A deliverable cytosolic gene expression system based on poxviral RNA polymerase and DNA templates
The use of a poxvirus promoter and RNA polymerase complex in eukaryotic cells enables cytosolic transcription and translation of nucleotide sequences, addressing the need for recombinant MVA production without a helper virus, enhancing efficiency and reducing costs.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- JULIUS MAXIMILIANS UNIV WURZBURG
- Filing Date
- 2025-10-21
- Publication Date
- 2026-04-30
AI Technical Summary
Existing methods for producing recombinant Modified vaccinia virus Ankara (MVA) require the use of a helper virus, which complicates the process and increases costs, and there is a need for a platform that allows recombinant expression of genes using vaccinia virus without this requirement.
A method involving transfection of eukaryotic host cells with a poxvirus promoter and RNA polymerase complex, enabling cytosolic transcription and translation of nucleotide sequences of interest without the need for a helper virus, using a poxvirus RNA polymerase complex to drive transcription and translation directly in the cytosol.
This approach allows for efficient and cost-effective production of MVA virus and recombinant proteins by eliminating the need for a helper virus, enhancing transcription and translation efficiency, and enabling fine-tuning of the transcription process.
Smart Images

Figure IMGF000010_0001_TABLE 
Figure IMGF000011_0001_TABLE 
Figure IMGF000011_0002_TABLE
Abstract
Description
[0001] A DELIVERABLE CYTOSOLIC GENE EXPRESSION SYSTEM BASED ON POXVIRAL RNA POLYMERASE AND DNA TEMPLATES
[0002] CO-FILED SEQUENCE LISTING
[0003] The present specification makes reference to a sequence listing (submitted electronically on the same date as the present application). The entire contents of the Sequence Listing are incorporated herein by reference.
[0004] TECHNICAL FIELD
[0005] The present invention relates to methods for the production of mRNA or the protein product encoded by a gene of interest in a eukaryotic host cell, wherein the transcription is effected in the cytosol. The invention further provides modified host cells. The present invention also relates to a method for the production of recombinant Modified vaccinia virus Ankara (MVA) and modified eukaryotic host cells for producing it.
[0006] BACKGROUND OF THE INVENTION
[0007] Proteins are synthesized and regulated depending upon the functional need in the cell. The blueprints for proteins are stored in DNA and decoded by highly regulated transcriptional processes to produce messenger RNA (mRNA). The message coded by an mRNA is then translated into a protein. Transcription is the transfer of information from DNA to mRNA, and translation is the synthesis of protein based on a sequence specified by mRNA. In eukaryotes, the processes of transcription and translation are spatially separated and occur sequentially with transcription happening in the nucleus and translation, or protein synthesis, occurring in the cytoplasm.
[0008] Transcription occurs in three steps in both prokaryotes and eukaryotes: initiation, elongation and termination. Transcription begins when the double-stranded DNA is unwound to allow the binding of RNA polymerase. Once transcription is initiated, RNA polymerase is released from the DNA.
[0009] Transcription is regulated at various levels by activators and repressors and also by chromatin structure in eukaryotes. In eukaryotes, mRNA is further processed to remove introns (splicing), addition of a cap at the 5' end and multiple adenines at the mRNA 3' end to generate a polyA tail. The modified mRNA is then exported to the cytoplasm where it is translated. Translation or protein synthesis is a multi-step process that requires macromolecules like ribosomes, transfer RNAs (tRNA), mRNA and protein factors as well as small molecules like amino acids, ATP, GTP and other cofactors. There are specific protein factors for each step of translation. The overall process is similar in both prokaryotes and eukaryotes, although particular differences exist.
[0010] Recombinant proteins can be produced transiently in mammalian cells by transfection with plasmid DNA or by transduction with baculoviruses (BacMam). The most widely used method forTGE is transfection with plasmid DNA, as it is fast and easy to adopt and affordable transfection reagents such as polyethylenimine (PEI) are readily available. Stable mammalian cell pools can be generated by either non-targeted gene integration, using lentiviruses or transposase enzymes such as Sleeping Beauty, Frog Prince, Minos, or piggyBac.
[0011] Virus vectors are particularly suitable for stable recombinant expression in mammalian cells because they naturally amplify their genomes in infected cells thus providing multiple copies of the genes to be expressed. Furthermore, viruses are readily propagated in a single host cell line thereby avoiding the need to handle distinct cell lines for each gene and viruses are less cumbersome to store and recover from storage than cell lines. As compared to transient expression upon nucleic acid transfection, a powerful method for protein production, virus infection more readily allows expression in entire cell cultures without the need for transfection agents or large amounts of nucleic acid. In the prior art, a transient expression system using a vaccinia virus ligated to the DNA coding for bacteriophage T7 RNA polymerase is known. The modified vaccinia virus was capable of driving the expression of a gene of interest under the control of the T7 promoter in a plasmid (Fuerst et al., PNAS 83 (1986), 8122-8126).
[0012] MVA virus may be produced recombinantly in a three-plasmid system containing in sum the entire MVA genome. The plasmids may further contain genes of interest under the control of suitable promoters. For the reconstitution of the MVA virus, an infection with a helper virus such as Fowl pox virus (FPV) is necessary (Chiuppesi et al., Nature Communications 11 (2020), 6121 et seq.) One technical problem underlying the present invention is to provide a platform for producing recombinant MVA virus which does not require the use of a helper virus.
[0013] A further technical problem is to provide a platform for the recombinant expression of genes on the basis of vaccinia virus.
[0014] SUMMARY OF THE INVENTION
[0015] In a first aspect the present invention provides a method for the production of RNA or the protein product encoded by a nucleotide sequence of interest comprising
[0016] (a) transfecting a eukaryotic host cell with an expression vector comprising a poxvirus promoter and a gene of interest under the control of the promoter;
[0017] (b) transfecting the eukaryotic host cell of step a) with a poxvirus RNA polymerase complex or a portion thereof capable of transcribing the nucleotide sequence of interest, wherein the transfecting step b) can be carried out before, during or after transfecting step a);
[0018] (c) culturing the transfected eukaryotic host cell under conditions allowing the cytosolic expression of the gene of interest; and
[0019] (d) optionally purifying the produced mRNA and / or the produced protein product encoded by the gene of interest.
[0020] In a second aspect the present invention provides a modified eukaryotic host cell comprising (i) an expression vector comprising a poxvirus promoter and a nucleotide sequence of interest under the control of the promoter genome, wherein the eukaryotic host cell further comprises a poxvirus RNA polymerase complex or a portion thereof capable of transcribing the nucleotide sequence of interest. In a third aspect is provided a method for the production of a MVA vector or recombinant MVA virus comprising:
[0021] (a) transfecting one or more DNA fragments into a eukaryotic host cell, wherein the one or more DNA fragments comprise genomic DNA sequences of an MVA species, such that the MVA virus is reconstituted in the eukaryotic host cell, and wherein the one or more DNA fragments further comprise a poxvirus promoter and optionally a nucleotide sequence of interest under the control of the promoter;
[0022] (b) transfecting the eukaryotic host cell of step a) with a poxvirus RNA polymerase complex or a portion thereof capable of transcribing the nucleotide sequence of interest, wherein the transfecting step b) can be carried out before, during or after transfecting step a);
[0023] (c) culturing the transfected host cell under conditions allowing the production of the MVA vector or the recombinant MVA virus; and
[0024] (d) optionally purifying the MVA vector or the recombinant MVA virus.
[0025] In a further aspect is provided a modified eukaryotic host cell comprising one or more DNA fragments comprising the entire genomic DNA sequence of an MVA species, such that the MVA virus is reconstituted in the eukaryotic host cell, and wherein the one or more DNA fragments further comprise an early poxvirus promoter and optionally a nucleotide sequence of interest under the control of the promoter, and wherein the eukaryotic host cell further comprises a poxvirus RNA polymerase complex or a portion thereof capable of transcribing the nucleotide sequence of interest, preferably the poxvirus RNA polymerase complex is an early poxvirus RNA polymerase complex further comprising transcription factors and capping enzymes.
