Text Reader

Abstract

The disclosure features a polynucleotide encoding a polypeptide, which polynucleotide comprises a 5' UTR, an open reading frame encoding the polypeptide, and a 3' UTR, as well as compositions containing the polynucleotide and a lipid nanoparticle. The polynucleotides and / or compositions of the present disclosure can increase and / or improve the expression of the polynucleotide encoding the polypeptide.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] 3’ UNTRANSLATED REGION SEQUENCES FOR EXTENDING MESSENGER RIBONUCLEIC ACIDS HALF-LIFE SEQUENCE LISTING The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on October 15, 2025, is named 45817- 0179WO1_SL.xml and is 232,415 bytes in size. CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Patent Application No.63 / 708,951, filed on October 18, 2024, the contents of which are hereby incorporated by reference. BACKGROUND Efforts to increase messenger ribonucleic acid (mRNA) potency have focused on mRNAs with optimal sequence design for the open reading frame (ORFs). However, there is a need to further improve potency and durability of mRNA expression by exploiting RNA biology. SUMMARY The present disclosure provides messenger RNA (mRNA) constructs comprising a TENT recruiting sequence for expression of polypeptides translated at the endoplasmic reticulum or mitochondria. Accordingly, provided herein are messenger RNAs (mRNAs) comprising a 5’ UTR, an open reading frame encoding a polypeptide, and a 3’ UTR, wherein the polypeptide is translated at the endoplasmic reticulum or mitochondria, wherein the 3’ UTR comprises a nucleotide sequence having at least 95% identity to the sequence of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), and wherein all of the uracils of the mRNA are N1- methylpseudouracils. In some embodiments, the 3’ UTR further comprises the sequence set forth in UAAAGCUCCCCGGGG (SEQ ID NO:300). In some embodiments, the sequence set forth in UAAAGCUCCCCGGGG (SEQ ID NO:300) is located at the 5’ end of the 3’ UTR immediately downstream of the last codon of the open reading frame. In some embodiments, the 3’ UTR comprises the nucleotide sequence set forth in UAAAGCUCCCCGGGGGCCUCCACCGCGUUAUCCGUUCCUCGUAGGCUGG UCCUGGGGAACGGGUCGGCGG (SEQ ID NO:212). In some embodiments, the 3’ UTR comprises the nucleotide sequence set forth in UAAAGCUCCCCGGGGGCCUCCACCGCGUUAUCCGUUCCUCGUAGGCUGG UCCUGGGGAACGGGUCGGCGGGUACCCCCGUGGUCUUUGAAUAAAGUC UGAGUGGGCGGC (SEQ ID NO:142). In some of any one of the above-described embodiments, the 3’ UTR comprises one or more miRNA binding sites (e.g., comprising one or more miRNA binding sites from Table 3). In some instances, the one or more miRNA binding sites comprise one or more miR122 binding sites, e.g., as set forth in CAAACACCAUUGUCACACUCCA (SEQ ID NO:148). In some instances, the one or more miRNA binding sites comprise one or more miR142 binding sites, e.g., as set forth in UCCAUAAAGUAGGAAACACUACA (SEQ ID NO:149). In some instances, the one or more miRNA binding sites comprise one or more miR150 binding sites, e.g., as set forth in CACUGGUACAAGGGUUGGGAGA SEQ ID NO:305). In some instances, each of the one or more miRNA binding sites is a miR142 binding site, e.g., as set forth in UCCAUAAAGUAGGAAACACUACA (SEQ ID NO:149). In some instances, the 3’ UTR comprises at least three copies of a miR142 binding site, e.g., as set forth in UCCAUAAAGUAGGAAACACUACA (SEQ ID NO:149). In some instances, the 3’ UTR comprises the nucleotide sequence set forth in UAAAGCUCCCCGGGGUCCAUAAAGUAGGAAACACUACAGCUGGA GCCUCCACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGU CGGCGGUCCAUAAAGUAGGAAACACUACAGUACCCCCUCCAUAAAGUA GGAAACACUACAGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO:160). In some of any one of the above-described embodiments, the 5’ UTR comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence selected from Table 1. In some of any one of the above-described embodiments, wherein the mRNA comprises a 5’ terminal cap. In some instances, the 5’ terminal cap comprises a m7GpppG2^OMe, m7G-ppp-Gm-A, m7G-ppp-Gm-AG, Cap0, Cap1, ARCA, inosine, N1-methyl-guanosine, 2’-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2- amino-guanosine, LNA-guanosine, 2-azidoguanosine, Cap2, Cap4, 5’ methylG cap, or an analog thereof. In some embodiments, the polypeptide is translated at the endoplasmic reticulum. In some embodiments, the polypeptide is translated at the mitochondria. In some embodiments, the polypeptide is GLA. In some embodiments, the polypeptide is hUGT1A1. In some embodiments, the polypeptide is G6PC. In some embodiments, the polypeptide is OTC. In some embodiments, the polypeptide is PCCA. In some embodiments, the polypeptide is PCCB. In some embodiments, the polypeptide is MUT. In some embodiments, the polypeptide is FECH. In some embodiments, the mRNA comprises a poly-A region. In some instances, the poly-A region is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90 nucleotides in length, or at least about 100 nucleotides in length. In some instances, the poly-A region has about 10 to about 200, about 20 to about 180, about 50 to about 160, about 70 to about 140, or about 80 to about 120 nucleotides in length. In some instances, the poly-A region is 100 nucleotides in length. In some instances, the poly-A region comprises A100-UCUAG-A20-inverted deoxy- thymidine (SEQ ID NO: 211). Also provided herein are compositions comprising any one of the above- described mRNAs and a lipid nanoparticle. In some embodiments of the described-herein compositions, the lipid nanoparticle comprises: (i) an ionizable lipid, (ii) a phospholipid, (iii) a structural lipid, and (iv) a PEG-lipid. In some embodiments of the described-herein compositions, the lipid nanoparticle comprises a compound of Formula (I): (I) or its N-oxide, or a salt or isomer thereof, wherein R’ais R’branched; wherein R’branchedis: ; wherein denotes a point of attachment; wherein Raα, Raβ, Raγ, and Raδare each independently selected from the group consisting of H, C2-12 alkyl, and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14alkyl and C2-14 alkenyl; R4is selected from the group consisting of -(CH2)nOH, wherein n is selected from the group consisting of 1, 2, 3, 4, and 5, and , wherein denotes a point of attachment; wherein R10is N(R)2; each R is independently selected from the group consisting of C1- 6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R5is independently selected from the group consisting of C1-3 alkyl, C2-3alkenyl, and H; each R6is independently selected from the group consisting of C1-3 alkyl, C2-3alkenyl, and H; M and M’ are each independently selected from the group consisting of - C(O)O- and -OC(O)-; R’ is a C1-12alkyl or C2-12alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13. In some embodiments of the described-herein compositions, the lipid nanoparticle comprises: (a) (i) Compound II, (ii) Cholesterol, and (iii) PEG-DMG or Compound I; (b) (i) Compound VI, (ii) Cholesterol, and (iii) PEG-DMG or Compound I; (c) (i) Compound II, (ii) DSPC or DOPE, (iii) Cholesterol, and (iv) PEG- DMG or Compound I; (d) (i) Compound VI, (ii) DSPC or DOPE, (iii) Cholesterol, and (iv) PEG- DMG or Compound I; (e) (i) Compound II, (ii) Cholesterol, and (iii) Compound I; (f) (i) Compound II, (ii) DSPC or DOPE, (iii) Cholesterol, and (iv) Compound I; (g) (i) Compound B, (ii) DSPC or DOPE, (iii) Cholesterol, and (iv) PEG- DMG or Compound I; (h) (i) Compound B, (ii) Cholesterol, and (iii) Compound I; or (i) (i) Compound B, (ii) DSPC or DOPE, (iii) Cholesterol, and (iv) Compound I. In some embodiments of the described-herein compositions, the lipid nanoparticle comprises Compound II and Compound I. In some embodiments of the described-herein compositions, the lipid nanoparticle comprises Compound II and PEG-DMG. In some embodiments of the described-herein compositions, the lipid nanoparticle comprises Compound II, DSPC, Cholesterol, and Compound I. In some embodiments of the described-herein compositions, the lipid nanoparticle comprises a molar ratio of about 20-60% ionizable lipid: 5-25% phospholipid: 25-55% cholesterol: and 0.5-15% PEG lipid. In some embodiments of the described-herein compositions, the composition is formulated for intravenous, subcutaneous, intramuscular, intranasal, intraocular, rectal, pulmonary or oral delivery. In some embodiments of the described-herein compositions, the composition comprises a first mRNA and a second mRNA, wherein the first mRNA is an mRNA of any one of claims 1 to 30 and comprises a first open reading frame encoding PCCA and wherein the second mRNA is an mRNA of any one of claims 1 to 30 and comprises a second open reading frame encoding PCCB. Also provided herein are methods of treating GSD1a in a human subject in need thereof, comprising administering to the human subject any one of the above- described mRNAs or any one of the above-described compositions, wherein the polypeptide is G6PC. Also provided herein are methods of treating propionic acidemia in a human subject in need thereof, comprising administering to the human subject any one of the above-described mRNAs or any one of the above-described compositions, wherein the polypeptide is PCCA. Also provided herein are methods of treating propionic acidemia in a human subject in need thereof, comprising administering to the human subject any one of the above-described mRNAs or any one of the above-described compositions, wherein the polypeptide is PCCB. Also provided herein are methods of treating propionic acidemia in a human subject in need thereof, comprising administering to the human subject (a) a first mRNA and a second mRNA, wherein the first mRNA is any one of the above- described mRNAs and comprises a first open reading frame encoding PCCA and wherein the second mRNA is any one of the above-described mRNAs and comprises a second open reading frame encoding PCCB, or (b) any one of the above-described compositions. Also provided herein are methods of treating methylmalonic acidemia in a human subject in need thereof, comprising administering to the human subject any one of the above-described mRNAs or any one of the above-described compositions, wherein the polypeptide is MUT. Also provided herein are methods of treating erythropoietic protoporphyria in a human subject in need thereof, comprising administering to the human subject any one of the above-described mRNAs or any one of the above-described compositions, wherein the polypeptide is FECH. Also provided herein are methods of increasing the half-life of a mRNA encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria, comprising administering to the human subject any one of the above- described mRNAs or any one of the above-described compositions. Also provided herein are methods of increasing duration of expression of a polypeptide that is translated at the endoplasmic reticulum or mitochondria, comprising administering to the human subject any one of the above-described mRNAs or any one of the above-described compositions. Also provided herein are methods method of expressing a polypeptide in a hepatic cell, comprising administering to the hepatic cell a messenger RNA (mRNA) comprising a 5’ UTR, an open reading frame encoding a polypeptide, and a 3’ UTR, wherein the 3’ UTR comprises a nucleotide sequence having at least 95% identity to the sequence of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), and wherein all of the uracils of the mRNA are N1- methylpseudouracils. In some embodiments, the 3’ UTR further comprises the sequence set forth in UAAAGCUCCCCGGGG (SEQ ID NO:300). In some embodiments, the sequence set forth in UAAAGCUCCCCGGGG (SEQ ID NO:300) is located at the 5’ end of the 3’ UTR immediately 3’ of the last codon of the open reading frame. In some embodiments of the methods described above, the 3’ UTR comprises the nucleotide sequence set forth in UAAAGCUCCCCGGGGGCCUCCACCGCGUUAUCCGUUCCUCGUAGGCUGG UCCUGGGGAACGGGUCGGCGG (SEQ ID NO:212). In some embodiments of the methods described above, the 3’ UTR comprises the nucleotide sequence set forth in UAAAGCUCCCCGGGGGCCUCCACCGCGUUAUCCGUUCCUCGUAGGCUGG UCCUGGGGAACGGGUCGGCGGGUACCCCCGUGGUCUUUGAAUAAAGUC UGAGUGGGCGGC (SEQ ID NO:142). In some embodiments of the methods described above, wherein the 3’ UTR comprises one or more miRNA binding sites (e.g., comprising one or more miRNA binding sites from Table 3). In some instances, the one or more miRNA binding sites comprise one or more miR142 binding sites, e.g., as set forth in UCCAUAAAGUAGGAAACACUACA SEQ ID NO:149). In some instances, the one or more miRNA binding sites comprise one or more miR122 binding sites, e.g., as set forth in CAAACACCAUUGUCACACUCCA (SEQ ID NO:148). In some instances, the one or more miRNA binding sites comprise one or more miR150 binding sites, e.g., as set forth in CACUGGUACAAGGGUUGGGAGA SEQ ID NO:305). In some instances, each of the one or more miRNA binding sites is a miR142 binding site, e.g., as set forth in UCCAUAAAGUAGGAAACACUACA SEQ ID NO:149). In some instances, the 3’ UTR comprises at least three copies of a miR142 binding site, e.g., as set forth in UCCAUAAAGUAGGAAACACUACA SEQ ID NO:149). In some instances, the 3’ UTR comprises the nucleotide sequence set forth in UAAAGCUCCCCGGGGUCCAUAAAGUAGGAAACACUACAGCUGGA GCCUCCACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGU CGGCGGUCCAUAAAGUAGGAAACACUACAGUACCCCCUCCAUAAAGUA GGAAACACUACAGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 160). In some embodiments of the methods described above, the 5’ UTR comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence selected from Table 1. In some embodiments of the methods described above, the mRNA comprises a 5’ terminal cap. In some instances, the 5’ terminal cap comprises a m7GpppG2^OMe, m7G-ppp-Gm-A, m7G-ppp-Gm-AG, Cap0, Cap1, ARCA, inosine, N1-methyl- guanosine, 2’-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino- guanosine, LNA-guanosine, 2-azidoguanosine, Cap2, Cap4, 5’ methylG cap, or an analog thereof. Also provided herein are messenger RNAs (mRNAs) comprising a 5’ UTR, an open reading frame encoding a FECH polypeptide (SEQ ID NO:235), and a 3’ UTR, wherein the open reading frame has at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:174. BRIEF DESCRIPTION OF THE DRAWINGS FIG.1A is a schematic showing that degradation of mRNA is triggered by the deadenylation of the poly-A tail by an mRNA deadenylase complex. Figure 1A discloses SEQ ID NOS 311-312, respectively, in order of appearance. FIG.1B is a schematic showing inclusion of inverted deoxythymidine (idT) at the 3’ end of an mRNA’s poly-A tail can help prevent deadenylation. FIG.1C is a schematic showing that inclusion of a TENT recruiting sequence (such as the one from HCMV), recruits TENT4A or TENT4B to stabilize mRNA by adding untemplated nucleotides to the 3’end of RNA poly(A) tails. FIG.2 is a graph showing levels of serum Epo at the indicated times after administration of the indicated mRNAs. FIG.3A is a bar graph showing levels of FECH at the indicated times after administration of the indicated mRNAs. FIG.3B is a graph showing levels of serum Phe at the indicated times after administration of the indicated mRNAs. FIG.4 is a schematic of the study design described in Example 3. FIG.5 are degradation graphs showing RNA expression in mouse liver over time of the noted targets after administration of the indicated mRNAs. FIG.6A is a schematic of the study design described in Example 4. FIG.6B is a line graph showing that the presence of the HCMV TENT recruiting sequence stabilized G6PC mRNA similar to idT. FIG.6C are images of western blots showing that the presence of the HCMV TENT recruiting sequence resulted in higher expression of G6PC (bar graph on bottom of FIG.6C is a graphical representation of the images on the top of the figure). FIG.7A is a schematic of the study design described in Example 5. FIG.7B are bar graphs showing that repeat dosing of G6PC constructs containing an HCMV TENT recruiting sequence stabilized G6PC mRNA similar to idT. At each timepoint in each graph, the mRNA constructs included in the 3’ UTR: standard 3’ UTR (leftmost bar), standard 3’ UTR in addition to idT (center bar), or standard 3’ UTR in addition to an HCMV TENT recruiting sequence (rightmost bar). FIG.8 is a bar graph showing the effect of the HCMV TENT recruiting sequence on DHCR7 expression in the liver. At each timepoint, the DHCR7 mRNA constructs included in the 3’ UTR: standard 3’ UTR (leftmost bar), standard 3’ UTR in addition to idT (bar second from left), or standard 3’ UTR in addition to an HCMV TENT recruiting sequence (bar second from right). The Green Lantern control is depicted in the rightmost bar. FIG.9A is a bar graph showing presence of the HCMV TENT recruiting sequence does not work in primary human monocytes. FIG.9B is a line graph showing that when an HCMV TENT recruiting sequence is combined with miR142, the combination shows a same level of knockdown as standard 3x miR142 UTR in a cell type that contains miR142. FIG.9C is a graph showing that when an HCMV TENT recruiting sequence is combined with miR142, the combination shows a same level of knockdown as standard 3x miR142 UTR in vivo. FIG.10 are bar graphs showing the effects of an HCMV TENT recruiting sequence in combination with miR142 on expression of the MSUD proteins E1a, E1b, and E2. In each graph, the mRNA constructs included in the 3’ UTR: 3x miR142 (leftmost bar), 3x miR142 in addition to idT (center bar), or an HCMV TENT recruiting sequence in addition to 3x miR142 (rightmost bar). DETAILED DESCRIPTION As shown in FIG.1A, degradation of mRNA is triggered by the deadenylation of the poly-A tail by an mRNA deadenylase complex. Inclusion of inverted deoxythymidine (idT) at the 3’ end of an mRNA’s poly-A tail can help prevent deadenylation (FIG.1B). Similarly, inclusion of a TENT recruiting sequence can stabilize mRNA by adding untemplated nucleotides to the 3’end of RNA poly(A) tails (FIG.1C). This increases the overall stability of the mRNA, thus increasing the half- life of the mRNA and increasing expression of the encoded polypeptide. As described in the Examples, inclusion of a TENT recruiting sequence in the 3’ UTR of mRNAs was as effective as idT for stabilizing mRNAs encoding polypeptides that are translated at the endoplasmic reticulum or mitochondria, while inclusion of the TENT recruiting sequence did not show a benefit for mRNAs encoding polypeptides that are translated in the cytoplasm. Accordingly, provided herein are mRNAs comprising TENT recruiting sequences for the expression of polypeptides translated at the endoplasmic reticulum or mitochondria. Polynucleotides and Open Reading Frames (ORFs) In some embodiments, the polynucleotide is a mRNA comprising a 5’ UTR, an open reading frame encoding a polypeptide, and a 3’ UTR, wherein the polypeptide is translated at the endoplasmic reticulum or mitochondria (e.g., any of the polypeptides described herein such as a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide), wherein the 3’ UTR comprises a nucleotide sequence having at least 95% identity (e.g., at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, 100% identity) to the sequence of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), and wherein all of the uracils of the mRNA are N1- methylpseudouracils. In some embodiments, the polynucleotide is a mRNA comprising a 5’ UTR, an open reading frame encoding a polypeptide, and a 3’ UTR, wherein the polypeptide is translated at the endoplasmic reticulum or mitochondria (e.g., any of the polypeptides described herein such as a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide), wherein the 3’ UTR comprises the nucleotide sequence of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), and wherein all of the uracils of the mRNA are N1- methylpseudouracils. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a nucleotide sequence (e.g., an ORF) encoding a GLA polypeptide (e.g., SEQ ID NO:226), wherein the nucleotide sequence has at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:167. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a nucleotide sequence (e.g., an ORF) encoding a hUGT1A1 polypeptide (e.g., SEQ ID NO:227), wherein the nucleotide sequence has at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:168. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a nucleotide sequence (e.g., an ORF) encoding a G6PC polypeptide (e.g., SEQ ID NO:228), wherein the nucleotide sequence has at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:169. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a nucleotide sequence (e.g., an ORF) encoding a G6PC polypeptide (e.g., SEQ ID NO:230), wherein the nucleotide sequence has at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:229. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a nucleotide sequence (e.g., an ORF) encoding a OTC polypeptide (e.g., SEQ ID NO:231), wherein the nucleotide sequence has at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:170. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a nucleotide sequence (e.g., an ORF) encoding a PCCA polypeptide (e.g., SEQ ID NO:232), wherein the nucleotide sequence has at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:171. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a nucleotide sequence (e.g., an ORF) encoding a PCCB polypeptide (e.g., SEQ ID NO:233), wherein the nucleotide sequence has at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:172. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a nucleotide sequence (e.g., an ORF) encoding a MUT polypeptide (e.g., SEQ ID NO:234), wherein the nucleotide sequence has at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:173. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a nucleotide sequence (e.g., an ORF) encoding a FECH polypeptide (e.g., SEQ ID NO:235), wherein the nucleotide sequence has at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:174. In some embodiments, any of the polynucleotides described herein (e.g., a RNA, e.g., an mRNA) comprises a nucleotide sequence (e.g., an ORF) further comprises a 5′-UTR (e.g., as described herein) and a 3′-UTR (e.g., as described herein). In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a sequence selected from SEQ ID NO:167, SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:170, SEQ ID NO:171, SEQ ID NO:172, SEQ ID NO:173, and SEQ ID NO:174. In a further embodiment, the polynucleotide (e.g., a RNA, e.g., an mRNA) comprises a 5′ terminal cap (e.g., m7G-ppp-Gm-AG, Cap0, Cap1, ARCA, inosine, N1-methyl-guanosine, 2′-fluoro-guanosine, 7-deaza- guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azidoguanosine, Cap2, Cap4, 5′ methylG cap, or an analog thereof) and a poly-A-tail region (e.g., about 100 nucleotides in length). In some embodiments, the mRNA comprises a polyA tail. In some instances, the poly A tail is 50-150 (e.g, as set forth in SEQ ID NO:197), 75-150 (e.g, as set forth in SEQ ID NO:198), 85-150 (e.g, as set forth in SEQ ID NO:199), 90-120 (e.g, as set forth in SEQ ID NO:193), 90-130 (e.g, as set forth in SEQ ID NO:194), or 90-150 (e.g, as set forth in SEQ ID NO:192) nucleotides in length. In some instances, the poly A tail is 100 nucleotides in length (e.g, as set forth in SEQ ID NO:195). In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) comprises a nucleotide sequence (e.g., an ORF) encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria (e.g., a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide). In some embodiments, the polynucleotide of the invention is single stranded or double stranded. GLA lApha-galactosidase A (GLA) is an enzyme that is active in lysosomes, which are structures that act as recycling centers within cells. Lysosomes use digestive enzymes to process worn-out cell components and recycle usable parts. Alpha- galactosidase A breaks down a molecule called globotriaosylceramide, which consists of three sugars attached to a fatty substance. This molecule is degraded as part of the normal recycling of old red blood cells (erythrocytes) and other types of cells. Mutations in the GLA gene have been identified in people with Fabry disease. Alterations in the GLA gene produce an abnormal version of the enzyme that is unable to break down globotriaosylceramide effectively. As a result, this substance builds up in the body's cells, particularly cells lining blood vessels in the skin and cells in the kidneys, heart, and nervous system. The progressive accumulation of globotriaosylceramide damages these cells, leading to the varied signs and symptoms of Fabry disease. hUGT1A1 Human UDP-glucuronosyltransferase family 1-member A1 (hUGT1A1) is one of the most essential enzymes responsible for the biotransformation and detoxification of the endogenous toxins (e.g., bilirubin), and for the metabolic elimination of numerous therapeutic and diet-derived xenobiotics. In adults, hUGT1A1 is predominantly expressed in the liver, while the conjugative enzyme is also distributed in the small intestine and kidney with relatively abundant levels. Increasing evidence has illustrated that dysfunction or potent inhibition of hepatic UGT1A1 may trigger metabolic disorder of bilirubin, resulting in varying degrees of hyperbilirubinemia, liver disorders, and even death. Furthermore, partial or complete loss of hepatic and intestinal UGT1A1 activity may affect the pharmacokinetic behaviors of the UGT1A1-substrate drugs, which in turn, enhance the in vivo effects of UGT1A1- substrate drugs or show clinically relevant drug / herb-drug interactions (DDI / HDI). Crigler-Najjar syndrome type 1 (CN1) is an autosomal recessive disease caused by a marked decrease in uridine-diphosphate-glucuronosyltransferase (UGT1A1) enzyme activity. G6PC Glucose 6-phosphatase (G6PC) is an enzyme found on the membrane of the endoplasmic reticulum, which is a structure inside cells that is involved in protein processing and transport. Glucose 6-phosphatase works together with the glucose 6- phosphate translocase protein (produced from the SLC37A4 gene) to break down a type of sugar molecule called glucose 6-phosphate. The breakdown of this molecule produces the simple sugar glucose, which is the primary source of energy for most cells in the body. The glucose 6-phosphatase enzyme is expressed (active) in the liver, kidneys, and intestines, and is the main regulator of glucose production in the liver. Alteration is in G6PC production or activity can cause glycogen storage disease type Ia (GSDIa). OTC Ornithine transcarbamylase (OTC) is an enzyme that participates in the urea cycle, a series of reactions that occurs in liver cells. The urea cycle processes excess nitrogen, generated when protein is used by the body, into a compound called urea that is excreted by the kidneys. Excreting the excess nitrogen prevents it from accumulating in the form of ammonia, which is toxic, especially to the nervous system. The specific role of the ornithine transcarbamylase enzyme is to control the reaction in which two compounds, carbamoyl phosphate and ornithine, form a new compound called citrulline. More than 500 OTC gene mutations have been identified in people with ornithine transcarbamylase deficiency, an inherited disorder that causes ammonia to accumulate in the blood. Ammonia, which is formed when proteins are broken down in the body, is toxic if the levels become too high. The nervous system is especially sensitive to the effects of excess ammonia. Alterations in OTC production or activity can cause ornithine transcarbamylase deficiency. PCCA and PCCB Propionyl-CoA carboxylase (PCC) is an enzyme created by six alpha subunits (produced from the PCCA gene) coming together with six beta subunits (produced from the PCCB gene). Propionyl-CoA carboxylase plays a role in the normal processing of proteins. It carries out a particular step in the breakdown of several protein building blocks (amino acids) called isoleucine, methionine, threonine, and valine. Propionyl-CoA carboxylase also helps break down certain types of lipids (fats) and cholesterol. First, several chemical reactions convert the amino acids, lipids, or cholesterol to a molecule called propionyl-CoA. Using the B vitamin biotin, propionyl-CoA carboxylase then converts propionyl-CoA to a molecule called methylmalonyl-CoA. Additional enzymes break down methylmalonyl-CoA into other molecules that are used for energy. Propionic acidemia, a condition that causes severe health problems appearing shortly after birth, can result from mutations in the PCCA or PCCB gene. Propionic acidemia results when the production of functional propionyl-CoA carboxylase is reduced or when there is a reduction in the enzyme's activity. MUT Methylmalonyl CoA mutase (MUT) is an enzyme that is active in mitochondria. Methylmalonyl CoA mutase is responsible for a particular step in the breakdown of several protein building blocks (amino acids), specifically isoleucine, methionine, threonine, and valine. The enzyme also helps break down certain types of fats (lipids) and cholesterol. First, several chemical reactions convert the amino acids, lipids, or cholesterol to a molecule called methylmalonyl CoA. Then, working with a compound called adenosylcobalamin (AdoCbl), which is a form of vitamin B12, methylmalonyl CoA mutase converts methylmalonyl CoA to a compound called succinyl-CoA. Other enzymes break down succinyl-CoA into molecules that are later used for energy. Alterations in MUT production or activity can result in methylmalonic acidemia. FECH Ferrochelatase (FECH) is an enzyme that is involved in the production of heme. The production of heme is a multi-step process that requires eight different enzymes. Ferrochelatase is responsible for the eighth and final step in this process, in which an iron atom is inserted into the center of protoporphyrin IX (the product of the seventh step) to form heme. Alterations in FECH production or activity can result in porphyria (e.g., erythropoietic protoporphyria). In some embodiments, the polynucleotide of the invention comprises a nucleotide sequence (e.g., an ORF) encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria (e.g., a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide). In some embodiments, the polynucleotide of the invention is DNA or RNA. In some embodiments, the polynucleotide of the invention is RNA. In some embodiments, the polynucleotide of the invention is, or functions as, an mRNA. In some embodiments, the mRNA comprises a nucleotide sequence (e.g., an ORF) that encodes at least one polypeptide that is translated at the endoplasmic reticulum or mitochondria (e.g., a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide), and is capable of being translated to produce the encoded polypeptide in vitro, in vivo, in situ or ex vivo. In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) comprises a sequence-optimized nucleotide sequence (e.g., an ORF) encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria (e.g., a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide), wherein the polynucleotide comprises at least one chemically modified nucleobase, e.g., N1-methylpseudouracil or 5-methoxyuracil. In certain embodiments, all uracils in the polynucleotide are N1-methylpseudouracils. In some embodiments, the polynucleotide (e.g., a RNA, e.g., a mRNA) disclosed herein is formulated with a delivery agent comprising, e.g., a compound having the Formula (I), e.g., Compound II or Compound A; a compound having the Formula (III), (IV), (V), or (VI), e.g., Compound VI or Compound I, or any combination thereof. In some embodiments, the delivery agent comprises an ionizable amino lipid (e.g., Compound II, VI, or A), a helper lipid (e.g., DSPC), a sterol (e.g., Cholesterol), and a PEG lipid (e.g., Compound I or PEG-DMG), e.g., with a mole ratio in the range of about (i) 40-50 mol% ionizable amino lipid (e.g., Compound II, VI, or A), optionally 45-50 mol% ionizable amino lipid, for example, 45-46 mol%, 46-47 mol%, 47-48 mol%, 48-49 mol%, or 49-50 mol% for example about 45 mol%, 45.5 mol%, 46 mol%, 46.5 mol%, 47 mol%, 47.5 mol%, 48 mol%, 48.5 mol%, 49 mol%, or 49.5 mol%; (ii) 30-45 mol% sterol (e.g., cholesterol), optionally 35-42 mol% sterol, for example, 30-31 mol%, 31-32 mol%, 32-33 mol%, 33-34 mol%, 35-35 mol%, 35-36 mol%, 36-37 mol%, 37-38 mol%, 38-39 mol%, or 39-40 mol%, or 40-42 mol% sterol; (iii) 5-15 mol% helper lipid (e.g., DSPC), optionally 10-15 mol% helper lipid, for example, 5-6 mol%, 6-7 mol%, 7-8 mol%, 8- 9 mol%, 9-10 mol%, 10-11 mol%, 11-12 mol%, 12-13 mol%, 13-14 mol%, or 14-15 mol% helper lipid; and (iv) 1-5% PEG lipid (e.g., Compound I or PEG-DMG), optionally 1-5 mol% PEG lipid, for example 1.5 to 2.5 mol%, 1-2 mol%, 2-3 mol%, 3-4 mol%, or 4-5 mol% PEG lipid. Signal Sequences The polynucleotides (e.g., a RNA, e.g., an mRNA) of the invention can also comprise nucleotide sequences that encode additional features that facilitate trafficking of the encoded polypeptides to therapeutically relevant sites. One such feature that aids in protein trafficking is the signal sequence, or targeting sequence. The peptides encoded by these signal sequences are known by a variety of names, including targeting peptides, transit peptides, and signal peptides. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) comprises a nucleotide sequence (e.g., an ORF) that encodes a signal peptide operably linked to a nucleotide sequence that encodes a polypeptide described herein. In some embodiments, the "signal sequence" or "signal peptide" is a polynucleotide or polypeptide, respectively, which is from about 30-210, e.g., about 45-80 or 15-60 nucleotides (e.g., about 20, 30, 40, 50, 60, or 70 amino acids) in length that, optionally, is incorporated at the 5′ (or N-terminus) of the coding region or the polypeptide, respectively. Addition of these sequences results in trafficking the encoded polypeptide to a desired site, such as the endoplasmic reticulum or the mitochondria through one or more targeting pathways. Some signal peptides are cleaved from the protein, for example by a signal peptidase after the proteins are transported to the desired site. In some embodiments, the polynucleotide of the invention comprises a nucleotide sequence encoding a polypeptide, wherein the nucleotide sequence further comprises a 5′ nucleic acid sequence encoding a heterologous signal peptide. Fusion Proteins In some embodiments, the polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) can comprise more than one nucleic acid sequence (e.g., an ORF) encoding a polypeptide of interest. In some embodiments, polynucleotides of the invention comprise a single ORF encoding a GLA polypeptide, a functional fragment, or a variant thereof. However, in some embodiments, the polynucleotide of the invention can comprise more than one ORF, for example, a first ORF encoding (i) a GLA (a first polypeptide of interest), a functional fragment, or a variant thereof, and (ii) a second ORF expressing a second polypeptide of interest. In some embodiments, polynucleotides of the invention comprise a single ORF encoding a hUGT1A1 polypeptide, a functional fragment, or a variant thereof. However, in some embodiments, the polynucleotide of the invention can comprise more than one ORF, for example, a first ORF encoding (i) a hUGT1A1 (a first polypeptide of interest), a functional fragment, or a variant thereof, and (ii) a second ORF expressing a second polypeptide of interest. In some embodiments, polynucleotides of the invention comprise a single ORF encoding a G6PC polypeptide, a functional fragment, or a variant thereof. However, in some embodiments, the polynucleotide of the invention can comprise more than one ORF, for example, a first ORF encoding (i) a G6PC (a first polypeptide of interest), a functional fragment, or a variant thereof, and (ii) a second ORF expressing a second polypeptide of interest. In some embodiments, polynucleotides of the invention comprise a single ORF encoding a OTC polypeptide, a functional fragment, or a variant thereof. However, in some embodiments, the polynucleotide of the invention can comprise more than one ORF, for example, a first ORF encoding (i) a OTC (a first polypeptide of interest), a functional fragment, or a variant thereof, and (ii) a second ORF expressing a second polypeptide of interest. In some embodiments, polynucleotides of the invention comprise a single ORF encoding a PCCA polypeptide, a functional fragment, or a variant thereof. However, in some embodiments, the polynucleotide of the invention can comprise more than one ORF, for example, a first ORF encoding (i) a PCCA (a first polypeptide of interest), a functional fragment, or a variant thereof, and (ii) a second ORF expressing a second polypeptide of interest. In some embodiments, polynucleotides of the invention comprise a single ORF encoding a PCCB polypeptide, a functional fragment, or a variant thereof. However, in some embodiments, the polynucleotide of the invention can comprise more than one ORF, for example, a first ORF encoding (i) a PCCB (a first polypeptide of interest), a functional fragment, or a variant thereof, and (ii) a second ORF expressing a second polypeptide of interest. In some embodiments, polynucleotides of the invention comprise a single ORF encoding a MUT polypeptide, a functional fragment, or a variant thereof. However, in some embodiments, the polynucleotide of the invention can comprise more than one ORF, for example, a first ORF encoding (i) a MUT (a first polypeptide of interest), a functional fragment, or a variant thereof, and (ii) a second ORF expressing a second polypeptide of interest. In some embodiments, polynucleotides of the invention comprise a single ORF encoding a FECH polypeptide, a functional fragment, or a variant thereof. However, in some embodiments, the polynucleotide of the invention can comprise more than one ORF, for example, a first ORF encoding (i) a FECH (a first polypeptide of interest), a functional fragment, or a variant thereof, and (ii) a second ORF expressing a second polypeptide of interest. In some embodiments, two or more polypeptides of interest can be genetically fused, i.e., two or more polypeptides can be encoded by the same ORF. In some embodiments, the polynucleotide can comprise a nucleic acid sequence encoding a linker (e.g., a G4S (SEQ ID NO:200) peptide linker or another linker known in the art) between two or more polypeptides of interest. In some embodiments, a polynucleotide of the invention (e.g., a RNA, e.g., an mRNA) can comprise two, three, four, or more ORFs, each expressing a polypeptide of interest. Linkers and Cleavable Peptides In certain embodiments, the mRNAs of the disclosure encode more than one domain or a heterologous domain, referred to herein as multimer constructs. In certain embodiments of the multimer constructs, the mRNA further encodes a linker located between each domain. The linker can be, for example, a cleavable linker or protease-sensitive linker. In certain embodiments, the linker is selected from the group consisting of F2A linker, P2A linker, T2A linker, E2A linker, and combinations thereof. This family of self-cleaving peptide linkers, referred to as 2A peptides, has been described in the art (see for example, Kim, J.H. et al. (2011) PLoS ONE 6:e18556). In certain embodiments, the linker is an F2A linker. In certain embodiments, the linker is a GGGS (SEQ ID NO:201) linker. In certain embodiments, the linker is a (GGGS)n (SEQ ID NO:202) linker, wherein n =2, 3,4, or 5. In one embodiment, the cleavable linker is an F2A linker (e.g., having the amino acid sequence GSGVKQTLNFDLLKLAGDVESNPGP (SEQ ID NO:189)). In other embodiments, the cleavable linker is a T2A linker (e.g., having the amino acid sequence GSGEGRGSLLTCGDVEENPGP (SEQ ID NO:190)), a P2A linker (e.g., having the amino acid sequence GSGATNFSLLKQAGDVEENPGP (SEQ ID NO:191)) or an E2A linker (e.g., having the amino acid sequence GSGQCTNYALLKLAGDVESNPGP (SEQ ID NO:186)). The skilled artisan will appreciate that other art-recognized linkers may be suitable for use in the constructs of the invention (e.g., encoded by the polynucleotides of the invention). The skilled artisan will likewise appreciate that other multicistronic constructs may be suitable for use in the invention. In exemplary embodiments, the construct design yields approximately equimolar amounts of intrabody and / or domain thereof encoded by the constructs of the invention. In one embodiment, the self-cleaving peptide may be, but is not limited to, a 2A peptide. A variety of 2A peptides are known and available in the art and may be used, including e.g., the foot and mouth disease virus (FMDV) 2A peptide, the equine rhinitis A virus 2A peptide, the Thosea asigna virus 2A peptide, and the porcine teschovirus-12A peptide. 