Engineered extracellular vesicles for gene therapy and cardiovascular disease

Abstract

A biological nanoparticle for targeted therapeutic delivery is provided. The biological nanoparticle includes a plurality of extracellular vesicles. Characteristically, each extracellular vesicle contains a microRNA, which has been modified with ExoMotif sequences to enhance selective loading into the vesicles during their biogenesis. The microRNA is configured to inhibit plaque formation and vascular calcification. Additionally, a hydroxyapatite-binding peptide (HABP) is conjugated to the surface of each extracellular vesicle, facilitating targeted delivery to calcified tissues. This configuration enables the nanoparticle to specifically target areas of vascular calcification, where it can deliver the microRNA to modulate cellular behavior.

Description

ENGINEERED EXTRACELLULAR VESICLES FOR GENE THERAPY ANDCARDIOVASCULAR DISEASECROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. provisional application Serial No. 63 / 711,236 filed October 24, 2024, the disclosure of which is hereby incorporated in its entirety by reference herein.SEQUENCE LISTING[0002| The text file USC0385PCT_Sequences.xml of size 14,996 bytes created October 11 , 2025, filed herewith, is hereby incorporated by reference.TECHNICAL FIELD

[0003] In at least one aspect, the present invention is related to nanoparticles for treating atherosclerosis and other calcification-damaged tissues" (broader scope).BACKGROUND

[0004] Cardiovascular disease (CVD) is the leading cause of death globally, despite significant advancements in diagnosis and treatment [1], Atherosclerosis is the main driver of CVDs and is characterized by plaque development in the vasculature. Vascular calcification in atherosclerosis is a predictor of acute cardiovascular events and atherosclerosis patients with severe vascular calcification have a 44% chance of experiencing a myocardial infarction or stroke [[2], [3], [4]]. Despite the clear correlation of vascular calcification and poor patient outcomes, there are currently no clinically approved therapies to treat vascular calcification [5],[0005| During atherosclerotic plaque formation, vascular smooth muscle cells (VSMCs), which normally maintain a quiescent contractile phenotype in healthy vasculature, undergo dedifferentiation into a migratory and proliferative synthetic phenotype [[6], [7], [8]]. In response to pathological cues, synthetic VSMCs further undergo transdifferentiation in plaque-propagating phenotypes such as inflammatory macrophages or osteochondrogenic cells, which drive calcificationwithin the vasculature [9,10], Plaque calcification results in destabilization, which directly correlates with thrombosis and fatal cardiac events

[0011] , Thus, developing a therapy to modulate VSMC phenotypes and inhibit the pathogenic osteochondrogenic phenotype would aid in inhibiting vascular calcification in atherosclerosis and the associated downstream consequences.[0006| MicroRNA-133a (miR-133) is a promising therapeutic as it is a potent regulator of osteogenic differentiation and directly targets the osteoblast transcription factor, RUNX2

[0012] , To deliver miR-133 to osteochondrogenic VSMCs, we utilized extracellular vesicles (EVs) as endogenous nanoparticles. EVs are inherently biocompatible and serve as a safe, naturally-derived drug carrier that can be used repeatedly for chronic diseases such as atherosclerosis. Specifically, EVs are lipid-bound nanoparticles (100-200 nm) that are released by all cells and function as integral mediators of cell-cell communication and exhibit low immunogenicity and inherent tissue-homing characteristics

[0013] , Moreover, EVs have ~30-40-fold greater cell internalization compared to clinically approved lipid nanoparticle formulations [14,15], enabling highly efficient drug delivery systems.

[0007] Current methods of loading miRs into EVs, however, are limited by low EV yield, degradation of miR cargo, and loss of the structural integrity of the EV membrane. EV loading techniques can be broadly categorized as exogenous or endogenous loading [16,17], While exogenous loading methods (e.g. sonication, electroporation, and extrusion) yield EVs with concentrations ranging from ~25 to 5000-fold greater miR cargo compared to unloaded controls, they can compromise the stability and physical structure of EVs and degrade the loaded RNA quality [

[0018] ,

[0019] ,

[0020] ]. Endogenous loading methods aim to engineer the cell to utilize cellular machinery to load miR into EVs

[0021] , In this way, the excellent nanoparticle characteristics of EVs (i.e., biocompatibility, stability, and low immunogenicity) are preserved while essentially converting the cell into a nanoparticle “factory.” Previous endogenous loading methods for RNA have focused on lentiviral transduction of a plasmid encoding the miR of interest with a strong promoter, forcing the cell to produce excess target miR that is then transiently bulk loaded into EVs [22,23], This method does not take advantage of the endogenous miR loading machinery and thus, leads to only modest increases in EV miR cargo [24,25] (Table SI). While these engineered EVs demonstrate moderate therapeutic efficacy, enhancing miR cargo in EVs can further boost their therapeutic potential.

[0008] Accordingly, there is a need for new treatments for treating atherosclerosis-related vascular calcification.SUMMARY

[0009] In at least one aspect, to address the limited loading increase by lentivirus transduction, we capitalize on a recent discovery in EV biology regarding ExoMotifs. ExoMotifs are 4-8 nucleotide motifs in microRNAs that facilitate directed loading of the ExoMotif-tagged microRNA into EVs by binding to RNA-binding proteins involved in the ESCRT EV biogenesis pathway

[0017] , Genetically engineering cells with ExoMotif-modified microRNA sequences allow for the creation of a stable cell line producing EV nanoparticles with significantly enriched therapeutic microRNA.[0010| In another aspect, the viability and potential of microRNA ExoMotif-engineering for developing cell lines that produce therapeutic biological nanoparticles is evaluated.

[0011] In another aspect, a biological nanoparticle for targeted therapeutic delivery is provided. The biological nanoparticle includes a plurality of extracellular vesicles. Characteristically, each extracellular vesicle contains a microRNA, which has been modified with an ExoMotif sequence to enhance selective loading into the vesicles during their biogenesis. The microRNA is configured to inhibit plaque formation and vascular calcification. Additionally, a hydroxyapatite-binding peptide (HABP) and / or another targeting peptide is conjugated to the surface of each extracellular vesicle, facilitating targeted delivery to calcified tissues. This configuration enables the nanoparticle to specifically target areas of vascular calcification, where it can deliver the microRNA to modulate cellular behavior.

[0012] The foregoing summary is illustrative only and is not intended to be in any way limiting. In addition to the illustrative aspects, embodiments, and features described above, further aspects, embodiments, and features will become apparent by reference to the drawings and the following detailed description.BRIEF DESCRIPTION OF THE DRAWINGS[0013[ The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0014] For a further understanding of the nature, objects, and advantages of the present disclosure, reference should be made to the following detailed description, read in conjunction with the following drawings, wherein like reference numerals denote like elements and wherein:[0015| FIGURE 1A. Schematic of a biological nanoparticle for treating atherosclerosis and other calcification-damaged tissues.

[0016] FIGURE IB. Mature duplex of WT miR-133a (after Dicer processing), with seed sequence(s) indicated (SEQ ID NO: 9 and SEQ ID NO: 10).

[0017] FIGURE 1C. Mature duplex of ExoMotif-modified miR-133a (after Dicer processing); changed nucleotides that incorporate the ExoMotif are highlighted; seed sequence(s) indicated (SEQ ID NO: 11 and SEQ ID NO: 12).

[0018] FIGURE ID. Mature duplex of WT miR-145 (after Dicer processing), with seed sequence(s) indicated (SEQ ID NO: 13 and SEQ ID NO: 14).[0019[ FIGURE IE. Mature duplex of ExoMotif-modified miR-145 (after Dicer processing); changed nucleotides that incorporate the ExoMotif are highlighted; seed sequence(s) indicated (SEQ ID NO: 15 and SEQ ID NO: 16).

[0020] FIGURE 2A, 2B, 2C, 2D, 2E, and 2F. miR-133 is downregulated in calcified vasculature. A) Contractile VSMCs transdifferentiate into osteochondrogenic VSMCs that cause vascular calcification. B) GO analysis of miR-133, miR-23, miR-30, miR-205, miR-338 targets reveal miR-133 to have functions in both smooth muscle cell and osteoblasts cellular processes. C) Sections of calcified human artery show significant calcification via ARS (N = 3; scale bar = 500 pm). D) miR- 133 gene expression is significantly downregulated in severely calcified vasculature (N = 4; *p < 0.05) compared to healthy vessels (N = 3; *p < 0.05). E) qRT-PCR of osteochondrogenic markers RUNX2 and BMP2 and contractile markers ACTA2 and MGP in healthy vessels (N = 3; *p < 0.05) versus calcified vessels (N = 4; *p < 0.05) show osteogenic markers have significantly greater expression in calcified vessels. F) EVs secreted from calcified HASMCs have significantly decreased miR-133 compared to EVs released from healthy HASMCs (N = 5; ****p < 0.0001). miR-133 expression normalized to RNU6; mRNA expression normalized to GAPDH.

[0021] FIGURE 3A, 3B, 3C, 3D, 3E, 3F, 3G, 3H, 31, 3J, and 3K. Synthesis and isolation of ExoMotif-modified miR-133-loaded EVs. A) MOVAS cells are lentivirally transduced with miR-133 wild type (miR-133-WT) and ExoMotif modified miR-133 (miR-133-ExoMotif), leading to enhanced miR-133 EV loading. The ExoMotif sequence modification does not change the hairpin loop structure of the pre-miR as predicted by RNAfold. B) NTA of MOVAS-EVs, ExoMotif-miR-133-EVs, and WT-miR-133-EVs have approximately the same size (~130-160 nm; N = 3). C) TEM shows cupshaped morphology for MOVAS-EVs, ExoMotif-miR-133-EVs, and WT-miR-133-EVs (N = 3; scale bar = 200 nm). D) Western blot analysis shows the presence of EV markers CD9, CD63, and TSG101 in MOVAS-EVs, ExoMotif-miR-133-EVs, and WT-miR-133-EVs. E) All three EV types have a similar zeta potential (N = 5). F) Cell miR-133 expression significantly increases after viral miR-133 transduction for the WT- and ExoMotif-miR-133 sequences (N = 5; ****p < 0.0001). G) miR-133 content is significantly increased in EVs secreted from the ExoMotif-miR-133 cells compared to the unmodified or WT-miR-133 transduced cells (N = 5; ****p < 0.0001). H) siRNA knockdown of Alyref and Fus leads to inhibition of ExoMotif-modified miR-133 loading into EVs (N = 4; *p < 0.05, ****p < 0.0001). I) EV miR-145, J) miR-21, and K) MGP are significantly upregulated with both WT- and ExoMotif-miR-133 transduction of the cell (N = 5; *p < 0.05, ****p < 0.0001).|0022] FIGURE 4A, 4B, 4C, 4D, 4E, 4F, 4G, and 4H. HABP EV surface functionalization enhances binding to calcification in vitro. A) Unmodified EVs are sonicated with an amphiphile comprised of the HABP conjugated to a DSPE lipid tail to form HABP-EV. B) HABP-EVs modified with increasing concentration of HABP exhibit maximal binding to HA crystals at 0.25 mg / mL (N = 5; **p < 0.01, ***p < 0.001). C / D) NTA and TEM of modified HABP-EVs show no significant change in size and morphology (N = 3; scale bar = 200 nm). E) EV membrane rigidity is decreased after sonication but is restored to baseline after 1 h incubation (N = 5; *p < 0.05, **p < 0.01). F) HABP modification does not lead to loss of miR-133 EV cargo via qRT-PCR (N = 4). G) Calcified MOVAS cells were treated with HABP-EVs or MOVAS-EVs for 30 min (DAPI = nuclei; ARS = calcification; N = 3; scale bar = 75 pm). H) Significantly greater binding to calcified cells was observed for HABP- EVs compared to MOVAS-EVs (N = 5; ***p < 0.001).