[0026] In another aspect is provided a method for producing a vaccine composition comprising performing the method according to the invention and formulating the MVA vector or the recombinant MVA virus with at least one pharmaceutically acceptable carrier to obtain a vaccine composition.
[0027] The present inventors have surprisingly found by the transfection of a eukaryotic host cell with a poxvirus RNA polymerase and an expression vector comprising a poxvirus promoter operably linked linked to a nucleotide sequence of interest drives the transcription and / or translation of the nucleotide sequence of interest. In contrast to the regular transcription in eukaryotes, the transcription takes place in the cytosol. This provides the advantage that the nucleotide sequence of interest does not have to enter the nucleus for transcription.
[0028] The use of the poxvirus RNA polymerase complex allows a fine-tuning of the transcription process. For example, it may be controlled if a cap is added to the 5’ end of the transcript.
[0029] The present inventors have further found that by the use of a poxvirus RNA polymerase complex the need to use a helper virus in the production of recombinant MVA virus from plasmids containing parts of the entire MVA genome can be omitted. The poxvirus RNA polymerase complex thereby acts as a kick-starter for the rapid transcription / translation of the polypeptides required for MVA assembly.
[0030] Poxviruses are outstanding as they install an effective gene expression system in the cytoplasm of the host cell. To this end they encode a multisubunit DNA-dependent RNA polymerase (vRNAP), a set of transcription factors that can be grouped according to the associated promoters into early, intermediate and late sets, RNA processing factors and a host immune evasion system that protects the viral cytosolic DNA. Previous studies have applied protocols for co-transfection of DNA and T7 RNA polymerase (1), however, the expression level is comparably low unless in presence of propagating vaccinia virus (2), which boosts the expression by a factor of 500.
[0031] Herein it is disclosed to transfect purified vRNAP along with DNA to overcome these shortcomings. In contrast to T7 RNA polymerase. vRNAP has evolved in a mammalian cytoplasmic environment and is able to cooperate seamlessly with other viral factors as the capping enzyme, poly-A polymerase, and systems that allow stabilization of cytoplasmic DNA. These factors might likewise be purified and delivered to the target cell. The availability of three different promoter types with their adjunct transcription factor sets allows for differential or timed gene expression programs.
[0032] The technical feasibility of the method has been demonstrated by co-transfection of vRNAP with a DNA molecule containing a fluorescent reporter gene under the control of a viral promoter.
[0033] References
[0034] 1. X. Gao, L. Huang, Cytoplasmic expression of a reporter gene by co-delivery of T7 RNA polymerase and T7 promoter sequence with cationic liposomes. Nucleic Acids Res 21 , 2867-2872 (1993).
[0035] 2. O. Elroy-Stein, B. Moss, Cytoplasmic expression system based on constitutive synthesis of bacteriophage T7 RNA polymerase in mammalian cells. Proc Natl Acad Sci U S A 87, 6743-6747 (1990).
[0036] BRIEF DESCRIPTION OF THE DRAWINGS
[0037] Fig. 1 shows the vRNAP as an “all-in-one” transcription unit for early vaccinia genes. A) Structure of the early “complete” vRNAP and B) the intermediate vRNAP. C) vRNAP-catalyzed transcription of a synthetic dsDNA template with an early promoter (EP), a start site (TSS) and a terminator (TER). Transcription is observed for the intermediate vRNAP for templates with the respective promoter. The transcript has been labelled radioactively and contains a m7G cap. The transcription has been performed in vitro.
[0038] Fig. 2 shows proof of principle for the cytoplasmic expression. A) Design of the experiment: vRNAP and dsDNA template were transfected with TranIT-CRISPR in HEK293T cells. B) Detection of the reporter mCHERRY in conventional fluorescence microscopy. Fig. 3 shows the confirmation of the vRNAP-driven expression of mCherry by Western Blot analysis. A) Transfected HEK293T cells with DNA template and vRNAP and analysis by fluorescence microscopy. B) In independent experiments the NTP-dependency of expression was assessed by Western Blot. The most efficient expression was observed in the packaging unit in the absence of NTPs. No expression was observed if vRNAP alone (lane 6) or different DNA templates without vRNAP (lanes 7 and 8) were transfected.
[0039] Fig. 4 shows the vector map of the plasmid pSB24.
[0040] Fig. 5 shows the vector map of the plasmid pUC19-VaccPromoterA_mCherry.
[0041] Fig. 6 shows an increase in transcription activity in the presence of B1 R kinase. Addition of a phosphatase drastically reduces the transcription efficiency (Fig. 6A). A mutational study of the Rpo30 phosphopeptide domain narrows the phosphorylation site down to its triple SP motif (Fig. 6B).
[0042] DETAILED DESCRIPTION OF THE INVENTION
[0043] In a first aspect the present invention provides a method for the production of mRNA or the protein product encoded by a gene of interest comprising
[0044] (a) transfecting a eukaryotic host cell with an expression vector comprising a poxvirus promoter and a gene of interest under the control of the promoter;
[0045] (b) transfecting the eukaryotic host cell of step a) with a poxvirus RNA polymerase complex or a portion thereof capable of transcribing the gene of interest, wherein the transfecting step b) can be carried out before, during or after transfecting step a);
[0046] (c) culturing the transfected eukaryotic host cell under conditions allowing the cytosolic expression of the gene of interest; and
[0047] (d) optionally purifying the produced mRNA and / or the produced protein product encoded by the gene of interest.
[0048] Definitions
[0049] “Transfecting” herein includes chemical and physical / mechanical methods.
[0050] For the chemical transfection, a lipid-based or non-lipid based transfection agent may be used. The lipid-based transfection includes the use of cationic lipid material which may form complexes with negatively charged nucleic acids or negatively charged amino acids.
[0051] The transfection reagents for the pure / high-lipid based approach may include oligofectamine, lipofectamine, siPORT amine (ThermoFisher), DharmaFECT (Dharmacon, UK), DOTAP (Roche, Germany), HiPerfect (Qiagen, Germany), Endofectin@Max (GeneCopeoeia, USA), Nanofectamine (GE Healthcare, USA) or Escort IV Liposome (Sigma-Aldrich, USA), or derivatives thereof. For the mixed lipid & non-lipid based approach Arrest-In (Dharmacon, UK), TurboFect (ThermoFisher), Effectene, Attractene, PolyFect and SuperFect (Qiagen, Germany), TranlT-TKO, TranslT-X2 (Mirus Bio LLC) and further reagents known to the skilled person may be used.
[0052] The non-lipid-based approach comprises microparticles or nanoparticles, polymeric-based, peptides / cations based, calcium phosphate or dendrimer based approach.
[0053] The physical / mechanical methods may include electroporation, laser beam, gene injection, sonoporation or magnetofection (with e.g. metal-coated nanoparticles). Further included are electroporation and microinjection.
[0054] “Eukaryotic host cell” herein includes any known host cell for the recombinant expression of proteins or used in transcription. Preferably, the eukaryotic host cell is a mammalian cell. More preferred, the host cell is selected from HeLa cells, OHO cells, BHK cells, COS cells, HEK293 cells, A549 cells and derivatives thereof. More preferably, the HEK293 cells are HEK293T cells.
[0055] “Poxvirus” comprises a species selected from the genera comprising orthopoxvirus, parapoxvirus, yatapoxvirus and molluscipoxvirus. The orthopoxvirus genus comprises smallpox virus (variola), vaccinia virus, cowpox virus, Mpox virus. The parapoxvirus genus comprises orf virus, pseudocowpox and bovine papular stomatitis virus. The genus Yatapoxvirus comprises tanapox virus, yaba monkey tumor virus. The Molluscipoxivirus comprises molluscum contagiosum virus (MCV).
[0056] Preferably, the poxvirus is from the orthopoxvirus genus, more preferably, the poxvirus is variola virus and vaccinia virus. Most preferred, the RNA polymerase complex is from vaccinia virus.
[0057] “RNA” herein includes any type of RNA. For example, the produced RNA may be a mRNA, a tRNA or a rRNA. Alternatively, the produced RNA may be a small nuclear RNA (snRNA), microRNA (miRNA) or small interfering RNA (siRNA).