2A peptides are used by several viruses to generate two proteins from one transcript by ribosome-skipping, such that a normal peptide bond is impaired at the 2A peptide sequence, resulting in two discontinuous proteins being produced from one translation event. As a non-limiting example, the 2A peptide may have the protein sequence of SEQ ID NO: 191, fragments or variants thereof. In one embodiment, the 2A peptide cleaves between the last glycine and last proline. As another non-limiting example, the polynucleotides of the present invention may include a polynucleotide sequence encoding the 2A peptide having the protein sequence of fragments or variants of SEQ ID NO: 191. One example of a polynucleotide sequence encoding the 2A peptide is:GGAAGCGGAGCUACUAACUUCAGCCUGCUGAAGCAGGCUGGAGACGU GGAGGAGAACCCUGGACCU (SEQ ID NO:187). In one illustrative embodiment, a 2A peptide is encoded by the following sequence: 5′- UCCGGACUCAGAUCCGGGGAUCUCAAAAUUGUCGCUCCUGUCAAACAA ACUCUUAACUUUGAUUUACUCAAACUGGCTGGGGAUGUAGAAAGCAAU CCAGGTCCACUC-3′(SEQ ID NO: 188). The polynucleotide sequence of the 2A peptide may be modified or codon optimized by the methods described herein and / or are known in the art. In one embodiment, this sequence may be used to separate the coding regions of two or more polypeptides of interest. As a non-limiting example, the sequence encoding the F2A peptide may be between a first coding region A and a second coding region B (A-F2Apep-B). The presence of the F2A peptide results in the cleavage of the one long protein between the glycine and the proline at the end of the F2A peptide sequence (NPGP (SEQ ID NO:205) is cleaved to result in NPG and P) thus creating separate protein A (with 21 amino acids of the F2A peptide attached, ending with NPG) and separate protein B (with 1 amino acid, P, of the F2A peptide attached). Likewise, for other 2A peptides (P2A, T2A and E2A), the presence of the peptide in a long protein results in cleavage between the glycine and proline at the end of the 2A peptide sequence (NPGP (SEQ ID NO:205) is cleaved to result in NPG and P). Protein A and protein B may be the same or different peptides or polypeptides of interest. Sequence-Optimized Nucleotide Sequences Encoding Polypeptides In some embodiments, the polynucleotide of the invention comprises a sequence-optimized nucleotide sequence encoding a polypeptide disclosed herein. In some embodiments, the polynucleotide of the invention comprises an open reading frame (ORF) encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria (e.g., a polynucleotide encoding one or more of GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and FECH), wherein the ORF has been sequence optimized. In some embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a polypeptide, comprises from 5’ to 3’ end: (i) a 5’ terminal cap provided herein; (ii) a 5’ UTR, such as the sequences provided herein; (iii) an open reading frame encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria (e.g., any of the polypeptides described herein such as, a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide); (iv) a stop cassette (e.g., UAAAGCUCCCCGGGG (SEQ ID NO:300), optionally wherein, the sequence is located at the 5’ end of the 3’ UTR immediately 3’ of the last codon of the open reading frame); (v) a 3’ UTR, such as the sequences provided herein, for example, a 3’ UTR comprising a nucleotide sequence having at least 95% identity (e.g., at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, 100% identity) to the sequence of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91); and (vi) a poly-A tail provided above. In some embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a polypeptide, comprises from 5’ to 3’ end: (i) a 5’ terminal cap provided herein; (ii) a 5’ UTR, such as the sequences provided herein; (iii) an open reading frame encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria (e.g., any of the polypeptides described herein such as, a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide); (iv) a stop cassette (e.g., UAAAGCUCCCCGGGG (SEQ ID NO:300), optionally wherein, the sequence is located at the 5’ end of the 3’ UTR immediately 3’ of the last codon of the open reading frame); (v) a 3’ UTR comprising the nucleotide sequence of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91); and (vi) a poly-A tail provided above. In certain embodiments, all uracils in the polynucleotide are N1-methylpseudouracil. In certain embodiments, all uracils in the polynucleotide are 5-methoxyuracil. The sequence-optimized nucleotide sequences disclosed herein are distinct from the corresponding wild type nucleotide acid sequences and from other known sequence-optimized nucleotide sequences, e.g., these sequence-optimized nucleic acids have unique compositional characteristics. In some embodiments, the percentage of uracil or thymine nucleobases in a sequence-optimized nucleotide sequence (e.g., a polynucleotide encoding polypeptide that is translated at the endoplasmic reticulum or mitochondria such as GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, or FECH) is modified (e.g., reduced) with respect to the percentage of uracil or thymine nucleobases in the reference wild- type nucleotide sequence. Such a sequence is referred to as a uracil-modified or thymine-modified sequence. The percentage of uracil or thymine content in a nucleotide sequence can be determined by dividing the number of uracils or thymines in a sequence by the total number of nucleotides and multiplying by 100. In some embodiments, the sequence-optimized nucleotide sequence has a lower uracil or thymine content than the uracil or thymine content in the reference wild-type sequence. In some embodiments, the uracil or thymine content in a sequence- optimized nucleotide sequence of the invention is greater than the uracil or thymine content in the reference wild-type sequence and still maintain beneficial effects, e.g., increased expression and / or reduced Toll-Like Receptor (TLR) response when compared to the reference wild-type sequence. Methods for optimizing codon usage are known in the art. For example, an ORF of any one or more of the sequences provided herein may be codon optimized. Codon optimization, in some embodiments, may be used to match codon frequencies in target and host organisms to ensure proper folding; bias GC content to increase mRNA stability or reduce secondary structures; minimize tandem repeat codons or base runs that may impair gene construction or expression; customize transcriptional and translational control regions; insert or remove protein trafficking sequences; remove / add post translation modification sites in encoded protein (e.g., glycosylation sites); add, remove or shuffle protein domains; insert or delete restriction sites; modify ribosome binding sites and mRNA degradation sites; adjust translational rates to allow the various domains of the protein to fold properly; or reduce or eliminate problem secondary structures within the polynucleotide. Codon optimization tools, algorithms and services are known in the art - non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and / or proprietary methods. In some embodiments, the open reading frame (ORF) sequence is optimized using optimization algorithms. Identification and Ratio Determination (IDR) Sequences An Identification and Ratio Determination (IDR) sequence is a sequence of a biological molecule (e.g., nucleic acid or protein) that, when combined with the sequence of a target biological molecule, serves to identify the target biological molecule. Typically, an IDR sequence is a heterologous sequence that is incorporated within or appended to a sequence of a target biological molecule and can be used as a reference to identify the target molecule. Thus, in some embodiments, a nucleic acid (e.g., mRNA) comprises (i) a target sequence of interest (e.g., a coding sequence encoding a therapeutic and / or antigenic peptide or protein); and (ii) a unique IDR sequence. An RNA species (e.g., RNA having a given coding sequence) may comprise an IDR sequence that differs from the IDR sequence of other RNA species (e.g., RNA(s) having different coding sequence(s)). Each IDR sequence thus identifies a particular RNA species, and so the abundance of IDR sequences may be measured to determine the abundance of each RNA species in a composition. Use of distinct IDR sequences to identify RNA species allows for analysis of multivalent RNA compositions (e.g., containing multiple RNA species) containing RNA species with similar coding sequences and / or lengths, which could otherwise be difficult to distinguish using PCR- or chromatography-based analysis of full-length RNAs. Each RNA species in a multivalent RNA composition may comprise an IDR sequence that is not a sequence isomer of an IDR sequence of another RNA species in a multivalent RNA composition (e.g., the IDR sequence does not have the same number of adenosine nucleotides, the same number of cytosine nucleotides, the same number of guanine nucleotides, and the same number of uracil nucleotides, as another IDR sequence in the composition, even if those sequences have different sequences). Having identical nucleotide compositions causes sequence isomers to have the same mass, presenting a challenge to distinguishing sequence isomers using mass-based identification methods (e.g., mass spectrometry). Each RNA species in a multivalent RNA composition may comprise an IDR sequence having a mass that differs from the mass of IDR sequences of each other RNA species in a multivalent RNA composition. For example, the mass of each IDR sequence may differ from the mass of other IDR sequences by at least 9 Da, at least 25 Da, at least 25 Da, or at least 50 Da. Use of IDR sequences with distinct masses allows RNA fragments comprising different IDR sequences to be distinguished using mass-based analysis methods (e.g., mass spectrometry), which do not require reverse transcription, amplification, or sequencing of RNAs. Each RNA species in an RNA composition may comprises an IDR sequence with a different length. For example, each IDR sequence may have a length independently selected from 0 to 25 nucleotides. The length of a nucleic acid influences the rate at which the nucleic acid traverses a chromatography column, and so the use of IDR sequences of different lengths on different RNA species allows RNA fragments having different IDR sequences to be distinguished using chromatography-based methods (e.g., LC-UV). IDR sequences may be chosen such that no IDR sequence comprises a start codon, ‘AUG’. Lack of a start codon in an IDR sequence prevents undesired translation of nucleotide sequences within and / or downstream from the IDR sequence. IDR sequences may be chosen such that no IDR sequence comprises a recognition site for a restriction enzyme. In one example, no IDR sequence comprises a recognition site for XbaI, ‘UCUAG’. Lack of a recognition site for a restriction enzyme (e.g., XbaI recognition site ‘UCUAG’) allows the restriction enzyme to be used in generating and modifying a DNA template for in vitro transcription, without affecting the IDR sequence or sequence of the transcribed RNA. Modified Nucleotide Sequences Encoding Polypeptides In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the invention comprises a chemically modified nucleobase, for example, a chemically modified uracil, e.g., pseudouracil, N1-methylpseudouracil, 5-methoxyuracil, or the like. In some embodiments, the mRNA is a uracil-modified sequence comprising an ORF encoding a polypeptide, wherein the mRNA comprises a chemically modified nucleobase, for example, a chemically modified uracil, e.g., pseudouracil, N1-methylpseudouracil, or 5-methoxyuracil. In some embodiments, all of the uracils of the mRNA are N1-methylpseudouracils. Methods for Modifying Polynucleotides The disclosure includes modified polynucleotides comprising a polynucleotide described herein (e.g., a polynucleotide, e.g. mRNA, comprising a nucleotide sequence encoding a polypeptide). The modified polynucleotides can be chemically modified and / or structurally modified. When the polynucleotides of the present invention are chemically and / or structurally modified the polynucleotides can be referred to as "modified polynucleotides." The present disclosure provides for modified nucleosides and nucleotides of a polynucleotide (e.g., RNA polynucleotides, such as mRNA polynucleotides) encoding a polypeptide. A "nucleoside" refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as "nucleobase"). A “nucleotide" refers to a nucleoside including a phosphate group. Modified nucleotides can be synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non- natural nucleosides. Polynucleotides can comprise a region or regions of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the polynucleotides would comprise regions of nucleotides. The modified polynucleotides disclosed herein can comprise various distinct modifications. In some embodiments, the modified polynucleotides contain one, two, or more (optionally different) nucleoside or nucleotide modifications. In some embodiments, a modified polynucleotide, introduced to a cell can exhibit one or more desirable properties, e.g., improved protein expression, reduced immunogenicity, or reduced degradation in the cell, as compared to an unmodified polynucleotide. In some embodiments, a polynucleotide of the present invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a polypeptide) is structurally modified. As used herein, a "structural" modification is one in which two or more linked nucleosides are inserted, deleted, duplicated, inverted or randomized in a polynucleotide without significant chemical modification to the nucleotides themselves. Because chemical bonds will necessarily be broken and reformed to effect a structural modification, structural modifications are of a chemical nature and hence are chemical modifications. However, structural modifications will result in a different sequence of nucleotides. For example, the polynucleotide "ATCG" can be chemically modified to "AT-5meC-G". The same polynucleotide can be structurally modified from "ATCG" to "ATCCCG". Here, the dinucleotide "CC" has been inserted, resulting in a structural modification to the polynucleotide. Therapeutic compositions of the present disclosure comprise, in some embodiments, the nucleic acid comprises nucleotides and / or nucleosides that can be standard (unmodified) or modified as is known in the art. In some embodiments, nucleotides and nucleosides of the present disclosure comprise modified nucleotides or nucleosides. Such modified nucleotides and nucleosides can be naturally-occurring modified nucleotides and nucleosides or non-naturally occurring modified nucleotides and nucleosides. Such modifications can include those at the sugar, backbone, or nucleobase portion of the nucleotide and / or nucleoside as are recognized in the art. In some embodiments, a naturally-occurring modified nucleotide or nucleotide of the disclosure is one as is generally known or recognized in the art. Non-limiting examples of such naturally occurring modified nucleotides and nucleotides can be found, inter alia, in the widely recognized MODOMICS database. In some embodiments, a non-naturally occurring modified nucleotide or nucleoside of the disclosure is one as is generally known or recognized in the art. Non-limiting examples of such non-naturally occurring modified nucleotides and nucleosides can be found, inter alia, in published US application Nos. PCT / US2012 / 058519; PCT / US2013 / 075177; PCT / US2014 / 058897; PCT / US2014 / 058891; PCT / US2014 / 070413; PCT / US2015 / 36773; PCT / US2015 / 36759; PCT / US2015 / 36771; or PCT / IB2017 / 051367 all of which are incorporated by reference herein. In some embodiments, at least one RNA (e.g., mRNA) of the present disclosure is not chemically modified and comprises the standard ribonucleotides consisting of adenosine, guanosine, cytosine and uridine. In some embodiments, nucleotides and nucleosides of the present disclosure comprise standard nucleoside residues such as those present in transcribed RNA (e.g. A, G, C, or U). In some embodiments, nucleotides and nucleosides of the present disclosure comprise standard deoxyribonucleosides such as those present in DNA (e.g. dA, dG, dC, or dT). Hence, nucleic acids of the disclosure (e.g., DNA nucleic acids and RNA nucleic acids, such as mRNA nucleic acids) can comprise standard nucleotides and nucleosides, naturally-occurring nucleotides and nucleosides, non-naturally-occurring nucleotides and nucleosides, or any combination thereof. Nucleic acids of the disclosure (e.g., DNA nucleic acids and RNA nucleic acids, such as mRNA nucleic acids), in some embodiments, comprise various (more than one) different types of standard and / or modified nucleotides and nucleosides. In some embodiments, a particular region of a nucleic acid contains one, two or more (optionally different) types of standard and / or modified nucleotides and nucleosides. In some embodiments, a modified RNA nucleic acid (e.g., a modified mRNA nucleic acid), introduced to a cell or organism, exhibits reduced degradation in the cell or organism, respectively, relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides. In some embodiments, a modified RNA nucleic acid (e.g., a modified mRNA nucleic acid), introduced into a cell or organism, may exhibit reduced immunogenicity in the cell or organism, respectively (e.g., a reduced innate response) relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides. Nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids), in some embodiments, comprise non-natural modified nucleotides that are introduced during synthesis or post-synthesis of the nucleic acids to achieve desired functions or properties. The modifications may be present on internucleotide linkages, purine or pyrimidine bases, or sugars. The modification may be introduced with chemical synthesis or with a polymerase enzyme at the terminal of a chain or anywhere else in the chain. Any of the regions of a nucleic acid may be chemically modified. The present disclosure provides for modified nucleosides and nucleotides of a nucleic acid (e.g., RNA nucleic acids, such as mRNA nucleic acids). A “nucleoside” refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”). A “nucleotide” refers to a nucleoside, including a phosphate group. Modified nucleotides may by synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides. Nucleic acids can comprise a region or regions of linked nucleosides. Such regions may have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the nucleic acids would comprise regions of nucleotides. Modified nucleotide base pairing encompasses not only the standard adenosine-thymine, adenosine-uracil, or guanosine-cytosine base pairs, but also base pairs formed between nucleotides and / or modified nucleotides comprising non- standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures, such as, for example, in those nucleic acids having at least one chemical modification. One example of such non-standard base pairing is the base pairing between the modified nucleotide inosine and adenine, cytosine or uracil. Any combination of base / sugar or linker may be incorporated into nucleic acids of the present disclosure. In some embodiments, modified nucleobases in nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) comprise N1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), and / or pseudouridine (ψ). In some embodiments, modified nucleobases in nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) comprise 5- methoxymethyl uridine, 5-methylthio uridine, 1-methoxymethyl pseudouridine, 5- methyl cytidine, and / or 5-methoxy cytidine. In some embodiments, the polyribonucleotide includes a combination of at least two (e.g., 2, 3, 4 or more) of any of the aforementioned modified nucleobases, including but not limited to chemical modifications. In some embodiments, a RNA nucleic acid of the disclosure comprises N1- methyl-pseudouridine (m1ψ) substitutions at one or more or all uridine positions of the nucleic acid. In some embodiments, a RNA nucleic acid of the disclosure comprises N1- methyl-pseudouridine (m1ψ) substitutions at one or more or all uridine positions of the nucleic acid and 5-methyl cytidine substitutions at one or more or all cytidine positions of the nucleic acid. In some embodiments, a RNA nucleic acid of the disclosure comprises pseudouridine (ψ) substitutions at one or more or all uridine positions of the nucleic acid. In some embodiments, a RNA nucleic acid of the disclosure comprises pseudouridine (ψ) substitutions at one or more or all uridine positions of the nucleic acid and 5-methyl cytidine substitutions at one or more or all cytidine positions of the nucleic acid. In some embodiments, a RNA nucleic acid of the disclosure comprises uridine at one or more or all uridine positions of the nucleic acid. In some embodiments, nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) are uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, a nucleic acid can be uniformly modified with N1-methyl-pseudouridine, meaning that all uridine residues in the mRNA sequence are replaced with N1-methyl-pseudouridine. Similarly, a nucleic acid can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as those set forth above. The nucleic acids of the present disclosure may be partially or fully modified along the entire length of the molecule. For example, one or more or all or a given type of nucleotide (e.g., purine or pyrimidine, or any one or more or all of A, G, U, C) may be uniformly modified in a nucleic acid of the disclosure, or in a predetermined sequence region thereof (e.g., in the mRNA including or excluding the polyA tail). In some embodiments, all nucleotides X in a nucleic acid of the present disclosure (or in a sequence region thereof) are modified nucleotides, wherein X may be any one of nucleotides A, G, U, C, or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C or A+G+C. The nucleic acid may contain from about 1% to about 100% modified nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, i.e., any one or more of A, G, U or C) or any intervening percentage (e.g., from 1% to 20%, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to 100%, from 90% to 95%, from 90% to 100%, and from 95% to 100%). It will be understood that any remaining percentage is accounted for by the presence of unmodified A, G, U, or C. The nucleic acids may contain at a minimum 1% and at maximum 100% modified nucleotides, or any intervening percentage, such as at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides. For example, the nucleic acids may contain a modified pyrimidine such as a modified uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the uracil in the nucleic acid is replaced with a modified uracil (e.g., a 5-substituted uracil). The modified uracil can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the cytosine in the nucleic acid is replaced with a modified cytosine (e.g., a 5-substituted cytosine). The modified cytosine can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures). Untranslated Regions (UTRs) Untranslated regions (UTRs) are nucleic acid sections of a polynucleotide before a start codon (5′ UTR) and after a stop codon (3′ UTR) that are not translated. In some embodiments, a polynucleotide (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) of the invention comprising an open reading frame (ORF) encoding a polypeptide further comprises UTR (e.g., a 5′ UTR or functional fragment thereof, a 3′ UTR or functional fragment thereof, or a combination thereof). A UTR (e.g., 5′ UTR or 3′ UTR) can be homologous or heterologous to the coding region in a polynucleotide. In some embodiments, the UTR is homologous to the ORF encoding any of the polypeptides described herein (e.g., GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide). In some embodiments, the UTR is heterologous to the ORF encoding any of the polypeptides described herein (e.g., GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide). In some embodiments, the polynucleotide comprises two or more 5′ UTRs or functional fragments thereof, each of which has the same or different nucleotide sequences. In some embodiments, the polynucleotide comprises two or more 3′ UTRs or functional fragments thereof, each of which has the same or different nucleotide sequences. In some embodiments, the 5′ UTR or functional fragment thereof, 3′ UTR or functional fragment thereof, or any combination thereof is sequence optimized. In some embodiments, the 5′UTR or functional fragment thereof, 3′ UTR or functional fragment thereof, or any combination thereof comprises at least one chemically modified nucleobase, e.g., N1-methylpseudouracil or 5-methoxyuracil. UTRs can have features that provide a regulatory role, e.g., increased or decreased stability, localization and / or translation efficiency. A polynucleotide comprising a UTR can be administered to a cell, tissue, or organism, and one or more regulatory features can be measured using routine methods. In some embodiments, a functional fragment of a 5′ UTR or 3′ UTR comprises one or more regulatory features of a full length 5′ or 3′ UTR, respectively. Natural 5′ UTRs bear features that play roles in translation initiation. They harbor signatures like Kozak sequences that are commonly known to be involved in the process by which the ribosome initiates translation of many genes. Kozak sequences have the consensus CCR(A / G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another ‘G’.5′ UTRs also have been known to form secondary structures that are involved in elongation factor binding. By engineering the features typically found in abundantly expressed genes of specific target organs, one can enhance the stability and protein production of a polynucleotide. For example, introduction of 5′ UTR of liver-expressed mRNA, such as albumin, serum amyloid A, Apolipoprotein A / B / E, transferrin, alpha fetoprotein, erythropoietin, or Factor VIII, can enhance expression of polynucleotides in hepatic cell lines or liver. Likewise, use of 5′UTR from other tissue-specific mRNA to improve expression in that tissue is possible for muscle (e.g., MyoD, Myosin, Myoglobin, Myogenin, Herculin), for endothelial cells (e.g., Tie-1, CD36), for myeloid cells (e.g., C / EBP, AML1, G-CSF, GM-CSF, CD11b, MSR, Fr-1, i-NOS), for leukocytes (e.g., CD45, CD18), for adipose tissue (e.g., CD36, GLUT4, ACRP30, adiponectin) and for lung epithelial cells (e.g., SP-A / B / C / D). In some embodiments, UTRs are selected from a family of transcripts whose proteins share a common function, structure, feature or property. For example, an encoded polypeptide can belong to a family of proteins (i.e., that share at least one function, structure, feature, localization, origin, or expression pattern), which are expressed in a particular cell, tissue or at some time during development. The UTRs from any of the genes or mRNA can be swapped for any other UTR of the same or different family of proteins to create a new polynucleotide. In some embodiments, the 5′ UTR and the 3′ UTR can be heterologous. In some embodiments, the 5′ UTR can be derived from a different species than the 3′ UTR. In some embodiments, the 3′ UTR can be derived from a different species than the 5′ UTR. Co-owned International Patent Application No. PCT / US2014 / 021522 (Publ. No. WO / 2014 / 164253, incorporated herein by reference in its entirety) provides a listing of exemplary UTRs that can be utilized in the polynucleotide of the present invention as flanking regions to an ORF. Additional exemplary UTRs of the application include, but are not limited to, one or more 5′UTR and / or 3′UTR derived from the nucleic acid sequence of: a globin, such as an α- or β-globin (e.g., a Xenopus, mouse, rabbit, or human globin); a strong Kozak translational initiation signal; a CYBA (e.g., human cytochrome b-245 α polypeptide); an albumin (e.g., human albumin7); a HSD17B4 (hydroxysteroid (17-β) dehydrogenase); a virus (e.g., a tobacco etch virus (TEV), a Venezuelan equine encephalitis virus (VEEV), a Dengue virus, a cytomegalovirus (CMV) (e.g., CMV immediate early 1 (IE1)), a hepatitis virus (e.g., hepatitis B virus), a sindbis virus, or a PAV barley yellow dwarf virus); a heat shock protein (e.g., hsp70); a translation initiation factor (e.g., elF4G); a glucose transporter (e.g., hGLUT1 (human glucose transporter 1)); an actin (e.g., human α or β actin); a GAPDH; a tubulin; a histone; a citric acid cycle enzyme; a topoisomerase (e.g., a 5′UTR of a TOP gene lacking the 5′ TOP motif (the oligopyrimidine tract)); a ribosomal protein Large 32 (L32); a ribosomal protein (e.g., human or mouse ribosomal protein, such as, for example, rps9); an ATP synthase (e.g., ATP5A1 or the β subunit of mitochondrial H+-ATP synthase); a growth hormone e (e.g., bovine (bGH) or human (hGH)); an elongation factor (e.g., elongation factor 1 α1 (EEF1A1)); a manganese superoxide dismutase (MnSOD); a myocyte enhancer factor 2A (MEF2A); a β-F1-ATPase, a creatine kinase, a myoglobin, a granulocyte-colony stimulating factor (G-CSF); a collagen (e.g., collagen type I, alpha 2 (Col1A2), collagen type I, alpha 1 (Col1A1), collagen type VI, alpha 2 (Col6A2), collagen type VI, alpha 1 (Col6A1)); a ribophorin (e.g., ribophorin I (RPNI)); a low density lipoprotein receptor-related protein (e.g., LRP1); a cardiotrophin-like cytokine factor (e.g., Nnt1); calreticulin (Calr); a procollagen- lysine, 2-oxoglutarate 5-dioxygenase 1 (Plod1); and a nucleobindin (e.g., Nucb1). In some embodiments, the 5′ UTR is selected from the group consisting of a β-globin 5′ UTR; a 5′UTR containing a strong Kozak translational initiation signal; a cytochrome b-245 α polypeptide (CYBA) 5′ UTR; a hydroxysteroid (17-β) dehydrogenase (HSD17B4) 5′ UTR; a Tobacco etch virus (TEV) 5′ UTR; a Venezuelen equine encephalitis virus (TEEV) 5′ UTR; a 5′ proximal open reading frame of rubella virus (RV) RNA encoding nonstructural proteins; a Dengue virus (DEN) 5′ UTR; a heat shock protein 70 (Hsp70) 5′ UTR; a eIF4G 5′ UTR; a GLUT1 5′ UTR; functional fragments thereof and any combination thereof. In some embodiments, the 3′ UTR is selected from the group consisting of a β-globin 3′ UTR; a CYBA 3′ UTR; an albumin 3′ UTR; a growth hormone (GH) 3′ UTR; a VEEV 3′ UTR; a hepatitis B virus (HBV) 3′ UTR; α-globin 3′UTR; a DEN 3′ UTR; a PAV barley yellow dwarf virus (BYDV-PAV) 3′ UTR; an elongation factor 1 α1 (EEF1A1) 3′ UTR; a manganese superoxide dismutase (MnSOD) 3′ UTR; a β subunit of mitochondrial H(+)-ATP synthase (β-mRNA) 3′ UTR; a GLUT13′ UTR; a MEF2A 3′ UTR; a β-F1-ATPase 3′ UTR; functional fragments thereof and combinations thereof. Wild-type UTRs derived from any gene or mRNA can be incorporated into the polynucleotides of the invention. In some embodiments, a UTR can be altered relative to a wild type or native UTR to produce a variant UTR, e.g., by changing the orientation or location of the UTR relative to the ORF; or by inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides. In some embodiments, variants of 5′ or 3′ UTRs can be utilized, for example, mutants of wild type UTRs, or variants wherein one or more nucleotides are added to or removed from a terminus of the UTR. Additionally, one or more synthetic UTRs can be used in combination with one or more non-synthetic UTRs. See, e.g., Mandal and Rossi, Nat. Protoc.2013 8(3):568-82, the contents of which are incorporated herein by reference in their entirety. UTRs or portions thereof can be placed in the same orientation as in the transcript from which they were selected or can be altered in orientation or location. Hence, a 5′ and / or 3′ UTR can be inverted, shortened, lengthened, or combined with one or more other 5′ UTRs or 3′ UTRs. In some embodiments, the polynucleotide comprises multiple UTRs, e.g., a double, a triple or a quadruple 5′ UTR or 3′ UTR. For example, a double UTR comprises two copies of the same UTR either in series or substantially in series. For example, a double beta-globin 3′UTR can be used (see US2010 / 0129877, the contents of which are incorporated herein by reference in its entirety). The polynucleotides of the invention can comprise combinations of features. For example, the ORF can be flanked by a 5′UTR that comprises a strong Kozak translational initiation signal and / or a 3′UTR comprising an oligo(dT) sequence for templated addition of a poly-A tail. A 5′UTR can comprise a first polynucleotide fragment and a second polynucleotide fragment from the same and / or different UTRs (see, e.g., US2010 / 0293625, herein incorporated by reference in its entirety). Other non-UTR sequences can be used as regions or subregions within the polynucleotides of the invention. For example, introns or portions of intron sequences can be incorporated into the polynucleotides of the invention. Incorporation of intronic sequences can increase protein production as well as polynucleotide expression levels. In some embodiments, the polynucleotide of the invention comprises an internal ribosome entry site (IRES) instead of or in addition to a UTR (see, e.g., Yakubov et al., Biochem. Biophys. Res. Commun.2010394(1):189-193, the contents of which are incorporated herein by reference in their entirety). In some embodiments, the polynucleotide comprises an IRES instead of a 5′ UTR sequence. In some embodiments, the polynucleotide comprises an ORF and a viral capsid sequence. In some embodiments, the polynucleotide comprises a synthetic 5′ UTR in combination with a non-synthetic 3′ UTR. In some embodiments, the UTR can also include at least one translation enhancer polynucleotide, translation enhancer element, or translational enhancer elements (collectively, "TEE," which refers to nucleic acid sequences that increase the amount of polypeptide or protein produced from a polynucleotide. As a non-limiting example, the TEE can be located between the transcription promoter and the start codon. In some embodiments, the 5′ UTR comprises a TEE. In one aspect, a TEE is a conserved element in a UTR that can promote translational activity of a nucleic acid such as, but not limited to, cap-dependent or cap-independent translation. a.5′ UTR sequences 5′ UTR sequences are important for ribosome recruitment to the mRNA and have been reported to play a role in translation (Hinnebusch A, et al., (2016) Science, 352:6292: 1413-6). Disclosed herein, inter alia, is a polynucleotide, e.g., mRNA, comprising an open reading frame encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria (e.g., GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide), which polynucleotide has a 5′ UTR that confers an increased half-life, increased expression and / or increased activity of the polypeptide encoded by said polynucleotide, or of the polynucleotide itself. In an embodiment, a polynucleotide disclosed herein comprises: (a) a 5′-UTR (e.g., as provided in Table 1 or a variant or fragment thereof); (b) a coding region comprising a stop element (e.g., as described herein); and (c) a 3′-UTR (e.g., as described herein), and LNP compositions comprising the same. In an embodiment, the polynucleotide comprises a 5′-UTR comprising a sequence provided in Table 1 or a variant or fragment thereof (e.g., a functional variant or fragment thereof). In an embodiment, the polynucleotide having a 5′ UTR sequence provided in Table 1 or a variant or fragment thereof, has an increase in the half-life of the polynucleotide, e.g., about 1.5-20-fold increase in half-life of the polynucleotide. In an embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20-fold, or more. In an embodiment, the increase in half life is about 1.5-fold or more. In an embodiment, the increase in half life is about 2- fold or more. In an embodiment, the increase in half life is about 3-fold or more. In an embodiment, the increase in half life is about 4-fold or more. In an embodiment, the increase in half life is about 5-fold or more. In an embodiment, the polynucleotide having a 5′ UTR sequence provided in Table 1 or a variant or fragment thereof, results in an increased level and / or activity, e.g., output, of the polypeptide encoded by the polynucleotide. In an embodiment, the 5′UTR results in about 1.5-20-fold increase in level and / or activity, e.g., output, of the polypeptide encoded by the polynucleotide. In an embodiment, the increase in level and / or activity is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20-fold, or more. In an embodiment, the increase in level and / or activity is about 1.5-fold or more. In an embodiment, the increase in level and / or activity is about 2- fold or more. In an embodiment, the increase in level and / or activity is about 3-fold or more. In an embodiment, the increase in level and / or activity is about 4-fold or more. In an embodiment, the increase in level and / or activity is about 5-fold or more. In an embodiment, the increase is compared to an otherwise similar polynucleotide which does not have a 5′ UTR, has a different 5′ UTR, or does not have a 5′ UTR described in Table 1 or a variant or fragment thereof. In an embodiment, the increase in half-life of the polynucleotide is measured according to an assay that measures the half-life of a polynucleotide. In an embodiment, the increase in level and / or activity, e.g., output, of the polypeptide encoded by the polynucleotide is measured according to an assay that measures the level and / or activity of a polypeptide. In an embodiment, the 5′ UTR comprises a sequence provided in Table 1 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 5′ UTR sequence provided in Table 1, or a variant or a fragment thereof. In an embodiment, the 5′ UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, or SEQ ID NO: 78. In an embodiment, the 5′ UTR comprises the sequence of SEQ ID NO:56. In an embodiment, the 5′ UTR consists of the sequence of SEQ ID NO:56. In an embodiment, a 5′ UTR sequence provided in Table 1 has a first nucleotide which is an A. In an embodiment, a 5′ UTR sequence provided in Table 1 has a first nucleotide which is a G. Table 1: 5′ UTR sequences