[0023] FIGURES 5A, 5B, 5C, 5D, and 5E. HABP-EVs localize to the aorta in a late-stage murine model of atherosclerosis. A) 9-month-old ApoELKO were fed a high fat diet for 10 weeks,followed by intravenous administration of DiR-labeled HABP-EVs, non-targeting EVs (NT-EVs), MOVAS-EVs, or OsteoSense. B / C) HABP-EVs localize to areas of turbulent flow (the aortic arch, renal bifurcations), while NT- and MOVAS-EVs have significantly less aortic accumulation (N = 6; ****p < 0.0001). D / E) Sections of the aortic arch show accumulation of DiR-labeled HABP-EVs at a level similar to OsteoSense (DAPI = cell nuclei, ARS = calcification, DIR = EVs or OsteoSense) (N = 6; ***p < 0.001, ****p < 0.0001; black scale bar = 250 pm; white scale bar = 100 pm).[0024| FIGURE 6A, 6B, 6C, and 6D. HABP-miR-133-EVs inhibit osteochondrogenic VSMCs and calcification in vitro. A and B) ARS at Day 10 shows that HABP-miR-133-EV treatment significantly reduces calcification deposition compared to all other treatment groups (N = 6; **p < 0.01 ***p < 0.001, ****p < 0.0001; scale bar = 250 pm (top row in A), 5.5 mm (bottom row in a)). C) qRT-PCR of contractile and osteochondrogenic markers at Day 10 show that HABP-miR-133- EVs decrease osteochondrogenic markers while upregulating contractile markers (N = 5; *p < 0.05, **p < 0.01, ****p < 0.0001). D) ALP activity is significantly decreased by HABP-miR-133-EV treatment at Day 7 and Day 10 (N = 5; *p < 0.05, **p < 0.01 ***p < 0.001).[0025| FIGURES 7A, 7B, 7C, 7D, 7E, 7F, 7G, and 7H. HABP-miR-133-EVs inhibit calcification in vivo in a late-stage model of atherosclerosis. A) Nine-month-old ApoE - / - knockout (KO) were fed a high fat diet for 10 weeks with weekly intravenous administration of HABP-miR- 133-EVs, MOVAS-EVs, free miR-133, or PBS. B / C) Von Kossa staining of aortic roots show HABP- miR-133-EVs significantly decreased calcification deposition (red arrows) compared to the other treatment groups (N = 6; scale bar = 250 pm; zoomed scale bar = 75 pm). D) Whole tissue qRT-PCR of miR-133 of the abdominal aorta at the renal bifurcation shows significantly increased miR-133 expression after HABP-miR-133-EV treatment (N = 6; *p < 0.05, **p < 0.01,****p < 0.0001). E) Whole tissue qRT-PCR of contractile and osteochondrogenic markers of the abdominal aorta at the renal bifurcation shows significantly increased expression of contractile markers ACTA2 and decreased expression of osteochondrogenic markers after HABP-miR-133-EV treatment (N = 6). F) Serum D-dimer levels are decreased after HABP-miR-133-EV treatment (N = 6; ***p < 0.001). G / H) Liver enzymes AST and ALT are decreased after HABP-miR-133-EV treatment (N = 6; *p < 0.05, **p < 0.01, ****p < 0.0001).

[0026] FIGURE 8A, 8B, 8C, 8D, 8E, 8F, 8G, and 8H. ExoMotif modification enhances miR- 145 loading in EVs after cell transduction. A) Scheme for lentivirus transduction of MOVAS cells with miR-145 wild type (WT-miR-145) and ExoMotif modified miR-145 (ExoMotif-miR-145), leading to enhanced miR-145 EV loading. B) The ExoMotif sequence modification does not change the hairpin loop structure of the pre-miR, as predicted by RNAfold. C) Nanoparticle tracking analysis (NTA) of MOVAS-EVs, WT-miR-145 EVs, and ExoMotif-miR-145 EVs have approximately the same diameter 140- 170 nm). D) TEM shows cup-shaped morphology (white arrows) for MOVAS- EVs, WT-miR-145 EVs, and ExoMotif-miR-145 EVs. E) All three EV types have a similar zeta potential. F) miR-145 expression in MOVAS cells significantly increases after viral miR-145 transduction for the WT- and ExoMotif-miR-145 sequences (N= 5). G) miR-145 content within isolated EVs is significantly greater in EVs released from the ExoMotif-miR-145 cells compared to the unmodified or WT-miR-145 transduced cells (N= 5). H) EV miR-1, miR-21, and miR-133 are significantly upregulated with both WT- and ExoMotif-miR-145 transduction of the cell (N= 5). Scale bar: 200 nm. *p < 0.05, **p < 0.01, ***p < 0.001,**** ? < 0.0001.

[0027] FIGURES 9A, 9B, 9C, 9D, 9E, 9F, and 9G. MCP-1 EV surface functionalization enhances binding to synthetic VSMCs. A) Unmodified EVs are sonicated with an amphiphile comprised of the MCP-1 peptide conjugated to a DSPE lipid tail to form MCP-l-miR-145 EVs. B, C) NTA and TEM of modified MCP-l-miR-145 EVs show no significant change in size and morphology.D) MCP-1 modification does not lead to loss of miR-145 EV cargo, determined by qRT-PCR (N= 4).E) MTS assay shows that EVs are not cytotoxic at multiple concentrations. F) Synthetic MOVAS cells were treated with DiO-labeled miR-145 EVs or MCP-l-miR-145 EVs for 30 min and stained with DAPI (cell nuclei). G) Significantly greater binding to synthetic MOVAS cells was observed for MCP- l-miR-145 EVs compared to miR-145 EVs (N= 5). TEM scale bar: 200 nm; fluorescence microscope scale bar: 100 pm. *p < 0.05.

[0028] FIGURES 10A, 10B, 10C, and 10D. LNP and micelle synthesis and characterization. A) Size, zeta potential, and loading efficiency of NT- and MCP-1 miR-145-LNPs and micelles. B) Gel shift assay demonstrates that miR-145 is protected from degradation by RNase by both LNPs and micelles. C, D) MCP-l-miR-145 LNPs and micelles exhibit significantly greater binding to syntheticMOVAS cells compared to NT -miR-145 LNPs or micelles (N = 5) via fluorescence microscopy. Scale bar: 100 pm. **p < 0.01 .I0029J FIGURE 11A, 1 IB, 11C, 1 ID, 1 IE, 1 IF, 11G, 11H, and 11J. A. MCP-l-miR-145 EVs promote contractile gene expression at low miR-145 concentrations. Synthetic MOVAS cells are treated with MCP-l-miR-145 EVs (1 x 1010EVs mL-1) and MCP-l-miR-145 LNPs and micelles at equivalent doses (0.01 nM). B-E) Gene expression for contractile markers miR-145, ACTA2, and MYH1 1 are increased and decreased for synthetic marker KLF4 with MCP-l-miR-145 EV treatment with no effect for LNP or micelle treatment. F) MCP-l-miR-145 EVs are compared to synthetic nanoparticle with high miR-145 dose (250 nM).G-J) Gene expression for contractile markers miR- 145, ACTA2, and MYH11 are increased and decreased for synthetic marker KLF4 with MCP-l-miR- 145 EV, LNP, and micelle treatment, (N = 5). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0030] FIGURE 12A, 12B, 12C, 12D, 12E, 12F, 12G, and 12H. A. MCP-l-miR-145 EVs inhibit synthetic VSMC function. Synthetic MOVAS cells are treated with MCP-l-miR-145 EVs and MCP-l-miR-145 LNPs and micelles (1 x 1010EVs mL1or 0.01 nM miR-145 dose). B, C) Scratch assay shows decreased migration with MCP-l-miR-145 EV treatment compared to both LNP and micelle nanoparticles. D) MCP-l-miR-145 EVs induced greater cholesterol efflux than all other treatment groups. E. MCP-l-miR-145 EVs are compared to synthetic nanoparticle with high miR-145 dose (250 nM). F, G) Scratch assay shows decreased migration with MCP-l-miR-145 EV, LNP, and micelle treatment and H) cholesterol efflux demonstrates the same effect, (N = 3). *p < 0.05, **p < 0.01, *** / ? < 0.001,**** / ? < 0.0001.[0031 | FIGURES 13A, 13B, 13C, 13D, and 13E. MCP-l-miR-145 EVs inhibit plaque formation in vivo. A) Schematic of in vivo treatment: ApoE’ ' KO mice are fed a high fat diet for 10 weeks followed by doses of MCP-l-miR-145 LNPs, micelles, EVs and unmodified MOVAS EVs and PBS every 5 days for 30 days. B, C) H&E sections of ascending aorta demonstrate significant plaque reduction with MCP-l-miR-145 EV treatment. D, E) qRT-PCR for miR-145, MYOCD, ACTA2, and MYH11 in aortic arch tissues show increased expression following treatment with MCP-l-miR-145 EVs, while KLF4 expression decreased (N= 6). Scale bar: 200 pm, *p < 0.05, **p < 0.01, ***p < 0.001,**** / ? < 0.0001.DETAILED DESCRIPTION