[0058] “An expression vector” herein includes vectors for stable transfection wherein the vectors do not integrate in the host cells genome. For example, episomal vectors are encompassed. The term also includes vectors for transient transfection such as plasmids. The expression vector may contain additional regulatory elements such as enhancer sequences, promoter sequences further defined below, poly(A) sequences, origin of replication, selection marker sequences. Preferably, the origin of replication is a high copy bacterial origin of replication such as a pUC origin. Alternatively, the origin of replication may be a eukaryotic origin of replication, e.g. from yeast.
[0059] “Poxvirus promoter” herein includes early, intermediate or late poxvirus promoters, variants and combinations thereof. Preferably, the promoter is a vaccinia virus promoter. The early promoters may be selected from 7.5-kD, DNA pol, TK, RNA pol, 19-kD, 22-kD, 42-kD, 37-kD, 87-kD, H3’, H6, D1 , D4, D5, D9, D12, I3, M1 and N2. The critical region, spacer region and initiation region of said promoters is shown in Davison & Moss. J Mol Biol 210 (1989), 749- 769Preferably, the early promoter is derived from the 7.5 kD early promoter of vaccinia virus. Even more preferred, the early promoter comprises the nucleotide sequence AGCTTAAAAGTAGAAAATATATTCTAATTTATTGCAC (SEQ ID NO: 1) and / or TCGAGTGCAATAAATTAGAATATATTTTCTACTTTTA (SEQ ID NO: 2).
[0060] The intermediate promoters may be selected from the promoter of an intermediate gene selected from K2L, K4L, F13L, E6R, E7R, E8R, E11 L, O2L, O3L, 11 L, I5L, I6L, I8R, G4L, G8R, L4R, J1R, H1.L H3L, H7R, D6R, D8L, D10R, D11 L, D13L, A1L, A2L, A3L, A3L, A6L, A12L, A15L, A16L, AWL, and A22R. Preferably, the gene promoter is selected from the promoter of any of A1 L, A2L and G8R, more preferably the poxvirus intermediate gene promoter is the G8R promoter.
[0061] The late promoters may be selected from the promoter of a late gene selected from A10L, A11 R, A13L, A14.5L, A14L.A17L, A2.5L, A21L, A26L, A28L, A39R, A7L, A9L, B7R, C19L, C3L, C8L, D2L, D3R, E10R, F10L, F17R, F9R, G1 L, F3L, G6R, G7L, G9R, H2R, A45R, H4L, H6R, I2L, I7L, J5L, L1R, L3L and L5R.
[0062] In a further preferred embodiment the expression vector contains 3’ of the nucleotide sequence of interest a termination signal. In a particular preferred embodiment the termination signal comprises the nucleotide sequence GATCCAATTTTTTATAAATTTTTTTATG (SEQ ID NO: 3) or the nucleotide sequence AGCTTCATATTTATAAAAAATTG (SEQ ID NO: 4).
[0063] More preferred, the expression vector contains a poxvirus promoter as defined above in combination with a termination signal.
[0064] More preferred, the vector is based on pSB24 or pUC19. Particularly preferred, the vector is a pSB24 vector in which a poxvirus early promoter or derivative has been cloned into. Also particularly preferred, the vector is a pUC19 vector in which a poxvirus early promoter or derivative thereof has been cloned into.
[0065] Particularly preferred, the vector has the following sequence (pSB24_vaccinia virus_early): TCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCC AACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCC GGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCC TATTTTTATARGKTAAAGGTCAKGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGC GGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCT TCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGSGGCATTTT GCCTTCCTGTTTTTGAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCG GATAACAATTTCACACAGGAAACAGCTATGACATGATTACGAATTCAAAAAATTGAAAAACTAGGAATTCCTTTCA TAACCCATACCCTTCCTCCATCTATACCACCCTACTCTCCTTTCCTCATTATTCCTCCTATTATCTTCTCCTCTTCT CTCCTTCTTCTATATTTCCCAAATCTATCATCATTCACTCTCATCCCCTCTTCCTTCACTCCCATTCTATTCTACTC CTTTCCCTTTCCATATCCCCTCCACCCCCCTTCCTCCCCTCTTTCAATCTTATCCCCAATCATAAAATTATCTCAAT TATATTCTCCTTCCATACCCCCTATCATCCTCATCCCTATCACCCCCTACTCACCCAATACTCCCTACTCATCTCA TATATCCTTATCCTCTCCTCACCTCTCCCTCCTCTATCTCCCCCCCTCACACTCATTTCTCATTCCACTCCCGGGG ATCCAATTTTTTATAAATTTTTTTATGAAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCT GGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCAC CGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATC TGTGCGGTATT (SEQ ID NO: 5).
[0066] In another preferred embodiment, the vector has the following nucleotide sequence:
[0067] TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAA GCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAA CTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGA GAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTC TTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCC CAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGCGCGCTATCAGCACACAATTGCCCATTATACGCGCGT ATAATGGACTATTGTGTGCTGATAGGCTCAAAAAAATTGAAAAACTAGGAGTTCCTTTCAGATATCGCCACCATG GTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCT CCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCC AAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCT CCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTG GGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGA GTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATG GGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTG AAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTG CCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTA CGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAGCTCGAGAATTTTTTATAA ATTTTTTTAGGCTCATATCAGCACACAATTGCCCATTATACGCGCGTATAATGGACTATTGTGTGCTGATAGCGCG CAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATAC GAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCA CTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCG GTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGC GGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAG CAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCC TGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGT TTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTC CCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAA GCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCC AACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAG GCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCT CTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGG TGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACG GGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACC TAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCA ATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGT GTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCA CCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATC CGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGT TGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAAC GATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTC AGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCC GTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGC TCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGT TCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAA CTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAA GGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGT TATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCC GAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGC CCTTTCGTC (SEQ ID NO: 6)
[0068] “poxvirus RNA polymerase complex or a portion thereof capable of transcribing the nucleotide sequence of interest”
[0069] Preferably, the poxvirus RNA polymerase complex comprises at least one of Rpo147, Rpo132, Rpo35, Rpo30, Rpo22, Rpo19, Rpo18, and Rpo7. Details on the individual components of the poxvirus RNA polymerase complex are given in the following table:
[0070] Protein name Gene ID Description
[0071] Rpo147 OPG105, RPO147, DNA-directed RNA
[0072] J6R polymerase 147 kDa
[0073] polypeptide
[0074] Rpo133 OPG151, RPO132, DNA-directed RNA
[0075] A24R polymerase 133 kDa
[0076] polypeptide
[0077] Rpo35 OPG156, RPO35, DNA-directed RNA
[0078] A29L polymerase 35 kDa
[0079] subunit
[0080] Rpo22 OPG103, RPO22, J4R DNA-directed RNA
[0081] polymerase 22 kDa
[0082] subunit
[0083] Rpo18 OPG119, RPO18, DNA-directed RNA
[0084] D7R polymerase 18 kDa
[0085] subunit
[0086] Rpo7 GPG090, RPO7, DNA-directed RNA
[0087] G5.5R polymerase 7 kDa subunit
[0088]
[0089] Rpo30 E4L, DNA-directed RNA
[0090] VAC_DPP21_070 polymerase 30 kDa
[0091] polypeptide
[0092]
[0093] Table 1: List of polypeptides contained in polymerase complexes and their databank numbers
[0094] Preferably, the poxvirus RNA polymerase complex comprises the minimal poxvirus RNA polymerase complex.
[0095] “minimal poxvirus RNA polymerase complex” means herein the poxvirus RNA polymerase complex lacking the capping enzyme and the transcription fa ctor for transcription of the poxvirus genes, genes. Preferably, the minimal poxvirus RNA polymerase complex consists of Rpo147, Rpo132, Rpo35, Rpo30, Rpo22, Rpo19, Rpo18, and Rpo7.
[0096] In a further preferred embodiment the poxvirus RNA polymerase complex comprises the minimal poxvirus RNA polymerase complex and a viral capping enzyme.