[0002]

[0003] In an embodiment, the 5′ UTR comprises a variant of SEQ ID NO:50. In an embodiment, the variant of SEQ ID NO:50 comprises a nucleic acid sequence of Formula A: G G A A A U C G C A A A A (N2)X (N3)X C U (N4)X (N5)X C G C G U U A G A U U U C U U U U A G U U U U C U N6N7C A A C U A G C A A G C U U U U U G U U C U C G C C (N8 C C)x (SEQ ID NO: 59), wherein: (N2)x is a uracil and x is an integer from 0 to 5, e.g., wherein x =3 or 4; (N3)xis a guanine and x is an integer from 0 to 1; (N4)x is a cytosine and x is an integer from 0 to 1; (N5)xis a uracil and x is an integer from 0 to 5, e.g., wherein x =2 or 3; N6 is a uracil or cytosine; N7is a uracil or guanine; N8 is adenine or guanine and x is an integer from 0 to 1. In an embodiment (N2)xis a uracil and x is 0. In an embodiment (N2)xis a uracil and x is 1. In an embodiment (N2)x is a uracil and x is 2. In an embodiment (N2)xis a uracil and x is 3. In an embodiment, (N2)xis a uracil and x is 4. In an embodiment (N2)x is a uracil and x is 5. In an embodiment, (N3)x is a guanine and x is 0. In an embodiment, (N3)x is a guanine and x is 1. In an embodiment, (N4)x is a cytosine and x is 0. In an embodiment, (N4)x is a cytosine and x is 1. In an embodiment (N5)x is a uracil and x is 0. In an embodiment (N5)x is a uracil and x is 1. In an embodiment (N5)xis a uracil and x is 2. In an embodiment (N5)x is a uracil and x is 3. In an embodiment, (N5)x is a uracil and x is 4. In an embodiment (N5)xis a uracil and x is 5. In an embodiment, N6 is a uracil. In an embodiment, N6 is a cytosine. In an embodiment, N7 is a uracil. In an embodiment, N7 is a guanine. In an embodiment, N8 is an adenine and x is 0. In an embodiment, N8 is an adenine and x is 1. In an embodiment, N8 is a guanine and x is 0. In an embodiment, N8 is a guanine and x is 1. In an embodiment, the 5′ UTR comprises a variant of SEQ ID NO:56. In an embodiment, the variant of SEQ ID NO:56 comprises a sequence with at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO:56. In an embodiment, the variant of SEQ ID NO:56 comprises a sequence with at least 50% identity to SEQ ID NO:56. In an embodiment, the variant of SEQ ID NO:56 comprises a sequence with at least 60% identity to SEQ ID NO:56. In an embodiment, the variant of SEQ ID NO:56 comprises a sequence with at least 70% identity to SEQ ID NO:56. In an embodiment, the variant of SEQ ID NO:56 comprises a sequence with at least 80% identity to SEQ ID NO:56. In an embodiment, the variant of SEQ ID NO:56 comprises a sequence with at least 90% identity to SEQ ID NO:56. In an embodiment, the variant of SEQ ID NO:56 comprises a sequence with at least 95% identity to SEQ ID NO:56. In an embodiment, the variant of SEQ ID NO:56 comprises a sequence with at least 96% identity to SEQ ID NO:56. In an embodiment, the variant of SEQ ID NO:56 comprises a sequence with at least 97% identity to SEQ ID NO:56. In an embodiment, the variant of SEQ ID NO:56 comprises a sequence with at least 98% identity to SEQ ID NO:56. In an embodiment, the variant of SEQ ID NO:56 comprises a sequence with at least 99% identity to SEQ ID NO:56. In an embodiment, the variant of SEQ ID NO:56 comprises a uridine content of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80%. In an embodiment, the variant of SEQ ID NO:56 comprises a uridine content of at least 5%. In an embodiment, the variant of SEQ ID NO:56 comprises a uridine content of at least 10%. In an embodiment, the variant of SEQ ID NO:56 comprises a uridine content of at least 20%. In an embodiment, the variant of SEQ ID NO:56 comprises a uridine content of at least 30%. In an embodiment, the variant of SEQ ID NO:56 comprises a uridine content of at least 40%. In an embodiment, the variant of SEQ ID NO:56 comprises a uridine content of at least 50%. In an embodiment, the variant of SEQ ID NO:56 comprises a uridine content of at least 60%. In an embodiment, the variant of SEQ ID NO:56 comprises a uridine content of at least 70%. In an embodiment, the variant of SEQ ID NO:56 comprises a uridine content of at least 80%. In an embodiment, the variant of SEQ ID NO:56 comprises at least 2, 3, 4, 5, 6 or 7 consecutive uridines (e.g., a polyuridine tract). In an embodiment, the polyuridine tract in the variant of SEQ ID NO:56 comprises at least 1-7, 2-7, 3-7, 4-7, 5-7, 6-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, or 3-5 consecutive uridines. In an embodiment, the polyuridine tract in the variant of SEQ ID NO:56 comprises 4 consecutive uridines. In an embodiment, the polyuridine tract in the variant of SEQ ID NO:56 comprises 5 consecutive uridines. In an embodiment, the variant of SEQ ID NO:56 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 polyuridine tracts. In an embodiment, the variant of SEQ ID NO:56 comprises 3 polyuridine tracts. In an embodiment, the variant of SEQ ID NO:56 comprises 4 polyuridine tracts. In an embodiment, the variant of SEQ ID NO:56 comprises 5 polyuridine tracts. In an embodiment, one or more of the polyuridine tracts are adjacent to a different polyuridine tract. In an embodiment, each of, e.g., all, the polyuridine tracts are adjacent to each other, e.g., all of the polyuridine tracts are contiguous. In an embodiment, one or more of the polyuridine tracts are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18.19, 20, 30, 40, 50 or 60 nucleotides. In an embodiment, each of, e.g., all of, the polyuridine tracts are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18.19, 20, 30, 40, 50 or 60 nucleotides. In an embodiment, a first polyuridine tract and a second polyuridine tract are adjacent to each other. In an embodiment, a subsequent, e.g., third, fourth, fifth, sixth or seventh, eighth, ninth, or tenth, polyuridine tract is separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18.19, 20, 30, 40, 50 or 60 nucleotides from the first polyuridine tract, the second polyuridine tract, or any one of the subsequent polyuridine tracts. In an embodiment, a first polyuridine tract is separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18.19, 20, 30, 40, 50 or 60 nucleotides from a subsequent polyuridine tract, e.g., a second, third, fourth, fifth, sixth or seventh, eighth, ninth, or tenth polyuridine tract. In an embodiment, one or more of the subsequent polyuridine tracts are adjacent to a different polyuridine tract. In an embodiment, the 5′ UTR comprises a Kozak sequence, e.g., a GCCRCC nucleotide sequence wherein R is an adenine or guanine. In an embodiment, the Kozak sequence is disposed at the 3′ end of the 5′UTR sequence. In an aspect, the polynucleotide (e.g., mRNA) comprising an open reading frame encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria (e.g., GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide) and comprising a 5′ UTR sequence disclosed herein is formulated as an LNP. In an embodiment, the LNP composition comprises: (i) an ionizable lipid, e.g., an amino lipid; (ii) a sterol or other structural lipid; (iii) a non-cationic helper lipid or phospholipid; and (iv) a PEG-lipid. In another aspect, the LNP compositions of the disclosure are used in a method for treating an indication in a subject. In an aspect, an LNP composition comprising a polynucleotide disclosed herein encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria, e.g., GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide, can be administered with an additional agent, e.g., as described herein. b.3′ UTR sequences 3′UTR sequences have been shown to influence translation, half-life, and subcellular localization of mRNAs (Mayr C., Cold Spring Harb Persp Biol 2019 Oct 1;11(10):a034728). Disclosed herein, inter alia, is a polynucleotide, e.g., mRNA, comprising an open reading frame encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria (e.g., a polynucleotide encoding one or more of GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and FECH), which polynucleotide has a 3’ UTR that confers an increased half-life, increased expression and / or increased activity of the polypeptide encoded by said polynucleotide, or of the polynucleotide itself. In an embodiment, a polynucleotide disclosed herein comprises: (a) a 5′-UTR (e.g., as described herein); (b) a coding region comprising a stop cassette (e.g., as described herein); and (c) a 3′-UTR (e.g., as described herein), and LNP compositions comprising the same. In an embodiment, the 3’ UTR comprises a TENT recruiting sequence, e.g., as described herein, which recruits one or more terminal nucleotidyl transferases (TENTs) to the polynucleotide comprising the 3’ UTR. In an embodiment, the TENT is TENT4, e.g., TENT4A and / or TENT4B. Without wishing to be bound by theory, it is believed that in some embodiments one or more TENTs (e.g., TENT4A and / or TENT4B) generates a mixed poly-A tail with intermittent non-adenosine residues (e.g., guanosine), which shields mRNA from rapid deadenylation. In some embodiments, provided herein are 3’ UTRs including the following TENT recruiting sequence: CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCGG (SEQ ID NO: 91). In an embodiment, the TENT recruiting sequence comprises the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or differing by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides therefrom. In an embodiment, the TENT recruiting sequence comprises the nucleotide sequence of SEQ ID NO: 91. In an embodiment, the 3’ UTR comprises one or more (e.g., 2, 3, 4, 5, or more) TENT recruiting sequences, e.g., one or more TENT recruiting sequences described herein. In an embodiment the 3’ UTR comprises one TENT recruiting sequence. In an embodiment the 3’ UTR comprises two TENT recruiting sequences. In an embodiment the 3’ UTR comprises three TENT recruiting sequences. In an embodiment the 3’ UTR comprises four TENT recruiting sequences. In an embodiment the 3’ UTR comprises five TENT recruiting sequences. For example, the multiple TENT recruiting sequences in the 3’ UTR can be identical or different. In an embodiment, the 3’ UTR comprises a TENT recruiting sequence comprising the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or differing by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides therefrom. In an embodiment, the 3’ UTR comprises a TENT recruiting sequence comprising the nucleotide sequence of SEQ ID NO: 91. In an embodiment, the 3’ UTR comprises one or more (e.g., 2, 3, 4, 5, or more) of a TENT recruiting sequence comprising the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or differing by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides therefrom. In an embodiment, the 3’ UTR comprises one TENT recruiting sequence comprising the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or differing by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides therefrom. In an embodiment, the 3’ UTR comprises two TENT recruiting sequences, each comprising the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or differing by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides therefrom. In an embodiment, the 3’ UTR comprises three TENT recruiting sequences, each comprising the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or differing by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides therefrom. In an embodiment, the 3’ UTR comprises four TENT recruiting sequences, each comprising the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or differing by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides therefrom. In an embodiment, the 3’ UTR comprises five TENT recruiting sequences, each comprising the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or differing by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides therefrom. In an embodiment, the 3’ UTR comprises one or more (e.g., 2, 3, 4, 5, or more) of a TENT recruiting sequence comprising the nucleotide sequence of SEQ ID NO: 91. In an embodiment, the 3’ UTR comprises two TENT recruiting sequences, each comprising the nucleotide sequence of SEQ ID NO: 91. In an embodiment, the 3’ UTR comprises three TENT recruiting sequences, each comprising the nucleotide sequence of SEQ ID NO: 91. In an embodiment, the 3’ UTR comprises four TENT recruiting sequences, each comprising the nucleotide sequence of SEQ ID NO: 91. In an embodiment, the 3’ UTR comprises five TENT recruiting sequences, each comprising the nucleotide sequence of SEQ ID NO: 91. In some embodiments, the 3’ UTR includes the following nucleotide sequence: UAAAGCUCCCCGGGGGCCUCCACCGCGUUAUCCGUUCCUCGUAGGCUGGUCC UGGGGAACGGGUCGGCGG (SEQ ID NO:212). In some embodiments, the 3’ UTR includes the following nucleotide sequence: UAAAGCUCCCCGGGGGCCUCCACCGCGUUAUCCGUUCCUCGUAGGCUGGUCC UGGGGAACGGGUCGGCGGGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO:142). In other embodiments, the polynucleotides disclosed herein comprise: (a) a 5′- UTR (e.g., as described herein, such as one described in Table 1 or a variant thereof); (b) a coding region comprising a stop cassette (e.g., as described herein); and (c) a 3′- UTR (e.g., as described herein, such as one described in Table 2 or a variant thereof). In an embodiment, the polynucleotide having a 3′ UTR sequence provided in Table 2 or a variant or fragment thereof, results in an increased half-life of the polynucleotide, e.g., about 1.5-10-fold increase in half-life of the polynucleotide. In an embodiment, the increase in half-life is about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold, or more. In an embodiment, the increase in half-life is about 1.5-fold or more. In an embodiment, the increase in half-life is about 2-fold or more. In an embodiment, the increase in half-life is about 3-fold or more. In an embodiment, the increase in half- life is about 4-fold or more. In an embodiment, the increase in half-life is about 5-fold or more. In an embodiment, the increase in half-life is about 6-fold or more. In an embodiment, the increase in half-life is about 7-fold or more. In an embodiment, the increase in half-life is about 8-fold. In an embodiment, the increase in half-life is about 9-fold or more. In an embodiment, the increase in half-life is about 10-fold or more. In an embodiment, the polynucleotide having a 3′ UTR sequence provided in Table 2 or a variant or fragment thereof, results in a polynucleotide with a mean half- life score of greater than 10. In an embodiment, the polynucleotide having a 3′ UTR sequence provided in Table 2 or a variant or fragment thereof, results in an increased level and / or activity, e.g., output, of the polypeptide encoded by the polynucleotide. In an embodiment, the increase is compared to an otherwise similar polynucleotide which does not have a 3′ UTR, has a different 3′ UTR, or does not have a 3′ UTR of Table 2 or a variant or fragment thereof. In an embodiment, the polynucleotide comprises a 3′ UTR sequence provided in Table 2 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 3′ UTR sequence provided in Table 2, or a fragment thereof. Table 2: 3′ UTR sequences

[0004] MicroRNA (miRNA) Binding Sites Nucleic acid molecules (e.g., RNA, e.g., mRNA) of the disclosure can include regulatory elements, for example, microRNA (miRNA) binding sites, transcription factor binding sites, structured mRNA sequences and / or motifs, artificial binding sites engineered to act as pseudo-receptors for endogenous nucleic acid binding molecules, and combinations thereof. In some embodiments, a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure comprises an open reading frame (ORF) encoding a polypeptide of interest and further comprises one or more miRNA binding site(s). Inclusion or incorporation of miRNA binding site(s) provides for regulation of nucleic acid molecules (e.g., RNA, e.g., mRNA) of the disclosure, and in turn, of the polypeptides encoded therefrom, based on tissue-specific and / or cell-type specific expression of naturally- occurring miRNAs. A miRNA, e.g., a natural-occurring miRNA, is a 19-25 nucleotide long noncoding RNA that binds to a nucleic acid molecule (e.g., RNA, e.g., mRNA) and down-regulates gene expression either by reducing stability or by inhibiting translation of the polynucleotide. A miRNA sequence comprises a “seed” region, i.e., a sequence in the region of positions 2-8 of the mature miRNA. A miRNA seed can comprise positions 2-8 or 2-7 of the mature miRNA. In some embodiments, a miRNA seed can comprise 7 nucleotides (e.g., nucleotides 2-8 of the mature miRNA), wherein the seed-complementary site in the corresponding miRNA binding site is flanked by an adenosine (A) opposed to miRNA position 1. In some embodiments, a miRNA seed can comprise 6 nucleotides (e.g., nucleotides 2-7 of the mature miRNA), wherein the seed-complementary site in the corresponding miRNA binding site is flanked by an adenosine (A) opposed to miRNA position 1. See, for example, Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP; Mol Cell.2007 Jul 6;27(1):91-105. miRNA profiling of the target cells or tissues can be conducted to determine the presence or absence of miRNA in the cells or tissues. In some embodiments, a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure comprises one or more microRNA binding sites, microRNA target sequences, microRNA complementary sequences, or microRNA seed complementary sequences. Such sequences can correspond to, e.g., have complementarity to, any known microRNA such as those taught in US Publication US2005 / 0261218 and US Publication US2005 / 0059005, the contents of each of which are incorporated herein by reference in their entirety. As used herein, the term “microRNA (miRNA or miR) binding site” refers to a sequence within a nucleic acid molecule, e.g., within a DNA or within an RNA transcript, including in the 5′ UTR and / or 3′ UTR, that has sufficient complementarity to all or a region of a miRNA to interact with, associate with or bind to the miRNA. In some embodiments, a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure comprising an ORF encoding a polypeptide of interest and further comprises one or more miRNA binding site(s). In exemplary embodiments, a 5’UTR and / or 3’ UTR of the nucleic acid molecule (e.g., RNA, e.g., mRNA) comprises the one or more miRNA binding site(s). A miRNA binding site having sufficient complementarity to a miRNA refers to a degree of complementarity sufficient to facilitate miRNA-mediated regulation of a nucleic acid molecule (e.g., RNA, e.g., mRNA), e.g., miRNA-mediated translational repression or degradation of the nucleic acid molecule (e.g., RNA, e.g., mRNA). In exemplary aspects of the disclosure, a miRNA binding site having sufficient complementarity to the miRNA refers to a degree of complementarity sufficient to facilitate miRNA-mediated degradation of the nucleic acid molecule (e.g., RNA, e.g., mRNA), e.g., miRNA-guided RNA-induced silencing complex (RISC)-mediated cleavage of mRNA. The miRNA binding site can have complementarity to, for example, a 19-25 nucleotide miRNA sequence, to a 19-23 nucleotide miRNA sequence, or to a 22 nucleotide miRNA sequence. A miRNA binding site can be complementary to only a portion of a miRNA, e.g., to a portion less than 1, 2, 3, or 4 nucleotides of the full length of a naturally-occurring miRNA sequence. Full or complete complementarity (e.g., full complementarity or complete complementarity over all or a significant portion of the length of a naturally-occurring miRNA) is preferred when the desired regulation is mRNA degradation. In some embodiments, a miRNA binding site includes a sequence that has complementarity (e.g., partial or complete complementarity) with a miRNA seed sequence. In some embodiments, the miRNA binding site includes a sequence that has complete complementarity with a miRNA seed sequence. In some embodiments, a miRNA binding site includes a sequence that has complementarity (e.g., partial or complete complementarity) with an miRNA sequence. In some embodiments, the miRNA binding site includes a sequence that has complete complementarity with a miRNA sequence. In some embodiments, a miRNA binding site has complete complementarity with a miRNA sequence but for 1, 2, or 3 nucleotide substitutions, terminal additions, and / or truncations. In some embodiments, the miRNA binding site is the same length as the corresponding miRNA. In other embodiments, the miRNA binding site is one, two, three, four, five, six, seven, eight, nine, ten, eleven or twelve nucleotide(s) shorter than the corresponding miRNA at the 5’ terminus, the 3’ terminus, or both. In still other embodiments, the microRNA binding site is two nucleotides shorter than the corresponding microRNA at the 5’ terminus, the 3’ terminus, or both. The miRNA binding sites that are shorter than the corresponding miRNAs are still capable of degrading the mRNA incorporating one or more of the miRNA binding sites or preventing the mRNA from translation. In some embodiments, the miRNA binding site binds the corresponding mature miRNA that is part of an active RISC containing Dicer. In another embodiment, binding of the miRNA binding site to the corresponding miRNA in RISC degrades the mRNA containing the miRNA binding site or prevents the mRNA from being translated. In some embodiments, the miRNA binding site has sufficient complementarity to miRNA so that a RISC complex comprising the miRNA cleaves the nucleic acid molecule (e.g., RNA, e.g., mRNA) comprising the miRNA binding site. In other embodiments, the miRNA binding site has imperfect complementarity so that a RISC complex comprising the miRNA induces instability in the nucleic acid molecule (e.g., RNA, e.g., mRNA) comprising the miRNA binding site. In another embodiment, the miRNA binding site has imperfect complementarity so that a RISC complex comprising the miRNA represses transcription of the nucleic acid molecule (e.g., RNA, e.g., mRNA) comprising the miRNA binding site. In some embodiments, the miRNA binding site has one, two, three, four, five, six, seven, eight, nine, ten, eleven or twelve mismatch(es) from the corresponding miRNA. In some embodiments, the miRNA binding site has at least about ten, at least about eleven, at least about twelve, at least about thirteen, at least about fourteen, at least about fifteen, at least about sixteen, at least about seventeen, at least about eighteen, at least about nineteen, at least about twenty, or at least about twenty-one contiguous nucleotides complementary to at least about ten, at least about eleven, at least about twelve, at least about thirteen, at least about fourteen, at least about fifteen, at least about sixteen, at least about seventeen, at least about eighteen, at least about nineteen, at least about twenty, or at least about twenty-one, respectively, contiguous nucleotides of the corresponding miRNA. By engineering one or more miRNA binding sites into a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure, the nucleic acid molecule (e.g., RNA, e.g., mRNA) can be targeted for degradation or reduced translation, provided the miRNA in question is available. This can reduce off-target effects upon delivery of the nucleic acid molecule (e.g., RNA, e.g., mRNA). For example, if a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure is not intended to be delivered to a tissue or cell but ends up is said tissue or cell, then a miRNA abundant in the tissue or cell can inhibit the expression of the gene of interest if one or multiple binding sites of the miRNA are engineered into the 5′ UTR and / or 3′ UTR of the nucleic acid molecule (e.g., RNA, e.g., mRNA). In some embodiments, a miRNA binding site is inserted in the nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure in any position of the nucleic acid molecule (e.g., RNA, e.g., mRNA) (e.g., the 5’UTR and / or 3’ UTR). In some embodiments, the 5’UTR comprises a miRNA binding site. In some embodiments, the 3’ UTR comprises a miRNA binding site. In some embodiments, the 5’UTR and the 3’ UTR comprise a miRNA binding site. The insertion site in the nucleic acid molecule (e.g., RNA, e.g., mRNA) can be anywhere in the nucleic acid molecule (e.g., RNA, e.g., mRNA) as long as the insertion of the miRNA binding site in the nucleic acid molecule (e.g., RNA, e.g., mRNA) does not interfere with the translation of a functional polypeptide in the absence of the corresponding miRNA; and in the presence of the miRNA, the insertion of the miRNA binding site in the nucleic acid molecule (e.g., RNA, e.g., mRNA) and the binding of the miRNA binding site to the corresponding miRNA are capable of degrading the polynucleotide or preventing the translation of the nucleic acid molecule (e.g., RNA, e.g., mRNA). In some embodiments, a miRNA binding site is inserted in at least about 30 nucleotides downstream from the stop codon of an ORF in a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure comprising the ORF. In some embodiments, a miRNA binding site is inserted in at least about 10 nucleotides, at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 45 nucleotides, at least about 50 nucleotides, at least about 55 nucleotides, at least about 60 nucleotides, at least about 65 nucleotides, at least about 70 nucleotides, at least about 75 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides, or at least about 100 nucleotides downstream from the stop codon of an ORF in a polynucleotide of the disclosure. In some embodiments, a miRNA binding site is inserted in about 10 nucleotides to about 100 nucleotides, about 20 nucleotides to about 90 nucleotides, about 30 nucleotides to about 80 nucleotides, about 40 nucleotides to about 70 nucleotides, about 50 nucleotides to about 60 nucleotides, about 45 nucleotides to about 65 nucleotides downstream from the stop codon of an ORF in a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure. miRNA gene regulation can be influenced by the sequence surrounding the miRNA such as, but not limited to, the species of the surrounding sequence, the type of sequence (e.g., heterologous, homologous, exogenous, endogenous, or artificial), regulatory elements in the surrounding sequence and / or structural elements in the surrounding sequence. The miRNA can be influenced by the 5′ UTR and / or 3′ UTR. As a non-limiting example, a non-human 3′ UTR can increase the regulatory effect of the miRNA sequence on the expression of a polypeptide of interest compared to a human 3′ UTR of the same sequence type. At least one miRNA binding site can be engineered into the 3′ UTR of a polynucleotide of the disclosure. In this context, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more miRNA binding sites can be engineered into a 3′ UTR of a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure. For example, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 miRNA binding sites can be engineered into the 3′ UTR of a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure. In one embodiment, miRNA binding sites incorporated into a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure can be the same or can be different miRNA sites. A combination of different miRNA binding sites incorporated into a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure can include combinations in which more than one copy of any of the different miRNA sites are incorporated. In another embodiment, miRNA binding sites incorporated into a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure can target the same or different tissues in the body. As a non-limiting example, through the introduction of tissue-, cell-type-, or disease-specific miRNA binding sites in the 3′-UTR of a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure, the degree of expression in specific cell types (e.g., hepatocytes, myeloid cells, endothelial cells, cancer cells, etc.) can be reduced. In one embodiment, a miRNA binding site can be engineered near the 5′ terminus of the 3′ UTR, about halfway between the 5′ terminus and 3′ terminus of the 3′ UTR and / or near the 3′ terminus of the 3′ UTR in a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure. As a non-limiting example, a miRNA binding site can be engineered near the 5′ terminus of the 3′ UTR and about halfway between the 5′ terminus and 3′ terminus of the 3′ UTR. As another non-limiting example, a miRNA binding site can be engineered near the 3′ terminus of the 3′ UTR and about halfway between the 5′ terminus and 3′ terminus of the 3′ UTR. As yet another non- limiting example, a miRNA binding site can be engineered near the 5′ terminus of the 3′ UTR and near the 3′ terminus of the 3′ UTR. In another embodiment, a 3′ UTR can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding sites. The miRNA binding sites can be complementary to a miRNA, miRNA seed sequence, and / or miRNA sequences flanking the seed sequence. A nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure can be engineered for more targeted expression in specific tissues, cell types, or biological conditions based on the expression patterns of miRNAs in the different tissues, cell types, or biological conditions. Through introduction of tissue-specific miRNA binding sites, a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure can be designed for optimal protein expression in a tissue or cell, or in the context of a biological condition. In some embodiments, a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the disclosure can comprise at least one miRNA binding site (e.g., one or more miR142 binding sites) in the 3′ UTR in order to selectively degrade mRNA therapeutics in immune cells. Non-limiting examples of miRNA binding sites that can used in mRNAs the disclosure are: Table 3: miRNA binding site sequences In some embodiments, the 3’ UTR comprising one or more miR142 binding sites has a nucleotide sequence comprising the following sequence: In some embodiments, the 3’ UTR comprising one or more miR142 binding sites is least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or differing by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides therefrom, SEQ ID NO: 160. Regions having a 5′ Cap The disclosure also includes a polynucleotide that comprises both a 5′ Cap and a polynucleotide of the present invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a polypeptide to be expressed). The 5′ cap structure of a natural mRNA is involved in nuclear export, increasing mRNA stability and binds the mRNA Cap Binding Protein (CBP), which is responsible for mRNA stability in the cell and translation competency through the association of CBP with poly(A) binding protein to form the mature cyclic mRNA species. The cap further assists the removal of 5′ proximal introns during mRNA splicing. Endogenous mRNA molecules can be 5′-end capped generating a 5′-ppp-5′- triphosphate linkage between a terminal guanosine cap residue and the 5′-terminal transcribed sense nucleotide of the mRNA molecule. This 5′-guanylate cap can then be methylated to generate an N7-methyl-guanylate residue. The ribose sugars of the terminal and / or anteterminal transcribed nucleotides of the 5′ end of the mRNA can optionally also be 2′-O-methylated.5′-decapping through hydrolysis and cleavage of the guanylate cap structure can target a nucleic acid molecule, such as an mRNA molecule, for degradation. In some embodiments, the polynucleotides of the present invention (e.g., a polynucleotide comprising a nucleotide sequence encoding a polypeptide) incorporate a cap moiety. In some embodiments, polynucleotides of the present invention comprise a non-hydrolyzable cap structure preventing decapping and thus increasing mRNA half- life. Because cap structure hydrolysis requires cleavage of 5′-ppp-5′ phosphorodiester linkages, modified nucleotides can be used during the capping reaction. For example, a Vaccinia Capping Enzyme from New England Biolabs (Ipswich, MA) can be used with α-thio-guanosine nucleotides according to the manufacturer's instructions to create a phosphorothioate linkage in the 5′-ppp-5′ cap. Additional modified guanosine nucleotides can be used such as α-methyl-phosphonate and seleno-phosphate nucleotides. Additional modifications include, but are not limited to, 2′-O-methylation of the ribose sugars of 5′-terminal and / or 5′-anteterminal nucleotides of the polynucleotide (as mentioned above) on the 2′-hydroxyl group of the sugar ring. Multiple distinct 5′-cap structures can be used to generate the 5′-cap of a nucleic acid molecule, such as a polynucleotide that functions as an mRNA molecule. Cap analogs, which herein are also referred to as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, differ from natural (i.e., endogenous, wild-type or physiological) 5′-caps in their chemical structure, while retaining cap function. Cap analogs can be chemically (i.e., non-enzymatically) or enzymatically synthesized and / or linked to the polynucleotides of the invention. For example, the Anti-Reverse Cap Analog (ARCA) cap contains two guanines linked by a 5′-5′-triphosphate group, wherein one guanine contains an N7 methyl group as well as a 3′-O-methyl group (i.e., N7,3′-O-dimethyl-guanosine-5′- triphosphate-5′-guanosine (m7G-3′mppp-G; which can equivalently be designated 3′ O-Me-m7G(5′)ppp(5′)G). The 3′-O atom of the other, unmodified, guanine becomes linked to the 5′-terminal nucleotide of the capped polynucleotide. The N7- and 3′-O- methlyated guanine provides the terminal moiety of the capped polynucleotide. Another exemplary cap is mCAP, which is similar to ARCA but has a 2′-O- methyl group on guanosine (i.e., N7,2′-O-dimethyl-guanosine-5′-triphosphate-5′- guanosine, m7Gm-ppp-G). Another exemplary cap is m7G-ppp-Gm-A (i.e., N7,guanosine-5′-triphosphate- 2′-O-dimethyl-guanosine-adenosine). In some embodiments, the cap is a dinucleotide cap analog. As a non-limiting example, the dinucleotide cap analog can be modified at different phosphate positions with a boranophosphate group or a phosphoroselenoate group such as the dinucleotide cap analogs described in U.S. Patent No. US 8,519,110, the contents of which are herein incorporated by reference in its entirety. In another embodiment, the cap is a cap analog is a N7-(4- chlorophenoxyethyl) substituted dinucleotide form of a cap analog known in the art and / or described herein. Non-limiting examples of a N7-(4-chlorophenoxyethyl) substituted dinucleotide form of a cap analog include a N7-(4-chlorophenoxyethyl)- G(5′)ppp(5′)G and a N7-(4-chlorophenoxyethyl)-m3′-OG(5′)ppp(5′)G cap analog (See, e.g., the various cap analogs and the methods of synthesizing cap analogs described in Kore et al. Bioorganic & Medicinal Chemistry 201321:4570-4574; the contents of which are herein incorporated by reference in its entirety). In another embodiment, a cap analog of the present invention is a 4-chloro / bromophenoxyethyl analog. Polynucleotides of the invention can also be capped post-manufacture (whether IVT or chemical synthesis), using enzymes, in order to generate more authentic 5′-cap structures. As used herein, the phrase "more authentic" refers to a feature that closely mirrors or mimics, either structurally or functionally, an endogenous or wild type feature. That is, a "more authentic" feature is better representative of an endogenous, wild-type, natural or physiological cellular function and / or structure as compared to synthetic features or analogs, etc., of the prior art, or which outperforms the corresponding endogenous, wild-type, natural or physiological feature in one or more respects. Non-limiting examples of more authentic 5′cap structures of the present invention are those that, among other things, have enhanced binding of cap binding proteins, increased half-life, reduced susceptibility to 5′ endonucleases and / or reduced 5′decapping, as compared to synthetic 5′cap structures known in the art (or to a wild-type, natural or physiological 5′cap structure). For example, recombinant Vaccinia Virus Capping Enzyme and recombinant 2′-O- methyltransferase enzyme can create a canonical 5′-5′-triphosphate linkage between the 5′-terminal nucleotide of a polynucleotide and a guanine cap nucleotide wherein the cap guanine contains an N7 methylation and the 5′-terminal nucleotide of the mRNA contains a 2′-O-methyl. Such a structure is termed the Cap1 structure. This cap results in a higher translational-competency and cellular stability and a reduced activation of cellular pro-inflammatory cytokines, as compared, e.g., to other 5′cap analog structures known in the art. Cap structures include, but are not limited to, 7mG(5′)ppp(5′)N1pN2p (cap 0), 7mG(5′)ppp(5′)N1mpNp (cap 1), and 7mG(5′)- ppp(5′)N1mpN2mp (cap 2). As a non-limiting example, capping chimeric polynucleotides post- manufacture can be more efficient as nearly 100% of the chimeric polynucleotides can be capped. This is in contrast to ~80% when a cap analog is linked to a chimeric polynucleotide in the course of an in vitro transcription reaction. According to the present invention, 5′ terminal caps can include endogenous caps or cap analogs. According to the present invention, a 5′ terminal cap can comprise a guanine analog. Useful guanine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2′fluoro-guanosine, 7-deaza-guanosine, 8-oxo- guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine. Also provided herein are exemplary caps including those that can be used in co-transcriptional capping methods for ribonucleic acid (RNA) synthesis, using RNA polymerase, e.g., wild type RNA polymerase or variants thereof, e.g., such as those variants described herein. In one embodiment, caps can be added when RNA is produced in a “one-pot” reaction, without the need for a separate capping reaction. Thus, the methods, in some embodiments, comprise reacting a polynucleotide template with an RNA polymerase variant, nucleoside triphosphates, and a cap analog under in vitro transcription reaction conditions to produce RNA transcript. As used here the term “cap” includes the inverted G nucleotide and can comprise one or more additional nucleotides 3’ of the inverted G nucleotide, e.g., 1, 2, 3, or more nucleotides 3’ of the inverted G nucleotide and 5’ to the 5’ UTR, e.g., a 5’ UTR described herein. Exemplary caps comprise a sequence of GG, GA, or GGA, wherein the underlined, italicized G is an in inverted G nucleotide followed by a 5’-5’- triphosphate group. In one embodiment, a cap comprises a compound of formula (I)