[0032] Reference will now be made in detail to presently preferred compositions, embodiments and methods of the present invention, which constitute the best modes of practicing the invention presently known to the inventors. The Figures are not necessarily to scale. However, it is to be understood that the disclosed embodiments are merely exemplary of the invention that may be embodied in various and alternative forms. Therefore, specific details disclosed herein are not to be interpreted as limiting, but merely as a representative basis for any aspect of the invention and / or as a representative basis for teaching one skilled in the art to variously employ the present invention.[0033| Except in the examples, or where otherwise expressly indicated, all numerical quantities in this description indicating amounts of material or conditions of reaction and / or use are to be understood as modified by the word "about" in describing the broadest scope of the invention. Practice within the numerical limits stated is generally preferred. Also, unless expressly stated to the contrary: all R groups (e.g. Ri where i is an integer) include hydrogen, alkyl, lower alkyl, Ci-6 alkyl, Ce-io aryl, Ce-io heteroaryl, alkylaryl (e.g., Ci-s alkyl Ce-io aryl), -NO2, -NH2, -N(R’R”), - N(R’R”R”’)+L-, Cl, F, Br, -CF3, -CCI3, -CN, -SO3H, -PO3H2, -COOH, -CO2R’, -COR’, -CHO, -OH, -OR’, -O M+, -S03M+, -P03M+, -C00 M+, -CF2H, -CF2R’, -CFH2, and -CFR’R” where R’, R” and R’” are C1-10 alkyl or Ce-18 aryl groups, M+is a metal ion, and L‘ is a negatively charged counter ion; R groups on adjacent carbon atoms can be combined as -OCH2O-; single letters (e.g., "n" or "o") are 1, 2, 3, 4, or 5; in the compounds disclosed herein a CH bond can be substituted with alkyl, lower alkyl, C1-6 alkyl, C6-io aryl, C6-io heteroaryl, -NO2, -NH2, -N(R’R”), -N(R’R”R’”)+L-, Cl, F, Br, -CF3, -CCI3, -CN, -SO3H, -PO3H2, -COOH, -CO2R’, -COR’, -CHO, -OH, -OR’, -O M+, -SO3M+, -P03M+, -C00‘M+, -CF2H, -CF2R’, -CFH2, and -CFR’R” where R’, R” and R’” are C1-10 alkyl or Ce-is aryl groups, M+is a metal ion, and L' is a negatively charged counter ion; hydrogen atoms on adjacent carbon atoms can be substituted as -OCH2O-; when a given chemical structure includes a substituent on a chemical moiety (e.g., on an aryl, alkyl, etc.) that substituent is imputed to a more general chemical structure encompassing the given structure; percent, "parts of," and ratio values are by weight; the term "polymer" includes "oligomer," "copolymer," "terpolymer," and the like; molecular weights provided for any polymers refers to weight average molecular weight unless otherwiseindicated; the description of a group or class of materials as suitable or preferred for a given purpose in connection with the invention implies that mixtures of any two or more of the members of the group or class are equally suitable or preferred; description of constituents in chemical terms refers to the constituents at the time of addition to any combination specified in the description, and does not necessarily preclude chemical interactions among the constituents of a mixture once mixed; the first definition of an acronym or other abbreviation applies to all subsequent uses herein of the same abbreviation and applies mutatis mutandis to normal grammatical variations of the initially defined abbreviation; and, unless expressly stated to the contrary, measurement of a property is determined by the same technique as previously or later referenced for the same property.

[0034] It must also be noted that, as used in the specification and the appended claims, the singular form "a," "an," and "the" comprise plural referents unless the context clearly indicates otherwise. For example, reference to a component in the singular is intended to comprise a plurality of components.[0035| As used herein, the term “about” means that the amount or value in question may be the specific value designated or some other value in its neighborhood. Generally, the term “about” denoting a certain value is intended to denote a range within + / - 5% of the value. As one example, the phrase “about 100” denotes a range of 100+ / - 5, i.e., the range from 95 to 105. Generally, when the term “about” is used, it can be expected that similar results or effects according to the invention can be obtained within a range of + / - 5% of the indicated value.[0036| As used herein, the term “and / or” means that either all or only one of the elements of said group may be present. For example, “A and / or B” shall mean “only A, or only B, or both A and B ” In the case of “only A,” the term also covers the possibility that B is absent, i.e., “only A, but not B.”[0037[ It is also to be understood that this invention is not limited to the specific embodiments and methods described below, as specific components and / or conditions may, of course, vary. Furthermore, the terminology used herein is used only for the purpose of describing particular embodiments of the present invention and is not intended to be limiting in any way.

[0038] The term “comprising” is synonymous with “including,” “having,” “containing,” or “characterized by.” These terms are inclusive and open-ended and do not exclude additional, unrecited elements or method steps.[0039| The phrase “consisting of’ excludes any element, step, or ingredient not specified in the claim. When this phrase appears in a clause of the body of a claim, rather than immediately following the preamble, it limits only the element set forth in that clause; other elements are not excluded from the claim as a whole.

[0040] The phrase “consisting essentially of’ limits the scope of a claim to the specified materials or steps, plus those that do not materially affect the basic and novel character! stic(s) of the claimed subject matter.

[0041] The phrase “composed of’ means “including” or “consisting of.” Typically, this phrase is used to denote that an object is formed from a material.|0042] With respect to the terms “comprising,” “consisting of,” and “consisting essentially of,” where one of these three terms is used herein, the presently disclosed and claimed subject matter can include the use of either of the other two terms.[0043[ The term “one or more” means “at least one” and the term “at least one” means “one or more.” The terms “one or more” and “at least one” include “plurality” and “multiple” as a subset. In a refinement, “one or more” includes “two or more.”

[0044] The term “substantially,” “generally,” or “about” may be used herein to describe disclosed or claimed embodiments. The term “substantially” may modify a value or relative characteristic disclosed or claimed in the present disclosure. In such instances, “substantially” may signify that the value or relative characteristic it modifies is within ± 0%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5% or 10% of the value or relative characteristic.|0045] It should also be appreciated that integer ranges explicitly include all intervening integers. For example, the integer range 1-10 explicitly includes 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Similarly, the range 1 to 100 includes 1, 2, 3, 4. . . . 97, 98, 99, 100. Similarly, when any range is called for, intervening numbers that are increments of the difference between the upper limit and the lower limit divided by 10 can be taken as alternative upper or lower limits. For example, if the range is 1.1.to 2.1 the following numbers 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, and 2.0 can be selected as lower or upper limits.

[0046] When referring to a numeral quantity, in a refinement, the term “less than” includes a lower non-included limit that is 5 percent of the number indicated after “less than.” For example, “less than 20” includes a lower non-included limit of 1 in a refinement. Therefore, this refinement of “less than 20” includes a range between 1 and 20. In another refinement, the term “less than” includes a lower non-included limit that is, in increasing order of preference, 20 percent, 10 percent, 5 percent, or 1 percent of the number indicated after “less than.”[0047| In the examples set forth herein, concentrations, temperature, and reaction conditions (e.g., pressure, pH, flow rates, etc.) can be practiced with plus or minus 50 percent of the values indicated rounded to or truncated to two significant figures of the value provided in the examples. In a refinement, concentrations, temperature, and reaction conditions (e g., pressure, pH, flow rates, etc.) can be practiced with plus or minus 30 percent of the values indicated rounded to or truncated to two significant figures of the value provided in the examples. In another refinement, concentrations, temperature, and reaction conditions (e.g., pressure, pH, flow rates, etc.) can be practiced with plus or minus 10 percent of the values indicated rounded to or truncated to two significant figures of the value provided in the examples.

[0048] Throughout this application, where publications are referenced, the disclosures of these publications in their entirety are hereby incorporated by reference into this application to more fully describe the state of the art to which this invention pertains.

[0049] Abbreviations:[0050J ACTA2" means alpha-smooth muscle actin.10051] "APOE" means apolipoprotein E.|0052] "BMP2" means bone morphogenetic protein 2.

[0053] "CNN1" means calponin 1.

[0054] "EV" means extracellular vesicle.

[0055] "HABP" means hydroxyapatite-binding peptide.

[0056] "KO" means knockout.10057] "MGP" means matrix Gia protein.

[0058] "miR" means microRNA.

[0059] "MOVAS" refers to mouse aortic vascular smooth muscle cells.

[0060] "RUNX2" means Runt-related transcription factor 2.

[0061] "SRF" means serum response factor.[0062 [ "VSMC" means vascular smooth muscle cell.[00631 "WT" means wild type.[0064| In at least one aspect, a biological nanoparticle for targeted therapeutic delivery is provided. Referring to Figure 1A, the biological nanoparticle includes a plurality of extracellular vesicles 10. Each extracellular vesicle 10 includes microRNA 12 (e.g., miR-133), which has been modified with an ExoMotif sequence 14 to enhance selective loading into the vesicles during their biogenesis. The microRNA is configured (e.g., selected) to inhibit plaque formation and vascular calcification. In a refinement, the nanoparticle is configured for treating atherosclerosis or chronic kidney disease. Additionally, a hydroxyapatite-binding peptide (HABP) 16 and / or another targeting peptide is conjugated to the surface of each extracellular vesicle 10 and is configured to target calcified tissues, thereby facilitating targeted delivery to calcified tissues. This configuration enables the nanoparticle to specifically target areas of vascular calcification, where it can deliver the microRNA to modulate cellular behavior.

[0065] In another aspect, the microRNA includes a component selected from the group consisting of miR-1, miR-21, miR-25-3p, miR-126-3p, miR-133a, miR-142-3p, miR-145, miR- 143 / 145, miR-146a, miR-150-5p, miR-221, and members of the let-7 family, and combinations thereof. In a refinement, the microRNA comprises one or more members of the miR-133 family, selected from the group consisting of precursor miR-133a-l, miR-133a-2, and miR-133b, and the corresponding mature sequences miR-133a-3p, miR-133a-5p, miR-133b-3p, and miR-133b-5p. Table 1 provides a description for a number of these microRNAs. In a refinement, wherein each extracellular vesicle includesa plurality of microRNAs which can be the same or different.

[0066] In another aspect, the ExoMotif sequences 14 are configured to bind to RNA-binding proteins within the vascular smooth muscle cells (VSMCs) during extracellular vesicle formation, promoting highly selective incorporation of the microRNA 12 into the vesicles 10. This ensures efficient targeting of the microRNA (e.g., miR-133) to the sites of vascular disease. In a refinement, the ExoMotif sequences 14 include components selected from the group consisting of CGGGAG, CAUG, UGUG, or GGAG, or combinations thereof, which interact with cellular machinery to promote miRNA packaging. This modification is made in such a way that it preserves the natural hairpin-loop structure of the pre-miRNA, which is crucial for miRNA biogenesis and function.

[0067] In another aspect, the hydroxyapatite-binding peptide (HABP) 16 attached to the vesicle surface comprises a sequence selected from CSVSVGMKPSPRP (SEQ ID NO: 1) or derivatives thereof. These derivatives may include peptide modifications designed to enhance binding affinity to calcified tissues or improve stability in physiological conditions, such as amino acid substitutions or protective modifications of functional groups.