[0097] A “viral capping enzyme” may be selected from D1 and D12, or a combination thereof. The poxviral capping enzyme (CE) is a heterodimer of the D1 and D12 subunits. D1 is a trifunctional enzyme that harbors all three enzymatic activities required for cap synthesis. D12 binds to the MTase domain of D1 and stimulates its activity allosterically, as shown by previous biochemical and crystallographic studies of the enzyme.
[0098] Protein name Gene ID Description
[0099] D12 D12L, Listl 13, Virus termination factor25
[0100] m8146R, mO146R, (capping enzyme) small
[0101] synVACV_128 subunit
[0102] D1 D1R, Virus termination factor
[0103] VAC_DPP17_117, (capping enzyme) large VACV_IOC_B141_132 subunit 30
[0104]
[0105] Table 2: capping enzymes
[0106] Preferably, the poxvirus RNA polymerase complex comprises the minimal poxvirus RNA polymerase complex and a transcription factor for transcription of an early, intermediate or late poxvirus gene identified above.
[0107] The vaccinia virus early transcription factors include VETF and the 94-kDa protein Rap94.
[0108] The vaccinia virus intermediate transcription factor is comprised of the virus-encoded polypeptides A8 and A23. The vaccinia virus late transcription factors include the A1 L, A2L and G8R gene products. “a portion of the RNA polymerase complex capable of transcribing the gene of interest under the control of the poxvirus promoter”
[0109] The skilled person can determine portions of the individual RNA polymerase complex which are capable of transcribing the gene of interest under the control of the poxvirus promoter.
[0110] A suitable in vitro transcription assay is indicated in the examples.
[0111] Methods for purifying of the poxvirus RNA polymerase complex for transcription of genes under the control of a poxvirus intermediate promoter
[0112] The poxvirus RNA polymerase complex may be purified from poxvirus infected host cells by protein purification methods known in the art. Alternatively, the complex may be prepared by recombinant expression of the individual polypeptide components which are subseguently assembled. Fortesting the poxvirus RNA polymerase activity an in vitro or in vivo assay may be used. A suitable in vitro transcription assay is described in the examples.
[0113] In a preferred embodiment the poxvirus RNA polymerase complex is prepared by the following method comprising the steps of
[0114] a) infecting host cells with a recombinant vaccinia virus encoding a component of the poxvirus RNA polymerase complex linked to an affinity tag in the presence of cytosine arabinoside;
[0115] b) lysing the infected cells;
[0116] c) contacting the lysate with a DNA hybrid comprising at least a portion of a poxvirus gene promoter under conditions allowing the formation of a poxvirus RNA polymerase complex / DNA hybrid;
[0117] d) incubating the poxvirus RNA polymerase complex / DNA hybrid with the complementary partner of the affinity tag bound to a column;
[0118] e) eluting the bound poxvirus RNA polymerase complex / DNA hybrid from the column; and f) purifying the poxvirus RNA polymerase complex by subjecting the eluate to density gradient centrifugation.
[0119] The host cells may be selected from a host cells capable of being infected with a poxvirus.
[0120] Preferably, the host cells are mammalian cells, more preferably human cells such as HeLa cells and CHO cells. Most preferred the host cells as HeLa S3 cells.
[0121] In a preferred embodiment the component of the poxvirus RNA polymerase complex may be Rpo132.
[0122] The affinity tag may be selected from a variety of possibilities known to the skilled person including a His tag or Flag®-tag. Flag® - tag which is preferred corresponds to the oligopeptide sequence DYKDDDDK (SEQ ID NO: 7).
[0123] The recombinant vaccinia virus strain is preferably GLV-1h439 expressing hemagglutin / Flag tag linked to the C-terminus of the Rpo132 polypeptide. Cytosine arabinoside is preferably used in a concentration of 100 to 400 pg / ml, preferably 200 to 300 pg / ml.
[0124] Methods for preparing cell lysates are known to the skilled person.
[0125] The DNA hybrid comprises at least a portion of a poxvirus gene promoter in annealed form.
[0126] Preferably, the intermediate gene promoter is the G8R promoter. The DNA hybrid may further comprise a mismatch sequence of about 10 to about 20 nucleotides thereby forming an artificial bubble.
[0127] More preferably, the DNA hybrid comprises the non-template strand of the DNA hybrid having the nucleotide sequence set forth in SEQ ID NO: 8, and the template strand of the DNA hybrid having the nucleotide sequence set forth in SEQ ID NO: 9. The incubation of the lysate with the DNA hybrid may be carried out for 15 min to 2h.
[0128] The incubated lysate is then applied to a column having the complementary partner of the affinity tag bound to the column material. The elution may be performed by the addition of affinity tag thereby removing the bound RNA polymerase complex from the column material.
[0129] The eluate is then subjected to density gradient centrifugation for further purification of the RNA polymerase complex.
[0130] Further purification steps including one or more of size exclusion chromatography, hydrophobic and / or ion exchange chromatography may be used as well.
[0131] The early poxvirus RNA polymerase complex and its structure is described in Grimm et al., Cell 179 (2019), 1537-1550 and Hillen et al., Cell 179 (2019), 1525-1536. The disclosure of which is incorporated herein by reference.
[0132] The intermediate poxvirus RNA polymerase complex and its structure is described in EP 24 174 856.5 filed on 8 May 2024. The disclosure of which is incorporated herein by reference.
[0133] “Nucleotide sequence of interest”
[0134] The nucleotide sequence of interest may encode a polypeptide of interest or a fragment thereof. The protein of interest includes a growth factor, an enzyme, a regulatory protein, a receptor, a peptide hormone, a cytokine, a membrane or transport protein, an antigen used for vaccination, a vaccine, an antigen-binding protein, an immunostimulatory protein, an allergen, a full-length antibody, an antibody fragment or derivative, and the like, and combinations thereof.
[0135] Alternatively, the nucleotide sequence of interest may be derived from a bacterium, virus or fungus. The nucleotide sequence of interest may comprise an open reading frame (ORF).
[0136] In a further aspect the present invention provides a modified eukaryotic host cell comprising (i) an expression vector comprising a poxvirus promoter and a nucleotide sequence of interest under the control of the promoter genome, wherein the eukaryotic host cell further comprises a poxvirus RNA polymerase complex or a portion thereof capable of transcribing the gene of interest. Recombinant MVA Production in the absence of helper virus
[0137] In a further aspect the present invention provides a method for the production of MVA vector or a recombinant MVA vector comprising:
[0138] (a) transfecting one or more DNA fragments into a eukaryotic host cell, wherein the one or more DNA fragments comprise genomic DNA sequences of an MVA species, such that the MVA virus is reconstituted in the eukaryotic host cell, and wherein the one or more DNA fragments further comprise a poxvirus promoter and a nucleotide sequence of interest under the control of the promoter;
[0139] (b) transfecting the eukaryotic host cell of step a) with a poxvirus RNA polymerase complex or a portion thereof capable of transcribing the nucleotide sequence of interest, wherein the transfecting step b) can be carried out before, during or after transfecting step a);
[0140] (c) culturing the transfected host cell under conditions allowing the production of recombinant MVA virus; and
[0141] (d) optionally purifying the recombinant MVA virus.
[0142] The production of recombinant MVA vector from plasmids comprising parts of the MVA genome which form the entire MVA genome in the presence of a helper virus, in particular FPV virus, is known. Herein incorporated by reference in its entirety is WO 2021 / 236550.
[0143] In contrast to the prior art methods, the present method does not require the use of a helper virus.
[0144] When eukaryotic host cells such mammalian host cells are co-transfected with the three plasmids containing the sMVA fragments F1-F3 and subsequently transfected with poxvirus RNA polymerase complex, the three sMVA fragments recombine with each other through the shared homologous sequences and the reconstitution of synthetic MVA (sMVA) is initiated (WO 2021 / 236550, Figure 3D). FPV is used as a helper virus to initiate the transcription of the sMVA DNA and, consequently, the sMVA reconstitution process.