[0005] (I), or a stereoisomer, tautomer or salt thereof, wherein ; ring B1is a modified or unmodified Guanine; ring B2 and ring B3 each independently is a nucleobase or a modified nucleobase; X2 is O, S(O)p, NR24 or CR25R26 in which p is 0, 1, or 2; Y0is O or CR6R7; Y1 is O, S(O)n, CR6R7, or NR8, in which n is 0, 1 , or 2; each --- is a single bond or absent, wherein when each --- is a single bond, Yi is O, S(O)n, CR6R7, or NR8; and when each --- is absent, Y1 is void; Y2is (OP(O)R4)min which m is 0, 1, or 2, or -O-(CR40R41)u-Q0-(CR42R43)v-, in which Q0 is a bond, O, S(O)r, NR44, or CR45R46, r is 0, 1 , or 2, and each of u and v independently is 1, 2, 3 or 4; each R2 and R2' independently is halo, LNA, or OR3; each R3independently is H, C1-C6alkyl, C2-C6alkenyl, or C2-C6alkynyl and R3, when being C1-C6 alkyl, C2-C6 alkenyl, or C2-C6 alkynyl, is optionally substituted with one or more of halo, OH and C1-C6 alkoxyl that is optionally substituted with one or more OH or OC(O)-C1-C6 alkyl; each R4 and R4' independently is H, halo, C1-C6 alkyl, OH, SH, SeH, or BH3-; each of R6, R7, and R8, independently, is -Q1-T1, in which Q1is a bond or C1- C3 alkyl linker optionally substituted with one or more of halo, cyano, OH and C1-C6 alkoxy, and T1is H, halo, OH, COOH, cyano, or Rs1, in which Rs1is C1-C3alkyl, C2- C6 alkenyl, C2-C6 alkynyl, C1- C6 alkoxyl, C(O)O-C1-C6 alkyl, C3-C8 cycloalkyl, C6- C10aryl, NR31R32, (NR31R32R33)+, 4 to 12- membered heterocycloalkyl, or 5- or 6- membered heteroaryl, and Rs1 is optionally substituted with one or more substituents selected from the group consisting of halo, OH, oxo, C1-C6alkyl, COOH, C(O)O-C1- C6 alkyl, cyano, C1-C6 alkoxyl, NR31R32, (NR31R32R33)+, C3-C8 cycloalkyl, C6- C10aryl, 4 to 12-membered heterocycloalkyl, and 5- or 6-membered heteroaryl; each of R10, R11, R12, R13 R14, and R15, independently, is -Q2-T2, in which Q2 is a bond or C1-C3alkyl linker optionally substituted with one or more of halo, cyano, OH and C1-C6 alkoxy, and T2 is H, halo, OH, NH2, cyano, NO2, N3, Rs2, or ORs2, in which Rs2is C1-C6alkyl, C2-C6alkenyl, C2-C6alkynyl, C3-C8cycloalkyl, C6-C10aryl, NHC(O)-C1-C6 alkyl, NR31R32, (NR31R32R33)+, 4 to 12-membered heterocycloalkyl, or 5- or 6-membered heteroaryl, and Rs2 is optionally substituted with one or more substituents selected from the group consisting of halo, OH, oxo, C1-C6alkyl, COOH, C(O)O-C1-C6 alkyl, cyano, C1 - C6 alkoxyl, NR31R32, (NR31R32R33)+, C3- C8cycloalkyl, C6-C10aryl, 4 to 12-membered heterocycloalkyl, and 5- or 6- membered heteroaryl; or alternatively R12 together with R14 is oxo, or R13 together with R15is oxo, each of R20, R21, R22, and R23 independently is -Q3-T3, in which Q3 is a bond or C1-C3alkyl linker optionally substituted with one or more of halo, cyano, OH and C1-C6 alkoxy, and T3 is H, halo, OH, NH2, cyano, NO2, N3, RS3, or ORS3, in which RS3is C1-C6alkyl, C2-C6alkenyl, C2-C6alkynyl, C3-C8cycloalkyl, C6-C10aryl, NHC(O)-C1-C6 alkyl, mono-C1-C6 alkylamino, di-C1-C6 alkylamino, 4 to 12- membered heterocycloalkyl, or 5- or 6-membered heteroaryl, and Rs3is optionally substituted with one or more substituents selected from the group consisting of halo, OH, oxo, C1-C6alkyl, COOH, C(O)O-C1-C6alkyl, cyano, C1-C6alkoxyl, amino, mono-C1-C6 alkylamino, di-C1-C6 alkylamino, C3-C8 cycloalkyl, C6-C10 aryl, 4 to 12- membered heterocycloalkyl, and 5- or 6-membered heteroaryl; each of R24, R25, and R26 independently is H or C1-C6 alkyl; each of R27 and R28 independently is H or OR29; or R27 and R28 together form O-R30-O; each R29independently is H, C1-C6alkyl, C2-C6alkenyl, or C2-C6alkynyl and R29, when being C1-C6 alkyl, C2-C6 alkenyl, or C2-C6 alkynyl, is optionally substituted with one or more of halo, OH and C1-C6alkoxyl that is optionally substituted with one or more OH or OC(O)-C1-C6 alkyl; R30is C1-C6alkylene optionally substituted with one or more of halo, OH and C1-C6 alkoxyl; each of R31, R32, and R33, independently is H, C1-C6alkyl, C3-C8cycloalkyl, C6-C10 aryl, 4 to 12-membered heterocycloalkyl, or 5- or 6-membered heteroaryl; each of R40, R41, R42, and R43independently is H, halo, OH, cyano, N3, OP(O)R47R48, or C1-C6 alkyl optionally substituted with one or more OP(O)R47R48, or one R41and one R43, together with the carbon atoms to which they are attached and Q0, form C4-C10 cycloalkyl, 4- to 14-membered heterocycloalkyl, C6-C10 aryl, or 5- to 14-membered heteroaryl, and each of the cycloalkyl, heterocycloalkyl, phenyl, or 5- to 6-membered heteroaryl is optionally substituted with one or more of OH, halo, cyano, N3, oxo, OP(O)R47R48, C1-C6 alkyl, C1-C6 haloalkyl, COOH, C(O)O-C1-C6 alkyl, C1-C6alkoxyl, C1-C6haloalkoxyl, amino, mono-C1-C6alkylamino, and di-C1- C6 alkylamino; R44is H, C1-C6alkyl, or an amine protecting group; each of R45 and R46 independently is H, OP(O)R47R48, or C1-C6 alkyl optionally substituted with one or more OP(O)R47R48, and each of R47 and R48, independently is H, halo, C1-C6 alkyl, OH, SH, SeH, or BH3. It should be understood that a cap analog, as provided herein, may include any of the cap analogs described in international publication WO 2017 / 066797, published on 20 April 2017, incorporated by reference herein in its entirety. In some embodiments, the B2middle position can be a non-ribose molecule, such as arabinose. In some embodiments R2is ethyl-based. Thus, in some embodiments, a cap comprises the following structure:

[0006] (II) In other embodiments, a cap comprises the following structure: (III)

[0007] In yet other embodiments, a cap comprises the following structure: (IV) In still other embodiments, a cap comprises the following structure: (V) In some embodiments, R is an alkyl (e.g., C1-C6alkyl). In some embodiments, R is a methyl group (e.g., C1 alkyl). In some embodiments, R is an ethyl group (e.g., C2alkyl). In some embodiments, a cap comprises a sequence selected from the following sequences: GAA, GAC, GAG, GAU, GCA, GCC, GCG, GCU, GGA , GGC, GGG, GGU, GUA, GUC, GUG, and GUU. In some embodiments, a cap comprises GAA. In some embodiments, a cap comprises GAC. In some embodiments, a cap comprises GAG. In some embodiments, a cap comprises GAU. In some embodiments, a cap comprises GCA. In some embodiments, a cap comprises GCC. In some embodiments, a cap comprises GCG. In some embodiments, a cap comprises GCU. In some embodiments, a cap comprises GGA. In some embodiments, a cap comprises GGC. In some embodiments, a cap comprises GGG. In some embodiments, a cap comprises GGU. In some embodiments, a cap comprises GUA. In some embodiments, a cap comprises GUC. In some embodiments, a cap comprises GUG. In some embodiments, a cap comprises GUU. In some embodiments, a cap comprises a sequence selected from the following sequences: m7GpppApA, m7GpppApC, m7GpppApG, m7GpppApU, m7GpppCpA, m7GpppCpC, m7GpppCpG, m7GpppCpU, m7GpppGpA, m7GpppGpC, m7GpppGpG, m7GpppGpU, m7GpppUpA, m7GpppUpC, m7GpppUpG, and m7GpppUpU. In some embodiments, a cap comprises m7GpppApA. In some embodiments, a cap comprises m7GpppApC. In some embodiments, a cap comprises m7GpppApG. In some embodiments, a cap comprises m7GpppApU. In some embodiments, a cap comprises m7GpppCpA. In some embodiments, a cap comprises m7GpppCpC. In some embodiments, a cap comprises m7GpppCpG. In some embodiments, a cap comprises m7GpppCpU. In some embodiments, a cap comprises m7GpppGpA. In some embodiments, a cap comprises m7GpppGpC. In some embodiments, a cap comprises m7GpppGpG. In some embodiments, a cap comprises m7GpppGpU. In some embodiments, a cap comprises m7GpppUpA. In some embodiments, a cap comprises m7GpppUpC. In some embodiments, a cap comprises m7GpppUpG. In some embodiments, a cap comprises m7GpppUpU. A cap, in some embodiments, comprises a sequence selected from the following sequences: m7G3^OMepppApA, m7G3^OMepppApC, m7G3^OMepppApG, m7G3^OMepppApU, m7G3^OMepppCpA, m7G3^OMepppCpC, m7G3^OMepppCpG, m7G3^OMepppCpU, m7G3^OMepppGpA, m7G3^OMepppGpC, m7G3^OMepppGpG, m7G3^OMepppGpU, m7G3^OMepppUpA, m7G3^OMepppUpC, m7G3^OMepppUpG, and m7G3^OMepppUpU. In some embodiments, a cap comprises m7G3^OMepppApA. In some embodiments, a cap comprises m7G3^OMepppApC. In some embodiments, a cap comprises m7G3^OMepppApG. In some embodiments, a cap comprises m7G3^OMepppApU. In some embodiments, a cap comprises m7G3^OMepppCpA. In some embodiments, a cap comprises m7G3^OMepppCpC. In some embodiments, a cap comprises m7G3^OMepppCpG. In some embodiments, a cap comprises m7G3^OMepppCpU. In some embodiments, a cap comprises m7G3^OMepppGpA. In some embodiments, a cap comprises m7G3^OMepppGpC. In some embodiments, a cap comprises m7G3^OMepppGpG. In some embodiments, a cap comprises m7G3^OMepppGpU. In some embodiments, a cap comprises m7G3^OMepppUpA. In some embodiments, a cap comprises m7G3^OMepppUpC. In some embodiments, a cap comprises m7G3^OMepppUpG. In some embodiments, a cap comprises m7G3^OMepppUpU. A cap, in other embodiments, comprises a sequence selected from the following sequences: m7G3^OMepppA2^OMepA, m7G3^OMepppA2^OMepC, m7G3^OMepppA2^OMepG, m7G3^OMepppA2^OMepU, m7G3^OMepppC2^OMepA, m7G3^OMepppC2^OMepC, m7G3^OMepppC2^OMepG, m7G3^OMepppC2^OMepU, m7G3^OMepppG2^OMepA, m7G3^OMepppG2^OMepC, m7G3^OMepppG2^OMepG, m7G3^OMepppG2^OMepU, m7G3^OMepppU2^OMepA, m7G3^OMepppU2^OMepC, m7G3^OMepppU2^OMepG, and m7G3^OMepppU2^OMepU. In some embodiments, a cap comprises m7G3^OMepppA2^OMepA. In some embodiments, a cap comprises m7G3^OMepppA2^OMepC. In some embodiments, a cap comprises m7G3^OMepppA2^OMepG. In some embodiments, a cap comprises m7G3^OMepppA2^OMepU. In some embodiments, a cap comprises m7G3^OMepppC2^OMepA. In some embodiments, a cap comprises m7G3^OMepppC2^OMepC. In some embodiments, a cap comprises m7G3^OMepppC2^OMepG. In some embodiments, a cap comprises m7G3^OMepppC2^OMepU. In some embodiments, a cap comprises m7G3^OMepppG2^OMepA. In some embodiments, a cap comprises m7G3^OMepppG2^OMepC. In some embodiments, a cap comprises m7G3^OMepppG2^OMepG. In some embodiments, a cap comprises m7G3^OMepppG2^OMepU. In some embodiments, a cap comprises m7G3^OMepppU2^OMepA. In some embodiments, a cap comprises m7G3^OMepppU2^OMepC. In some embodiments, a cap comprises m7G3^OMepppU2^OMepG. In some embodiments, a cap comprises m7G3^OMepppU2^OMepU. A cap, in still other embodiments, comprises a sequence selected from the following sequences: m7GpppA2^OMepA, m7GpppA2^OMepC, m7GpppA2^OMepG, m7GpppA2^OMepU, m7GpppC2^OMepA, m7GpppC2^OMepC, m7GpppC2^OMepG, m7GpppC2^OMepU, m7GpppG2^OMepA, m7GpppG2^OMepC, m7GpppG2^OMepG, m7GpppG2^OMepU, m7GpppU2^OMepA, m7GpppU2^OMepC, m7GpppU2^OMepG, and m7GpppU2^OMepU. In some embodiments, a cap comprises m7GpppA2^OMepA. In some embodiments, a cap comprises m7GpppA2^OMepC. In some embodiments, a cap comprises m7GpppA2^OMepG. In some embodiments, a cap comprises m7GpppA2^OMepU. In some embodiments, a cap comprises m7GpppC2^OMepA. In some embodiments, a cap comprises m7GpppC2^OMepC. In some embodiments, a cap comprises m7GpppC2^OMepG. In some embodiments, a trinucleotide cap comprises m7GpppC2^OMepU. In some embodiments, a cap comprises m7GpppG2^OMepA. In some embodiments, a cap comprises m7GpppG2^OMepC. In some embodiments, a cap comprises m7GpppG2^OMepG. In some embodiments, a cap comprises m7GpppG2^OMepU. In some embodiments, a cap comprises m7GpppU2^OMepA. In some embodiments, a cap comprises m7GpppU2^OMepC. In some embodiments, a cap comprises m7GpppU2^OMepG. In some embodiments, a cap comprises m7GpppU2^OMepU. In some embodiments, a cap comprises m7Gpppm6A2’OmepG. In some embodiments, a cap comprises m7Gpppe6A2’OmepG. In some embodiments, a cap comprises GAG. In some embodiments, a cap comprises GCG. In some embodiments, a cap comprises GUG. In some embodiments, a cap comprises GGG. In some embodiments, a cap comprises any one of the following structures: (VI); (VII); or (VIII). In some embodiments, the cap comprisesm7GpppN1N2N3, where N1, N2, and N3are optional (i.e., can be absent or one or more can be present) and are independently a natural, a modified, or an unnatural nucleoside base. In some embodiments,m7G is further methylated, e.g., at the 3’ position. In some embodiments, them7G comprises an O-methyl at the 3’ position. In some embodiments N1, N2, and N3if present, optionally, are independently an adenine, a uracil, a guanidine, a thymine, or a cytosine. In some embodiments, one or more (or all) of N1, N2, and N3, if present, are methylated, e.g., at the 2’ position. In some embodiments, one or more (or all) of N1, N2, and N3, if present have an O-methyl at the 2’ position. In some embodiments, the cap comprises the following structure:

[0008] ĨIX) wherein B1, B2, and B3 are independently a natural, a modified, or an unnatural nucleoside based; and R1, R2, R3, and R4 are independently OH or O- methyl. In some embodiments, R3 is O-methyl and R4 is OH. In some embodiments, R3 and R4 are O-methyl. In some embodiments, R4 is O-methyl. In some embodiments, R1is OH, R2is OH, R3is O-methyl, and R4is OH. In some embodiments, R1 is OH, R2 is OH, R3 is O-methyl, and R4 is O-methyl. In some embodiments, at least one of R1and R2is O-methyl, R3is O-methyl, and R4is OH. In some embodiments, at least one of R1 and R2 is O-methyl, R3 is O-methyl, and R4 is O-methyl. In some embodiments, B1, B3, and B3 are natural nucleoside bases. In some embodiments, at least one of B1, B2, and B3is a modified or unnatural base. In some embodiments, at least one of B1, B2, and B3 is N6-methyladenine. In some embodiments, B1is adenine, cytosine, thymine, or uracil. In some embodiments, B1is adenine, B2 is uracil, and B3 is adenine. In some embodiments, R1 and R2 are OH, R3and R4are O-methyl, B1is adenine, B2is uracil, and B3is adenine. In some embodiments the cap comprises a sequence selected from the following sequences: GAAA, GACA, GAGA, GAUA, GCAA, GCCA, GCGA, GCUA, GGAA, GGCA, GGGA, GGUA, GUCA, and GUUA. In some embodiments the cap comprises a sequence selected from the following sequences: GAAG, GACG, GAGG, GAUG, GCAG, GCCG, GCGG, GCUG, GGAG, GGCG, GGGG, GGUG, GUCG, GUGG, and GUUG. In some embodiments the cap comprises a sequence selected from the following sequences: GAAU, GACU, GAGU, GAUU, GCAU, GCCU, GCGU, GCUU, GGAU, GGCU, GGGU, GGUU, GUAU, GUCU, GUGU, and GUUU. In some embodiments the cap comprises a sequence selected from the following sequences: GAAC, GACC, GAGC, GAUC, GCAC, GCCC, GCGC, GCUC, GGAC, GGCC, GGGC, GGUC, GUAC, GUCC, GUGC, and GUUC. A cap, in some embodiments, comprises a sequence selected from the following sequences: m7G3^OMepppApApN, m7G3^OMepppApCpN, m7G3^OMepppApGpN, m7G3^OMepppApUpN, m7G3^OMepppCpApN, m7G3^OMepppCpCpN, m7G3^OMepppCpGpN, m7G3^OMepppCpUpN, m7G3^OMepppGpApN, m7G3^OMepppGpCpN, m7G3^OMepppGpGpN, m7G3^OMepppGpUpN, m7G3^OMepppUpApN, m7G3^OMepppUpCpN, m7G3^OMepppUpGpN, and m7G3^OMepppUpUpN, where N is a natural, a modified, or an unnatural nucleoside base. A cap, in other embodiments, comprises a sequence selected from the following sequences: m7G3^OMepppA2^OMepApN, m7G3^OMepppA2^OMepCpN, m7G3^OMepppA2^OMepGpN, m7G3^OMepppA2^OMepUpN, m7G3^OMepppC2^OMepApN, m7G3^OMepppC2^OMepCpN, m7G3^OMepppC2^OMepGpN, m7G3^OMepppC2^OMepUpN, m7G3^OMepppG2^OMepApN, m7G3^OMepppG2^OMepCpN, m7G3^OMepppG2^OMepGpN, m7G3^OMepppG2^OMepUpN, m7G3^OMepppU2^OMepApN, m7G3^OMepppU2^OMepCpN, m7G3^OMepppU2^OMepGpN, and m7G3^OMepppU2^OMepUpN, where N is a natural, a modified, or an unnatural nucleoside base. A cap, in still other embodiments, comprises a sequence selected from the following sequences: m7GpppA2^OMepApN, m7GpppA2^OMepCpN, m7GpppA2^OMepGpN, m7GpppA2^OMepUpN, m7GpppC2^OMepApN, m7GpppC2^OMepCpN, m7GpppC2^OMepGpN, m7GpppC2^OMepUpN, m7GpppG2^OMepApN, m7GpppG2^OMepCpN, m7GpppG2^OMepGpN, m7GpppG2^OMepUpN, m7GpppU2^OMepApN, m7GpppU2^OMepCpN, m7GpppU2^OMepGpN, and m7GpppU2^OMepUpN, where N is a natural, a modified, or an unnatural nucleoside base. A cap, in other embodiments, comprises a sequence selected from the following sequences: m7G3^OMepppA2^OMepA2^OMepN, m7G3^OMepppA2^OMepC2^OMepN, m7G3^OMepppA2^OMepG2^OMepN, m7G3^OMepppA2^OMepU2^OMepN, m7G3^OMepppC2^OMepA2^OMepN, m7G3^OMepppC2^OMepC2^OMepN, m7G3^OMepppC2^OMepG2^OMepN, m7G3^OMepppC2^OMepU2^OMepN, m7G3^OMepppG2^OMepA2^OMepN, m7G3^OMepppG2^OMepC2^OMepN, m7G3^OMepppG2^OMepG2^OMepN, m7G3^OMepppG2^OMepU2^OMepN, m7G3^OMepppU2^OMepA2^OMepN, m7G3^OMepppU2^OMepC2^OMepN, m7G3^OMepppU2^OMepG2^OMepN, and m7G3^OMepppU2^OMepU2^OMepN, where N is a natural, a modified, or an unnatural nucleoside base. A cap, in still other embodiments, comprises a sequence selected from the following sequences: m7GpppA2^OMepA2^OMepN, m7GpppA2^OMepC2^OMepN, m7GpppA2^OMepG2^OMepN, m7GpppA2^OMepU2^OMepN, m7GpppC2^OMepA2^OMepN, m7GpppC2^OMepC2^OMepN, m7GpppC2^OMepG2^OMepN, m7GpppC2^OMepU2^OMepN, m7GpppG2^OMepA2^OMepN, m7GpppG2^OMepC2^OMepN, m7GpppG2^OMepG2^OMepN, m7GpppG2^OMepU2^OMepN, m7GpppU2^OMepA2^OMepN, m7GpppU2^OMepC2^OMepN, m7GpppU2^OMepG2^OMepN, and m7GpppU2^OMepU2^OMepN, where N is a natural, a modified, or an unnatural nucleoside base. In some embodiments, a cap comprises GGAG. In some embodiments, a cap comprises the following structure: (X). Poly-A Tails In some embodiments, the polynucleotides of the present disclosure (e.g., a polynucleotide comprising a nucleotide sequence encoding a polypeptide) further comprise a poly-A tail. In further embodiments, terminal groups on the poly-A tail can be incorporated for stabilization. In other embodiments, a poly-A tail comprises des-3′ hydroxyl tails. During RNA processing, a long chain of adenine nucleotides (poly-A tail) can be added to a polynucleotide such as an mRNA molecule in order to increase stability. Immediately after transcription, the 3′ end of the transcript can be cleaved to free a 3′ hydroxyl. Then poly-A polymerase adds a chain of adenine nucleotides to the RNA. The process, called polyadenylation, adds a poly-A tail that can be between, for example, approximately 80 to approximately 250 residues long, including approximately 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240 or 250 residues long. In one embodiment, the poly-A tail is 100 nucleotides in length (SEQ ID NO:195). PolyA tails can also be added after the construct is exported from the nucleus. According to the present invention, terminal groups on the poly A tail can be incorporated for stabilization. Polynucleotides of the present invention can include des-3′ hydroxyl tails. They can also include structural moieties or 2'-Omethyl modifications as taught by Junjie Li, et al. (Current Biology, Vol.15, 1501–1507, August 23, 2005, the contents of which are incorporated herein by reference in its entirety). The polynucleotides of the present invention can be designed to encode transcripts with alternative polyA tail structures including histone mRNA. According to Norbury, "Terminal uridylation has also been detected on human replication- dependent histone mRNAs. The turnover of these mRNAs is thought to be important for the prevention of potentially toxic histone accumulation following the completion or inhibition of chromosomal DNA replication. These mRNAs are distinguished by their lack of a 3ʹ poly(A) tail, the function of which is instead assumed by a stable stem–loop structure and its cognate stem–loop binding protein (SLBP); the latter carries out the same functions as those of PABP on polyadenylated mRNAs" (Norbury, "Cytoplasmic RNA: a case of the tail wagging the dog," Nature Reviews Molecular Cell Biology; AOP, published online 29 August 2013; doi:10.1038 / nrm3645) the contents of which are incorporated herein by reference in its entirety. Unique poly-A tail lengths provide certain advantages to the polynucleotides of the present invention. Generally, the length of a poly-A tail, when present, is greater than 30 nucleotides in length. In another embodiment, the poly-A tail is greater than 35 nucleotides in length (e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides). In some embodiments, the polynucleotide or region thereof includes from about 30 to about 3,000 nucleotides (e.g., from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 750, from 30 to 1,000, from 30 to 1,500, from 30 to 2,000, from 30 to 2,500, from 50 to 100, from 50 to 250, from 50 to 500, from 50 to 750, from 50 to 1,000, from 50 to 1,500, from 50 to 2,000, from 50 to 2,500, from 50 to 3,000, from 100 to 500, from 100 to 750, from 100 to 1,000, from 100 to 1,500, from 100 to 2,000, from 100 to 2,500, from 100 to 3,000, from 500 to 750, from 500 to 1,000, from 500 to 1,500, from 500 to 2,000, from 500 to 2,500, from 500 to 3,000, from 1,000 to 1,500, from 1,000 to 2,000, from 1,000 to 2,500, from 1,000 to 3,000, from 1,500 to 2,000, from 1,500 to 2,500, from 1,500 to 3,000, from 2,000 to 3,000, from 2,000 to 2,500, and from 2,500 to 3,000). In some embodiments, the poly-A tail is designed relative to the length of the overall polynucleotide or the length of a particular region of the polynucleotide. This design can be based on the length of a coding region, the length of a particular feature or region or based on the length of the ultimate product expressed from the polynucleotides. In this context, the poly-A tail can be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% greater in length than the polynucleotide or feature thereof. The poly-A tail can also be designed as a fraction of the polynucleotides to which it belongs. In this context, the poly-A tail can be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the construct, a construct region or the total length of the construct minus the poly-A tail. Further, engineered binding sites and conjugation of polynucleotides for Poly-A binding protein can enhance expression. Additionally, multiple distinct polynucleotides can be linked together via the PABP (Poly-A binding protein) through the 3′-end using modified nucleotides at the 3′-terminus of the poly-A tail. Transfection experiments can be conducted in relevant cell lines at and protein production can be assayed by ELISA at 12hr, 24hr, 48hr, 72hr and day 7 post-transfection. In some embodiments, the polynucleotides of the present invention are designed to include a polyA-G Quartet region. The G-quartet is a cyclic hydrogen bonded array of four guanine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In this embodiment, the G-quartet is incorporated at the end of the poly-A tail. The resultant polynucleotide is assayed for stability, protein production and other parameters including half-life at various time points. It has been discovered that the polyA-G quartet results in protein production from an mRNA equivalent to at least 75% of that seen using a poly-A tail of 120 nucleotides alone (SEQ ID NO:196). In some embodiments, the polyA tail comprises an alternative nucleoside, e.g., inverted thymidine. PolyA tails comprising an alternative nucleoside, e.g., inverted thymidine, may be generated as described herein. For instance, mRNA constructs may be modified by ligation to stabilize the poly(A) tail. Ligation may be performed using 0.5-1.5 mg / mL mRNA (5′ Cap1, 3′ A100), 50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM TCEP, 1000 units / mL T4 RNA Ligase 1, 1 mM ATP, 20% w / v polyethylene glycol 8000, and 5:1 molar ratio of modifying oligo to mRNA. Modifying oligo has a sequence of 5’-phosphate-AAAAAAAAAAAAAAAAAAAA- (inverted deoxythymidine (idT) (SEQ ID NO:209)) (see below). Ligation reactions are mixed and incubated at room temperature (~22°C) for, e.g., 4 hours. Stable tail mRNA are purified by, e.g., dT purification, reverse phase purification, hydroxyapatite purification, ultrafiltration into water, and sterile filtration. The resulting stable tail-containing mRNAs contain the following structure at the 3’end, starting with the polyA region: A100-UCUAGAAAAAAAAAAAAAAAAAAAA- inverted deoxythymidine (SEQ ID NO:211). Modifying oligo to stabilize tail (5’-phosphate- AAAAAAAAAAAAAAAAAAAA-(inverted deoxythymidine)(SEQ ID NO:209)): In some instances, the polyA tail comprises A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211). In some instances, the polyA tail consists of A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211). Start codon region The invention also includes a polynucleotide that comprises both a start codon region and the polynucleotide described herein (e.g., a polynucleotide encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria, such as GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and FECH). In some embodiments, the polynucleotides of the present invention can have regions that are analogous to or function like a start codon region. In some embodiments, the translation of a polynucleotide can initiate on a codon that is not the start codon AUG. Translation of the polynucleotide can initiate on an alternative start codon such as, but not limited to, ACG, AGG, AAG, CTG / CUG, GTG / GUG, ATA / AUA, ATT / AUU, TTG / UUG (see Touriol et al. Biology of the Cell 95 (2003) 169-178 and Matsuda and Mauro PLoS ONE, 2010 5:11; the contents of each of which are herein incorporated by reference in its entirety). As a non-limiting example, the translation of a polynucleotide begins on the alternative start codon ACG. As another non-limiting example, polynucleotide translation begins on the alternative start codon CTG or CUG. As yet another non- limiting example, the translation of a polynucleotide begins on the alternative start codon GTG or GUG. Nucleotides flanking a codon that initiates translation such as, but not limited to, a start codon or an alternative start codon, are known to affect the translation efficiency, the length and / or the structure of the polynucleotide. (See, e.g., Matsuda and Mauro PLoS ONE, 20105:11; the contents of which are herein incorporated by reference in its entirety). Masking any of the nucleotides flanking a codon that initiates translation can be used to alter the position of translation initiation, translation efficiency, length and / or structure of a polynucleotide. In some embodiments, a masking agent can be used near the start codon or alternative start codon in order to mask or hide the codon to reduce the probability of translation initiation at the masked start codon or alternative start codon. Non-limiting examples of masking agents include antisense locked nucleic acids (LNA) polynucleotides and exon-junction complexes (EJCs) (See, e.g., Matsuda and Mauro describing masking agents LNA polynucleotides and EJCs (PLoS ONE, 20105:11); the contents of which are herein incorporated by reference in its entirety). In another embodiment, a masking agent can be used to mask a start codon of a polynucleotide in order to increase the likelihood that translation will initiate on an alternative start codon. In some embodiments, a masking agent can be used to mask a first start codon or alternative start codon in order to increase the chance that translation will initiate on a start codon or alternative start codon downstream to the masked start codon or alternative start codon. In some embodiments, a start codon or alternative start codon can be located within a perfect complement for a miRNA binding site. The perfect complement of a miRNA binding site can help control the translation, length and / or structure of the polynucleotide similar to a masking agent. As a non-limiting example, the start codon or alternative start codon can be located in the middle of a perfect complement for a miRNA binding site. The start codon or alternative start codon can be located after the first nucleotide, second nucleotide, third nucleotide, fourth nucleotide, fifth nucleotide, sixth nucleotide, seventh nucleotide, eighth nucleotide, ninth nucleotide, tenth nucleotide, eleventh nucleotide, twelfth nucleotide, thirteenth nucleotide, fourteenth nucleotide, fifteenth nucleotide, sixteenth nucleotide, seventeenth nucleotide, eighteenth nucleotide, nineteenth nucleotide, twentieth nucleotide or twenty-first nucleotide. In another embodiment, the start codon of a polynucleotide can be removed from the polynucleotide sequence in order to have the translation of the polynucleotide begin on a codon that is not the start codon. Translation of the polynucleotide can begin on the codon following the removed start codon or on a downstream start codon or an alternative start codon. In a non-limiting example, the start codon ATG or AUG is removed as the first 3 nucleotides of the polynucleotide sequence in order to have translation initiate on a downstream start codon or alternative start codon. The polynucleotide sequence where the start codon was removed can further comprise at least one masking agent for the downstream start codon and / or alternative start codons in order to control or attempt to control the initiation of translation, the length of the polynucleotide and / or the structure of the polynucleotide. Stop Codon Region The invention also includes a polynucleotide that comprises both a stop codon region (also referred to herein as “stop element” or “stop cassette”) and the polynucleotide described herein (e.g., a polynucleotide encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria such as GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and FECH). In some embodiments, the polynucleotides of the present invention can include at least two stop codons before the 3′ untranslated region (UTR). The stop codon can be selected from TGA, TAA and TAG in the case of DNA, or from UGA, UAA and UAG in the case of RNA. In some embodiments, the polynucleotides of the present invention include the stop codon TGA in the case or DNA, or the stop codon UGA in the case of RNA, and one additional stop codon. In a further embodiment the addition stop codon can be TAA or UAA. In another embodiment, the polynucleotides of the present invention include three consecutive stop codons, four stop codons, or more. In some embodiments the stop codon region includes the following sequence: UAAAGCUCCCCGGGG (SEQ ID NO:300). Combination of mRNA elements Any of the polynucleotides disclosed herein can comprise one, two, three, or all of the following elements: (a) a 5’-UTR, e.g., as described herein; (b) a coding region comprising a stop element (e.g., as described herein); (c) a 3’-UTR (e.g., as described herein) and; optionally (d) a 3’ stabilizing region, e.g., as described herein. Also disclosed herein are LNP compositions comprising the same. In an embodiment, a polynucleotide of the disclosure comprises (a) a 5’ UTR described in Table 1 or a variant or fragment thereof, (b) a coding region as described herein, and (c) a 3’ UTR described in Table 2 or a variant or fragment thereof. In some embodiments, the 3′ UTR comprises a micro RNA (miRNA) binding site, e.g., as described in Table 3 or a variant or fragment thereof, which binds to a miR present in a human cell. In an embodiment, a polynucleotide of the disclosure comprises (a) a 5’ UTR described in Table 1 or a variant or fragment thereof, (b) an open ready frame encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria (e.g., any of the polypeptides described herein such as, a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide), and (c) a 3’ UTR, wherein the 3’ UTR includes a nucleotide sequence having at least 95% identity (e.g., at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, 100% identity) to the sequence of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91). In an embodiment, the 3’ UTR 3’ UTR further comprises the sequence set forth in CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91). In an embodiment, the 3’ UTR 3’ UTR further comprises the sequence set forth in UAAAGCUCCCCGGGG (SEQ ID NO:300), wherein the sequence is located at the 5’ end of the 3’ UTR immediately 3’ of the last codon of the open reading frame. In an embodiment, the 3’ UTR comprises the nucleotide sequence set forth in UAAAGCUCCCCGGGGGCCUCCACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGG AACGGGUCGGCGG (SEQ ID NO:212). In an embodiment, the 3’ UTR comprises the nucleotide sequence set forth in UAAAGCUCCCCGGGGGCCUCCACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGG AACGGGUCGGCGGGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO:142). In an embodiment, the polynucleotide further comprises a 5’ terminal cap. In an embodiment, the polynucleotide further comprises a poly A tail, e.g., as described herein. In an embodiment, the polynucleotide further comprises a 3’ stabilizing region, e.g., as described herein. Polynucleotides Comprising mRNAs Encoding a Polypeptide that is Translated at the Endoplasmic Reticulum or Mitochondria In certain embodiments, a polynucleotide (e.g., mRNA) of the present disclosure comprises from 5′ to 3′ end: (i) a 5′ UTR; (ii) an ORF encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria (e.g., any of the polypeptides described herein such as, a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide); and (v) a 3′ UTR comprising a nucleotide sequence having at least 95% identity (e.g., at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, 100% identity) to the sequence of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), wherein all of the uracils of the mRNA are N1-methylpseudouracils. In certain embodiments, a polynucleotide (e.g., mRNA) of the present disclosure comprises from 5′ to 3′ end: (i) a 5′ UTR; (ii) an ORF encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria (e.g., any of the polypeptides described herein such as, a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide); and (v) a 3′ UTR comprising the nucleotide sequence of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), wherein all of the uracils of the mRNA are N1-methylpseudouracils. In certain embodiments, a polynucleotide (e.g., mRNA) of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a GLA polypeptide, comprises from 5′ to 3′ end: (i) a 5′ UTR; (ii) an ORF encoding a GLA polypeptide (e.g., SEQ ID NO:226); and (v) a 3′ UTR comprising a nucleotide sequence having at least 95% identity (e.g., at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, 100% identity) to the sequence of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), wherein all of the uracils of the mRNA are N1-methylpseudouracils. In certain embodiments, a polynucleotide (e.g., mRNA) of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a GLA polypeptide, comprises from 5′ to 3′ end: (i) a 5′ UTR; (ii) an ORF encoding a GLA polypeptide (e.g., SEQ ID NO:226); and (v) a 3′ UTR comprising the nucleotide of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), wherein all of the uracils of the mRNA are N1-methylpseudouracils. In some embodiments, a GLA polynucleotide of the present disclosure comprises a nucleotide sequence encoding a polypeptide sequence at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% , at least 97%, at least 98%, at least 99%, or 100% identical to a GLA protein sequence having the amino acid sequence of SEQ ID NO:226. In some embodiments, the ORF encoding a GLA polypeptide has at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence of SEQ ID NO:167. In some embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a polypeptide, comprises (1) a 5′ cap such as provided above, for example, m7Gp-ppGm-A, (2) a 5′ UTR, (3) a nucleotide sequence ORF of SEQ ID NO:167, (3) a stop codon, (4) a 3′UTR, and (5) a poly-A tail provided above, for example, a poly-A tail of SEQ ID NO:195 or A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211). An exemplary GLA nucleotide construct is described, consists from 5’ to 3’ end: 5' UTR of SEQ ID NO:50, ORF of SEQ ID NO:167, and 3' UTR of SEQ ID NO:142. The construct has a m7Gp-ppGm- cap and a poly-A tail of SEQ ID NO:195. In certain embodiments, all uracils in the construct are N1-methylpseudouracils. In certain embodiments, a polynucleotide (e.g., mRNA) of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a hUGT1A1 polypeptide, comprises from 5′ to 3′ end: (i) a 5′ UTR; (ii) an ORF encoding a hUGT1A1 polypeptide (e.g., SEQ ID NO:227); and (v) a 3′ UTR comprising a nucleotide sequence having at least 95% identity (e.g., at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, 100% identity) to the sequence of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), wherein all of the uracils of the mRNA are N1-methylpseudouracils. In certain embodiments, a polynucleotide (e.g., mRNA) of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a hUGT1A1 polypeptide, comprises from 5′ to 3′ end: (i) a 5′ UTR; (ii) an ORF encoding a hUGT1A1 polypeptide (e.g., SEQ ID NO:227); and (v) a 3′ UTR comprising the nucleotide of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), wherein all of the uracils of the mRNA are N1-methylpseudouracils. In some embodiments, a hUGT1A1 polynucleotide of the present disclosure comprises a nucleotide sequence encoding a polypeptide sequence at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% , at least 97%, at least 98%, at least 99%, or 100% identical to a hUGT1A1 protein sequence having the amino acid sequence of SEQ ID NO:227. In some embodiments, the ORF encoding a hUGT1A1 polypeptide has at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence of SEQ ID NO:168. In some embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a polypeptide, comprises (1) a 5′ cap such as provided above, for example, m7Gp-ppGm-A, (2) a 5′ UTR, (3) a nucleotide sequence ORF of SEQ ID NO:168, (3) a stop codon, (4) a 3′UTR, and (5) a poly-A tail provided above, for example, a poly-A tail of SEQ ID NO:195 or A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211). An exemplary hUGT1A1 nucleotide construct is described, consists from 5’ to 3’ end: 5' UTR of SEQ ID NO:50, ORF of SEQ ID NO:168, and 3' UTR of SEQ ID NO:160. The construct has a m7Gp-ppGm- cap and a poly-A tail of SEQ ID NO:195. In certain embodiments, all uracils in the construct are N1-methylpseudouracils. In certain embodiments, a polynucleotide (e.g., mRNA) of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a G6PC polypeptide, comprises from 5′ to 3′ end: (i) a 5′ UTR; (ii) an ORF encoding a G6PC polypeptide (e.g., SEQ ID NO:228 or SEQ ID NO: 230); and (v) a 3′ UTR comprising a nucleotide sequence having at least 95% identity (e.g., at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, 100% identity) to the sequence of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), wherein all of the uracils of the mRNA are N1-methylpseudouracils. In certain embodiments, a polynucleotide (e.g., mRNA) of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a G6PC polypeptide, comprises from 5′ to 3′ end: (i) a 5′ UTR; (ii) an ORF encoding a G6PC polypeptide (e.g., SEQ ID NO:228 or SEQ ID NO: 230); and (v) a 3′ UTR comprising the nucleotide of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), wherein all of the uracils of the mRNA are N1-methylpseudouracils. In some embodiments, a G6PC polynucleotide of the present disclosure comprises a nucleotide sequence encoding a polypeptide sequence at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% , at least 97%, at least 98%, at least 99%, or 100% identical to a G6PC protein sequence having the amino acid sequence of SEQ ID NO:228. In some embodiments, a G6PC polynucleotide of the present disclosure comprises a nucleotide sequence encoding a polypeptide sequence at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% , at least 97%, at least 98%, at least 99%, or 100% identical to a G6PC protein sequence having the amino acid sequence of SEQ ID NO: 230. In some embodiments, the ORF encoding a G6PC polypeptide has at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence of SEQ ID NO:169. In some embodiments, the ORF encoding a G6PC polypeptide has at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence of SEQ ID NO:229. In some embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a polypeptide, comprises (1) a 5′ cap such as provided above, for example, m7Gp-ppGm-A, (2) a 5′ UTR, (3) a nucleotide sequence ORF of SEQ ID NO:169 or SEQ ID NO:229, (3) a stop codon, (4) a 3′UTR, and (5) a poly-A tail provided above, for example, a poly-A tail of SEQ ID NO:195 or A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211). An exemplary G6PC nucleotide construct is described, consists from 5’ to 3’ end: 5' UTR of SEQ ID NO:50, ORF of SEQ ID NO:169, and 3' UTR of SEQ ID NO:142. The construct has a m7Gp-ppGm- cap and a poly-A tail of SEQ ID NO:195. In certain embodiments, all uracils in the construct are N1-methylpseudouracils. An exemplary G6PC nucleotide construct is described, consists from 5’ to 3’ end: 5' UTR of SEQ ID NO:50, ORF of SEQ ID NO:229, and 3' UTR of SEQ ID NO:142. The construct has a m7Gp-ppGm- cap and a poly-A tail of SEQ ID NO:195. In certain embodiments, all uracils in the construct are N1-methylpseudouracils. In certain embodiments, a polynucleotide (e.g., mRNA) of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a OTC polypeptide, comprises from 5′ to 3′ end: (i) a 5′ UTR; (ii) an ORF encoding a OTC polypeptide (e.g., SEQ ID NO:231); and (v) a 3′ UTR comprising a nucleotide sequence having at least 95% identity (e.g., at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, 100% identity) to the sequence of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), wherein all of the uracils of the mRNA are N1-methylpseudouracils. In certain embodiments, a polynucleotide (e.g., mRNA) of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a OTC polypeptide, comprises from 5′ to 3′ end: (i) a 5′ UTR; (ii) an ORF encoding a OTC polypeptide (e.g., SEQ ID NO:231); and (v) a 3′ UTR comprising the nucleotide of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), wherein all of the uracils of the mRNA are N1-methylpseudouracils. In some embodiments, a OTC polynucleotide of the present disclosure comprises a nucleotide sequence encoding a polypeptide sequence at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% , at least 97%, at least 98%, at least 99%, or 100% identical to a OTC protein sequence having the amino acid sequence of SEQ ID NO:231. In some embodiments, the ORF encoding a OTC polypeptide has at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence of SEQ ID NO:170. In some embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a polypeptide, comprises (1) a 5′ cap such as provided above, for example, m7Gp-ppGm-A, (2) a 5′ UTR, (3) a nucleotide sequence ORF of SEQ ID NO:170, (3) a stop codon, (4) a 3′UTR, and (5) a poly-A tail provided above, for example, a poly-A tail of SEQ ID NO:195 or A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211). An exemplary OTC nucleotide construct is described, consists from 5’ to 3’ end: 5' UTR of SEQ ID NO:58, ORF of SEQ ID NO:170, and 3' UTR of SEQ ID NO:160. The construct has a m7Gp-ppGm- cap and a poly-A tail of SEQ ID NO:195. In certain embodiments, all uracils in the construct are N1-methylpseudouracils. In certain embodiments, a polynucleotide (e.g., mRNA) of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a PCCA polypeptide, comprises from 5′ to 3′ end: (i) a 5′ UTR; (ii) an ORF encoding a PCCA polypeptide (e.g., SEQ ID NO:232); and (v) a 3′ UTR comprising a nucleotide sequence having at least 95% identity (e.g., at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, 100% identity) to the sequence of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), wherein all of the uracils of the mRNA are N1-methylpseudouracils. In certain embodiments, a polynucleotide (e.g., mRNA) of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a PCCA polypeptide, comprises from 5′ to 3′ end: (i) a 5′ UTR; (ii) an ORF encoding a PCCA polypeptide (e.g., SEQ ID NO:232); and (v) a 3′ UTR comprising the nucleotide of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), wherein all of the uracils of the mRNA are N1-methylpseudouracils. In some embodiments, a PCCA polynucleotide of the present disclosure comprises a nucleotide sequence encoding a polypeptide sequence at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% , at least 97%, at least 98%, at least 99%, or 100% identical to a PCCA protein sequence having the amino acid sequence of SEQ ID NO:232. In some embodiments, the ORF encoding a PCCA polypeptide has at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence of SEQ ID NO:171. In some embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a polypeptide, comprises (1) a 5′ cap such as provided above, for example, m7Gp-ppGm-A, (2) a 5′ UTR, (3) a nucleotide sequence ORF of SEQ ID NO:171, (3) a stop codon, (4) a 3′UTR, and (5) a poly-A tail provided above, for example, a poly-A tail of SEQ ID NO:195 or A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211). An exemplary PCCA nucleotide construct is described, consists from 5’ to 3’ end: 5' UTR of SEQ ID NO:55, ORF of SEQ ID NO:171, and 3' UTR of SEQ ID NO:160. The construct has a m7Gp-ppGm- cap and a poly-A tail of SEQ ID NO:195. In certain embodiments, all uracils in the construct are N1-methylpseudouracils. In certain embodiments, a polynucleotide (e.g., mRNA) of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a PCCB polypeptide, comprises from 5′ to 3′ end: (i) a 5′ UTR; (ii) an ORF encoding a PCCB polypeptide (e.g., SEQ ID NO:233); and (v) a 3′ UTR comprising a nucleotide sequence having at least 95% identity (e.g., at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, 100% identity) to the sequence of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), wherein all of the uracils of the mRNA are N1-methylpseudouracils. In certain embodiments, a polynucleotide (e.g., mRNA) of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a PCCB polypeptide, comprises from 5′ to 3′ end: (i) a 5′ UTR; (ii) an ORF encoding a PCCB polypeptide (e.g., SEQ ID NO:233); and (v) a 3′ UTR comprising the nucleotide of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), wherein all of the uracils of the mRNA are N1-methylpseudouracils. In some embodiments, a PCCB polynucleotide of the present disclosure comprises a nucleotide sequence encoding a polypeptide sequence at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% , at least 97%, at least 98%, at least 99%, or 100% identical to a PCCB protein sequence having the amino acid sequence of SEQ ID NO:233. In some embodiments, the ORF encoding a PCCB polypeptide has at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence of SEQ ID NO:172. In some embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a polypeptide, comprises (1) a 5′ cap such as provided above, for example, m7Gp-ppGm-A, (2) a 5′ UTR, (3) a nucleotide sequence ORF of SEQ ID NO:172, (3) a stop codon, (4) a 3′UTR, and (5) a poly-A tail provided above, for example, a poly-A tail of SEQ ID NO:195 or A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211). An exemplary PCCB nucleotide construct is described, consists from 5’ to 3’ end: 5' UTR of SEQ ID NO:55, ORF of SEQ ID NO:172, and 3' UTR of SEQ ID NO:160. The construct has a m7Gp-ppGm- cap and a poly-A tail of SEQ ID NO:195. In certain embodiments, all uracils in the construct are N1-methylpseudouracils. In certain embodiments, a polynucleotide (e.g., mRNA) of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a MUT polypeptide, comprises from 5′ to 3′ end: (i) a 5′ UTR; (ii) an ORF encoding a MUT polypeptide (e.g., SEQ ID NO:234); and (v) a 3′ UTR comprising a nucleotide sequence having at least 95% identity (e.g., at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, 100% identity) to the sequence of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), wherein all of the uracils of the mRNA are N1-methylpseudouracils. In certain embodiments, a polynucleotide (e.g., mRNA) of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a MUT polypeptide, comprises from 5′ to 3′ end: (i) a 5′ UTR; (ii) an ORF encoding a MUT polypeptide (e.g., SEQ ID NO:234); and (v) a 3′ UTR comprising the nucleotide of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), wherein all of the uracils of the mRNA are N1-methylpseudouracils. In some embodiments, a MUT polynucleotide of the present disclosure comprises a nucleotide sequence encoding a polypeptide sequence at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% , at least 97%, at least 98%, at least 99%, or 100% identical to a MUT protein sequence having the amino acid sequence of SEQ ID NO:234. In some embodiments, the ORF encoding a MUT polypeptide has at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence of SEQ ID NO:173. In some embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a polypeptide, comprises (1) a 5′ cap such as provided above, for example, m7Gp-ppGm-A, (2) a 5′ UTR, (3) a nucleotide sequence ORF of SEQ ID NO:173, (3) a stop codon, (4) a 3′UTR, and (5) a poly-A tail provided above, for example, a poly-A tail of SEQ ID NO:195 or A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211). An exemplary MUT nucleotide construct is described, consists from 5’ to 3’ end: 5' UTR of SEQ ID NO:78, ORF of SEQ ID NO:173, and 3' UTR of SEQ ID NO:142. The construct has a m7Gp-ppGm- cap and a poly-A tail of SEQ ID NO:195. In certain embodiments, all uracils in the construct are N1-methylpseudouracils. In certain embodiments, a polynucleotide (e.g., mRNA) of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a FECH polypeptide, comprises from 5′ to 3′ end: (i) a 5′ UTR; (ii) an ORF encoding a FECH polypeptide (e.g., SEQ ID NO:235); and (v) a 3′ UTR comprising a nucleotide sequence having at least 95% identity (e.g., at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, 100% identity) to the sequence of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), wherein all of the uracils of the mRNA are N1-methylpseudouracils. In certain embodiments, a polynucleotide (e.g., mRNA) of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a FECH polypeptide, comprises from 5′ to 3′ end: (i) a 5′ UTR; (ii) an ORF encoding a FECH polypeptide (e.g., SEQ ID NO:235); and (v) a 3′ UTR comprising the nucleotide of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), wherein all of the uracils of the mRNA are N1-methylpseudouracils. In some embodiments, a FECH polynucleotide of the present disclosure comprises a nucleotide sequence encoding a polypeptide sequence at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% , at least 97%, at least 98%, at least 99%, or 100% identical to a FECH protein sequence having the amino acid sequence of SEQ ID NO:235. In some embodiments, the ORF encoding a FECH polypeptide has at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence of SEQ ID NO:174. In some embodiments, a polynucleotide of the present disclosure, for example a polynucleotide comprising an mRNA nucleotide sequence encoding a polypeptide, comprises (1) a 5′ cap such as provided above, for example, m7Gp-ppGm-A, (2) a 5′ UTR (such as any of those described in Table 1), (3) a nucleotide sequence ORF of SEQ ID NO:174, (3) a stop codon, (4) a 3′UTR (such as any of those described in Table 2), and (5) a poly-A tail provided above, for example, a poly-A tail of SEQ ID NO:195 or A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO:211). An exemplary FECH nucleotide construct is described, consists from 5’ to 3’ end: 5' UTR of SEQ ID NO:50, ORF of SEQ ID NO:174, and 3' UTR of SEQ ID NO:139. The construct has a m7Gp-ppGm- cap and a poly-A tail of SEQ ID NO:195. In certain embodiments, all uracils in the construct are N1-methylpseudouracils. An exemplary FECH nucleotide construct is described, consists from 5’ to 3’ end: 5' UTR of SEQ ID NO:50, ORF of SEQ ID NO:174, and 3' UTR of SEQ ID NO:142. The construct has a m7Gp-ppGm- cap and a poly-A tail of SEQ ID NO:195. In certain embodiments, all uracils in the construct are N1-methylpseudouracils. An exemplary FECH nucleotide construct is described, consists from 5’ to 3’ end: 5' UTR of SEQ ID NO:50, ORF of SEQ ID NO:174, and 3' UTR of SEQ ID NO:117. The construct has a m7Gp-ppGm- cap and a poly-A tail of SEQ ID NO:195. In certain embodiments, all uracils in the construct are N1-methylpseudouracils. Methods of Making Polynucleotides The present disclosure also provides methods for making a polynucleotide of the invention (e.g., a polynucleotide encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria such as GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and FECH) or a complement thereof. In some aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria such as a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide, can be constructed using in vitro transcription (IVT). In other aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria such as a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide, can be constructed by chemical synthesis using an oligonucleotide synthesizer. In other aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria such as a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide is made by using a host cell. In certain aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria such as a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide is made by one or more combination of the IVT, chemical synthesis, host cell expression, or any other methods known in the art. Naturally occurring nucleosides, non-naturally occurring nucleosides, or combinations thereof, can totally or partially naturally replace occurring nucleosides present in the candidate nucleotide sequence and can be incorporated into a sequence- optimized nucleotide sequence (e.g., a RNA, e.g., an mRNA) encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria such as a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide. The resultant polynucleotides, e.g., mRNAs, can then be examined for their ability to produce protein and / or produce a therapeutic outcome. Pharmaceutical Compositions and Formulations The present invention provides pharmaceutical compositions and formulations that comprise any of the polynucleotides described above. In some embodiments, the composition or formulation further comprises a delivery agent. In some embodiments, the composition or formulation can contain a polynucleotide comprising a sequence optimized nucleic acid sequence disclosed herein which encodes a polypeptide that is translated at the endoplasmic reticulum or mitochondria such as a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide. In some embodiments, the composition or formulation can contain a polynucleotide (e.g., a RNA, e.g., an mRNA) comprising a polynucleotide (e.g., an ORF) having significant sequence identity to a sequence optimized nucleic acid sequence disclosed herein which encodes a polypeptide that is translated at the endoplasmic reticulum or mitochondria such as a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide. In some embodiments, the polynucleotide further comprises a miRNA binding site, e.g., a miRNA binding site that binds miR-10a, miR-16, miR-21, miR-24, miR-26a, miR-27, miR-29a, miR-122, miR-125a, miR-125b, miR-126, miR-130a, miR-142, miR-144, miR-146, miR-150, miR-155, miR-196b, and miR-223. Pharmaceutical compositions or formulation can optionally comprise one or more additional active substances, e.g., therapeutically and / or prophylactically active substances. Pharmaceutical compositions or formulation of the present invention can be sterile and / or pyrogen-free. General considerations in the formulation and / or manufacture of pharmaceutical agents can be found, for example, in Remington: The Science and Practice of Pharmacy 21sted., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference in its entirety). In some embodiments, compositions are administered to humans, human patients or subjects. For the purposes of the present disclosure, the phrase "active ingredient" generally refers to polynucleotides to be delivered as described herein. Formulations and pharmaceutical compositions described herein can be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of associating the active ingredient with an excipient and / or one or more other accessory ingredients, and then, if necessary and / or desirable, dividing, shaping and / or packaging the product into a desired single- or multi-dose unit. A pharmaceutical composition or formulation in accordance with the present disclosure can be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unit doses. As used herein, a "unit dose" refers to a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient that would be administered to a subject and / or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage. Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and / or any additional ingredients in a pharmaceutical composition in accordance with the present disclosure can vary, depending upon the identity, size, and / or condition of the subject being treated and further depending upon the route by which the composition is to be administered. In some embodiments, the compositions and formulations described herein can contain at least one polynucleotide of the invention. As a non-limiting example, the composition or formulation can contain 1, 2, 3, 4 or 5 polynucleotides of the invention. In some embodiments, the compositions or formulations described herein can comprise more than one type of polynucleotide. In some embodiments, the composition or formulation can comprise a polynucleotide in linear and circular form. In another embodiment, the composition or formulation can comprise a circular polynucleotide and an in vitro transcribed (IVT) polynucleotide. In yet another embodiment, the composition or formulation can comprise an IVT polynucleotide, a chimeric polynucleotide and a circular polynucleotide. Although the descriptions of pharmaceutical compositions and formulations provided herein are principally directed to pharmaceutical compositions and formulations that are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other animal, e.g., to non-human animals, e.g. non-human mammals. The present invention provides pharmaceutical formulations that comprise a polynucleotide described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria such as a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide). The polynucleotides described herein can be Formulated using one or more excipients to: (1) increase stability; (2) increase cell transfection; (3) permit the sustained or delayed release (e.g., from a depot formulation of the polynucleotide); (4) alter the biodistribution (e.g., target the polynucleotide to specific tissues or cell types); (5) increase the translation of encoded protein in vivo; and / or (6) alter the release profile of encoded protein in vivo. In some embodiments, the pharmaceutical formulation further comprises a delivery agent comprising, e.g., a compound having the Formula (I), e.g., Compound II, Compound A, or Compound B; or a compound having the Formula (III), (IV), (V), or (VI), e.g., Compound I or VI, or any combination thereof. In some embodiments, the delivery agent comprises an ionizable amino lipid (e.g., Compound II, VI, or A), a helper lipid (e.g., DSPC), a sterol (e.g., Cholesterol), and a PEG lipid (e.g., Compound I or PEG-DMG), e.g., with a mole ratio in the range of about (i) 40-50 mol% ionizable amino lipid (e.g., Compound II, VI, or A), optionally 45-50 mol% ionizable amino lipid, for example, 45-46 mol%, 46-47 mol%, 47-48 mol%, 48-49 mol%, or 49-50 mol% for example about 45 mol%, 45.5 mol%, 46 mol%, 46.5 mol%, 47 mol%, 47.5 mol%, 48 mol%, 48.5 mol%, 49 mol%, or 49.5 mol%; (ii) 30-45 mol% sterol (e.g., cholesterol), optionally 35-42 mol% sterol, for example, 30-31 mol%, 31-32 mol%, 32-33 mol%, 33-34 mol%, 35-35 mol%, 35-36 mol%, 36-37 mol%, 37-38 mol%, 38-39 mol%, or 39-40 mol%, or 40-42 mol% sterol; (iii) 5-15 mol% helper lipid (e.g., DSPC), optionally 10-15 mol% helper lipid, for example, 5-6 mol%, 6-7 mol%, 7-8 mol%, 8- 9 mol%, 9-10 mol%, 10-11 mol%, 11-12 mol%, 12-13 mol%, 13-14 mol%, or 14-15 mol% helper lipid; and (iv) 1-5% PEG lipid (e.g., Compound I or PEG-DMG), optionally 1-5 mol% PEG lipid, for example 1.5 to 2.5 mol%, 1-2 mol%, 2-3 mol%, 3-4 mol%, or 4-5 mol% PEG lipid. A pharmaceutically acceptable excipient, as used herein, includes, but are not limited to, any and all solvents, dispersion media, or other liquid vehicles, dispersion or suspension aids, diluents, granulating and / or dispersing agents, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, binders, lubricants or oil, coloring, sweetening or flavoring agents, stabilizers, antioxidants, antimicrobial or antifungal agents, osmolality adjusting agents, pH adjusting agents, buffers, chelants, cyoprotectants, and / or bulking agents, as suited to the particular dosage form desired. Various excipients for Formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, MD, 2006; incorporated herein by reference in its entirety). Exemplary diluents include, but are not limited to, calcium or sodium carbonate, calcium phosphate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, etc., and / or combinations thereof. Exemplary surface active agents and / or emulsifiers include, but are not limited to, natural emulsifiers (e.g., acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), sorbitan fatty acid esters (e.g., polyoxyethylene sorbitan monooleate [TWEEN®80], sorbitan monopalmitate [SPAN®40], glyceryl monooleate, polyoxyethylene esters, polyethylene glycol fatty acid esters (e.g., CREMOPHOR®), polyoxyethylene ethers (e.g., polyoxyethylene lauryl ether [BRIJ®30]), PLUORINC®F 68, POLOXAMER®188, etc. and / or combinations thereof. Exemplary binding agents include, but are not limited to, starch, gelatin, sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol), amino acids (e.g., glycine), natural and synthetic gums (e.g., acacia, sodium alginate), ethylcellulose, hydroxyethylcellulose, hydroxypropyl methylcellulose, etc., and combinations thereof. Oxidation is a potential degradation pathway for mRNA, especially for liquid mRNA formulations. In order to prevent oxidation, antioxidants can be added to the formulations. Exemplary antioxidants include, but are not limited to, alpha tocopherol, ascorbic acid, ascorbyl palmitate, benzyl alcohol, butylated hydroxyanisole, m-cresol, methionine, butylated hydroxytoluene, monothioglycerol, sodium or potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, etc., and combinations thereof. Exemplary chelating agents include, but are not limited to, ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, trisodium edetate, etc., and combinations thereof. Exemplary antimicrobial or antifungal agents include, but are not limited to, benzalkonium chloride, benzethonium chloride, methyl paraben, ethyl paraben, propyl paraben, butyl paraben, benzoic acid, hydroxybenzoic acid, potassium or sodium benzoate, potassium or sodium sorbate, sodium propionate, sorbic acid, etc., and combinations thereof. Exemplary preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, ascorbic acid, butylated hydroxyanisol, ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), etc., and combinations thereof. In some embodiments, the pH of polynucleotide solutions is maintained between pH 5 and pH 8 to improve stability. Exemplary buffers to control pH can include, but are not limited to sodium phosphate, sodium citrate, sodium succinate, histidine (or histidine-HCl), sodium malate, sodium carbonate, etc., and / or combinations thereof. Exemplary lubricating agents include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, hydrogenated vegetable oils, polyethylene glycol, sodium benzoate, sodium or magnesium lauryl sulfate, etc., and combinations thereof. The pharmaceutical composition or formulation described here can contain a cryoprotectant to stabilize a polynucleotide described herein during freezing. Exemplary cryoprotectants include, but are not limited to mannitol, sucrose, trehalose, lactose, glycerol, dextrose, etc., and combinations thereof. The pharmaceutical composition or formulation described here can contain a bulking agent in lyophilized polynucleotide formulations to yield a "pharmaceutically elegant" cake, stabilize the lyophilized polynucleotides during long term (e.g., 36 month) storage. Exemplary bulking agents of the present invention can include, but are not limited to sucrose, trehalose, mannitol, glycine, lactose, raffinose, and combinations thereof. In some embodiments, the pharmaceutical composition or formulation further comprises a delivery agent. The delivery agent of the present disclosure can include, without limitation, liposomes, lipid nanoparticles, lipidoids, polymers, lipoplexes, microvesicles, exosomes, peptides, proteins, cells transfected with polynucleotides, hyaluronidase, nanoparticle mimics, nanotubes, conjugates, and combinations thereof. Delivery Agents Lipid Compound The present disclosure provides pharmaceutical compositions with advantageous properties. The lipid compositions described herein may be advantageously used in lipid nanoparticle compositions for the delivery of therapeutic and / or prophylactic agents, e.g., mRNAs, to mammalian cells or organs. For example, the lipids described herein have little or no immunogenicity. For example, the lipid compounds disclosed herein have a lower immunogenicity as compared to a reference lipid (e.g., MC3, KC2, or DLinDMA). For example, a formulation comprising a lipid disclosed herein and a therapeutic or prophylactic agent, e.g., mRNA, has an increased therapeutic index as compared to a corresponding formulation which comprises a reference lipid (e.g., MC3, KC2, or DLinDMA) and the same therapeutic or prophylactic agent. In certain embodiments, the present application provides pharmaceutical compositions comprising: (a) a polynucleotide comprising a nucleotide sequence encoding a polypeptide; and (b) a delivery agent. Lipid Nanoparticle Formulations In some embodiments, nucleic acids of the invention (e.g., encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria such as GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH mRNA) are Formulated in a lipid nanoparticle (LNP). Lipid nanoparticles typically comprise ionizable cationic lipid, non-cationic lipid, sterol and PEG lipid components along with the nucleic acid cargo of interest. The lipid nanoparticles of the invention can be generated using components, compositions, and methods as are generally known in the art, see for example PCT / US2016 / 052352; PCT / US2016 / 068300; PCT / US2017 / 037551; PCT / US2015 / 027400; PCT / US2016 / 047406; PCT / US2016000129; PCT / US2016 / 014280; PCT / US2016 / 014280; PCT / US2017 / 038426; PCT / US2014 / 027077; PCT / US2014 / 055394; PCT / US2016 / 52117; PCT / US2012 / 069610; PCT / US2017 / 027492; PCT / US2016 / 059575 and PCT / US2016 / 069491 all of which are incorporated by reference herein in their entirety. Nucleic acids of the present disclosure (e.g., encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria such as GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH mRNA) are typically Formulated in lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises at least one ionizable cationic lipid, at least one non-cationic lipid, at least one sterol, and / or at least one polyethylene glycol (PEG)-modified lipid. In some embodiments, the lipid nanoparticle comprises a molar ratio of 20- 60% ionizable cationic lipid. For example, the lipid nanoparticle may comprise a molar ratio of 40-50 mol%, optionally 45-50 mol%, for example, 45-46 mol%, 46-47 mol%, 47-48 mol%, 48-49 mol%, or 49-50 mol%, for example about 45 mol%, 45.5 mol%, 46 mol%, 46.5 mol%, 47 mol%, 47.5 mol%, 48 mol%, 48.5 mol%, 49 mol%, or 49.5 mol% ionizable cationic lipid. In some embodiments, the lipid nanoparticle comprises a molar ratio of 5-25% non-cationic lipid. For example, the lipid nanoparticle may comprise a molar ratio of 5-15 mol%, optionally 10-12 mol%, for example, 5-6 mol%, 6-7 mol%, 7-8 mol%, 8- 9 mol%, 9-10 mol%, 10-11 mol%, 11-12 mol%, 12-13 mol%, 13-14 mol%, or 14-15 mol% non-cationic lipid. In some embodiments, the lipid nanoparticle comprises a molar ratio of 25- 55% sterol. For example, the lipid nanoparticle may comprise a molar ratio of 30-45 mol%, optionally 35-40 mol%, for example, 30-31 mol%, 31-32 mol%, 32-33 mol%, 33-34 mol%, 35-35 mol%, 35-36 mol%, 36-37 mol%, 38-38 mol%, 38-39 mol%, or 39-40 mol% sterol. In some embodiments, the lipid nanoparticle comprises a molar ratio of 0.5- 15% PEG-modified lipid. For example, the lipid nanoparticle may comprise a molar ratio of 1-5%, optionally 1-3 mol%, for example 1.5 to 2.5 mol%, 1-2 mol%, 2-3 mol%, 3-4 mol%, or 4-5 mol% PEG-modified lipid. In some embodiments, the lipid nanoparticle comprises a molar ratio of 20- 60% ionizable cationic lipid, 5-25% non-cationic lipid, 25-55% sterol, and 0.5-15% PEG-modified lipid. In some embodiments, the lipid nanoparticle comprises a molar ratio of 40- 50% ionizable cationic lipid, 5-15% non-cationic lipid, 30-45% sterol, and 1-5% PEG-modified lipid. In some embodiments, the lipid nanoparticle comprises a molar ratio of 45- 50% ionizable cationic lipid, 10-12% non-cationic lipid, 35-40% sterol, and 1-3% PEG-modified lipid. In some embodiments, the lipid nanoparticle comprises a molar ratio of 45- 50% ionizable cationic lipid, 10-12% non-cationic lipid, 35-40% sterol, and 1.5-2.5% PEG-modified lipid. Ionizable amino lipids In some aspects, the disclosure relates to a compound of Formula (I): (I) or its N-oxide, or a salt or isomer thereof, wherein R’ais R’branched; wherein R’branchedis: ; wherein denotes a point of attachment; wherein Raα, Raβ, Raγ, and Raδare each independently selected from the group consisting of H, C2-12 alkyl, and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4is selected from the group consisting of -(CH2)nOH, wherein n is selected from the group consisting of 1, 2, 3, 4, and 5, and , wherein denotes a point of attachment; wherein R10is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R5is independently selected from the group consisting of C1-3 alkyl, C2-3alkenyl, and H; each R6is independently selected from the group consisting of C1-3 alkyl, C2-3alkenyl, and H; M and M’ are each independently selected from the group consisting of - C(O)O- and -OC(O)-; R’ is a C1-12 alkyl or C2-12 alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13. In some embodiments of the compounds of Formula (I), R’ais R’branched; R’branchedis ; denotes a point of attachment; Raα, Raβ, Raγ, and Raδare each H; R2and R3are each C1-14 alkyl; R4is -(CH2)nOH; n is 2; each R5is H; each R6is H; M and M’ are each -C(O)O-; R’ is a C1-12alkyl; l is 5; and m is 7. In some embodiments of the compounds of Formula (I), R’ais R’branched; R’branchedis ; denotes a point of attachment; Raα, Raβ, Raγ, and Raδare each H; R2and R3are each C1-14alkyl; R4is -(CH2)nOH; n is 2; each R5is H; each R6is H; M and M’ are each -C(O)O-; R’ is a C1-12 alkyl; l is 3; and m is 7. In some embodiments of the compounds of Formula (I), R’ais R’branched; R’branchedis ; denotes a point of attachment; Raαis C2-12 alkyl; Raβ, Raγ, and Raδare each H; R2and R3are each C1-14alkyl; R4is ; R10NH(C1-6 alkyl); n2 is 2; R5is H; each R6is H; M and M’ are each -C(O)O-; R’ is a C1-12alkyl; l is 5; and m is 7. In some embodiments of the compounds of Formula (I), R’ais R’branched; R’branchedis ; denotes a point of attachment; Raα, Raβ, and Raδare each H; Raγis C2-12alkyl; R2and R3are each C1-14alkyl; R4is -(CH2)nOH; n is 2; each R5is H; each R6is H; M and M’ are each -C(O)O-; R’ is a C1-12 alkyl; l is 5; and m is 7. In some embodiments, the compound of Formula (I) is selected from: , , , and . In some embodiments, the compound of Formula (I) is: (Compound II). In some embodiments, the compound of Formula (I) is: . In some embodiments, the compound of Formula (I) is: . In some embodiments, the compound of Formula (I) is: (Compound B). In some aspects, the disclosure relates to a compound of Formula (Ia): (Ia) or its N-oxide, or a salt or isomer thereof, wherein R’ais R’branched; wherein R’branchedis: ; wherein denotes a point of attachment; wherein Raβ, Raγ, and Raδare each independently selected from the group consisting of H, C2-12 alkyl, and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 1, 2, 3, 4, and 5, and , wherein denotes a point of attachment; wherein R10is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R5is independently selected from the group consisting of C1-3 alkyl, C2-3alkenyl, and H; each R6is independently selected from the group consisting of C1-3 alkyl, C2-3alkenyl, and H; M and M’ are each independently selected from the group consisting of - C(O)O- and -OC(O)-; R’ is a C1-12alkyl or C2-12alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13. In some aspects, the disclosure relates to a compound of Formula (Ib): (Ib) or its N-oxide, or a salt or isomer thereof, wherein R’ais R’branched; wherein R’branchedis: ; wherein denotes a point of attachment; wherein Raα, Raβ, Raγ, and Raδare each independently selected from the group consisting of H, C2-12alkyl, and C2-12alkenyl; R2and R3are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4is -(CH2)nOH, wherein n is selected from the group consisting of 1, 2, 3, 4, and 5; each R5is independently selected from the group consisting of C1-3alkyl, C2-3 alkenyl, and H; each R6is independently selected from the group consisting of C1-3alkyl, C2-3 alkenyl, and H; M and M’ are each independently selected from the group consisting of - C(O)O- and -OC(O)-; R’ is a C1-12 alkyl or C2-12 alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13. In some embodiments of Formula (I) or (Ib), R’ais R’branched; R’branchedis ; denotes a point of attachment; Raβ, Raγ, and Raδare each H; R2and R3are each C1-14alkyl; R4is -(CH2)nOH; n is 2; each R5is H; each R6is H; M and M’ are each -C(O)O-; R’ is a C1-12 alkyl; l is 5; and m is 7. In some embodiments of Formula (I) or (Ib), R’ais R’branched; R’branchedis ; denotes a point of attachment; Raβ, Raγ, and Raδare each H; R2and R3are each C1-14 alkyl; R4is -(CH2)nOH; n is 2; each R5is H; each R6is H; M and M’ are each -C(O)O-; R’ is a C1-12alkyl; l is 3; and m is 7.Insome embodiments of Formula (I) or (Ib), R’ais R’branched; R’branchedis ; denotes a point of attachment; Raβand Raδare each H; Raγis C2-12 alkyl; R2and R3are each C1-14 alkyl; R4is -(CH2)nOH; n is 2; each R5is H; each R6is H; M and M’ are each -C(O)O-; R’ is a C1-12alkyl; l is 5; and m is 7. In some aspects, the disclosure relates to a compound of Formula (Ic): (Ic) or its N-oxide, or a salt or isomer thereof, wherein R’ais R’branched; wherein R’branchedis: ; wherein denotes a point of attachment; wherein Raα, Raβ, Raγ, and Raδare each independently selected from the group consisting of H, C2-12 alkyl, and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14alkyl and C2-14alkenyl; R4is , wherein denotes a point of attachment; wherein R10is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R5is independently selected from the group consisting of C1-3 alkyl, C2-3alkenyl, and H; each R6is independently selected from the group consisting of C1-3 alkyl, C2-3alkenyl, and H; M and M’ are each independently selected from the group consisting of - C(O)O- and -OC(O)-; R’ is a C1-12alkyl or C2-12alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13. In some embodiments, R’ais R’branched; R’branchedis ; denotes a point of attachment; Raβ, Raγ, and Raδare each H; Raαis C2-12alkyl; R2and R3are each C1-14alkyl; R4is ; denotes a point of attachment; R10is NH(C1-6 alkyl); n2 is 2; each R5is H; each R6is H; M and M’ are each -C(O)O-; R’ is a C1-12alkyl; l is 5; and m is 7. In some embodiments, the compound of Formula (Ic) is: (Compound A). In some aspects, the disclosure relates to a compound of Formula (II): (II) or its N-oxide, or a salt or isomer thereof, wherein R’ais R’branchedor R’cyclic; wherein R’branchedis: and R’cyclicis: ; and R’bis: or ; wherein denotes a point of attachment; Raγand Raδare each independently selected from the group consisting of H, C1-12alkyl, and C2-12alkenyl, wherein at least one of Raγand Raδis selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; Rbγand Rbδare each independently selected from the group consisting of H, C1-12alkyl, and C2-12alkenyl, wherein at least one of Rbγand Rbδis selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14alkyl and C2-14alkenyl; R4is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 1, 2, 3, 4, and 5, and , wherein denotes a point of attachment; wherein R10is N(R)2; each R is independently selected from the group consisting of C1-6alkyl, C2-3alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C1-12alkyl or C2-12alkenyl; Yais a C3-6 carbocycle; R*”ais selected from the group consisting of C1-15 alkyl and C2-15 alkenyl; and s is 2 or 3; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; l is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9. In some aspects, the disclosure relates to a compound of Formula (II-a): (II-a) or its N-oxide, or a salt or isomer thereof, wherein R’ais R’branchedor R’cyclic; wherein R’branchedis: and R’bis: or ; wherein denotes a point of attachment; Raγand Raδare each independently selected from the group consisting of H, C1-12 alkyl, and C2-12 alkenyl, wherein at least one of Raγand Raδis selected from the group consisting of C1-12alkyl and C2-12alkenyl; Rbγand Rbδare each independently selected from the group consisting of H, C1-12alkyl, and C2-12alkenyl, wherein at least one of Rbγand Rbδis selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14alkyl and C2-14alkenyl; R4is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 1, 2, 3, 4, and 5, and , wherein denotes a point of attachment; wherein R10is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C1-12 alkyl or C2-12 alkenyl; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; l is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9. In some aspects, the disclosure relates to a compound of Formula (II-b): (II-b) or its N-oxide, or a salt or isomer thereof, wherein R’ais R’branchedor R’cyclic; wherein R’branchedis: and R’bis: or ; wherein denotes a point of attachment; Raγand Rbγare each independently selected from the group consisting of C1-12alkyl and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 1, 2, 3, 4, and 5, and , wherein denotes a point of attachment; wherein R10is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C1-12 alkyl or C2-12 alkenyl; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; l is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9. In some aspects, the disclosure relates to a compound of Formula (II-c): (II-c) or its N-oxide, or a salt or isomer thereof, wherein R’ais R’branchedor R’cyclic; wherein R’branchedis: and R’bis: ; wherein denotes a point of attachment; wherein Raγis selected from the group consisting of C1-12alkyl and C2-12alkenyl; R2and R3are each independently selected from the group consisting of C1-14alkyl and C2-14alkenyl; R4is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 1, 2, 3, 4, and 5, and , wherein denotes a point of attachment; wherein R10is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; R’ is a C1-12 alkyl or C2-12 alkenyl; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; l is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9. In some aspects, the disclosure relates to a compound of Formula (II-d): (II-d) or its N-oxide, or a salt or isomer thereof, wherein R’ais R’branchedor R’cyclic; wherein R’branchedis: and R’bis: ; wherein denotes a point of attachment; wherein Raγand Rbγare each independently selected from the group consisting of C1-12alkyl and C2-12alkenyl; R4is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 1, 2, 3, 4, and 5, and , wherein denotes a point of attachment; wherein R10is N(R)2; each R is independently selected from the group consisting of C1-6alkyl, C2-3alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C1-12alkyl or C2-12alkenyl; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; l is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9. In some aspects, the disclosure relates to a compound of Formula (II-e): (II-e) or its N-oxide, or a salt or isomer thereof, wherein R’ais R’branchedor R’cyclic; wherein R’branchedis: and R’bis: ; wherein denotes a point of attachment; wherein Raγis selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl; R4is -(CH2)nOH wherein n is selected from the group consisting of 1, 2, 3, 4, and 5; R’ is a C1-12alkyl or C2-12alkenyl; m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; l is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), m and l are each independently selected from 4, 5, and 6. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), m and l are each 5. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), each R’ independently is a C1-12alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), each R’ independently is a C2-5alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’bis: and R2and R3are each independently a C1-14 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’bis: and R2and R3are each independently a C6-10alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’bis: and R2and R3are each a C8alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: and R’bis: , Raγis a C1-12 alkyl and R2and R3are each independently a C6-10alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: and R’bis: , Raγis a C2-6 alkyl and R2and R3are each independently a C6-10alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: and R’bis: , Raγis a C2-6 alkyl, and R2and R3are each a C8 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: , R’bis: , and Raγand Rbγare each a C1-12 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: , R’bis: , and Raγand Rbγare each a C2-6 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), m and l are each independently selected from 4, 5, and 6 and each R’ independently is a C1-12alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), m and l are each 5 and each R’ independently is a C2-5alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: , R’bis: , m and l are each independently selected from 4, 5, and 6, each R’ independently is a C1-12 alkyl, and Raγand Rbγare each a C1-12alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: , R’bis: , m and l are each 5, each R’ independently is a C2-5alkyl, and Raγand Rbγare each a C2-6 alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: and R’bis: , m and l are each independently selected from 4, 5, and 6, R’ is a C1-12 alkyl, Raγis a C1-12 alkyl and R2and R3are each independently a C6-10alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: and R’bis: , m and l are each 5, R’ is a C2-5 alkyl, Raγis a C2-6 alkyl, and R2and R3are each a C8alkyl. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R4is , wherein R10is NH(C1-6 alkyl) and n2 is 2. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R4is , wherein R10is NH(CH3) and n2 is 2. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: , R’bis: , m and l are each independently selected from 4, 5, and 6, each R’ independently is a C1-12 alkyl, Raγand Rbγare each a C1-12 alkyl, and R4is , wherein R10is NH(C1-6 alkyl), and n2 is 2. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: , R’bis: , m and l are each 5, each R’ independently is a C2-5 alkyl, Raγand Rbγare each a C2-6 alkyl, and R4is , wherein R10is NH(CH3) and n2 is 2. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: and R’bis: , m and l are each independently selected from 4, 5, and 6, R’ is a C1-12 alkyl, R2and R3are each independently a C6-10alkyl, Raγis a C1-12alkyl, and R4is , wherein R10is NH(C1-6 alkyl) and n2 is 2. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: and R’bis: , m and l are each 5, R’ is a C2-5alkyl, Raγis a C2-6alkyl, R2and R3are each a C8alkyl, and R4is , wherein R10is NH(CH3) and n2 is 2. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R4is -(CH2)nOH and n is 2, 3, or 4. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R4is -(CH2)nOH and n is 2. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: , R’bis: , m and l are each independently selected from 4, 5, and 6, each R’ independently is a C1-12alkyl, Raγand Rbγare each a C1-12 alkyl, R4is -(CH2)nOH, and n is 2, 3, or 4. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), R’branchedis: , R’bis: , m and l are each 5, each R’ independently is a C2-5alkyl, Raγand Rbγare each a C2-6alkyl, R4is -(CH2)nOH, and n is 2. In some aspects, the disclosure relates to a compound of Formula (II-f): (II-f) or its N-oxide, or a salt or isomer thereof, wherein R’ais R’branchedor R’cyclic; wherein R’branchedis: and R’bis: ; wherein denotes a point of attachment; Raγis a C1-12alkyl; R2and R3are each independently a C1-14 alkyl; R4is -(CH2)nOH wherein n is selected from the group consisting of 1, 2, 3, 4, and 5; R’ is a C1-12alkyl; m is selected from 4, 5, and 6; and l is selected from 4, 5, and 6. In some embodiments of the compound of Formula (II-f), m and l are each 5, and n is 2, 3, or 4. In some embodiments of the compound of Formula (II-f) R’ is a C2-5alkyl, Raγis a C2-6 alkyl, and R2and R3are each a C6-10 alkyl. In some embodiments of the compound of Formula (II-f), m and l are each 5, n is 2, 3, or 4, R’ is a C2-5 alkyl, Raγis a C2-6 alkyl, and R2and R3are each a C6-10 alkyl. In some aspects, the disclosure relates to a compound of Formula (II-g): (II-g), wherein Raγis a C2-6alkyl; R’ is a C2-5 alkyl; and R4is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 3, 4, and 5, and , wherein denotes a point of attachment, R10is NH(C1-6alkyl), and n2 is selected from the group consisting of 1, 2, and 3. In some aspects, the disclosure relates to a compound of Formula (II-h): (II-h), wherein Raγand Rbγare each independently a C2-6 alkyl; each R’ independently is a C2-5alkyl; and R4is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 3, 4, and 5, and , wherein denotes a point of attachment, R10is NH(C1-6alkyl), and n2 is selected from the group consisting of 1, 2, and 3. In some embodiments of the compound of Formula (II-g) or (II-h), R4is , wherein R10is NH(CH3) and n2 is 2. In some embodiments of the compound of Formula (II-g) or (II-h), R4is - (CH2)2OH. In some aspects, the disclosure relates to a compound having the Formula (III): (III), or a salt or isomer thereof, wherein R1, R2, R3, R4, and R5are independently selected from the group consisting of C5-20 alkyl, C5-20 alkenyl, -R”MR’, -R*YR”, -YR”, and -R*OR”; each M is independently selected from the group consisting of -C(O)O-, -OC(O)-, -OC(O)O-, -C(O)N(R’)-, -N(R’)C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR’)O-, -S(O)2-, an aryl group, and a heteroaryl group; X1, X2, and X3are independently selected from the group consisting of a bond, -CH2-, -(CH2)2-, -CHR-, -CHY-, -C(O)-, -C(O)O-, -OC(O)-, -C(O)-CH2-, -CH2-C(O)-, -C(O)O-CH2-, -OC(O)-CH2-, -CH2-C(O)O-, -CH2-OC(O)-, -CH(OH)-, -C(S)-, and -CH(SH)-; each Y is independently a C3-6carbocycle; each R* is independently selected from the group consisting of C1-12 alkyl and C2-12alkenyl; each R is independently selected from the group consisting of C1-3 alkyl and a C3-6carbocycle; each R’ is independently selected from the group consisting of C1-12 alkyl, C2-12alkenyl, and H; and each R” is independently selected from the group consisting of C3-12 alkyl and C3-12alkenyl, and wherein: i) at least one of X1, X2, and X3is not -CH2-; and / or ii) at least one of R1, R2, R3, R4, and R5is -R”MR’. In some embodiments, R1, R2, R3, R4, and R5 are each C5-20 alkyl; X1is -CH2-; and X2and X3are each -C(O)-. In some embodiments, the compound of Formula (III) is: (Compound VI), or a salt or isomer thereof. Phospholipids The lipid composition of the lipid nanoparticle composition disclosed herein can comprise one or more phospholipids, for example, one or more saturated or (poly)unsaturated phospholipids or a combination thereof. In general, phospholipids comprise a phospholipid moiety and one or more fatty acid moieties. A phospholipid moiety can be selected, for example, from the non-limiting group consisting of phosphatidyl choline, phosphatidyl ethanolamine, phosphatidyl glycerol, phosphatidyl serine, phosphatidic acid, 2-lysophosphatidyl choline, and a sphingomyelin. A fatty acid moiety can be selected, for example, from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanoic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid. Particular phospholipids can facilitate fusion to a membrane. For example, a cationic phospholipid can interact with one or more negatively charged phospholipids of a membrane (e.g., a cellular or intracellular membrane). Fusion of a phospholipid to a membrane can allow one or more elements (e.g., a therapeutic agent) of a lipid- containing composition (e.g., LNPs) to pass through the membrane permitting, e.g., delivery of the one or more elements to a target tissue. Non-natural phospholipid species including natural species with modifications and substitutions including branching, oxidation, cyclization, and alkynes are also contemplated. For example, a phospholipid can be functionalized with or cross-linked to one or more alkynes (e.g., an alkenyl group in which one or more double bonds is replaced with a triple bond). Under appropriate reaction conditions, an alkyne group can undergo a copper-catalyzed cycloaddition upon exposure to an azide. Such reactions can be useful in functionalizing a lipid bilayer of a nanoparticle composition to facilitate membrane permeation or cellular recognition or in conjugating a nanoparticle composition to a useful component such as a targeting or imaging moiety (e.g., a dye). Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholines, phosphatidylethanolamines, phosphatidylserines, phosphatidylinositols, phosphatidy glycerols, and phosphatidic acids. Phospholipids also include phosphosphingolipid, such as sphingomyelin. In some embodiments, a phospholipid of the invention comprises 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-gly cero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3- phosphocholine (DOPC), l,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2- diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero- 3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2 cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2- dilinolenoyl-sn-glycero-3-phosphocholine,1,2-diarachidonoyl-sn-glycero-3- phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2- diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn- glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero- 3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof. In certain embodiments, a phospholipid useful or potentially useful in the present invention is an analog or variant of DSPC. In certain embodiments, a phospholipid useful or potentially useful in the present invention is a compound of Formula (IV): (IV), or a salt thereof, wherein: each R1is independently optionally substituted alkyl; or optionally two R1are joined together with the intervening atoms to form optionally substituted monocyclic carbocyclyl or optionally substituted monocyclic heterocyclyl; or optionally three R1are joined together with the intervening atoms to form optionally substituted bicyclic carbocyclyl or optionally substitute bicyclic heterocyclyl; n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is of the Formula: or ; each instance of L2is independently a bond or optionally substituted C1-6 alkylene, wherein one methylene unit of the optionally substituted C1-6alkylene is optionally replaced with O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, or NRNC(O)N(RN); each instance of R2is independently optionally substituted C1-30 alkyl, optionally substituted C1-30alkenyl, or optionally substituted C1-30alkynyl; optionally wherein one or more methylene units of R2are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), - C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, OC(O)N(RN), - NRNC(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRNC(=NRN), - NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), OS(O), - S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(RN)S(O), S(O)N(RN), - N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), - N(RN)S(O)2N(RN), OS(O)2N(RN), or N(RN)S(O)2O; each instance of RNis independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group; Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and p is 1 or 2; provided that the compound is not of the Formula: , wherein each instance of R2is independently unsubstituted alkyl, unsubstituted alkenyl, or unsubstituted alkynyl. In some embodiments, the phospholipids may be one or more of the phospholipids described in U.S. Application No.62 / 520,530. Phospholipid Head Modifications In certain embodiments, a phospholipid useful or potentially useful in the present invention comprises a modified phospholipid head (e.g., a modified choline group). In certain embodiments, a phospholipid with a modified head is DSPC, or analog thereof, with a modified quaternary amine. For example, in embodiments of Formula (IV), at least one of R1is not methyl. In certain embodiments, at least one of R1is not hydrogen or methyl. In certain embodiments, the compound of Formula (IV) is of one of the following Formulae: , , , , , or a salt thereof, wherein: each t is independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; each u is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and each v is independently 1, 2, or 3. In certain embodiments, a compound of Formula (IV) is of Formula (IV-a): (IV-a), or a salt thereof. In certain embodiments, a phospholipid useful or potentially useful in the present invention comprises a cyclic moiety in place of the glyceride moiety. In certain embodiments, a phospholipid useful in the present invention is DSPC, or analog thereof, with a cyclic moiety in place of the glyceride moiety. In certain embodiments, the compound of Formula (IV) is of Formula (IV-b): , (IV-b), or a salt thereof. Phospholipid Tail Modifications In certain embodiments, a phospholipid useful or potentially useful in the present invention comprises a modified tail. In certain embodiments, a phospholipid useful or potentially useful in the present invention is DSPC, or analog thereof, with a modified tail. As described herein, a “modified tail” may be a tail with shorter or longer aliphatic chains, aliphatic chains with branching introduced, aliphatic chains with substituents introduced, aliphatic chains wherein one or more methylenes are replaced by cyclic or heteroatom groups, or any combination thereof. For example, in certain embodiments, the compound of (IV) is of Formula (IV-a), or a salt thereof, wherein at least one instance of R2is each instance of R2is optionally substituted C1-30 alkyl, wherein one or more methylene units of R2are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, - C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, - OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRNC(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), OS(O), - S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(RN)S(O), S(O)N(RN), - N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), - N(RN)S(O)2N(RN), OS(O)2N(RN), or N(RN)S(O)2O. In certain embodiments, the compound of Formula (IV) is of Formula (IV-c): (IV-c), or a salt thereof, wherein: each x is independently an integer between 0-30, inclusive; and each instance is G is independently selected from the group consisting of optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, - C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, - OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRNC(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), OS(O), - S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(RN)S(O), S(O)N(RN), - N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), - N(RN)S(O)2N(RN), OS(O)2N(RN), or N(RN)S(O)2O. Each possibility represents a separate embodiment of the present invention. In certain embodiments, a phospholipid useful or potentially useful in the present invention comprises a modified phosphocholine moiety, wherein the alkyl chain linking the quaternary amine to the phosphoryl group is not ethylene (e.g., n is not 2). Therefore, in certain embodiments, a phospholipid useful or potentially useful in the present invention is a compound of Formula (IV), wherein n is 1, 3, 4, 5, 6, 7, 8, 9, or 10. For example, in certain embodiments, a compound of Formula (IV) is of one of the following Formulae: , , or a salt thereof. Alternative Lipids In certain embodiments, a phospholipid useful or potentially useful in the present invention comprises a modified phosphocholine moiety, wherein the alkyl chain linking the quaternary amine to the phosphoryl group is not ethylene (e.g., n is not 2). Therefore, in certain embodiments, a phospholipid useful. In certain embodiments, an alternative lipid is used in place of a phospholipid of the present disclosure. In certain embodiments, an alternative lipid of the invention is oleic acid. In certain embodiments, the alternative lipid is one of the following: , , , , , , and . Structural Lipids The lipid composition of a pharmaceutical composition disclosed herein can comprise one or more structural lipids. As used herein, the term "structural lipid" refers to sterols and also to lipids containing sterol moieties. Incorporation of structural lipids in the lipid nanoparticle may help mitigate aggregation of other lipids in the particle. Structural lipids can be selected from the group including but not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha- tocopherol, hopanoids, phytosterols, steroids, and mixtures thereof. In some embodiments, the structural lipid is a sterol. As defined herein, "sterols" are a subgroup of steroids consisting of steroid alcohols. In certain embodiments, the structural lipid is a steroid. In certain embodiments, the structural lipid is cholesterol. In certain embodiments, the structural lipid is an analog of cholesterol. In certain embodiments, the structural lipid is alpha-tocopherol. In some embodiments, the structural lipids may be one or more of the structural lipids described in U.S. Application No.62 / 520,530. Polyethylene Glycol (PEG)-Lipids The lipid composition of a pharmaceutical composition disclosed herein can comprise one or more a polyethylene glycol (PEG) lipid. As used herein, the term “PEG-lipid” refers to polyethylene glycol (PEG)- modified lipids. Non-limiting examples of PEG-lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines and PEG-modified 1,2- diacyloxypropan-3-amines. Such lipids are also referred to as PEGylated lipids. For example, a PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid. In some embodiments, the PEG-lipid includes, but not limited to 1,2- dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn- glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEG- disteryl glycerol (PEG-DSG), PEG-dipalmetoleyl, PEG-dioleyl, PEG-distearyl, PEG- diacylglycamide (PEG-DAG), PEG-dipalmitoyl phosphatidylethanolamine (PEG- DPPE), or PEG-l,2-dimyristyloxlpropyl-3-amine (PEG-c-DMA). In one embodiment, the PEG-lipid is selected from the group consisting of a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG- modified ceramide, a PEG-modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof. In some embodiments, the lipid moiety of the PEG-lipids includes those having lengths of from about C14to about C22, preferably from about C14to about C16. In some embodiments, a PEG moiety, for example an mPEG-NH2, has a size of about 1000, 2000, 5000, 10,000, 15,000 or 20,000 daltons. In one embodiment, the PEG- lipid is PEG2k-DMG. In one embodiment, the lipid nanoparticles described herein can comprise a PEG lipid which is a non-diffusible PEG. Non-limiting examples of non-diffusible PEGs include PEG-DSG and PEG-DSPE. PEG-lipids are known in the art, such as those described in U.S. Patent No. 8158601 and International Publ. No. WO 2015 / 130584 A2, which are incorporated herein by reference in their entirety. In general, some of the other lipid components (e.g., PEG lipids) of various Formulae, described herein may be synthesized as described International Patent Application No. PCT / US2016 / 000129, filed December 10, 2016, entitled “Compositions and Methods for Delivery of Therapeutic Agents,” which is incorporated by reference in its entirety. The lipid component of a lipid nanoparticle composition may include one or more molecules comprising polyethylene glycol, such as PEG or PEG-modified lipids. Such species may be alternately referred to as PEGylated lipids. A PEG lipid is a lipid modified with polyethylene glycol. A PEG lipid may be selected from the non-limiting group including PEG-modified phosphatidylethanolamines, PEG- modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. For example, a PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid. In some embodiments the PEG-modified lipids are a modified form of PEG DMG. PEG-DMG has the following structure: In one embodiment, PEG lipids useful in the present invention can be PEGylated lipids described in International Publication No. WO2012099755, the contents of which is herein incorporated by reference in its entirety. Any of these exemplary PEG lipids described herein may be modified to comprise a hydroxyl group on the PEG chain. In certain embodiments, the PEG lipid is a PEG-OH lipid. As generally defined herein, a “PEG-OH lipid” (also referred to herein as “hydroxy- PEGylated lipid”) is a PEGylated lipid having one or more hydroxyl (–OH) groups on the lipid. In certain embodiments, the PEG-OH lipid includes one or more hydroxyl groups on the PEG chain. In certain embodiments, a PEG-OH or hydroxy-PEGylated lipid comprises an –OH group at the terminus of the PEG chain. Each possibility represents a separate embodiment of the present invention. In certain embodiments, a PEG lipid useful in the present invention is a compound of Formula (V). Provided herein are compounds of Formula (V): (V), or salts thereof, wherein: R3is –ORO; ROis hydrogen, optionally substituted alkyl, or an oxygen protecting group; r is an integer between 1 and 100, inclusive; L1is optionally substituted C1-10 alkylene, wherein at least one methylene of the optionally substituted C1-10alkylene is independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, O, N(RN), S, C(O), - C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, or - NRNC(O)N(RN); D is a moiety obtained by click chemistry or a moiety cleavable under physiological conditions; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is of the Formula: or ; each instance of L2is independently a bond or optionally substituted C1-6 alkylene, wherein one methylene unit of the optionally substituted C1-6alkylene is optionally replaced with O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, or NRNC(O)N(RN); each instance of R2is independently optionally substituted C1-30 alkyl, optionally substituted C1-30alkenyl, or optionally substituted C1-30alkynyl; optionally wherein one or more methylene units of R2are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, - C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, - OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRNC(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O) , OS(O), - S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(RN)S(O), S(O)N(RN), - N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), - N(RN)S(O)2N(RN), OS(O)2N(RN), or N(RN)S(O)2O; each instance of RNis independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group; Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and p is 1 or 2. In certain embodiments, the compound of Fomula (V) is a PEG-OH lipid (i.e., R3is –ORO, and ROis hydrogen). In certain embodiments, the compound of Formula (V) is of Formula (V-OH): (V-OH), or a salt thereof. In certain embodiments, a PEG lipid useful in the present invention is a PEGylated fatty acid. In certain embodiments, a PEG lipid useful in the present invention is a compound of Formula (VI). Provided herein are compounds of Formula (VI): (VI), or a salts thereof, wherein: R3is–ORO; ROis hydrogen, optionally substituted alkyl or an oxygen protecting group; r is an integer between 1 and 100, inclusive; R5is optionally substituted C10-40alkyl, optionally substituted C10-40alkenyl, or optionally substituted C10-40 alkynyl; and optionally one or more methylene groups of R5are replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), - OC(O)O, OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), - NRNC(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), - S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(RN)S(O), S(O)N(RN), N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), - N(RN)S(O)2N(RN), OS(O)2N(RN), or N(RN)S(O)2O; and each instance of RNis independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group. In certain embodiments, the compound of Formula (VI) is of Formula (VI- OH): (VI-OH), or a salt thereof. In some embodiments, r is 45. In yet other embodiments the compound of Formula (VI) is: . or a salt thereof. In one embodiment, the compound of Formula (VI) is (Compound I). In some aspects, the lipid composition of the pharmaceutical compositions disclosed herein does not comprise a PEG-lipid. In some embodiments, the PEG-lipids may be one or more of the PEG lipids described in U.S. Application No.62 / 520,530. In some embodiments, a PEG lipid of the invention comprises a PEG- modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG- modified ceramide, a PEG-modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof. In some embodiments, the PEG-modified lipid is PEG-DMG, PEG-c-DOMG (also referred to as PEG-DOMG), PEG-DSG and / or PEG-DPG. In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of any of Formula I, II or III, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising PEG-DMG. In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of any of Formula I, II or III, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising a compound having Formula VI. In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid comprising a compound having Formula IV, a structural lipid, and the PEG lipid comprising a compound having Formula V or VI. In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid comprising a compound having Formula IV, a structural lipid, and the PEG lipid comprising a compound having Formula V or VI. In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid having Formula IV, a structural lipid, and a PEG lipid comprising a compound having Formula VI. In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of , and a PEG lipid comprising Formula VI. In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of , and an alternative lipid comprising oleic acid. In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of , an alternative lipid comprising oleic acid, a structural lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI. In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of a phospholipid comprising DOPE, a structural lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI. In some embodiments, a LNP of the invention comprises an ionizable cationic lipid of , a phospholipid comprising DOPE, a structural lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI. In