[0068] In general terms, the application attaches a hydroxyapatite-binding peptide (HABP) to an extracellular vesicle (EV) by conjugating the peptide to a lipid-PEG anchor (e.g., DSPE-PEG(2000)-maleimide) via a cysteine-maleimide thioether, creating a peptide “amphiphile,” and then post-inserting this amphiphile into the EV membrane with brief sonication and incubation so the lipid tail embeds in the bilayer and the peptide is displayed outward; excess amphiphile is removed by size-exclusion chromatography, and the modified EVs retain size, morphology, and cargo while gaining binding to calcified tissue. Alternatives mentioned include using the same post-insertion workflow with other targeting peptides (e.g., an MCP-l / CCR2-binding peptide) tethered to DSPE-PEG, and bypassing exogenous insertion by genetically engineering the producer cells to express membrane / fusogenic proteins bearing the targeting peptide so EVs bud with the ligand pre-displayed.

[0069] In another aspect, the hydroxyapatite-binding peptide (HABP) is attached to extracellular vesicles (EVs) using a post-insertion method. The HABP, with the sequence CSVSVGMKPSPRP (SEQ ID NO: 1), is first conjugated to a lipid tail, specifically DSPE-PEG(2000)- maleimide, creating a peptide amphiphile. This amphiphilic molecule allows the lipid tail to insert into the lipid bilayer of the EV membrane. The process involves incubating the EVs with the DSPE-PEG- HABP conjugate (e.g., at 37°C), followed by sonication to facilitate proper integration of the peptide into the EV membrane. Once inserted, the HABP is displayed on the surface of the EVs, allowing the vesicles to bind specifically to hydroxyapatite in calcified tissues. This method enables the functionalization of EVs without altering their structural integrity, making them effective for targeted therapeutic delivery to calcified regions.(0070] In another aspect, the biological nanoparticle further comprises a targeting peptide 20, which includes a CCR2 binding motif of MCP-1. This allows for additional targeting of inflamed tissues that express CCR2 receptors, enabling the biological nanoparticle to address both vascular inflammation and calcification. In a refinement, the targeting peptide 20 includes a component selected from the group consisting of MCP-1 having a sequence having CYNFTNRKISVQRLASYRRITSSK (SEQ ID NO: 2), VLA-4 peptide having sequence CVHPKQHR (SEQ ID NO: 3), fibrin-targeting peptide sequence CREKA (SEQ ID NO: 4), collagenase-targeting peptide sequence CVPMSMRGG (SEQ ID NO: 5), or hydroxyapatite-targeting peptide CSVSVGMKPSPRP (SEQ ID NO: 1), as well as derivatives thereof. In a refinement, the targeting peptide includes a polypeptide having sequence YNFTNRKISVQRLASYRRITSSK (SEQ ID NO: 6) or a fragment thereof that binds to CCR2. These derivatives may include cysteine modifications or other functional changes on either peptide side to optimize binding properties for specific tissues.[00711 In another, to increase ExoMotif-miR-145 EV (miR-145 EV) localization to pathogenic synthetic VSMCs, can be functionalized the EV surface with an MCP-1 peptide having the following sequence YNFTNRKISVQRLASYRRITSSKC] (SEQ ID NO: 7).10072] In another aspect, a miR-145 containing the sense sequence 5'-GUCCAGUUUUCCCAGGAAUCCCU-3' (SEQ ID NO: 8) is provided.

[0073] Figures 1B-1E depict the Dicer-processed duplexes of miR-133a and miR-145 with 3' overhangs on both strands, the seed nucleotides (positions 2-8) indicated, and ExoMotif substitutionshighlighted outside the guide-strand seed to preserve target recognition: for miR-133a (WT) the mature guide and passenger strands are shown as AGCUGGUAAAAUGGAACCAAAUCG (SEQ ID NO: 9) and AUUUGGUCCCCUUCAACCAGCUGU(SEQ ID NO: 10), respectively, and for miR-133a (EXO: CGGGAG) as UCCCGGUAAAAUGGAACCAAAUCG (SEQ ID NO: 11) (guide) and AUUUGGUCCCCUUCAACCGGGAGU(SEQ ID NO: 12) (passenger) (FIGS. 1B-1C); for miR-145 (WT) the mature guide and passenger strands are GUCCAGUUUUCCCAGGAAUCCCUUA (SEQ ID NO: 13) andGGGAUUCCUGGAAAUACUGUUCUU (SEQ ID NO: 14), respectively, and for the miR-145 (EXO: GGAG) variant the strands are GUCCAGUUUUCCCGGGAGUCCCUUA (SEQ ID NO: 15) (guide) and GGACUCCCGGAAAUACUGUUCUU (SEQ ID NO: 16) (passenger) (FIGS. 1D-1E). These SEQ ID NO assignments correspond to the Sequence Listing incorporated by reference in this application and are provided for each strand separately, consistent with the duplex presentations in the figures.. As illustrated in FIGS. 1B-1E, these duplexes are the Dicer-processed products with 3' overhangs and seed nucleotides (positions 2-8) indicated; ExoMotif substitutions (e.g., CGGGAG in miR-133a, GGAG in miR-145) are positioned outside the guide-strand seed. The sequences of SEQ ID NOs: 11-12 (miR-133a EXO: CGGGAG) and SEQ ID NOs: 15-16 (miR-145 EXO: GGAG) exemplify the claimed “ExoMotif-modified microRNA loaded into extracellular vesicles,” supporting claims reciting ExoMotifs selected from CGGGAG, CAUG, UGUG, GGAG. These exemplifications align with the described methods of genetically engineering cells to endogenously load ExoMotif-modified microRNAs into EVs with enhanced cargo (e g., ~68x for miR-133; ~40 for miR-145) and with the claimed EV products further surface-functionalized with targeting peptides (e.g., HABP SEQ ID NO: 1, MCP-1 SEQ ID NO: 7) for delivery to calcified or inflamed vascular tissues

[0074] In yet another aspect, the microRNA 12 loaded into the extracellular vesicles 10 is configured to inhibit osteochondrogenic transformation of vascular smooth muscle cells (VSMCs), a critical process in vascular calcification. By preventing this transformation, the microRNA (e.g., miR- 133) promotes a contractile VSMC phenotype, reducing the progression of calcification. This makes the biological nanoparticle particularly effective for treating diseases characterized by calcification, such as atherosclerosis. In a refinement, the microRNA is configured to inhibit osteochondrogenic transformation of endothelial cells, macrophages, fibroblasts, stem cells, and / or T cells.

[0075] In another aspect, the biological nanoparticle is configured for treating calcified diseased tissues, with a specific focus on delivering the microRNA (e.g., miR-133) to calcified vascular regions. The targeted delivery reduces or prevents calcification progression while promoting healthier cellular behavior in affected tissues.[0076| In another aspect, the biological nanoparticle is particularly effective in treating vascular calcification in a subject by delivering the microRNA (e.g., miR-133) to calcified tissues. In a further refinement, the microRNA (e.g., miR-133) is delivered to reduce osteogenic processes in VSMCs, while simultaneously modulating inflammatory responses, providing a multifaceted approach to preventing the progression of vascular diseases such as atherosclerosis.

[0077] In another aspect, the extracellular vesicles 10 are produced by genetically engineered vascular smooth muscle cells (VSMCs) that have been modified to overexpress the microRNA 12 (e.g., miR-133) with ExoMotif sequences 14. This genetic modification ensures that the microRNA is selectively loaded into the extracellular vesicles 10, optimizing the delivery of the therapeutic miRNA to the targeted tissues. In a variation, the extracellular vesicles 10 are produced by one or more of genetically engineered Mesenchymal Stem Cells (MSCs), monocytes, macrophages, endothelial cells, or cells of the nephron including urinary stem cells, podocytes, cortical collecting duct, proximal tubule cells, or distal tubule cells.

[0078] In another aspect, each extracellular vesicle surface is further modified with a hydroxyapatite-binding peptide (HABP) 16 to specifically target calcified tissues. This surface modification enhances the delivery efficiency of the miRNA payload to calcified regions, improving the therapeutic effect of the nanoparticle.

[0079] In another aspect, the extracellular vesicles 10 are derived from a mammalian cell culture of genetically engineered vascular smooth muscle cells (VSMCs). These cells are cultivated under specific conditions that promote the production of extracellular vesicles with high loading efficiency of the microRNA 12 (e.g., miR-133) . In a refinement, the vesicles 10 have an average size range of 20-500 nm in diameter, which is optimized for tissue penetration and cellular uptake in calcified tissues.

[0080] In yet another aspect, the hydroxyapatite-binding peptide (HABP) 16 attached to the extracellular vesicles 10 provides specificity for calcified tissues, facilitating targeted delivery of themiRNA payload. This targeted delivery system is particularly useful for treating or preventing vascular calcification in therapeutic applications.

[0081] In another aspect, a pharmaceutical composition is provided, comprising the biological nanoparticle and a pharmaceutically acceptable carrier. This composition is specifically formulated for intravenous administration, allowing for efficient delivery of the extracellular vesicles 10 to the target tissues in the body. In a refinement, the pharmaceutical composition further includes genetically engineered cells with ExoMotif-modified microRNA sequences that produce EV nanoparticles.

[0082] In another aspect, a method of manufacturing extracellular vesicles 10 for targeted therapeutic delivery is provided. The method includes genetically engineering a vascular smooth muscle cell (VSMC) or other cell types to express the microRNA 12 (e.g., miR-133) modified with ExoMotif sequences 14, culturing the VSMCs or other cell types under conditions that promote the production and release of extracellular vesicles 10 into a culture medium, and isolating the extracellular vesicles 10 from the medium. Examples of other cell types include but are not limited to wherein the other cell types include endothelial cells, macrophages, fibroblasts, stem cells, or T cells. In a refinement, the method further includes modifying extracellular vesicle surfaces with targeting peptides (e.g., a hydroxyapatite-binding peptide (HABP)). In a refinement, the isolation step involves sequential centrifugation and filtration to ensure the purity and consistency of the vesicle population.