[0145] In certain embodiments, two or more DNA fragments are co-transfected into the host cell, each DNA fragment comprises a partial sequence of the MVA genome such that the two or more DNA fragments are assembled sequentially by homologous recombination and comprise the full-length sequence of the MVA genome when reconstituted in the host cell.
[0146] In certain embodiments, the one or more DNA fragments are circularized before transfection or transfected in circular forms into the host cell. In certain embodiments, the one or more DNA fragments are cloned into a plasmid or a bacterial artificial chromosome (BAC) vector. In certain embodiments, the one or more DNA fragments are naturally derived, chemically synthesized, or a combination of naturally derived and chemically synthesized DNA fragments. In certain embodiments, the MVA genomic sequence comprises the sequence of Accession No. #1194848. In certain embodiments, two adjacent DNA fragments have an overlapping sequence to facilitate homologous recombination. In certain embodiments, the overlapping sequence is between about 100 bp and about 5000 bp in length. In certain embodiments, the one or more DNA fragments further comprise an inverted terminal repeat (ITR) region. In certain embodiments, the one or more DNA fragments further comprise an MVA terminal hairpin loop (HL) sequence, an MVA genome resolution (CR) sequence, or both, wherein the HL or the CR sequence is added to one or both ends of the DNA fragment as single stranded or double stranded DNA sequences in sense or antisense orientation. In certain embodiments, the one or more DNA fragments further comprise one or more HL sequences and one or more CR sequences. In certain embodiments, each HL sequence is flanked by two CR sequences at both ends of the HL sequence. The ITR, HL or CR sequences may be derived from MVA (NCBI accession #U94848, #AY603355), Vaccinia virus (#NC_006998, #LT966077), Camelpox virus (#NC_003391), Cowpox virus (#NC_003663) Ectromelia virus (#NC_004105), Monkeypox virus (#NC_003310), Racoonpox virus (#NC_027213), Skunkpox virus (#NC_031038), Taterapox virus (#NC_008291), Variola virus (#NC_001611, #L22579), Velopox virus (#NC_031033), Canarypox virus (#NC_005309), Swinepox virus (#NC_003389), FPV (#NC_002188, #MH734528), Myxoma virus (#GQ409969), Sheeppox virus (NC_004002), Goatpox virus (#NC_004003), (Orf virus #NC_005336), Rabbit fibroma virus (#NC_001266), any strain variations of these poxviruses, or any other poxvirus or strain variation thereof.
[0147] In certain embodiments, the one or more DNA fragments further comprise one or more DNA sequences encoding one or more antigens, subunits, or fragments thereof. In certain embodiments, the DNA sequences of the antigens, subunits, or fragments thereof are codon optimized for expression in the host cell, e.g., in human cells or vaccinia virus, and / or codon optimized for stability in vaccinia by silent-codon alternation to avoid 4 or more of the same nucleotides consecutively. In certain embodiments, the one or more DNA fragments further comprise a virus promoter upstream of the DNA sequences of the antigens, subunits, or fragments thereof, a transcription termination signal downstream the DNA sequences of the antigens, subunits, or fragments thereof, or both. In certain embodiments, the promoter sequences include mFI5 and p7.5 promoters, or any other suitable native or synthetic vaccinia or poxvirus promoters. In certain embodiments, the DNA sequences encoding the antigens, subunits, or fragments thereof are inserted in one or more MVA insertion sites such as intergenic regions, non-essential genes and regions, and deletion sites.
[0148] In a further aspect the present invention provides a modified eukaryotic host cell comprising one or more DNA fragments comprising the entire genomic DNA sequence of an MVA species, such that the MVA virus is reconstituted in the eukaryotic host cell, and wherein the one or more DNA fragments further comprise a poxvirus promoter and a gene of interest under the control of the promoter, and wherein the eukaryotic host cell further comprises a poxvirus RNA polymerase complex or a portion thereof capable of transcribing the nucleotide sequence of interest.
[0149] In a further aspect it is provided a method for producing a vaccine composition comprising performing the method for the production of RNA and / or a protein product according to the invention and formulating the recombinant MVA virus with at least one pharmaceutically acceptable carrier to obtain a vaccine composition.
[0150] “pharmaceutically acceptable carrier” herein means any known pharmaceutically acceptable carrier or excipient known in the art. The type of pharmaceutically acceptable carrier depends on the route of administration such as oral excipients, topical excipients, parenteral excipients and other excipients.
[0151] Inorganic carriers include calcium phosphates, calcium carbonate, calcium sulfate, halites and metallic oxicdes. Organic carrriers include carbohydrates such as sugars, actual sugars, sugar alcohols, artificial sweeteners; starch such as modified starch, dried starch, converted starch; cellulose such as cellulose ethers, cellulose esters, CMC and croscarmellose sodium, microcrystalline cellulose; glycols such as polyethylene glycol, propylene glycol; povidones; mineral hydrocarbons such as petrolatum, mineral waxes, mineral oils; acrylic polymers; other petrochemical excipients; oleochemicals such as fatty alcohols, mineral stearates, glycerin, lipids; other oleochemical excipients; and proteins.
[0152] The pharmaceutical composition may be administered by any known route, including oral, sublingual, transdermal, inhalation, intranasal, subcutaneous, intramuscular, intravenous, rectal, vaginal and ophthalmic.
[0153] The dosage of the active agent will be determined based on the physician’s common general knowledge.
[0154] The present invention contemplates single vaccinations as well as repeated vaccinations including prime-boost vaccination schemes.
[0155] The produced MVA vector may confer immunity against various poxvirus diseases such as smallpox disease. If the produced MVA vector is a recombinant vector carrying an exogenous nucleotide sequence of interest, the exogenous nucleotide sequence of interest may be derived from bacteria, viruses or funghi and the recombinant MVA virus may then provide immunity against these organisms. If the recombinant MVA virus carries a tumor antigen, the recombinant MVA virus may confer immunity against cancer.
[0156] The present invention is not limited by the appended examples.
[0157] List of Embodiments
[0158] 1. A method for the production of RNA or the protein product encoded by a nucleotide sequence of interest comprising
[0159] (a) transfecting a eukaryotic host cell with an expression vector comprising a poxvirus promoter and a nucleotide sequence of interest under the control of the promoter; (b) transfecting the eukaryotic host cell of step a) with a poxvirus RNA polymerase complex or a portion thereof capable of transcribing the nucleotide sequence of interest, wherein the transfecting step b) can be carried out before, during or after transfecting step a);
[0160] (c) culturing the transfected eukaryotic host cell under conditions allowing the cytosolic expression of the gene of interest; and
[0161] (d) optionally purifying the produced mRNA and / or the produced protein product encoded by the gene of interest.
[0162] 2. The method of embodiment 1 , wherein the RNA is selected from mRNA, tRNA and rRNA, snRNA, miRNA or siRNA, preferably the RNA is mRNA.
[0163] 3. The method of embodiment 1 or 2, wherein the RNA is capped at the 5’ end with N7-methyl guanosine (m7G).
[0164] 4. The method of any one of embodiments 1 to 3, wherein the poxvirus promoter is an early poxvirus promoter and the poxvirus RNA polymerase complex is an early poxvirus RNA polymerase complex or a portion thereof.
[0165] 5. The method of any one of embodiments 1 to 3, wherein the poxvirus promoter is an intermediate poxvirus promoter and the poxvirus RNA polymerase complex is an intermediate poxvirus RNA polymerase complex or a portion thereof.
[0166] 6. The method of any one of embodiments 1 to 3, wherein the poxvirus promoter is a late poxvirus promoter and the poxvirus RNA polymerase complex is a late poxvirus RNA polymerase complex or a portion thereof.
[0167] 7. The method of any one of embodiments 1 to 4, wherein the promoter has the nucleotide sequence set forth in SEQ ID NO: 1 or 2.
[0168] 8. The method of any one of embodiments 1 to 7, wherein the expression vector is a non-integrating expression vector, preferably selected from a plasmid ora BAC.
[0169] 9. The method of any one of embodiments 1 to 8, wherein the expression vector further comprises a transcription termination signal from vaccinia virus, preferably from an early promoter.