some embodiments, a LNP of the invention comprises an N:P ratio of from about 2:1 to about 30:1. In some embodiments, a LNP of the invention comprises an N:P ratio of about 6:1. In some embodiments, a LNP of the invention comprises an N:P ratio of about 3:1. In some embodiments, a LNP of the invention comprises a wt / wt ratio of the ionizable cationic lipid component to the RNA of from about 10:1 to about 100:1. In some embodiments, a LNP of the invention comprises a wt / wt ratio of the ionizable cationic lipid component to the RNA of about 20:1. In some embodiments, a LNP of the invention comprises a wt / wt ratio of the ionizable cationic lipid component to the RNA of about 10:1. In some embodiments, a LNP of the invention has a mean diameter from about 50nm to about 150nm. In some embodiments, a LNP of the invention has a mean diameter from about 70nm to about 120nm. As used herein, the term "alkyl", "alkyl group", or "alkylene" means a linear or branched, saturated hydrocarbon including one or more carbon atoms (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms), which is optionally substituted. The notation "C1-14 alkyl" means an optionally substituted linear or branched, saturated hydrocarbon including 1-14 carbon atoms. Unless otherwise specified, an alkyl group described herein refers to both unsubstituted and substituted alkyl groups. As used herein, the term "alkenyl", "alkenyl group", or "alkenylene" means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one double bond, which is optionally substituted. The notation "C2-14 alkenyl" means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon double bond. An alkenyl group may include one, two, three, four, or more carbon-carbon double bonds. For example, C18alkenyl may include one or more double bonds. A C18 alkenyl group including two double bonds may be a linoleyl group. Unless otherwise specified, an alkenyl group described herein refers to both unsubstituted and substituted alkenyl groups. As used herein, the term "alkynyl", "alkynyl group", or "alkynylene" means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one carbon-carbon triple bond, which is optionally substituted. The notation "C2-14 alkynyl" means an optionally substituted linear or branched hydrocarbon including 2- 14 carbon atoms and at least one carbon-carbon triple bond. An alkynyl group may include one, two, three, four, or more carbon-carbon triple bonds. For example, C18alkynyl may include one or more carbon-carbon triple bonds. Unless otherwise specified, an alkynyl group described herein refers to both unsubstituted and substituted alkynyl groups. As used herein, the term "carbocycle" or "carbocyclic group" means an optionally substituted mono- or multi-cyclic system including one or more rings of carbon atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or twenty membered rings. The notation "C3-6carbocycle" means a carbocycle including a single ring having 3-6 carbon atoms. Carbocycles may include one or more carbon- carbon double or triple bonds and may be non-aromatic or aromatic (e.g., cycloalkyl or aryl groups). Examples of carbocycles include cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, and 1,2 dihydronaphthyl groups. The term "cycloalkyl" as used herein means a non-aromatic carbocycle and may or may not include any double or triple bond. Unless otherwise specified, carbocycles described herein refers to both unsubstituted and substituted carbocycle groups, i.e., optionally substituted carbocycles. As used herein, the term "heterocycle" or "heterocyclic group" means an optionally substituted mono- or multi-cyclic system including one or more rings, where at least one ring includes at least one heteroatom. Heteroatoms may be, for example, nitrogen, oxygen, or sulfur atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen membered rings. Heterocycles may include one or more double or triple bonds and may be non- aromatic or aromatic (e.g., heterocycloalkyl or heteroaryl groups). Examples of heterocycles include imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl groups. The term "heterocycloalkyl" as used herein means a non-aromatic heterocycle and may or may not include any double or triple bond. Unless otherwise specified, heterocycles described herein refers to both unsubstituted and substituted heterocycle groups, i.e., optionally substituted heterocycles. As used herein, the term "heteroalkyl", "heteroalkenyl", or "heteroalkynyl", refers respectively to an alkyl, alkenyl, alkynyl group, as defined herein, which further comprises one or more (e.g., 1, 2, 3, or 4) heteroatoms (e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus) wherein the one or more heteroatoms is inserted between adjacent carbon atoms within the parent carbon chain and / or one or more heteroatoms is inserted between a carbon atom and the parent molecule, i.e., between the point of attachment. Unless otherwise specified, heteroalkyls, heteroalkenyls, or heteroalkynyls described herein refers to both unsubstituted and substituted heteroalkyls, heteroalkenyls, or heteroalkynyls, i.e., optionally substituted heteroalkyls, heteroalkenyls, or heteroalkynyls. As used herein, a "biodegradable group" is a group that may facilitate faster metabolism of a lipid in a mammalian entity. A biodegradable group may be selected from the group consisting of, but is not limited to, -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, an aryl group, and a heteroaryl group. As used herein, an "aryl group" is an optionally substituted carbocyclic group including one or more aromatic rings. Examples of aryl groups include phenyl and naphthyl groups. As used herein, a "heteroaryl group" is an optionally substituted heterocyclic group including one or more aromatic rings. Examples of heteroaryl groups include pyrrolyl, furyl, thiophenyl, imidazolyl, oxazolyl, and thiazolyl. Both aryl and heteroaryl groups may be optionally substituted. For example, M and M' can be selected from the non- limiting group consisting of optionally substituted phenyl, oxazole, and thiazole. In the Formulas herein, M and M' can be independently selected from the list of biodegradable groups above. Unless otherwise specified, aryl or heteroaryl groups described herein refers to both unsubstituted and substituted groups, i.e., optionally substituted aryl or heteroaryl groups. Alkyl, alkenyl, and cyclyl (e.g., carbocyclyl and heterocyclyl) groups may be optionally substituted unless otherwise specified. Optional substituents may be selected from the group consisting of, but are not limited to, a halogen atom (e.g., a chloride, bromide, fluoride, or iodide group), a carboxylic acid (e.g., C(O)OH), an alcohol (e.g., a hydroxyl, OH), an ester (e.g., C(O)OR OC(O)R), an aldehyde (e.g., C(O)H), a carbonyl (e.g., C(O)R, alternatively represented by C=O), an acyl halide (e.g., C(O)X, in which X is a halide selected from bromide, fluoride, chloride, and iodide), a carbonate (e.g., OC(O)OR), an alkoxy (e.g., OR), an acetal (e.g., C(OR)2R"", in which each OR are alkoxy groups that can be the same or different and R"" is an alkyl or alkenyl group), a phosphate (e.g., P(O)43-), a thiol (e.g., SH), a sulfoxide (e.g., S(O)R), a sulfinic acid (e.g., S(O)OH), a sulfonic acid (e.g., S(O)2OH), a thial (e.g., C(S)H), a sulfate (e.g., S(O)42-), a sulfonyl (e.g., S(O)2 ), an amide (e.g., C(O)NR2, or N(R)C(O)R), an azido (e.g., N3), a nitro (e.g., NO2), a cyano (e.g., CN), an isocyano (e.g., NC), an acyloxy (e.g., OC(O)R), an amino (e.g., NR2, NRH, or NH2), a carbamoyl (e.g., OC(O)NR2, OC(O)NRH, or OC(O)NH2), a sulfonamide (e.g., S(O)2NR2, S(O)2NRH, S(O)2NH2, N(R)S(O)2R, N(H)S(O)2R, N(R)S(O)2H, or N(H)S(O)2H), an alkyl group, an alkenyl group, and a cyclyl (e.g., carbocyclyl or heterocyclyl) group. In any of the preceding, R is an alkyl or alkenyl group, as defined herein. In some embodiments, the substituent groups themselves may be further substituted with, for example, one, two, three, four, five, or six substituents as defined herein. For example, a C1-6 alkyl group may be further substituted with one, two, three, four, five, or six substituents as described herein. Compounds of the disclosure that contain nitrogens can be converted to N- oxides by treatment with an oxidizing agent (e.g., 3-chloroperoxybenzoic acid (mCPBA) and / or hydrogen peroxides) to afford other compounds of the disclosure. Thus, all shown and claimed nitrogen-containing compounds are considered, when allowed by valency and structure, to include both the compound as shown and its N- oxide derivative (which can be designated as N^O or N+-O-). Furthermore, in other instances, the nitrogens in the compounds of the disclosure can be converted to N- hydroxy or N-alkoxy compounds. For example, N-hydroxy compounds can be prepared by oxidation of the parent amine by an oxidizing agent such as m CPBA. All shown and claimed nitrogen-containing compounds are also considered, when allowed by valency and structure, to cover both the compound as shown and its N- hydroxy (i.e., N-OH) and N-alkoxy (i.e., N-OR, wherein R is substituted or unsubstituted C1-C6alkyl, C1-C6alkenyl, C1-C6alkynyl, 3-14-membered carbocycle or 3-14-membered heterocycle) derivatives. Other Lipid Composition Components The lipid composition of a pharmaceutical composition disclosed herein can include one or more components in addition to those described above. For example, the lipid composition can include one or more permeability enhancer molecules, carbohydrates, polymers, surface altering agents (e.g., surfactants), or other components. For example, a permeability enhancer molecule can be a molecule described by U.S. Patent Application Publication No.2005 / 0222064. Carbohydrates can include simple sugars (e.g., glucose) and polysaccharides (e.g., glycogen and derivatives and analogs thereof). A polymer can be included in and / or used to encapsulate or partially encapsulate a pharmaceutical composition disclosed herein (e.g., a pharmaceutical composition in lipid nanoparticle form). A polymer can be biodegradable and / or biocompatible. A polymer can be selected from, but is not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, polystyrenes, polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyleneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates. The ratio between the lipid composition and the polynucleotide range can be from about 10:1 to about 60:1 (wt / wt). In some embodiments, the ratio between the lipid composition and the polynucleotide can be about 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 21:1, 22:1, 23:1, 24:1, 25:1, 26:1, 27:1, 28:1, 29:1, 30:1, 31:1, 32:1, 33:1, 34:1, 35:1, 36:1, 37:1, 38:1, 39:1, 40:1, 41:1, 42:1, 43:1, 44:1, 45:1, 46:1, 47:1, 48:1, 49:1, 50:1, 51:1, 52:1, 53:1, 54:1, 55:1, 56:1, 57:1, 58:1, 59:1 or 60:1 (wt / wt). In some embodiments, the wt / wt ratio of the lipid composition to the polynucleotide encoding a therapeutic agent is about 20:1 or about 15:1. In some embodiments, the pharmaceutical composition disclosed herein can contain more than one polypeptides. For example, a pharmaceutical composition disclosed herein can contain two or more polynucleotides (e.g., RNA, e.g., mRNA). In one embodiment, the lipid nanoparticles described herein can comprise polynucleotides (e.g., mRNA) in a lipid:polynucleotide weight ratio of 5:1, 10:1, 15:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, 55:1, 60:1 or 70:1, or a range or any of these ratios such as, but not limited to, 5:1 to about 10:1, from about 5:1 to about 15:1, from about 5:1 to about 20:1, from about 5:1 to about 25:1, from about 5:1 to about 30:1, from about 5:1 to about 35:1, from about 5:1 to about 40:1, from about 5:1 to about 45:1, from about 5:1 to about 50:1, from about 5:1 to about 55:1, from about 5:1 to about 60:1, from about 5:1 to about 70:1, from about 10:1 to about 15:1, from about 10:1 to about 20:1, from about 10:1 to about 25:1, from about 10:1 to about 30:1, from about 10:1 to about 35:1, from about 10:1 to about 40:1, from about 10:1 to about 45:1, from about 10:1 to about 50:1, from about 10:1 to about 55:1, from about 10:1 to about 60:1, from about 10:1 to about 70:1, from about 15:1 to about 20:1, from about 15:1 to about 25:1,from about 15:1 to about 30:1, from about 15:1 to about 35:1, from about 15:1 to about 40:1, from about 15:1 to about 45:1, from about 15:1 to about 50:1, from about 15:1 to about 55:1, from about 15:1 to about 60:1 or from about 15:1 to about 70:1. In one embodiment, the lipid nanoparticles described herein can comprise the polynucleotide in a concentration from approximately 0.1 mg / ml to 2 mg / ml such as, but not limited to, 0.1 mg / ml, 0.2 mg / ml, 0.3 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0.6 mg / ml, 0.7 mg / ml, 0.8 mg / ml, 0.9 mg / ml, 1.0 mg / ml, 1.1 mg / ml, 1.2 mg / ml, 1.3 mg / ml, 1.4 mg / ml, 1.5 mg / ml, 1.6 mg / ml, 1.7 mg / ml, 1.8 mg / ml, 1.9 mg / ml, 2.0 mg / ml or greater than 2.0 mg / ml. Nanoparticle Compositions In some embodiments, the pharmaceutical compositions disclosed herein are Formulated as lipid nanoparticles (LNP). Accordingly, the present disclosure also provides nanoparticle compositions comprising (i) a lipid composition comprising a delivery agent such as compound as described herein, and (ii) a polynucleotide encoding any of the polypeptides described herein (e.g., a polypeptide that is translated at the endoplasmic reticulum or mitochondria such as a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide). In such nanoparticle composition, the lipid composition disclosed herein can encapsulate the polynucleotide encoding any of the polypeptides described herein (e.g., a polypeptide that is translated at the endoplasmic reticulum or mitochondria such as a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide). Nanoparticle compositions are typically sized on the order of micrometers or smaller and can include a lipid bilayer. Nanoparticle compositions encompass lipid nanoparticles (LNPs), liposomes (e.g., lipid vesicles), and lipoplexes. For example, a nanoparticle composition can be a liposome having a lipid bilayer with a diameter of 500 nm or less. Nanoparticle compositions include, for example, lipid nanoparticles (LNPs), liposomes, and lipoplexes. In some embodiments, nanoparticle compositions are vesicles including one or more lipid bilayers. In certain embodiments, a nanoparticle composition includes two or more concentric bilayers separated by aqueous compartments. Lipid bilayers can be functionalized and / or crosslinked to one another. Lipid bilayers can include one or more ligands, proteins, or channels. In one embodiment, a lipid nanoparticle comprises an ionizable amino lipid, a structural lipid, a phospholipid, and mRNA. In some embodiments, the LNP comprises an ionizable amino lipid, a PEG-modified lipid, a sterol and a structural lipid. In some embodiments, the LNP has a molar ratio of about 40-50% ionizable amino lipid; about 5-15% structural lipid; about 30-45% sterol; and about 1-5% PEG- modified lipid. In some embodiments, the LNP has a polydispersity value of less than 0.4. In some embodiments, the LNP has a net neutral charge at a neutral pH. In some embodiments, the LNP has a mean diameter of 50-150 nm. In some embodiments, the LNP has a mean diameter of 80-100 nm. As generally defined herein, the term “lipid” refers to a small molecule that has hydrophobic or amphiphilic properties. Lipids may be naturally occurring or synthetic. Examples of classes of lipids include, but are not limited to, fats, waxes, sterol-containing metabolites, vitamins, fatty acids, glycerolipids, glycerophospholipids, sphingolipids, saccharolipids, and polyketides, and prenol lipids. In some instances, the amphiphilic properties of some lipids leads them to form liposomes, vesicles, or membranes in aqueous media. In some embodiments, a lipid nanoparticle (LNP) may comprise an ionizable amino lipid. As used herein, the term “ionizable amino lipid” has its ordinary meaning in the art and may refer to a lipid comprising one or more charged moieties. In some embodiments, an ionizable amino lipid may be positively charged or negatively charged. An ionizable amino lipid may be positively charged, in which case it can be referred to as “cationic lipid”. In certain embodiments, an ionizable amino lipid molecule may comprise an amine group, and can be referred to as an ionizable amino lipid. As used herein, a “charged moiety” is a chemical moiety that carries a formal electronic charge, e.g., monovalent (+1, or -1), divalent (+2, or -2), trivalent (+3, or -3), etc. The charged moiety may be anionic (i.e., negatively charged) or cationic (i.e., positively charged). Examples of positively-charged moieties include amine groups (e.g., primary, secondary, and / or tertiary amines), ammonium groups, pyridinium group, guanidine groups, and imidizolium groups. In a particular embodiment, the charged moieties comprise amine groups. Examples of negatively- charged groups or precursors thereof, include carboxylate groups, sulfonate groups, sulfate groups, phosphonate groups, phosphate groups, hydroxyl groups, and the like. The charge of the charged moiety may vary, in some cases, with the environmental conditions, for example, changes in pH may alter the charge of the moiety, and / or cause the moiety to become charged or uncharged. In general, the charge density of the molecule may be selected as desired. It should be understood that the terms “charged” or “charged moiety” does not refer to a “partial negative charge" or “partial positive charge" on a molecule. The terms “partial negative charge" and “partial positive charge" are given its ordinary meaning in the art. A “partial negative charge" may result when a functional group comprises a bond that becomes polarized such that electron density is pulled toward one atom of the bond, creating a partial negative charge on the atom. Those of ordinary skill in the art will, in general, recognize bonds that can become polarized in this way. The ionizable amino lipid is sometimes referred to in the art as an “ionizable cationic lipid”. In one embodiment, the ionizable amino lipid may have a positively charged hydrophilic head and a hydrophobic tail that are connected via a linker structure. In addition to these, an ionizable amino lipid may also be a lipid including a cyclic amine group. In one embodiment, the ionizable amino lipid may be selected from, but not limited to, an ionizable amino lipid described in International Publication Nos. WO2013086354 and WO2013116126; the contents of each of which are herein incorporated by reference in their entirety. In yet another embodiment, the ionizable amino lipid may be selected from, but not limited to, Formula CLI-CLXXXXII of US Patent No.7,404,969; each of which is herein incorporated by reference in their entirety. In one embodiment, the lipid may be a cleavable lipid such as those described in International Publication No. WO2012170889, herein incorporated by reference in its entirety. In one embodiment, the lipid may be synthesized by methods known in the art and / or as described in International Publication Nos. WO2013086354; the contents of each of which are herein incorporated by reference in their entirety. Nanoparticle compositions can be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of a nanoparticle composition. Dynamic light scattering or potentiometry (e.g., potentiometric titrations) can be used to measure zeta potentials. Dynamic light scattering can also be utilized to determine particle sizes. Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) can also be used to measure multiple characteristics of a nanoparticle composition, such as particle size, polydispersity index, and zeta potential. The size of the nanoparticles can help counter biological reactions such as, but not limited to, inflammation, or can increase the biological effect of the polynucleotide. As used herein, “size” or “mean size” in the context of nanoparticle compositions refers to the mean diameter of a nanoparticle composition. In one embodiment, the polynucleotide encoding any of the polypeptides described herein (e.g., a polypeptide that is translated at the endoplasmic reticulum or mitochondria such as a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide) are Formulated in lipid nanoparticles having a diameter from about 10 to about 100 nm such as, but not limited to, about 10 to about 20 nm, about 10 to about 30 nm, about 10 to about 40 nm, about 10 to about 50 nm, about 10 to about 60 nm, about 10 to about 70 nm, about 10 to about 80 nm, about 10 to about 90 nm, about 20 to about 30 nm, about 20 to about 40 nm, about 20 to about 50 nm, about 20 to about 60 nm, about 20 to about 70 nm, about 20 to about 80 nm, about 20 to about 90 nm, about 20 to about 100 nm, about 30 to about 40 nm, about 30 to about 50 nm, about 30 to about 60 nm, about 30 to about 70 nm, about 30 to about 80 nm, about 30 to about 90 nm, about 30 to about 100 nm, about 40 to about 50 nm, about 40 to about 60 nm, about 40 to about 70 nm, about 40 to about 80 nm, about 40 to about 90 nm, about 40 to about 100 nm, about 50 to about 60 nm, about 50 to about 70 nm, about 50 to about 80 nm, about 50 to about 90 nm, about 50 to about 100 nm, about 60 to about 70 nm, about 60 to about 80 nm, about 60 to about 90 nm, about 60 to about 100 nm, about 70 to about 80 nm, about 70 to about 90 nm, about 70 to about 100 nm, about 80 to about 90 nm, about 80 to about 100 nm and / or about 90 to about 100 nm. In one embodiment, the nanoparticles have a diameter from about 10 to 500 nm. In one embodiment, the nanoparticle has a diameter greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than 400 nm, greater than 450 nm, greater than 500 nm, greater than 550 nm, greater than 600 nm, greater than 650 nm, greater than 700 nm, greater than 750 nm, greater than 800 nm, greater than 850 nm, greater than 900 nm, greater than 950 nm or greater than 1000 nm. In some embodiments, the largest dimension of a nanoparticle composition is 1 µm or shorter (e.g., 1 µm, 900 nm, 800 nm, 700 nm, 600 nm, 500 nm, 400 nm, 300 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, 50 nm, or shorter). A nanoparticle composition can be relatively homogenous. A polydispersity index can be used to indicate the homogeneity of a nanoparticle composition, e.g., the particle size distribution of the nanoparticle composition. A small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution. A nanoparticle composition can have a polydispersity index from about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of a nanoparticle composition disclosed herein can be from about 0.10 to about 0.20. The zeta potential of a nanoparticle composition can be used to indicate the electrokinetic potential of the composition. For example, the zeta potential can describe the surface charge of a nanoparticle composition. Nanoparticle compositions with relatively low charges, positive or negative, are generally desirable, as more highly charged species can interact undesirably with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of a nanoparticle composition disclosed herein can be from about -10 mV to about +20 mV, from about -10 mV to about +15 mV, from about 10 mV to about +10 mV, from about -10 mV to about +5 mV, from about -10 mV to about 0 mV, from about -10 mV to about -5 mV, from about -5 mV to about +20 mV, from about -5 mV to about +15 mV, from about -5 mV to about +10 mV, from about -5 mV to about +5 mV, from about -5 mV to about 0 mV, from about 0 mV to about +20 mV, from about 0 mV to about +15 mV, from about 0 mV to about +10 mV, from about 0 mV to about +5 mV, from about +5 mV to about +20 mV, from about +5 mV to about +15 mV, or from about +5 mV to about +10 mV. In some embodiments, the zeta potential of the lipid nanoparticles can be from about 0 mV to about 100 mV, from about 0 mV to about 90 mV, from about 0 mV to about 80 mV, from about 0 mV to about 70 mV, from about 0 mV to about 60 mV, from about 0 mV to about 50 mV, from about 0 mV to about 40 mV, from about 0 mV to about 30 mV, from about 0 mV to about 20 mV, from about 0 mV to about 10 mV, from about 10 mV to about 100 mV, from about 10 mV to about 90 mV, from about 10 mV to about 80 mV, from about 10 mV to about 70 mV, from about 10 mV to about 60 mV, from about 10 mV to about 50 mV, from about 10 mV to about 40 mV, from about 10 mV to about 30 mV, from about 10 mV to about 20 mV, from about 20 mV to about 100 mV, from about 20 mV to about 90 mV, from about 20 mV to about 80 mV, from about 20 mV to about 70 mV, from about 20 mV to about 60 mV, from about 20 mV to about 50 mV, from about 20 mV to about 40 mV, from about 20 mV to about 30 mV, from about 30 mV to about 100 mV, from about 30 mV to about 90 mV, from about 30 mV to about 80 mV, from about 30 mV to about 70 mV, from about 30 mV to about 60 mV, from about 30 mV to about 50 mV, from about 30 mV to about 40 mV, from about 40 mV to about 100 mV, from about 40 mV to about 90 mV, from about 40 mV to about 80 mV, from about 40 mV to about 70 mV, from about 40 mV to about 60 mV, and from about 40 mV to about 50 mV. In some embodiments, the zeta potential of the lipid nanoparticles can be from about 10 mV to about 50 mV, from about 15 mV to about 45 mV, from about 20 mV to about 40 mV, and from about 25 mV to about 35 mV. In some embodiments, the zeta potential of the lipid nanoparticles can be about 10 mV, about 20 mV, about 30 mV, about 40 mV, about 50 mV, about 60 mV, about 70 mV, about 80 mV, about 90 mV, and about 100 mV. The term “encapsulation efficiency” of a polynucleotide describes the amount of the polynucleotide that is encapsulated by or otherwise associated with a nanoparticle composition after preparation, relative to the initial amount provided. As used herein, “encapsulation” can refer to complete, substantial, or partial enclosure, confinement, surrounding, or encasement. Encapsulation efficiency is desirably high (e.g., close to 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of the polynucleotide in a solution containing the nanoparticle composition before and after breaking up the nanoparticle composition with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free polynucleotide in a solution. For the nanoparticle compositions described herein, the encapsulation efficiency of a polynucleotide can be at least 50%, for example 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency can be at least 90%. The amount of a polynucleotide present in a pharmaceutical composition disclosed herein can depend on multiple factors such as the size of the polynucleotide, desired target and / or application, or other properties of the nanoparticle composition as well as on the properties of the polynucleotide. For example, the amount of an mRNA useful in a nanoparticle composition can depend on the size (expressed as length, or molecular mass), sequence, and other characteristics of the mRNA. The relative amounts of a polynucleotide in a nanoparticle composition can also vary. The relative amounts of the lipid composition and the polynucleotide present in a lipid nanoparticle composition of the present disclosure can be optimized according to considerations of efficacy and tolerability. For compositions including an mRNA as a polynucleotide, the N:P ratio can serve as a useful metric. As the N:P ratio of a nanoparticle composition controls both expression and tolerability, nanoparticle compositions with low N:P ratios and strong expression are desirable. N:P ratios vary according to the ratio of lipids to RNA in a nanoparticle composition. In general, a lower N:P ratio is preferred. The one or more RNA, lipids, and amounts thereof can be selected to provide an N:P ratio from about 2:1 to about 30:1, such as 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30:1. In certain embodiments, the N:P ratio can be from about 2:1 to about 8:1. In other embodiments, the N:P ratio is from about 5:1 to about 8:1. In certain embodiments, the N:P ratio is between 5:1 and 6:1. In one specific aspect, the N:P ratio is about is about 5.67:1. In addition to providing nanoparticle compositions, the present disclosure also provides methods of producing lipid nanoparticles comprising encapsulating a polynucleotide. Such method comprises using any of the pharmaceutical compositions disclosed herein and producing lipid nanoparticles in accordance with methods of production of lipid nanoparticles known in the art. See, e.g., Wang et al. (2015) “Delivery of oligonucleotides with lipid nanoparticles” Adv. Drug Deliv. Rev.87:68- 80; Silva et al. (2015) “Delivery Systems for Biopharmaceuticals. Part I: Nanoparticles and Microparticles” Curr. Pharm. Technol.16: 940-954; Naseri et al. (2015) “Solid Lipid Nanoparticles and Nanostructured Lipid Carriers: Structure, Preparation and Application” Adv. Pharm. Bull.5:305-13; Silva et al. (2015) “Lipid nanoparticles for the delivery of biopharmaceuticals” Curr. Pharm. Biotechnol. 16:291-302, and references cited therein. Methods of Use The polynucleotides, pharmaceutical compositions and formulations described above are used in the preparation, manufacture and therapeutic use of to treat and / or prevent various diseases, disorders or conditions. In some embodiments, the polynucleotides (e.g., those encoding G6PC), compositions and formulations of the present disclosure are used to treat and / or prevent GSD1a. For instance, one aspect of the invention provides a method of alleviating the symptoms of GSD1a in a subject comprising the administration of a composition or formulation comprising a polynucleotide encoding G6PC to that subject (e.g., an mRNA encoding an G6PC polypeptide). In some embodiments, the polynucleotides (e.g., those encoding PCCA and / or PCCB), compositions and formulations of the present disclosure are used to treat and / or prevent propionic acidemia. For instance, one aspect of the invention provides a method of alleviating the symptoms of propionic acidemia in a subject comprising the administration of a composition or formulation comprising one or more polynucleotides encoding PCCA and / or PCCB to that subject (e.g., an mRNA or mRNAs encoding PCCA and / or PCCB polypeptides). In some embodiments, the polynucleotides (e.g., those encoding MUT), compositions and formulations of the present disclosure are used to treat and / or prevent methylmalonic acidemia. For instance, one aspect of the invention provides a method of alleviating the symptoms of methylmalonic acidemia in a subject comprising the administration of a composition or formulation comprising a polynucleotide encoding MUT to that subject (e.g., an mRNA encoding an MUT polypeptide). In some embodiments, the polynucleotides (e.g., those encoding FECH), compositions and formulations of the present disclosure are used to treat and / or prevent erythropoietic protoporphyria. For instance, one aspect of the invention provides a method of alleviating the symptoms of erythropoietic protoporphyria in a subject comprising the administration of a composition or formulation comprising a polynucleotide encoding FECH to that subject (e.g., an mRNA encoding an FECH polypeptide). In some embodiments, the administration of any of the polynucleotides, pharmaceutical compositions or formulations of the invention result in expression of the polypeptide in cells of the subject. In some embodiments, administration of the any of the polynucleotides, pharmaceutical compositions or formulations of the invention result in expression of the polypeptide at the endoplasmic reticulum or mitochondria of the cells of the subject. In some embodiments, administering the polynucleotide, pharmaceutical composition or formulation of the invention results in an increase of the respective polypeptide’s expression in the subject. For example, in some embodiments, the polynucleotides of the present invention are used in methods of administering a composition or formulation comprising an mRNA encoding a polypeptide, as described herein, to a subject, wherein the method results in an increase of the respective polypeptide’s expression and / or enzymatic activity in at least some cells of a subject. In another embodiment, the polynucleotides, pharmaceutical compositions, or formulations of the present disclosure can be repeatedly administered such that protein is expressed at a therapeutic level for a period of time sufficient to have a beneficial biological effect as described herein. In some embodiments, the expression of the encoded polypeptide is increased. In some embodiments, the polynucleotide increases polypeptide expression levels in cells (e.g., specifically at the endoplasmic reticulum or mitochondria) when introduced into those cells, e.g., by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or to 100% with respect to the expression level of the same protein in the cells before the polypeptide is introduced in the cells. The skilled artisan will appreciate that the therapeutic effectiveness of a drug or a treatment of the instant invention can be characterized or determined by measuring the level of expression of an encoded protein (e.g., enzyme) in a sample or in samples taken from a subject (e.g., from a preclinical test subject (rodent, primate, etc.) or from a clinical subject (human). Likewise, the therapeutic effectiveness of a drug or a treatment of the instant invention can be characterized or determined by measuring the level of activity of an encoded protein (e.g., enzyme) in a sample or in samples taken from a subject (e.g., from a preclinical test subject (rodent, primate, etc.) or from a clinical subject (human). Furthermore, the therapeutic effectiveness of a drug or a treatment of the instant invention can be characterized or determined by measuring the level of an appropriate biomarker in sample(s) taken from a subject. Levels of protein and / or biomarkers can be determined post-administration with a single dose of an mRNA therapeutic of the invention or can be determined and / or monitored at several time points following administration with a single dose or can be determined and / or monitored throughout a course of treatment, e.g., a multi-dose treatment. Compositions and Formulations for Use Certain aspects of the invention are directed to compositions or formulations comprising any of the polynucleotides disclosed above. In some embodiments, the composition or formulation comprises: (i) a polynucleotide (e.g., a RNA, e.g., an mRNA) comprising a 5’UTR, an open ready frame encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria (e.g., any of the polypeptides described herein such as, a GLA, hUGT1A1, G6PC, OTC, PCCA, PCCB, MUT, and / or FECH polypeptide), and a 3’ UTR comprising a nucleotide sequence having at least 95% identity (e.g., at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, 100% identity) to the sequence of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), and wherein all of the uracils of the mRNA are N1- methylpseudouracils; and (ii) a delivery agent comprising, e.g., a compound having the Formula (I), e.g., Compound II, Compound A, or Compound B; a compound having the Formula (III), (IV), (V), or (VI), e.g., Compound I or Compound VI, or any combination thereof. In some embodiments, the delivery agent is a lipid nanoparticle comprising Compound II, Compound VI, a salt or a stereoisomer thereof, or any combination thereof. In some embodiments, the delivery agent comprises an ionizable amino lipid (e.g., Compound II, VI, or A), a helper lipid (e.g., DSPC), a sterol (e.g., Cholesterol), and a PEG lipid (e.g., Compound I or PEG-DMG), e.g., with a mole ratio in the range of about (i) 40-50 mol% ionizable amino lipid (e.g., Compound II, VI, or A), optionally 45-50 mol% ionizable amino lipid, for example, 45-46 mol%, 46-47 mol%, 47-48 mol%, 48-49 mol%, or 49-50 mol% for example about 45 mol%, 45.5 mol%, 46 mol%, 46.5 mol%, 47 mol%, 47.5 mol%, 48 mol%, 48.5 mol%, 49 mol%, or 49.5 mol%; (ii) 30-45 mol% sterol (e.g., cholesterol), optionally 35-42 mol% sterol, for example, 30-31 mol%, 31-32 mol%, 32-33 mol%, 33-34 mol%, 35-35 mol%, 35-36 mol%, 36-37 mol%, 37-38 mol%, 38-39 mol%, or 39-40 mol%, or 40-42 mol% sterol; (iii) 5-15 mol% helper lipid (e.g., DSPC), optionally 10-15 mol% helper lipid, for example, 5-6 mol%, 6-7 mol%, 7-8 mol%, 8-9 mol%, 9-10 mol%, 10-11 mol%, 11-12 mol%, 12-13 mol%, 13-14 mol%, or 14-15 mol% helper lipid; and (iv) 1-5% PEG lipid (e.g., Compound I or PEG-DMG), optionally 1-5 mol% PEG lipid, for example 1.5 to 2.5 mol%, 1-2 mol%, 2-3 mol%, 3-4 mol%, or 4-5 mol% PEG lipid. Definitions In order that the present disclosure can be more readily understood, certain terms are first defined. As used in this application, except as otherwise expressly provided herein, each of the following terms shall have the meaning set forth below. Additional definitions are set forth throughout the application. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process. In this specification and the appended claims, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. The terms "a" (or "an"), as well as the terms "one or more," and "at least one" can be used interchangeably herein. In certain aspects, the term "a" or "an" means "single." In other aspects, the term "a" or "an" includes "two or more" or "multiple." Furthermore, "and / or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and / or" as used in a phrase such as "A and / or B" herein is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Likewise, the term "and / or" as used in a phrase such as "A, B, and / or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone). Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary Of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure. Wherever aspects are described herein with the language "comprising," otherwise analogous aspects described in terms of "consisting of" and / or "consisting essentially of" are also provided. Units, prefixes, and symbols are denoted in their Système International de Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. Where a range of values is recited, it is to be understood that each intervening integer value, and each fraction thereof, between the recited upper and lower limits of that range is also specifically disclosed, along with each subrange between such values. The upper and lower limits of any range can independently be included in or excluded from the range, and each range where either, neither or both limits are included is also encompassed within the invention. Where a value is explicitly recited, it is to be understood that values which are about the same quantity or amount as the recited value are also within the scope of the invention. Where a combination is disclosed, each subcombination of the elements of that combination is also specifically disclosed and is within the scope of the invention. Conversely, where different elements or groups of elements are individually disclosed, combinations thereof are also disclosed. Where any element of an invention is disclosed as having a plurality of alternatives, examples of that invention in which each alternative is excluded singly or in any combination with the other alternatives are also hereby disclosed; more than one element of an invention can have such exclusions, and all combinations of elements having such exclusions are hereby disclosed. Nucleotides are referred to by their commonly accepted single-letter codes. Unless otherwise indicated, nucleic acids are written left to right in 5′ to 3′ orientation. Nucleobases are referred to herein by their commonly known one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Accordingly, A represents adenine, C represents cytosine, G represents guanine, T represents thymine, U represents uracil. Amino acids are referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Unless otherwise indicated, amino acid sequences are written left to right in amino to carboxy orientation. About: The term "about" as used in connection with a numerical value throughout the specification and the claims denotes an interval of accuracy, familiar and acceptable to a person skilled in the art, such interval of accuracy is ± 10 %. Where ranges are given, endpoints are included. Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. Approximately: As used herein, the term "approximately," as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term "approximately" refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value). Dosing regimen: As used herein, a "dosing regimen" or a "dosing regimen" is a schedule of administration or physician determined regimen of treatment, prophylaxis, or palliative care. Effective Amount: As used herein, the term "effective amount" of an agent is that amount sufficient to effect beneficial or desired results, for example, clinical results, and, as such, an "effective amount" depends upon the context in which it is being applied. The term "effective amount" can be used interchangeably with "effective dose," "therapeutically effective amount," or "therapeutically effective dose." Methods of Administration: As used herein, “methods of administration” can include intravenous, intramuscular, intradermal, subcutaneous, or other methods of delivering a composition to a subject. A method of administration can be selected to target delivery (e.g., to specifically deliver) to a specific region or system of a body. Nanoparticle Composition: As used herein, a “nanoparticle composition” is a composition comprising one or more lipids. Nanoparticle compositions are typically sized on the order of micrometers or smaller and can include a lipid bilayer. Nanoparticle compositions encompass lipid nanoparticles (LNPs), liposomes (e.g., lipid vesicles), and lipoplexes. For example, a nanoparticle composition can be a liposome having a lipid bilayer with a diameter of 500 nm or less. The phrase "nucleotide sequence encoding" refers to the nucleic acid (e.g., an mRNA or DNA molecule) coding sequence which encodes a polypeptide. The coding sequence can further include initiation and termination signals operably linked to regulatory elements including a promoter and polyadenylation signal capable of directing expression in the cells of an individual or mammal to which the nucleic acid is administered. The coding sequence can further include sequences that encode signal peptides. Pseudouridine: As used herein, pseudouridine (ψ) refers to the C-glycoside isomer of the nucleoside uridine. A "pseudouridine analog" is any modification, variant, isoform or derivative of pseudouridine. For example, pseudouridine analogs include but are not limited to 1-carboxymethyl-pseudouridine, 1-propynyl- pseudouridine, 1-taurinomethyl-pseudouridine, 1-taurinomethyl-4-thio-pseudouridine, 1-methylpseudouridine (m1ψ) (also known as N1-methyl-pseudouridine), 1-methyl-4- thio-pseudouridine (m1s4ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m3ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1- methyl-1-deaza-pseudouridine, dihydropseudouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy- 2-thio-pseudouridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp3ψ), and 2′-O-methyl-pseudouridine (ψm). Therapeutically effective amount: As used herein, the term "therapeutically effective amount" means an amount of an agent to be delivered (e.g., nucleic acid, drug, therapeutic agent, diagnostic agent, prophylactic agent, etc.) that is sufficient, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and / or condition, to treat, improve symptoms of, diagnose, prevent, and / or delay the onset of the infection, disease, disorder, and / or condition. Uracil: Uracil is one of the four nucleobases in the nucleic acid of RNA, and it is represented by the letter U. Uracil can be attached to a ribose ring, or more specifically, a ribofuranose via a ^-N1-glycosidic bond to yield the nucleoside uridine. The nucleoside uridine is also commonly abbreviated according to the one letter code of its nucleobase, i.e., U. Thus, in the context of the present disclosure, when a monomer in a polynucleotide sequence is U, such U is designated interchangeably as a "uracil" or a "uridine." Uridine Content: The terms "uridine content" or "uracil content" are interchangeable and refer to the amount of uracil or uridine present in a certain nucleic acid sequence. Uridine content or uracil content can be expressed as an absolute value (total number of uridine or uracil in the sequence) or relative (uridine or uracil percentage respect to the total number of nucleobases in the nucleic acid sequence). Uridine-Modified Sequence: The terms "uridine-modified sequence" refers to a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with a different overall or local uridine content (higher or lower uridine content) or with different uridine patterns (e.g., gradient distribution or clustering) with respect to the uridine content and / or uridine patterns of a candidate nucleic acid sequence. In the content of the present disclosure, the terms "uridine-modified sequence" and "uracil-modified sequence" are considered equivalent and interchangeable. Nucleobase: As used herein, the term “nucleobase” (alternatively “nucleotide base” or “nitrogenous base”) refers to a purine or pyrimidine heterocyclic compound found in nucleic acids, including any derivatives or analogs of the naturally occurring purines and pyrimidines that confer improved properties (e.g., binding affinity, nuclease resistance, chemical stability) to a nucleic acid or a portion or segment thereof. Adenine, cytosine, guanine, thymine, and uracil are the nucleobases predominately found in natural nucleic acids. Other natural, non-natural, and / or synthetic nucleobases, as known in the art and / or described herein, can be incorporated into nucleic acids. Unless otherwise specified, the nucleobase sequence of a SEQ ID NO described herein encompasses both natural nucleobases and chemically modified nucleobases (e.g., a “U” designation in a SEQ ID NO encompasses both uracil and chemically modified uracil). Nucleoside / Nucleotide: As used herein, the term “nucleoside” refers to a compound containing a sugar molecule (e.g., a ribose in RNA or a deoxyribose in DNA), or derivative or analog thereof, covalently linked to a nucleobase (e.g., a purine or pyrimidine), or a derivative or analog thereof (also referred to herein as “nucleobase”), but lacking an internucleoside linking group (e.g., a phosphate group). As used herein, the term “nucleotide” refers to a nucleoside covalently bonded to an internucleoside linking group (e.g., a phosphate group), or any derivative, analog, or modification thereof that confers improved chemical and / or functional properties (e.g., binding affinity, nuclease resistance, chemical stability) to a nucleic acid or a portion or segment thereof. Nucleic acid: As used herein, the term “nucleic acid” is used in its broadest sense and encompasses any compound and / or substance that includes a polymer of nucleotides, or derivatives or analogs thereof. These polymers are often referred to as “polynucleotides”. Accordingly, as used h...