[0083] In another aspect, the surfaces of the extracellular vesicles 10 are modified using a chemical conjugation process to attach the hydroxyapatite-binding peptide (HABP) 16 to the vesicle surface. This surface modification ensures that the vesicles can efficiently bind to calcified tissues in vivo.10084] In one aspect, a method for treating vascular calcification in a subject is provided. The method includes administering a therapeutically effective amount of the extracellular vesicles 10 to the subject, wherein the vesicles deliver the microRNA 12 (e.g., miR-133) to calcified vascular tissues. This delivery inhibits osteochondrogenic transformation and reduces calcification processes, while promoting a contractile phenotype in vascular smooth muscle cells. In a refinement, the method includes monitoring the gene expression levels in the treated tissues to assess the efficacy of the treatment and make adjustments, as necessary. It should be appreciated that the drug delivery system can be administered intravenously, subcutaneously, orally, by intraperitoneal injection, andtransdermally, and the like, and combinations thereof.Additional details are provided in Patel, N., Avery, E., Huang, Y., & Chung, E. J. (2025). Developing therapeutically enhanced extracellular vesicles for atherosclerosis therapy. Advanced Healthcare Materials, 14 \SS), e2404398. https: / / doi.org / 10.1002 / adhm.202404398 and its related supplemental material and Patel N, LaMastro V, Giblin J, Avery E, Noor B, Magee G, Chung EJ. Genetically engineering cells to produce therapeutically boosted extracellular vesicles for cardiovascular calcification. Biomaterials. 2026 Feb;325: 123552. doi: 10.1016 / j.biomaterials.2025.123552. Epub 2025 Jul 14. PMID: 40682948 and related supplemental material; the entire disclosures of which are hereby incorporated by reference.[0085| The following examples illustrate the various embodiments of the present invention. Those skilled in the art will recognize many variations that are within the spirit of the present invention and scope of the claims.|0086J 1. Genetically engineering cells to produce therapeutically boosted extracellular vesicles for cardiovascular disease[0087| To address the challenges of limited yield and RNA degradation associated with exogenous loading methods, as well as the limited loading by endogenous methods, we capitalize on a recent discovery in EV biology regarding ExoMotifs. ExoMotifs are 4-8 nucleotide motifs in miRNAs that direct loading of the ExoMotif-tagged miR into EVs by binding to RNA binding proteins involved in the endosomal sorting complex required for transport (ESCRT) EV biogenesis pathway

[0026] , Genetically engineering cells with ExoMotif-modified miR sequences allows for the creation of a stable cell line producing EVs with significantly enriched (~40- 100-fold greater) therapeutic miRs.[0088| Herein, we engineer miR-133 with the ExoMotif (“CGGGAG”) to generate genetically engineered VSMCs to selectively load miR-133 into EVs and functionalize the EV surface with a hydroxyapatite-binding peptide (HABP) for targeted delivery to osteochondrogenic VSMCs. We evaluate the efficacy of our HABP-miR-133-EVs to inhibit vascular calcification by inhibiting osteochondrogenic VSMCs in vitro and in vivo w ' . an ApoE knockout murine model [27,28], Together, we report on the translation of a novel EV engineering method towards treating vascular calcification and late-stage atherosclerosis. We demonstrate the viability of genetically engineering cells with miR sequences modified with ExoMotifs to produce therapeutic EVs that can be utilized for chronic diseases.

[0089] 1.2. Methods and materials

[0090] 1.2.1. Cell culture

[0091] The use of human tissues in this study was approved by the Institutional Biosafety Committee (IBC #BUA- 16-00057) and Institutional Review Board (IRB #HS-18-00638, BUA-18- 0031) at the University of Southern California (USC). Informed consent was obtained from patients for collection of tissue discarded during the normal course of their operation. Healthy segments from the carotid arteries (N = 3) and severely calcified diseased segments from the pulmonary artery, tibial artery, and peroneal artery (N = 4) were collected for whole tissue PCR. Healthy segments of the pulmonary artery, aorta, and carotid artery (N = 6) and severely calcified diseased segments from the coronary artery, tibial artery, subclavian artery, and femoral artery (N = 6) were collected for patient- derived human vascular smooth muscle cell (HASMC) isolation. Tissue samples were stored in Hank's balanced salt solution (HBSS) for no longer than 16 h prior to HASMC harvest and cell culture.

[0092] The VSMC harvest and cell culture procedure was adapted from a previous report

[0029] , Briefly, tissue samples were washed and rinsed three times with HBSS before the endothelium and adventitia were removed. The medial layer was sectioned into 1-2 mm2explants and digested with 0.25 % collagenase type II and 0.5 % elastase type II for 16 h at 37 °C. The explant solution was centrifuged at 1500 rpm for 10 min, and the pelleted VSMCs were collected and incubated in 2 mb Dulbecco's Modified Eagle Medium (DMEM; Gibco, Waltham, MA) supplemented with 10 % fetal bovine serum (FBS; Gibco, Waltham, MA) and 1 % penicillin / streptomycin (Gibco, Waltham, MA) at 37 °C for a week or until 70 % confluent. Cells from passage 2 to 7 were used for all experiments.

[0093] Mouse Aortic Smooth Muscle Cells (MOVAS; passage 4-8; ATCC, Manassas, VA) and patient-derived healthy and diseased HASMCs were cultured in DMEM with 10 % FBS, 1 mmol / L sodium pyruvate, and 4.5 g / L d-glucose or VSMC supplement (ATCC, Manassas, VA). Cells were cultured on 182.5 cm2flasks until ~70 % confluent and washed with phosphate buffered saline (PBS; pH 7.4). Cell media was replaced with EV isolation media, which consisted of DMEM, 10 % ExoFree FBS (Gibco, Waltham, MA), 1 mmol / L sodium pyruvate, and 4.5 g / L d-glucose. After 48 h, EV-containing media (EV-CM) was collected.

[0094] 1.2.2. Calcifying cell culture

[0095] MOVAS cells were cultured in DMEM with 10 % ExoFree FBS. Cells were grown to confluence, then introduced to osteogenic media containing 2.5 mM calcium chloride and 2.7 mM sodium phosphate (Sigma- Aldrich, St Louis, MO)

[0030] , Cells were cultured in osteogenic media for 10 days, and the media was changed every 2-3 days.[0096| 1.2.3. ExoMotif modification and transduction[0097[ The mature miR-133 sequence was modified to include the ExoMotif “CGGGAG”, while maintaining the same pre-miRNA stem loop structure as the wild type (WT) sequence, as predicted by RNAfold Webserver (University of Vienna). Sequences for 150 base pairs upstream and downstream of the pre-miR-133-ExoMotif and pre-miR 145-ExoMotif sequences were obtained from the Ensembl database and synthesized by System Biosciences (Palo Alto, CA). The sequences were cloned into a lentiviral vector containing puromycin resistance cassettes (CD513-A, System Biosciences, Palo Alto, CA). 293FT packaging cells (ThermoFisher, Waltham, MA) were transfected with these plasmids, and the lentivirus released were concentrated to a viral titer of 1 x 107IFUs / mL. Lentiviruses were applied to MOVAS cells. Plasmid expressing cells were selected after 5 days by puromycin resistance.[0998[ 1.2.4. EV isolation[0099| Cells, cellular debris, and large vesicles (>1000 nm) were removed from EV-CM through sequential centrifugation at 1000 g and 10,000 g. EV-CM was then filtered through 0.22 pm PES syringe filters (Millipore Sigma, Burlington, MA). The filtered EV-CM was concentrated with an Amicon Ultra- 15 10 kDa MWCO centrifuge filter (Millipore Sigma, Burlington, MA) from 15 mL EV-CM to ~250 pL, yielding a concentrated EV-CM. qEV 2 mL / 35 nm size exclusion chromatography (SEC) columns (Izon, Irvine, CA) were equilibrated with 50 mL of PBS (pH 7.4) at 4 °C. After flow through, 2 mL of concentrated EV-CM was overlaid on the column followed by elution with 50 mL PBS. A flow through void volume of 14 mL was discarded, per manufacturer's instructions, and 5 EV-containing 2 mL fractions were collected and pooled. The pooled fractions were then concentration from 10 mL to ~100-150 pL using an Amicon Ultra-15 10 kDa MWCOcentrifuge filter, yielding a final EV isolate. EV isolate was aliquoted and stored at -80 °C for further characterization and use.

[0100] 1.2.5. WT- and ExoMotif-miR-133 mimic transfection

[0101] WT- and ExoMotif-miR-133 oligonucleotide mimics were transfected into osteochondrogenic MOVAS cells using Lipofectamine RNAiMax (ThermoFisher, Waltham, MA), according to the manufacturer's protocol. Briefly, osteochondrogenic VSMCs were cultured in 6-well plates. WT-miR-133 and ExoMotif-miR-133 mimics (100 pmol; Integrated DNA Technologies, Coralville, IA) were diluted in 500 pL Opti-Mem serum free media (ThermoFisher, Waltham, MA). 10 pL of Lipofectamine RNAiMax was added to miRNA solution and incubated for 30 min. siRNA- Lipofectamine complex was added to washed cells and incubated for 48 h. WT- and ExoMotif-miR- 133 oligonucleotide mimics were also loaded into MOVAS EVs using the ExoFect transfection kit (Systems Biosciences, Palo Alto, CA), based on the manufacturer's protocol. Briefly, 1 x 108EVs in 50 pL of PBS were added to 50 pL of ExoFect reagent and 50 pL of WT- and ExoMotif-miR-133 (100 pmol), then incubated for 30 min at 37 °C. miR-133 mimic-loaded EVs were isolated using SEC. WT- and ExoMotif-miR-133 mimic-loaded EVs and MOVAS-EVs (1 x 108EVs) were then added to washed cells and incubated for 24 h. Cell RNA was isolated via Trizol (Invitrogen, Carlsbad, CA), and cDNA was synthesized using the RT2First Strand Kit (Qiagen, Hilden, Germany) based on the manufacturer's instructions. ACTA2 (alpha smooth muscle actin), CNN1 (calponin), MGP (matrix Gia protein), OSX (osterix), RUNX2 (runt related transcription factor 2), and BMP2 (bone morphogenic protein 2) expressions were determined by real time-PCR using RT2SYBR Green qPCR Mastermix (Qiagen, Hilden, Germany) on a CFX384 (Bio-Rad Laboratories, Hercules, CA). GAPDH was used as an internal control. The 2CT method was used to quantify mRNA expression.

[0102] 1.2.6. TEM imaging

[0103] 10 pL of concentrated EV isolate was fixed with an equal volume of 1 % paraformaldehyde (PF A) for 30 min (final PFA concentration = 0.5 %). 10 pL of the fixed EVs were then pipetted onto a carbon / copper grids (Ted Pella, Redding, CA) and incubated for 10 min. The grid was washed with Milli-Q water and stained with 10 pL of 2 wt% uranyl acetate (5). Dried samples were imaged on a JEM 2100-F (JEOL Ltd., Tokyo, Japan).

[0104] 1.2.7. NTA analysis

[0105] EV size distribution and concentration were determined using Nanoparticle Tracking Analysis (NTA) with the NanoSight NS300 (Malvern Technologies, Malvern, UK). Samples were diluted 1 : 1000 in particle-free PBS to a concentration of approximately 1 x 108EV / mL. Samples were then analyzed with 5 60-sec videos under continuous flow conditions (flow rate: 30 pL / min; temp = 25 °C) with a camera level of 10. Data analysis was performed with the NTA 3.1.54 software with a detection threshold of 4.