[0170] 10. The method of any one of embodiments 1 to 9, wherein the nucleotide sequence of the transcription termination signal comprises SEQ ID NO: 3 or 4. 11. The method of any one of embodiments 1 to 10, wherein the poxvirus RNA polymerase complex comprises at least one polypeptide selected from the group consisting of Rpo147, Rpo132, Rpo35, Rpo30, Rpo22, Rpo19, Rpo18 and Rpo7, preferably, the poxvirus RNA polymerase complex comprises each of the polypeptides.
[0171] 12. The method of any one of 1 to 11, wherein the poxvirus RNA polymerase complex further comprises transcription factors for transcription of early, intermediate or late poxvirus genes, preferably early poxvirus genes.
[0172] 13. The method of any one of embodiments 1 to 12, wherein the poxvirus RNA polymerase complex further comprises the viral capping enzymes D1 and D12.
[0173] 14. The method of any one of embodiments 11 to 13, wherein the polypeptides of embodiment 11 , the transcription factors of embodiment 12 and / or the viral capping enzymes of embodiment 13 are from vaccinia virus.
[0174] 15. The method of any one of embodiments 1 to 14, wherein the eukaryotic host cell is a mammalian cell, preferably the host cell is selected from HeLa cells, CHO cells, BHK cells, COS cells, HEK293 cells and A549 cells.
[0175] 16. The method of any one of embodiments 1 to 15, wherein the nucleotide sequence of interest is selected from a growth factor, an enzyme, a regulatory protein, a receptor, a peptide hormone, a cytokine, a membrane or transport protein, an antigen used for vaccination, a vaccine, an antigen-binding protein, an immunostimulatory protein, an allergen, a full-length antibody, an antibody fragment or derivative, and combinations thereof.
[0176] 17. The method of any one of embodiments 1 to 15, wherein the nucleotide sequence of interest is derived from a virus, bacterium or fungus.
[0177] 18. A modified eukaryotic host cell comprising (i) an expression vector comprising a poxvirus promoter and a nucleotide sequence of interest under the control of the promoter genome, wherein the eukaryotic host cell further comprises a poxvirus RNA polymerase complex or a portion thereof capable of transcribing the nucleotide sequence of interest.
[0178] 19. A method for the production of a MVA vector or recombinant MVA virus comprising: (a) transfecting one or more DNA fragments into a eukaryotic host cell, wherein the one or more DNA fragments comprise genomic DNA sequences of an MVA species, such that the MVA virus is reconstituted in the eukaryotic host cell, and wherein the one or more DNA fragments further comprise a poxvirus promoter and optionally a nucleotide sequence of interest under the control of the promoter; (b) transfecting the eukaryotic host cell of step a) with a poxvirus RNA polymerase complex or a portion thereof capable of transcribing the nucleotide sequence of interest, wherein the transfecting step b) can be carried out before, during or after transfecting step a);
[0179] (c) culturing the transfected host cell under conditions allowing the production of the MVA vector or the recombinant MVA virus; and
[0180] (d) optionally purifying the MVA vector or the recombinant MVA virus.
[0181] 20. The method of embodiment 19, wherein the method does not include using a helper virus.
[0182] 21. The method of embodiment 19 or 20, wherein the poxvirus RNA polymerase complex comprises at least one polypeptide selected from the group consisting of Rpo147, Rpo132, Rpo35, Rpo30, Rpo22, Rpo19, Rpo18 and Rpo7, preferably, the poxvirus RNA polymerase complex comprises each of the polypeptides, more preferably, the poxvirus RNA polymerase complex further comprises transcription factors fortranscription of poxvirus early genes and capping enzymes.
[0183] 22. The method of embodiment 21 , wherein the poxvirus promoter is an early poxvirus promoter.
[0184] 23. The method of any one of embodiments 19 to 22, wherein the eukaryotic host cell is selected from HeLa cells, CHO cells, BHK cells, COS cells, HEK293 cells, and A549 cells.
[0185] 24. The method of any one of embodiments 19 to 23, wherein the poxvirus genomic sequence comprises the sequence of MVA Accession No. #U94848 or#AY603355.
[0186] 25. A modified eukaryotic host cell comprising one or more DNA fragments comprising the entire genomic DNA sequence of an MVA species, such that the MVA virus is reconstituted in the eukaryotic host cell, and wherein the one or more DNA fragments further comprise an early poxvirus promoter and optionally a nucleotide sequence of interest under the control of the promoter, and wherein the eukaryotic host cell further comprises a poxvirus RNA polymerase complex or a portion thereof capable of transcribing the nucleotide sequence of interest, preferably the poxvirus RNA polymerase complex is an early poxvirus RNA polymerase complex further comprising transcription factors and capping enzymes.
[0187] 26. A method for producing a vaccine composition comprising
[0188] performing the method of any one of embodiments 19 to 25 and formulating the MVA vector or the recombinant MVA virus with at least one pharmaceutically acceptable carrier to obtain a vaccine composition. Examples
[0189] Purification of vaccinia virus RNAP
[0190] Vaccinia virus RNA polymerase was purified from Hela S3 cells infected with GLV-1 h439 virus strain (Genelux; San Diego). For this purpose, cells were seeded in 100x15 cm2dishes and were grown at 5% CO2 at 37°C, until they reach 90% confluency. Hela S3 cells were infected at MOI of 3 and incubated 48 hours at 32°C. The efficiency of infection was estimated by fluorescence microscopy (EVOS M5000; Invitrogen). Cells were scraped, lysed in lysis buffer (150 mM NaCI; 50 mM HEPES 7.5; 1.5 mM MgCI2; 1%NP40; 1 mM DTT and proteinase inhibitors) and incubated with FLAG agarose beads (Sigma Aldrich; cat N) for 4 hours at 4°C. The agarose beads with immobilized vRNAP complexes were washed 4 times with 12 mL of wash buffer (150 mM NaCI; 50 mM HEPES 7.5; 1.5 mM; 1mM DTT; 0.1%NP40). Native vRNAP complexes were eluted from beads with 3xFLAG peptide (Sigma Aldrich) and eluted resulting complexes analyzed PAGE electrophoresis and Coomassie stain.
[0191] vRNAP in vitro transcription assay
[0192] A pSB24 plasmid, containing a vaccinia virus early promoter, followed by a G-less cassette was derivatized by inserting an early termination signal 3’ of the G-less cassette, yielding plasmid pSB24_TS. For the in vitro transcription assay, 500 ng of vRNAP, purified as described above, was mixed with 500 ng of Nde l-linearized pSB24_TS, in a 50 pl transcription reaction, containing 40mM Tris-HCI, pH 7.9, 1mM DTT, 2mM spermidine, 6mM MgCI2, 1 mM ATP, 1mM CTP, 1mM GTP and, 0.1 mM of UTP, 5pCi of alfa-[P32]-UTP, 80pM SAM and Mouse RNAsin. The mixture was incubated at 300C, samples were drawn at the desired time points and stopped by adding TRIzol (Thermo Fisher Scientific). All time point samples were filled up with water to 50 pl, each before four times the volume TRIzol was added. After mixing, 50 pl chloroform was added and the sample was centrifuged at 12 000 g for at least 15 min at room temperature. The aqueous fraction was transferred into a fresh tube containing four times the volume 2 propanol and 15 pg GlycoBlue Coprecipitant (Thermo Fisher Scientific). After mixing, the RNA was precipitated at -20°C for at least 10 h. The sample was centrifuged at 12 000 g at 4°C for 15 min and the supernatant was discarded, before the RNA pellet was washed once with 180 pl of 70 % ethanol. The RNA pellet was dried at 37°C for 5 min and resuspended in 20 pl 1x RNA loading dye (47.5 % formamide, 0.025 % bromophenol blue, 0.025 % xylene cyanol). After boiling the sample at 95°C for 5 min, 5 pl were loaded on a 4 % polyacrylamide gel containing 8 M urea. Electrophoresis was carried out at 20 mA in 1x TBE running buffer. After 120 min, electrophoresis was stopped, and the gel was transferred onto Whatman paper and exposed to a high performance chemiluminescence film (Cytiva) at 80°C. The film was developed after 7 h.