Claims

WHAT IS CLAIMED IS:

1. A messenger RNA (mRNA) comprising a 5’ UTR, an open reading frame encoding a polypeptide, and a 3’ UTR, wherein the polypeptide is translated at the endoplasmic reticulum or mitochondria, wherein the 3’ UTR comprises a nucleotide sequence having at least 95% identity to the sequence of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), and wherein all of the uracils of the mRNA are N1- methylpseudouracils.

2. The mRNA of claim 1, wherein the 3’ UTR further comprises the sequence set forth in UAAAGCUCCCCGGGG (SEQ ID NO:300).

3. The mRNA of claim 2, wherein the sequence set forth in UAAAGCUCCCCGGGG (SEQ ID NO:300) is located at the 5’ end of the 3’ UTR immediately downstream of the last codon of the open reading frame.

4. The mRNA of claim 1, wherein the 3’ UTR comprises the nucleotide sequence set forth in UAAAGCUCCCCGGGGGCCUCCACCGCGUUAUCCGUUCCUCGUAGGCUGG UCCUGGGGAACGGGUCGGCGG (SEQ ID NO:212).

5. The mRNA of claim 1, wherein the 3’ UTR comprises the nucleotide sequence set forth in UAAAGCUCCCCGGGGGCCUCCACCGCGUUAUCCGUUCCUCGUAGGCUGG UCCUGGGGAACGGGUCGGCGGGUACCCCCGUGGUCUUUGAAUAAAGUC UGAGUGGGCGGC (SEQ ID NO:142).

6. The mRNA of any one of claims 1 to 5, wherein the 3’ UTR comprises one or more miRNA binding sites (e.g., comprising one or more miRNA binding sites from Table 3).

7. The mRNA of claim 6, wherein the one or more miRNA binding sites comprise one or more miR122 binding sites, e.g., as set forth in CAAACACCAUUGUCACACUCCA (SEQ ID NO:148).

8. The mRNA of claim 6, wherein the one or more miRNA binding sites comprise one or more miR142 binding sites, e.g., as set forth in UCCAUAAAGUAGGAAACACUACA (SEQ ID NO:149).

9. The mRNA of claim 6, wherein the one or more miRNA binding sites comprise one or more miR150 binding sites, e.g., as set forth in CACUGGUACAAGGGUUGGGAGA SEQ ID NO:305).

10. The mRNA of claim 6, wherein each of the one or more miRNA binding sites is a miR142 binding site, e.g., as set forth in UCCAUAAAGUAGGAAACACUACA (SEQ ID NO:149).

11. The mRNA of claim 6, wherein the 3’ UTR comprises at least three copies of a miR142 binding site, e.g., as set forth in UCCAUAAAGUAGGAAACACUACA (SEQ ID NO:149).

12. The mRNA of claim 11, wherein the 3’ UTR comprises the nucleotide sequence set forth in UAAAGCUCCCCGGGGUCCAUAAAGUAGGAAACACUACAGCUGGA GCCUCCACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGU CGGCGGUCCAUAAAGUAGGAAACACUACAGUACCCCCUCCAUAAAGUA GGAAACACUACAGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO:160).

13. The mRNA of any one of claims 1 to 12, wherein the 5’ UTR comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence selected from Table 1.

14. The mRNA of any one of claims 1 to 13, wherein the mRNA comprises a 5’ terminal cap.

15. The mRNA of claim 14, wherein the 5’ terminal cap comprises a m7GpppG2^OMe, m7G-ppp-Gm-A, m7G-ppp-Gm-AG, Cap0, Cap1, ARCA, inosine, N1-methyl-guanosine, 2’-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2- amino-guanosine, LNA-guanosine, 2-azidoguanosine, Cap2, Cap4, 5’ methylG cap, or an analog thereof.

16. The mRNA of any one of claims 1 to 15, wherein the polypeptide is translated at the endoplasmic reticulum.

17. The mRNA of any one of claims 1 to 15, wherein the polypeptide is translated at the mitochondria.

18. The mRNA of any one of claims 1 to 15, wherein the polypeptide is GLA.

19. The mRNA of any one of claims 1 to 15, wherein the polypeptide is hUGT1A1.

20. The mRNA of any one of claims 1 to 15, wherein the polypeptide is G6PC.

21. The mRNA of any one of claims 1 to 15, wherein the polypeptide is OTC.

22. The mRNA of any one of claims 1 to 15, wherein the polypeptide is PCCA.

23. The mRNA of any one of claims 1 to 15, wherein the polypeptide is PCCB.

24. The mRNA of any one of claims 1 to 15, wherein the polypeptide is MUT.

25. The mRNA of any one of claims 1 to 15, wherein the polypeptide is FECH.

26. The mRNA of any one of the preceding claims, wherein the mRNA comprises a poly-A region.

27. The mRNA of claim 26, wherein the poly-A region is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90 nucleotides in length, or at least about 100 nucleotides in length.

28. The mRNA of claim 26, wherein the poly-A region has about 10 to about 200, about 20 to about 180, about 50 to about 160, about 70 to about 140, or about 80 to about 120 nucleotides in length.

29. The mRNA of any one of claim 26, wherein the poly-A region is 100 nucleotides in length.

30. The mRNA of claim 26, wherein the poly-A region comprises A100- UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO: 211).

31. A composition comprising the mRNA of any one of claims 1 to 30 and a lipid nanoparticle.

32. The composition of claim 31, wherein the lipid nanoparticle comprises: (i) an ionizable lipid, (ii) a phospholipid, (iii) a structural lipid, and (iv) a PEG-lipid.

33. The composition of claim 31 or 32, wherein the lipid nanoparticle comprises a compound of Formula (I): (I) or its N-oxide, or a salt or isomer thereof, wherein R’ais R’branched; wherein R’branchedis: ; wherein denotes a point of attachment; wherein Raα, Raβ, Raγ, and Raδare each independently selected from the group consisting of H, C2-12 alkyl, and C2-12 alkenyl; R2and R3are each independently selected from the group consisting of C1-14 alkyl and C2-14alkenyl; R4is selected from the group consisting of -(CH2)nOH, wherein n is selected from the group consisting of 1, 2, 3, 4, and 5, and , wherein denotes a point of attachment; wherein R10is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R5is independently selected from the group consisting of C1-3 alkyl, C2-3alkenyl, and H; each R6is independently selected from the group consisting of C1-3 alkyl, C2-3alkenyl, and H; M and M’ are each independently selected from the group consisting of - C(O)O- and -OC(O)-;R’ is a C1-12 alkyl or C2-12 alkenyl; l is selected from the group consisting of 1, 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13.

34. The composition of any one of claims 31 to 33, wherein the lipid nanoparticle comprises: (a) (i) Compound II, (ii) Cholesterol, and (iii) PEG-DMG or Compound I; (b) (i) Compound VI, (ii) Cholesterol, and (iii) PEG-DMG or Compound I; (c) (i) Compound II, (ii) DSPC or DOPE, (iii) Cholesterol, and (iv) PEG- DMG or Compound I; (d) (i) Compound VI, (ii) DSPC or DOPE, (iii) Cholesterol, and (iv) PEG- DMG or Compound I; (e) (i) Compound II, (ii) Cholesterol, and (iii) Compound I; (f) (i) Compound II, (ii) DSPC or DOPE, (iii) Cholesterol, and (iv) Compound I; (g) (i) Compound B, (ii) DSPC or DOPE, (iii) Cholesterol, and (iv) PEG- DMG or Compound I; (h) (i) Compound B, (ii) Cholesterol, and (iii) Compound I; or (i) (i) Compound B, (ii) DSPC or DOPE, (iii) Cholesterol, and (iv) Compound I.

35. The composition of any one of claims 31 to 33, wherein the lipid nanoparticle comprises Compound II and Compound I.

36. The composition of any one of claims 31 to 33, wherein the lipid nanoparticle comprises Compound II and PEG-DMG.

37. The composition of any one of claims 31 to 33, wherein the lipid nanoparticle comprises Compound II, DSPC, Cholesterol, and Compound I.

38. The composition of any one of claims 31 to 37, wherein the lipid nanoparticle comprises a molar ratio of about 20-60% ionizable lipid: 5-25% phospholipid: 25-55% cholesterol: and 0.5-15% PEG lipid.

39. The composition of any one of claims 31 to 38, wherein the composition is formulated for intravenous, subcutaneous, intramuscular, intranasal, intraocular, rectal, pulmonary or oral delivery.

40. The composition of any one of claims 31 to 39, wherein the composition comprises a first mRNA and a second mRNA, wherein the first mRNA is an mRNA of any one of claims 1 to 30 and comprises a first open reading frame encoding PCCA and wherein the second mRNA is an mRNA of any one of claims 1 to 30 and comprises a second open reading frame encoding PCCB.

41. A method of treating GSD1a in a human subject in need thereof, comprising administering to the human subject the mRNA of any one of claims 1 to 30 or the composition of any one of claims 31 to 39, wherein the polypeptide is G6PC.

42. A method of treating propionic acidemia in a human subject in need thereof, comprising administering to the human subject the mRNA of any one of claims 1 to 30 or the composition of any one of claims 31 to 39, wherein the polypeptide is PCCA.

43. A method of treating propionic acidemia in a human subject in need thereof, comprising administering to the human subject the mRNA of any one of claims 1 to 30 or the composition of any one of claims 31 to 39, wherein the polypeptide is PCCB.

44. A method of treating propionic acidemia in a human subject in need thereof, comprising administering to the human subject (a) a first mRNA and a second mRNA, wherein the first mRNA is an mRNA of any one of claims 1 to 30 andcomprises a first open reading frame encoding PCCA and wherein the second mRNA is an mRNA of any one of claims 1 to 30 and comprises a second open reading frame encoding PCCB, or (b) the composition of any one of claims 31 to 39.

45. A method of treating methylmalonic acidemia in a human subject in need thereof, comprising administering to the human subject the mRNA of any one of claims 1 to 30 or the composition of any one of claims 31 to 39, wherein the polypeptide is MUT.

46. A method of treating erythropoietic protoporphyria in a human subject in need thereof, comprising administering to the human subject the mRNA of any one of claims 1 to 30 or the composition of any one of claims 31 to 39, wherein the polypeptide is FECH.

47. A method of increasing the half-life of a mRNA encoding a polypeptide that is translated at the endoplasmic reticulum or mitochondria, comprising administering to a cell the mRNA of any one of claims 1 to 30 or the composition of any one of claims 31 to 39.

48. A method of increasing duration of expression of a polypeptide that is translated at the endoplasmic reticulum or mitochondria, comprising administering to a cell the mRNA of any one of claims 1 to 30 or the composition of any one of claims 31 to 39.

49. A method of expressing a polypeptide in a hepatic cell, comprising administering to the hepatic cell a messenger RNA (mRNA) comprising a 5’ UTR, an open reading frame encoding a polypeptide, and a 3’ UTR, wherein the 3’ UTR comprises a nucleotide sequence having at least 95% identity to the sequence of CACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGUCGGCG G (SEQ ID NO:91), and wherein all of the uracils of the mRNA are N1- methylpseudouracils.

50. The method of any one of claims 41-49, wherein the 3’ UTR further comprises the sequence set forth in UAAAGCUCCCCGGGG (SEQ ID NO:300).

51. The mRNA of claim 50, wherein the sequence set forth in UAAAGCUCCCCGGGG (SEQ ID NO:300) is located at the 5’ end of the 3’ UTR immediately 3’ of the last codon of the open reading frame.

52. The method of any one of claims 41-49, wherein the 3’ UTR comprises the nucleotide sequence set forth in UAAAGCUCCCCGGGGGCCUCCACCGCGUUAUCCGUUCCUCGUAGGCUGG UCCUGGGGAACGGGUCGGCGG (SEQ ID NO:212).

53. The method of any one of claims 41-49, wherein the 3’ UTR comprises the nucleotide sequence set forth in UAAAGCUCCCCGGGGGCCUCCACCGCGUUAUCCGUUCCUCGUAGGCUGG UCCUGGGGAACGGGUCGGCGGGUACCCCCGUGGUCUUUGAAUAAAGUC UGAGUGGGCGGC (SEQ ID NO:142).

54. The method of any one of claims 41-53, wherein the 3’ UTR comprises one or more miRNA binding sites (e.g., comprising one or more miRNA binding sites from Table 3).

55. The method of claim 54, wherein the one or more miRNA binding sites comprise one or more miR142 binding sites, e.g., as set forth in UCCAUAAAGUAGGAAACACUACA SEQ ID NO:149).

56. The method of claim 54, wherein the one or more miRNA binding sites comprise one or more miR122 binding sites, e.g., as set forth in CAAACACCAUUGUCACACUCCA (SEQ ID NO:148).

57. The method of claim 54, wherein the one or more miRNA binding sites comprise one or more miR150 binding sites, e.g., as set forth in CACUGGUACAAGGGUUGGGAGA SEQ ID NO:305).

58. The method of claim 54, wherein each of the one or more miRNA binding sites is a miR142 binding site, e.g., as set forth in UCCAUAAAGUAGGAAACACUACA SEQ ID NO:149).

59. The method of claim 54, wherein the 3’ UTR comprises at least three copies of a miR142 binding site, e.g., as set forth in UCCAUAAAGUAGGAAACACUACA SEQ ID NO:149).

60. The method of claim 59, wherein the 3’ UTR comprises the nucleotide sequence set forth in UAAAGCUCCCCGGGGUCCAUAAAGUAGGAAACACUACAGCUGGA GCCUCCACCGCGUUAUCCGUUCCUCGUAGGCUGGUCCUGGGGAACGGGU CGGCGGUCCAUAAAGUAGGAAACACUACAGUACCCCCUCCAUAAAGUA GGAAACACUACAGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 160).

61. The method of any one of claims 41-60, wherein the 5’ UTR comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence selected from Table 1.

62. The method of any one of claims 41-61, wherein the mRNA comprises a 5’ terminal cap.

63. The mRNA of claim 62, wherein the 5’ terminal cap comprises a m7GpppG2^OMe, m7G-ppp-Gm-A, m7G-ppp-Gm-AG, Cap0, Cap1, ARCA, inosine, N1-methyl-guanosine, 2’-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2- amino-guanosine, LNA-guanosine, 2-azidoguanosine, Cap2, Cap4, 5’ methylG cap, or an analog thereof.

64. A messenger RNA (mRNA) comprising a 5’ UTR, an open reading frame encoding a FECH polypeptide (SEQ ID NO:235), and a 3’ UTR, wherein the open reading frame has at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:174.

Citation Information

Patent Citations

  • Microrna molecules

    US20050059005A1

  • Polycationic compositions for cellular delivery of polynucleotides

    US20050222064A1

  • Oligomeric compounds and compositions for use in modulation small non-coding RNAs

    US20050261218A1

  • Modification of RNA, Producing an Increased Transcript Stability and Translation Efficiency

    US20100129877A1

  • Synthetic 5'UTRs, Expression Vectors, and Methods for Increasing Transgene Expression

    US20100293625A1