[0106] 1.2.8. EV lysis and protein quantification

[0107] EV protein concentration was determined using a bicinchoninic acid assay (Pierce BCAProtein Assay Kit, ThermoFisher, Waltham, MA). Briefly, 10 pL of Lysis Buffer (1 RIPA Buffer (ThermoFisher, Waltham, MA), 1 Complete Protease Inhibitor (Roche, Basel, Switzerland) and 1 mM dithiothreitol (Sigma Aldrich, St. Louis, MO)) was added to 100 pL of concentrated EV isolate, incubated on ice for 30 min, then sonicated for 1 min. Lysed EVs were diluted 1 :5 in PBS and 25 pL were added to a 96-well plate followed by 200 pL of the BCA reagent. The plate was incubated in the dark at 37 °C for 30 min and absorbance was measured at 580 nm. Protein concentration was determined using a BCA standard curve.[0108| 1.2.9. EV miR quantification[0109| EV miR was isolated via the miRNEASY micro kit (Qiagen, Hilden, Germany), according to the manufacturer's instructions. cDNA was synthesized using RT2miR First Strand Kit (Qiagen, Hilden, Germany), according to manufacturer's instructions. miR-133, miR-133-ExoMotif, miR-145, and miR-21 expressions were determined by real time-PCR using SYBR Green qPCR Mastermix (Qiagen, Hilden, Germany) on a CFX384 (Bio-Rad Laboratories, Hercules, CA).

[0110] 1.2.10. Gel electrophoresis and Western blot[0111[ 20 pg of EV protein was mixed with 4 Laemmli Sample Buffer (Bio-Rad Laboratories,Hercules, CA) and heated at 80 °C for 15 min. Proteins were then separated by gel electrophoresis using a 4-15 % Mini -PROTEAN TGX precast gel (Bio-Rad Laboratories, Hercules, CA). Gels wererun using Tris / Glycine / sodium dodecyl sulfate (SDS) running buffer (25 mM Tris, 192 mM glycine, 0.1 % SDS, pH 8.3) at 150 V for 60 min. Proteins were then transferred to a 0.2 pm PVDF membrane (Bio-Rad Laboratories, Hercules, CA) using a mini -Protean II blotting system at constant 100 V for 60 min. The PVDF membranes were then blocked for 1 h at room temperature using blocking solution (TBS, 0.1 % Tween-20, and 5 % bovine serum albumin; Sigma Aldrich, St. Louis, MO). The membrane was washed three times with TBS, and proteins were detected by incubation with the primary antibodies CD9 (Invitrogen, Carlsbad, CA), CD63 (ThermoFisher, Waltham, MA), TSG101 (Invitrogen, Carlsbad, CA), and calnexin (ThermoFisher, Waltham, MA) diluted 1 : 1000 in blocking solution overnight at 4 °C. Membranes were then washed three times with 0.1 % Tween-20 TBS and incubated with the secondary antibody Goat Anti-Rabbit IgG H&L (HRP; Abeam, Cambridge, UK) diluted 1 :2000 in blocking solution for 1 h at room temperature. After secondary incubation, the membrane was washed three times with 0.1 % Tween-20 TBS followed by a wash with TBS. Pierce CN / DAB HRP substrate (ThermoFisher, Waltham, MA) was added to the membrane and the membrane was imaged using chemiluminescence with the Bio-Rad Chemidoc XRS system (Bio-Rad, Hercules, CA).

[0112] 1.2.11. Alyref and Fus knockdown

[0113] Alyref and Fus siRNA mediated knockdown was then performed using transfection with Lipofectamine RNAiMax (ThermoFisher, Waltham, MA), according to the manufacturer's instructions. Briefly, WT- and ExoMotif-miR-133 cells were cultured to 70 % confluency in 6-well plates. Alyref siRNA (lOO pmol, Integrated DNA Technologies, Coralville, IA) or Fus siRNA (50 pmol, Integrated DNA Technologies, Coralville, IA) was diluted in 500 pL Opti-Mem serum free media (ThermoFisher, Waltham, MA). 10 pL of Lipofectamine RNAiMax was added to siRNA solution and incubated for 30 min. siRNA-Lipofectamine complex was added to washed cells and incubated for 24 h. Media was collected after 48 h for EV isolation and characterization. Cell RNA was isolated via Trizol (Invitrogen, Carlsbad, CA), and cDNA was synthesized using the RT2First Strand Kit (Qiagen, Hilden, Germany) based on the manufacturer's instructions. Alyref and Fus expressions after 48 h were determined by real time-PCR using RT2SYBR Green qPCR Mastermix (Qiagen, Hilden, Germany) on a CFX384 (Bio-Rad Laboratories, Hercules, CA). GAPDH was used as an internal control. The 2CT method was used to quantify mRNA expression.[IM 1 ] 1.2.12. DSPE-PEG-HABP synthesis

[0115] HABP (CSVSVGMKPSPRP (SEQ ID NO: 1)) was synthesized using standard 9- fluorenylmethoxycarbonyl (Fmoc)-mediated solid phase peptide synthesis on an automatic PS3 benchtop peptide synthesizer (Protein Technologies, Tucson, AZ)

[0029] , The cysteine residue at the N- terminus was used for thioether linkage. The peptides were N-capped with an acetyl group and cleaved from the rink amide resin using trifluoroacetic acid, 1,2-ethanedithiol, water, and triisopropylsilane in a 94:2.5:2.5: 1 vol ratio. Cleaved peptides were precipitated and washed several times with ice cold diethyl ether, subsequently dissolved in Milli-Q water, and lyophilized. Lyophilized peptides were stored at -20 °C until purification using reverse-phase high performance liquid chromatography (HPLC; Shimadzu, Kyoto, Japan). Crude peptides were purified using a C8 column at 55 °C using 0.1 % formic acid in an acetonitrile / water mixture. Purified samples were characterized and verified using Matrix Assisted Laser Desorption / Ionization-Time of Flight (MALDLTOF) mass spectral analysis (Bruker, Billerica, MA). Pure peptides were conjugated to create amphiphiles via a thioether linkage to l,2-distearoyl-sz7-glycero-3-phosphoethanolamine-N-[maleimide(polyethylene glycol)- 2000], or DSPE-PEG(2000)-maleimide (Nanocs, New York, NY). Briefly, a 10 % molar excess of the peptide was added to lipid solution in water. The pH of the mixture was adjusted to 7 and the solution was left to react at room temperature for 24 h with constant agitation until purification using a C4 column (Phenomenex, Torrance, CA) and verification using MALDLTOF. Fluorescent amphiphiles were also synthesized using FITC (DSPE-PEG-FITC, Nanocs, New York, NY), as described above.

[0116] 1.2.13. EV surface modification and fluorescence labeling[0117| 1010EV / mL were incubated with varying concentrations (0.1, 0.25, 0.5, 1.0 mg / mL) of amphiphile (DSPE-PEG-FITC or DSPE-PEG-HABP) in PBS. The EV amphiphile solution was sonicated for 30 s followed by 1 min rest at 37 °C. This process was repeated for a total of three times, followed by a 1 h incubation at 37 °C. Following EV modification, free amphiphiles were removed via gravity driven SEC (Izon Scientific, Irvine, CA).

[0118] 1.2.14. EV binding to HA crystals

[0119] DiO-labeled HABP-EVs or MOVAS-EVs (l x lO9EV / mL) were synthesized and incubated with 10 mg of HA microcrystals (Sigma-Aldrich, St. Louis, MO) at room temperature in PBS for 30 min with constant agitation to facilitate binding. The amount of EVs bound was determined by measuring the amount of unbound EVs through fluorescence readings and comparing with a standard curve (N = 5). To further verify HABP-EV binding to HA microcrystals, EV-bound HA microcrystals were imaged under a Leica DMi8 fluorescence microscope (Leica, Wetzlar, Germany; N = 5).

[0120] 1.2.15. In vitro internalization and EV endosomal escape

[0121] To track cargo release, Cy5-labeled miR-133 (Integrated DNA Technologies,Coralville, IA) was loaded into EVs using ExoFect reagent (Systems Biosciences, Palo Alto, CA), following the manufacturer's protocol. Briefly, 50 pg of EVs were incubated with 10 pM of Cy5-miR- 133 and ExoFect in a final volume of 200 pL at 37 °C for 1 h. Following incubation, unincorporated Cy5-miR-133 was removed using a 100 kDa MWCO Amicon Ultra centrifugal filter. Loading efficiency was determined by measuring Cy5 fluorescence in the EV suspension relative to the initial input mass of Cy5-miR-133.

[0122] To evaluate the delivery of EV-loaded miR-133 to recipient cells, MOVAS cells were incubated with Cy5-miR- 133 -loaded EVs in the presence of LysoTracker Green. Fluorescent microscopy was performed at 30 min, 1 h, 2 h, and 4 h post-incubation to assess intracellular uptake and localization of Cy5-miR-133 using a Leica DMi8 fluorescence microscope (Leica, Wetzlar, Germany; N = 3).

[0123] 1.2.16. In vitro biocompatibility

[0124] EV biocompatibility was assessed with MOVAS cells using a 3-(4,5-dimethylthiazol- 2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) cell proliferation assay (Biovision, Milpitas, CA). Briefly, cells were incubated with HABP-miR-133-EVs, MOVAS-EVs (1 x 10s 10EV / mL), or PBS for 24 h. Then, EV treatment was removed and MOVAS cells were incubated with media containing 10 % MTS reagent for 1 h at 37 °C. The absorbance was measuredusing a plate reader at 490 nm (N = 5), and cell viability was calculated by normalizing to the PBS control .

[0125] 1.2.17. In vitro cellular calcification binding assays

[0126] MOVAS cells were calcified for 10 days and binding of HABP-EVs and MOVAS-EVs was assessed. EV binding was determined indirectly by measuring the amount of unbound EVs. DiO- labeled EVs (1 x 109EV / mL) were incubated with calcified MOVAS cells at 37 °C for 1 h. EVs were then removed and DiO fluorescence at 490 / 525 nm was measured using a Varioskan LUX plate reader (ThermoFisher, Waltham, MA; N = 5). In addition, EV binding to calcifications was confirmed through fluorescence microscopy. After EV removal, cells grown in osteogenic or growth media for 10 days were fixed in 4 % PF A, stained for calcification using 0.00005 % alizarin red staining (ARS), and imaged on a Leica DMi8 fluorescence microscope (Leica, Wetzlar, Germany). 4',6-diamidino-2- phenylindole (DAPI) was used to stain nuclei.