[0193] Capping assay
[0194] This single enzyme is composed of two subunits (D1 and D12) and has three enzymatic activities (RNA triphosphatase and guanylyl transferase by the D1 subunit and guanine methyltransferase by the D12 subunit). Vaccinia virus Capping Enzyme is effective to catalyze the formation of cap structure, which can specifically attach the 7-methylguanylate cap structure (m7Gppp, Cap 0) to the 5' end of RNA. Methods for testing the enzyme activities are known in the art. An exemplary capping assay is described in the following.
[0195] For the investigation of the 5'-end of in vitro transcribed intermediate RNA, early and intermediate RNAs were produced in 125 l transcription reactions each. Additionally, 50 pl of T7 transcribed U7 snRNA served as non-capped control. After precipitation, all RNAs were resuspended in 30 pl water and pooled. 200 pl of Dynabeads Protein G (Invitrogen, 10004D) slurry was washed twice with PBS containing 0.02 % Tween20. The beads were incubated with 60 pg H-20 antibody in 400 pl PBS supplied with 0.02 % Tween20 for 45 min under shaking at room temperature. After removing unbound antibody, vvRNAP transcribed early, intermediate and T7 transcribed U7 snRNA were combined and added to the beads after taking off 20 % as an input sample. The sample was incubated for 70 min under rotation at RT, before the supernatant, which contained all unbound RNAs, was taken off. The beads were washed three times with 400 pl PBS supplied with 0.02 % Tween20 each, before 50 pl of water were added. The RNAs of input, unbound and IP samples were extracted via TRIzol reagent (Invitrogen). Therefore, all samples were filled up with water to 50 pl, before four times the volume TRIzol was added. After mixing, 50 pl chloroform were added and the sample was centrifuged at 12 000 g for at least 15 min at RT. The aqueous fraction was transferred into a fresh tube containing four times the volume 2 propanol and 15 pg GlycoBlue Coprecipitant (Thermo Fisher Scientific). After mixing, the RNA was precipitated at -20°C for at least 10 h. The sample was centrifuged at 12 000 g at 4°C for 15 min and the supernatant was discarded, before the RNA pellet was washed once with 180 pl of 70 % ethanol. The RNA pellet was dried at 37°C for 5 min and resuspended in 20 pl 1x RNA loading dye (47.5 % formamide, 0.025 % bromophenol blue, 0.025 % xylene cyanol). After boiling the sample at 95°C for 5 min, 5 pl were loaded on a 4 % polyacrylamide gel containing 8 M urea. Electrophoresis was carried out at 20 mA in 1x TBE running buffer. After 120 min, electrophoresis was stopped, and the gel was transferred onto Whatman paper and exposed to a high performance chemiluminescence film (Cytiva) at 80°C. The film was developed after 7 h.
[0196] Cytoplasmic gene expression by co-transfection of DNA / vRNAP vesicles
[0197] Viral expression vector pEP-mCherry-ET was generated containing a vaccinia virus early promoter, followed by an ORF for mCherry red fluorescent protein, a viral early transcription termination signal and a short PolyA- tail by standard DNA cloning technique. The vector was propagated in an E. coli DH5-alpha strain and purified for the following experiments.
[0198] 1*105HEK293T cells per well were seeded into standard 24 well plates and grown in a cell culture incubator at 5% CO2 and 37°C. 5 g purified vRNAP (see above) was mixed with 2pg of pEP-mCherry-ET DNA in the presence of different NTP’s and incubated for 10’ at 30°C for efficient vRNAP / DNA complex formation. After vRNAP / DNA was mixed with TransIT-CRISPR non-liposomal polymeric transfection reagent (Mirus product #T1706) and transferred into a single well of the cell culture plate according to the manufacturer’s recommendations. The cell culture plate was subsequently incubated for 24 hours at at 5% CO2 and 37°C. mCherry expression was then detected either by fluorescence on an EVOS M5000 imaging system (Invitrogen) or by western blot analysis with an anti-mCherry antibody (Abeam ab167453).
[0199] Reconstitution of Modified Vaccinia Ankara vaccines using vRNAP in place of a helper virus Modified Vaccinia Ankara (MVA)-vectored systems are promising systems for rapid development of novel vaccines. For example, Yll-Pico et al. (Yll-Pico, Park et al. 2024) describe the development and biotechnological production of a CMV vaccine candidate targeting the dominant CMV antigens phosphoprotein 65 (pp65) and immediate-early 1 and 2 (IE1 / 2). Yll-Pico et al. (Yll-Pico, Park et al.
[0200] 2024) use three sMVA plasmids (MVA fragments 1-3 having the respective CMV antigen sequences inserted) for genetically stable large-scale production in conjunction with a Fowl pox virus (FPV) as a helper virus to initiate viral transcription. With respect to biological safety and GMP precautions it is desirable to replace the FPV helper virus. The present inventors contemplate to replace the (FPV) helper virus by a vRNAP preparation for improved GMP production.
[0201] Methodology
[0202] Except for the use of the Fowl virus as helper virus, the procedure is described by Yll-Pico et al. (Yll-Pico, Park et al. 2024).
[0203] Construction of sMVA fragments: The three about 60 kbp sMVA fragments (F1-F3) comprising the complete MVA genome sequence (NCBI Accession# U94848)<4>were constructed as follows: sMVA F1 contained base pairs 191-59743 of the MVA genome sequence; sMVA F2 comprised base pairs 56744-119298 of the MVA sequence; and sMVA F3 included base pairs 116299-177898 of the reported MVA genome sequence<4>. A CR / HL / CR sequence arrangement composed of 5’-TTT TTT TCT AG A CAC TAA AT A AAT A GTAAG ATT AAA TTA ATT AT A AAA TTA TGTATA TAA TAT TAA TTA TAA AAT TAT GTA TAT GAT TTA CTA ACT TTA GTT AGA TAA ATT AAT AAT ACA TAA ATT TTA GTA TAT TAA TAT TAT AAA TTA ATA ATA CAT AAA TTT TAG TAT ATT AATATTATA TTT TAA ATA TTT ATT TAG TGT CTA GAA AAA AA-3’ was added in the same orientation to both ends of each of the sMVA fragments, wherein the italicized letters indicate the duplex copy of the MVA terminal HL sequence and the underlined letters indicate the CR sequences. Notably, the CR / HL / CR sequences incorporated at the ITRs of sMVAFI and F3 were added in identical arrangement as the CR / HL / CR sequences occur at the ITRs at the genomic junctions of putative MVA replication intermediates. The sMVA fragments were produced and assembled by Genscript using chemical synthesis, combined with a yeast recombination system. All sMVA fragments were cloned into a yeast shuttle vector, termed pCCI-Brick, which contains a mini-F replicon for stable propagation of large DNA fragments as low copy BACs in E. coli. sMVA F1 and F3 were cloned and maintained in EPI300 E. coli (Epicentre), while sMVAFI was cloned and maintained in DH10B E. coli (Invitrogen).
[0204] Briefly, the three sMVA plasmids (fragments 1-3) are cotransfected into 70% confluent BHK cells using Eugene HD transfection reagent (Roche) according to the manufacturer’s instructions. At 4 h culture time post cotransfection, the BHK cells are further transfected with vRNAP prepared as described above. The efficiency of different transfection reagents (e. g. TransIT-CRISPR non-liposomal polymeric transfection reagent (Mirus product #T1706), Fugene HD transfection reagent (Roche), Lipofectamine (Invitrogen) for vRNAP delivery is evaluated.
[0205] In an alternative protocol, the three sMVA plasmids (fragments 1-3) are mixed with vRNAP and cotransfected into 70% confluent BHK cells using different transfection reagents (e. g. TransIT-CRISPR non-liposomal polymeric transfection reagent (Mirus product #T1706), Fugene HD transfection reagent (Roche), Lipofectamine (Invitrogen).