[0127] 1.2.18. In vivo HA binding[0128| Female, nine-month-old ApoE mice (Jackson Laboratory, Bar Harbor, ME) were fed a Western diet for 10 weeks (Envigo, Huntingdon, UK). Mice were injected with HABP-EVs, NT- EVs, MOVAS-EVs (N = 6; l x lO9EV / g bodyweight), or 100 pM OsteoSense (Revvity Health Sciences, Waltham, MA). Mice were then euthanized 24 h after injection and the aorta and organs, including the heart, lungs, liver, kidneys, spleen, stomach, and intestine, were harvested. Ex vivo imaging was conducted using Ami HTX (Spectral Instruments Imaging, Tucson, AZ) and fluorescence was analyzed to determine EV biodistribution. Harvested tissues were embedded in Optimal Cutting Temperature (OCT, Leica, Wetzlar, Germany) compound, flash frozen in 2- methylbutane and liquid nitrogen, and sectioned using a Leica CM3050S cryostat (10 pm thickness; Leica, Wetzlar, Germany). Tissue sections were then stained with von Kossa stain and ARS, mounted, and imaged using a fluorescence microscope (Leica DMi8; Leica, Wetzlar, Germany). All mice experiments were approved by and performed in compliance with the USC Institutional Animal Care and Use Committee (IACUC).

[0129] 1.2.19. In vitro calcification treatment

[0130] Confluent MOVAS cells were treated with MOVAS-EVs, free miR-133, NT-miR- 133- EVs, and HABP-miR-133-EVs, or PBS at an EV dose of 1 x 109EV / mL. During dosing, osteogenic media was replaced with serum free DMEM and cells were incubated with EVs for 4 h, followed by a PBS wash and media change. Cells were dosed on day 3, 5, 7 and 9 during incubation in osteogenic media conditions. Cellular calcification was quantified via ARS dye extraction by incubating the cells with 10 % acetic acid (Sigma Aldrich, St. Louis, MO) for 30 min with constant agitation. Cells and calcium deposits were then collected, heated to 85 °C for 10 min, and centrifuged at 20000 g for 15 min. The supernatant containing the extracted ARS dye was collected and absorbance was measured at 405 nm using a Varioskan LUX microplate reader (ThermoFisher, Waltham, MA; N = 5).[0131| To compare the anti-calcifying effects of miR-133 and miR-67 (a non-therapeutic control), ExoMotif-miR-133 and miR-67 oligonucleotide mimics (Integrated DNA Technologies, Coralville, IA) were transfected into osteochondrogenic MOVAS cells using Lipofectamine RNAiMax (ThermoFisher, Waltham, MA), according to the manufacturer's protocol. Briefly, osteochondrogenic VSMCs were cultured in 12-well plates. miR-67 and ExoMotif-miR-133 mimics (200 pmol) were diluted in 500 pL Opti-Mem serum free media (ThermoFisher, Waltham, MA). 10 pL of Lipofectamine RNAiMax was added to miRNA solution and incubated for 30 min. miRNA- Lipofectamine complex was added to washed cells and incubated for 72 h. Calcification was quantified using ARS, as described above.

[0132] 1.2.20. ALP activity

[0133] Cellular calcification was determined by measuring alkaline phosphatase (ALP) enzyme activity. Briefly, calcifying cells were lysed using 0.2 % Triton X-100, 3 mM sodium bicarbonate, and 150 mM sodium chloride (Sigma-Aldrich, St Louis, MO). i-Nitrophenyl phosphate (10 mM; Sigma Aldrich, St. Louis, MO) was added to lysed cells and incubated at 37 °C for 10 min. Phosphatase activity was stopped with 0.1 M sodium hydroxide (Sigma Aldrich, St. Louis, MO). Cells and substrate solution were collected and centrifuged at 16000 g for 10 min. Absorbance of the supernatant was measured at 405 nm using a microplate reader (N = 5). Enzyme activity was calculated using Equation (1), where A is the amount of / ?-nitrophenol produced, V is the volume, and T is the reaction time.

[0134] 1.2.21. In vitro mRNA expression after treatment[0135| MOVAS cells, incubated for 7 days in osteogenic media, were incubated with EVs or PBS at a concentration of 1 x 109EV / mL in serum free media. Following the 4 h incubation period, the media was replaced with DMEM for 20 h (N = 5). RNA was isolated via Trizol (Invitrogen, Carlsbad, CA), and cDNA was synthesized using the RT2First Strand Kit (Qiagen, Hilden, Germany) based on the manufacturer's instructions. MYOCD, ACTA2, CNN1, MGP, OSX, RUNX2, and BMP2 expressions were determined by real time-PCR using RT2SYBR Green qPCR Mastermix (Qiagen, Hilden, Germany) on a CFX384 (Bio-Rad Laboratories, Hercules, CA). GAPDH was used as an internal control. The 2AAtr method was used to quantify mRNA expression.

[0136] 1.2.22. In vivo treatment

[0137] Female, nine-month-old ApoELmice (Jackson Laboratory, Bar Harbor, ME) were fed a Western diet for 10 weeks (Envigo, Huntingdon, UK). Mice were injected with HABP-miR-133- EVs, MOVAS-EVs (N = 6; l x 109EV / g bodyweight), free miR-133 (1 mg / kg bodyweight), or PBS weekly for 10 weeks. Mice were then euthanized on Week 11 and the aorta and organs, including the heart, lungs, liver, kidneys, spleen, stomach, and intestines, were harvested. Harvested tissues were embedded in OCT compound, flash frozen in 2-methylbutane and liquid nitrogen, and sectioned using a Leica CM3050S cryostat (10 pm thickness; Leica, Wetzlar, Germany). Tissue sections were stained with hematoxylin and eosin (H&E), ARS, and von Kossa, mounted, and imaged using a fluorescence microscope (Leica DMi8; Leica, Wetzlar, Germany).

[0138] 1.2.23. Whole tissue gene expression

[0139] Mouse abdominal aorta and renal bifurcation was harvested, weighed, and lysed with Trizol (Invitrogen, Carlsbad, CA). For patient-derived tissue, the tissue was cleaned in PBS, weighed, and lysed with Trizol. miR and mRNA was extracted from tissue by miRNeasy Mini Kit (Qiagen, Hilden, Germany) and linearly amplified with RT2miR First Strand Kit (Qiagen, Hilden, Germany), according to manufacturer's instructions. Real-time PCR was conducted on a CFX384 (Bio-RadLaboratories, Hercules, CA) to evaluate tissue miR-133, ACTA2, MGP, OSX, RUNX2, and BMP2. GAPDH or RNU6 was used as an internal loading control. The 2Cmethod was used to calculate relative expression changes.

[0140] 1.2.24. Immunohistochemistry

[0141] Aortic roots were sectioned and fixed in acetone. Sections were permeabilized with TBS buffer containing 0.1 % Tween-20 (TBST) and Triton-X. Then, sections were blocked with TBST containing 5 % bovine serum albumin for 1 h at room temperature. Sections were washed three times with TBST, and proteins were detected using either the primary antibody for RUNX2 (EPR14334; Abeam, Cambridge, UK) or ACTA2 (EPR5368; Abeam, Cambridge, UK) diluted in TBST 1 :200. The sections were incubated at 4 °C overnight, then washed with TBST three times. The secondary antibody goat anti-rabbit IgG H&L Alexa Fluor 594 (Abeam, Cambridge, UK) was diluted 1 : 1000, added to each section, and incubated for 1 h at room temperature. Sections were washed with TBST three times, then with TBS without Tween-20 twice. Sections were mounted on coverslips and stored at 4 °C until imaging using a fluorescence microscope (Leica DMi8; Leica, Wetzlar, Germany).

[0142] 1.2.25. In vivo evaluation of biocompatibility and toxicity

[0143] Blood urea nitrogen (BUN; Bioo Scientific, Austin, TX) and serum creatinine (Crystal Chem, Elk Grove Village, IL) levels were measured in mouse serum following manufacturer's protocols to assess renal toxicity. Alanine transaminase (ALT; Sigma Aldrich, St Louis, MO) and aspartate transferase (AST; Sigma Aldrich, St Louis, MO) activity was measured in mouse serum following manufacturer's protocol to assess liver health. Serum D-dimer levels were measured using an enzyme-linked immunosorbent assay (ELISA; LS Bio, Lynwood, WA), following the manufacturer's instructions.

[0144] 1.2.26. Statistical analysis[0145| Results are presented as mean ± standard deviation (S.D.). A two-tailed Student / -tests was used to determine statistical significance between two groups, while a one-way analysis of variance (ANOVA) was used to determine statistical significance between more than two groups. Ap-value <0.05 was considered statistically significant. All statistical analyses were conducted using GraphPad Prism 8 (GraphPad Software, San Diego, CA).

[0146] 1.3. Results

[0147] 1.3.1. miR-133 is downregulated in calcified vasculature

[0148] Vascular calcification is mediated by the pathogenic differentiation of synthetic VSMCs into osteochondrogenic-like cells (Fig. 2A)

[0031] , As this process is homologous to the differentiation of mesenchymal stem cells into osteoblasts and involves the same pro-osteogenic transcription factors, we identified five potential miR candidates that were significantly downregulated during the osteoblast transition: miR-133, miR-23, rniR-30, miR-205, and miR-338 [

[0031] ,

[0032] ,

[0033] ]. We performed gene ontological (GO) analysis on the top 250 miRNA gene targets for each miR, as predicted from miR-TarBase and TargetScan. GO analysis revealed that only miR-133 was involved in biological pathways related to osteoblast differentiation, bone formation, and regulation of VSMCs and vasculature (Fig. 2B). To further confirm miR-133 downregulation during vascular calcification, whole tissue PCR was performed on patient arteries with severe calcification (Fig. 2C and D). miR- 133 in calcified vessels had significantly decreased expression relative to the healthy patient vessels (Fig. 2D). Conversely, expression of the osteoblast transcription factors RUNX2 and BMP2 was significantly increased by 1.84 ± 0.45 and 2.13 ± 0.50 fold, respectively (Fig. 2E)

[0034] , Additionally, we evaluated miR-133 content in EVs released from osteogenic patient-derived HASMCs compared to healthy patient HASMCs. miR-133 cargo in EVs released from calcified cells was decreased to 0.10 ± 0.07-fold compared to EVs released from healthy HASMCs (Fig. 2F).