[0206] The BHK cells transfected by either method are grown for 2 days and then split in a 1 :2 ratio, and finally grown for additional 2 days in a large culture format. The growth / split scheme is repeated over a total period of 12 days and signs of sMVA virus infection are analyzed. If positive, the infected BHK cells are harvested by centrifugation at 1200 rpm for 5 min at room temperature and resuspended in MEM supplemented with 2% FBS, 1% sodium pyruvate, 1% non-essential amino acids and 1% penicillin-streptomycin. The sMVA virus is prepared by three freeze / thaw cycles combined with 2 rounds of sonication and analyzed for efficiency of infection, plaque formation and -phenotype, titer and genetic identity.
[0207] References
[0208] Yll-Pico, M., Y. Park, J. Martinez, A. Iniguez, M. Kha, T. Kim, L. Medrano, V. H. Nguyen, T.
[0209] Kaltcheva, S. Dempsey, F. Chiuppesi, F. Wussow and D. J. Diamond (2024). "Highly stable and immunogenic CMV T cell vaccine candidate developed using a synthetic MVA platform." NPJ Vaccines 9(1): 68.
[0210] Increase of transcripton efficiency in presence of B1R-Kinase
[0211] The vaccinia B1R gene was amplified from genomic DNA and cloned into bacterial expression vectora with either a sequence for an N-terminal HIS or an N-terminal GST-tag. By virtue of the tag the B1R-Kinase protein was purified to homogeneity and added to a concentration of 1 microgram per milliliter to transcription reactions as described above. For control reaction, a KD-variant of the B1 R-Kinase was expressed which lacked the key catalytic residue. An approximately fivefold increase in transcription activity is observed in presence of the kinase. Addition of a phosphatase drastically reduces the transcription efficiency (Fig. 6A). A mutational study of the Rpo30 phosphopeptide domain narrows the phosphorylation site down to its triple SP motif (Fig. 6B).
Claims
CLAIMS1. A method for the production of RNA or the protein product encoded by a nucleotide sequence of interest comprising(a) transfecting a eukaryotic host cell with an expression vector comprising a poxvirus promoter and a nucleotide sequence of interest under the control of the promoter;(b) transfecting the eukaryotic host cell of step a) with a poxvirus RNA polymerase complex or a portion thereof capable of transcribing the nucleotide sequence of interest, wherein the transfecting step b) can be carried out before, during or after transfecting step a);(c) culturing the transfected eukaryotic host cell under conditions allowing the cytosolic expression of the gene of interest; and(d) optionally purifying the produced mRNA and / or the produced protein product encoded by the gene of interest.
2. The method of claim 1, wherein the RNA is selected from mRNA, tRNA, rRNA, small nuclear RNA, microRNA, siRNA, preferably the RNA is mRNA.
3. The method of claim 1 or 2, wherein the RNA is capped at the 5’ end with N7-methyl guanosine (m7G).
4. The method of any one of claims 1 to 3, wherein the method is carried out for in vitro production of RNA or the protein product encoded by a nucleotide sequence of interest.
5. The method of any one of claims 1 to 3, wherein the method is carried out ex vivo as part of a gene therapy of a patient in need thereof.
6. The method of any one of claims 1 to 5, wherein the poxvirus promoter is (i) an early poxvirus promoter and the poxvirus RNA polymerase complex is an early poxvirus RNA polymerase complex or a portion thereof, or (ii) the poxvirus promoter is an intermediate poxvirus promoter and the poxvirus RNA polymerase complex is an intermediate poxvirus RNA polymerase complex or a portion thereof, or (iii) the poxvirus promoter is a late poxvirus promoter and the poxvirus RNA polymerase complex is a late poxvirus RNA polymerase complex or a portion thereof.
7. The method of any one of claims 1 to 6, wherein the poxvirus promoter has the nucleotide sequence set forth in SEQ ID NO: 1 or 2.
8. The method of any one of claims 1 to 7, wherein the expression vector is a nonintegrating expression vector, preferably selected from a plasmid or a BAG.
9. The method of any one of claims 1 to 8, wherein the expression vector further comprises a transcription termination signal from vaccinia virus, optionally wherein the nucleotide sequence of the transcription termination signal comprises SEQ ID NO: 3 or 4.
10. The method of any one of claims 1 to 9, wherein the poxvirus RNA polymerase complex comprises at least one polypeptide selected from Rpo147, Rpo132, Rpo35, Rpo30, Rpo22, Rpo19, Rpo18 or Rpo7, preferably, the poxvirus RNA polymerase complex comprises each of the polypeptides.
11. The method of any one of claims 1 to 10, wherein the poxvirus RNA polymerase complex further comprises transcription factors for transcription of early, intermediate or late poxvirus genes, optionally the transcription factors of the early poxvirus genes are selected from VETF and / or Rap94.
12. The method of any one of claims 1 to 11 , wherein the poxvirus RNA polymerase complex further comprises the viral capping enzymes D1 and D12.
13. The method of any one of claims 10 to 12, wherein the polypeptides of claim 10, the transcription factors of claim 11 and / or the viral capping enzymes of claim 12 are from vaccinia virus.
14. The method of any one of claims 1 to 13, wherein the eukaryotic host cell is a mammalian cell, preferably the host cell is selected from HeLa cells, CHO cells, BHK cells, COS cells, HEK293 cells and A549 cells.
15. The method of any one of claims 1 to 14, wherein (i) the nucleotide sequence of interest is selected from a growth factor, an enzyme, a regulatory protein, a receptor, a peptide hormone, a cytokine, a membrane or transport protein, an antigen used for vaccination, a vaccine, an antigen-binding protein, an immunostimulatory protein, an allergen, a full-length antibody, an antibody fragment or derivative, and combinations thereof, or (ii) the nucleotide sequence of interest is derived from a virus, bacterium or fungus.
16. A method for the production of a MVA vector or recombinant MVA virus comprising: (a) transfecting one or more DNA fragments into a eukaryotic host cell, wherein the one or more DNA fragments comprise genomic DNA sequences of an MVA species, such that the MVA virus is reconstituted in the eukaryotic host cell, and wherein the one or more DNA fragments comprise a poxvirus promoter and optionally a nucleotide sequence of interest under the control of the promoter;(b) transfecting the eukaryotic host cell of step a) with a poxvirus RNA polymerase complex or a portion thereof capable of transcribing the nucleotide sequence of interest, wherein the transfecting step b) can be carried out before, during or after transfecting step a);(c) culturing the transfected host cell under conditions allowing the production of the MVA vector or the recombinant MVA virus; and(d) optionally purifying the MVA vector or the recombinant MVA virus.
17. The method of claim 16, wherein the method does not include using a helper virus.
18. The method of claim 16 or 17, wherein the poxvirus RNA polymerase complex comprises at least one polypeptide selected from Rpo147, Rpo132, Rpo35, Rpo30, Rpo22, Rpo19, Rpo18 or Rpo7, preferably, the poxvirus RNA polymerase complex comprises each of the polypeptides, more preferably, the poxvirus RNA polymerase complex further comprises transcription factors for transcription of poxvirus early genes and capping enzymes.
19. The method of any one of claims 16 to 18, wherein the eukaryotic host cell is selected from HeLa cells, CHO cells, BHK cells, COS cells, HEK293 cells, and A549 cells.
20. The method of any one of claims 16 to 19, wherein the poxvirus genomic sequence comprises the sequence of MVA Accession No. #U94848 or#AY603355.
21. A method for producing a vaccine composition comprisingperforming (i) the method of any one of claims 1 to 15 and formulating the produced RNA or protein product with at least one pharmaceutically acceptable carrier to obtain a pharmaceutical composition or (ii) the method of any one of claims 16 to 20 and formulating the MVA vector or the recombinant MVA virus with at least one pharmaceutically acceptable carrier to obtain a vaccine composition.
Citation Information
Patent Citations
Synthetic modified vaccinia ankara (SMVA) based coronavirus vaccines
WO2021236550A1
Multivalent recombinant modified vaccinia virus ankara (MVA) vector encoding filovirus immunogens
US11338030B2
EP24174856A