[0149] 1.3.2. Generating miR-133 boosted EVs using miR ExoMotif modification

[0150] Drawing from our finding that miR-133 was present at a greater level in EVs from healthy HASMCs compared to those from osteogenic HASMCs, we initially hypothesized that treatment with healthy EVs would ameliorate calcification deposition and promote the contractile VSMC phenotype. To test this hypothesis, we treated osteochondrogenic MOVAS cells with healthy EVs derived from the same cell source; this showed a modest effect in reducing calcification deposition (~15 % reduction) at the highest doses that did not compromise biocompatibility(1 x IO10EV / mL and 1 x IO11EV / mL). Similarly, evaluating the gene expression after EV treatment showed only a small reduction in osteochondrogenic markers and a modest effect in increasing contractile markers.Thus, in order to boost the therapeutic effect of the contractile EVs, we genetically engineered MOVAS cells using lentiviral transduction to express miR-133 modified with an ExoMotif. First, we modified the wild type pre-miR-133 sequence (WT-miR-133) in the mature miR strand with a “CGGGAG” ExoMotif (miR- 133 -ExoMotif), which has been shown to bind to Fus and Alyref proteins involved in RNA binding and sorting during EV biogenesis (Fig. 3A). In silico modeling of RNA structure was performed to ensure that ExoMotif modifications did not affect the hairpin loop structure of the pre-miR sequence (Fig. 3A). Additionally, we evaluated whether the ExoMotif modification would alter the function of miR-133 once delivered to the cell. We first transfected osteochondrogenic MOVAS cells with WT-miR-133 and ExoMotif-miR-133 mimics (100 pmol) with Lipofectamine and evaluated gene expression. No significant differences were shown between WT- and ExoMotif-miR-133 expression at downregulating expression of the osteochondrogenic markers RUNX2, BMP2, and OSX. Moreover, we loaded WT- and ExoMotif- miR-133 mimics (100 pmol) into MOVAS-EVs using ExoFect transfection and treated osteochondrogenic MOVAS cells. We found that both WT- and ExoMotif-miR-133-loaded EVs significantly upregulated contractile markers ACTA2 and CNN1 and downregulated osteochondrogenic markers RUNX2, BMP2, and OSX. Thus, the ExoMotif-modification did not alter the function of miR-133 after delivery to the target cell.

[0152] Then, to develop cells which would endogenously load EVs with miR-133, we transduced MOVAS cells with either the miR- 133 -ExoMotif sequence or the WT sequence as a control to evaluate the effect of the ExoMotif modification on miR-133 loading into EVs. To ensure miR-133 lentiviral transduction of the cell would not alter the physical characteristics of the secreted EVs, EVs were isolated using SEC from ExoMotif-miR-133, WT-miR-133, or unmodified MOVAS cells. EVs were found to be ~ 130-160 nm in diameter and morphological characterization showed the expected cup-shaped EV structure by NTA and TEM, respectively (Fig. 3B and C)

[0035] , Western blot analysis confirmed the presence of EV-specific markers CD9, CD63, and TSG101 in EVs isolated from the transduced and unmodified MOVAS cells (Fig. 3D). Lastly, the zeta potential of the EVgroups was found to be negatively charged (~-30 mV; Fig. 3E). Thus, transduction of the cell did not alter the physical characteristics of the EVs released from the cell.

[0153] Next, we evaluated miR-133 expression within the cell and EVs after transduction. qRT-PCR analysis confirmed successful transduction of the MOVAS cells; miR-133 expression was upregulated for the ExoMotif-miR-133 (26.6 ± 2.8-fold) and the WT-miR-133 cells (33.7 ± 3.4-fold) compared to the unmodified MOVAS cells (Fig. 3F). For the EVs, ExoMotif-miR-133-EVs had 67.7 ± 9.7-fold greater miR-133 cargo compared to unmodified MOVAS-EVs, while WT-miR-133- EVs had a 27.8 ± 5.6-fold increase in miR-133 content (Fig. 3G). Furthermore, we confirmed that the knockdown of two proteins involved in ExoMotif-mediated sorting of miRs, Alyref and Fus, decreased ExoMotif-miR-133 loading into EVs [36,37], Upon siRNA knockdown, EVs collected from ExoMotif-miR-133 cells had significantly decreased miR-133 cargo (Fig. 3H). Conversely, knockdown of Alyref in WT-miR-133 cells did not significantly decrease miR-133 loading, while knockdown of Fus in WT-miR-133 cells had a slight decrease in miR-133 cargo (Fig. 3H). Thus, lentiviral transduction of ExoMotif-modified miR-133 leads to ~68-fold greater endogenous miR cargo loading compared to the unmodified EVs, and that ExoMotif-miR loading was dependent on Alyref and Fus proteins.

[0154] Interestingly, transduction of both the ExoMotif- and WT-miR-133 boosted the loading of other atheroprotective miRs, including miR-145 and miR-21, into EVs (Fig. 31 and J). qRT-PCR of the transduced cells showed increased expression of both miR-145 and miR-21, as well as increased expression of the contractile VSMC markers MYOCD, ACTA2, and MGP. Furthermore, EV loading of MGP, an inhibitor of vascular calcification, was significantly increased compared to EVs from unmodified healthy and osteochondrogenic MOVAS cells (Fig. 3K) [

[0038] ,

[0039] ,

[0040] ]. Collectively, these results demonstrate the feasibility of engineering cells to produce EVs containing both anticalcifying and atheroprotective cargo.

[0155] 1.3.3. Surface modification of EVs with hydroxyapatite binding peptide facilitates calcification binding

[0156] To increase the accumulation of the miR-133-loaded-EVs at sites of vascular calcification, EVs were functionalized with a HABP. The HABP was previously discovered via phagedisplay and has been shown to bind in vivo o calcifications composed mainly of HA [29,41,42]. Additionally, osteochondrogenic VSMCs have been shown to secrete HA onto the cell surface

[0043] , First, HABP was conjugated to a lipid tail (DSPE-PEG2ooo-maleimide) to create peptide amphiphiles and post-inserted into the EV lipid bilayer (Fig. 4A). Multiple concentrations of DSPE-PEG-HABP (0.1, 0.25, 0.5 mg / mL) were tested to modify the EVs to maximize binding to HA. DiO-labeled HABP- EVs were then incubated with HA particles for 30 min, and binding was evaluated. EVs modified with 0.25 mg / mL of DSPE-PEG-HABP exhibited the greatest binding with 65.1 ± 4.2 % of HABP-EVs bound to HA particles (Fig. 4B). Furthermore, quantifying total EV amphiphile insertion with DSPE- PEG-FITC showed a plateau in amphiphile copies per EV at ~60 copies at concentrations 0.25 mg / mL. Thus, all EVs were modified with 0.25 mg / mL DSPE-PEG-HABP for further experiments.

[0157] Next, we evaluated whether HABP surface functionalization alters the EV size or morphology. NTA analysis found HABP-EVs maintained ~ 150 nm size, and TEM showed a standard cup-shaped EV morphology, confirming that peptide amphiphile-mediated surface functionalization does not change the physical structure of the EVs (Fig. 4C and D) [44,45], Additionally, we evaluated whether HABP surface functionalization alters the EV membrane stability and loaded cargo. Membrane rigidity was analyzed using the molecular rotor dye BODIPY, which exhibits increased fluorescence in rigid lipid membranes

[0046] , Immediately after sonication, fluorescence decreased significantly compared to the non-sonication control, indicating EV membrane fluidity. However, after incubation at 37 °C for 1 h, the EV membrane rigidity was restored to pre-soni cation levels (Fig. 4E). Importantly, we found that HABP surface functionalization did not lead to any significant miR- 133 cargo loss by qRT-PCR (Fig. 4F). Lastly, HABP-EV binding was evaluated on calcified osteochondrogenic cells, with HABP-EVs demonstrating increased binding compared to the unmodified MOVAS-EVs with 35.1 ± 4.0 % of EVs bound (Fig. 4G and H).

[0158] 1.3.4. HABP-EVs localize to the aorta in a murine model of vascular calcification

[0159] To target miR-133-loaded EVs to areas of vascular calcification in vivo, we assessed the binding capacity of the HABP-EVs to vascular calcification in a murine model of late-stage atherosclerosis. Nine-month-old ApoE KO mice were fed a high-fat diet for 10 weeks to establishvascular calcification, after which administration of DIR-1 ab eled HABP-EVs, EVs modified with a scrambled HABP sequence (CVRVSSPPMPGSK; NT-EVs), or unmodified MOVAS-EVs were administered intravenously at a dose of 1 x 109EV / g (Fig. 5A)

[0029] , Additionally, OsteoSense, a clinically-used bisphosphonate probe, which has high binding and specificity to HA, was administered as a standard

[0047] , Mice were then euthanized 24 h later, and the aortic arch and descending aorta were dissected and analyzed via IVIS (Fig. 5B). HABP-EVs showed significantly greater accumulation in the aortic arch and renal bifurcations compared to NT-EVs and MOVAS-EVs (Fig. 5B, C). Furthermore, HABP-EVs exhibited similar accumulation in the aortic arch as OsteoSense, demonstrating their ability to bind to calcification (Fig. 5B, C). Fluorescence microscopy analysis of aortic arch sections confirmed greater accumulation of the HABP-EVs in the vessel wall compared to NT-EVs (Fig. 5D and E). Moreover, ARS of calcification shows that HABP-EVs localize to calcification within the vessel wall (Fig. 5D). As areas of turbulent flow, such as the aortic arch, have been correlated with increased plaque growth and vascular calcification, our results suggest that HABP-EVs can home to calcified atherosclerotic plaques, thereby maximizing interactions with osteochondrogenic VSMCs to promote their anti-calcifying effect

[0048] ,

[0160] 1.3.5. HABP-miR-133-EVs inhibit calcification in vitro by inhibiting osteochondrogenic VSMCs

[0161] After confirming the vascular targeting ability of HABP-miR-133-EVs, their anticalcification ability was first evaluated in vitro. First, to ensure HABP-EVs were not cytotoxic to the target cell, MOVAS cell viability was measured after treatment with MOVAS- and HABP-miR-133- EVs at concentrations ranging from 1 x 108 10EV / mL. No cytotoxicity was observed across all concentrations. Internalization of the MOVAS- and HABP-miR-133-EVs (1 * 109EV / mL) by MOVAS cells was verified using fluorescence microscopy. Further, release of miR-133 cargo into the cytosol following EV internalization into MOVAS cells was observed using Cy5-labeled miR-133, suggesting successful delivery of miR cargo. Next, MOVAS cells were cultured in osteogenic conditions and treated with free miR-133 (250 nM), MOVAS-EVs, or HABP-miR-133-EVs (1 x 109EV / mL) [49,50], Treatment with HABP-miR-133-EVs reduced calcification deposition by 56.7 ± 6.3 % compared to the PBS control, as measured by ARS (Fig. 6A and B). Treatment with MOVAS-EVs had a modest anti-calcifying effect in vitro, as observed in preliminary studies;however, HABP surface modification and miR-133 loading significantly enhanced the anti-calcifying effect of the EVs. Furthermore, the free miR-133 control did not affect calcification deposition, demonstrating the need for EV-mediated delivery of the miR cargo (Fig. 6A and B). Further, no anticalcifying effects were observed following treatment with a non-therapeutic miRNA control (miR-67, supporting the therapeutic use of miR-133 within EVs. Overall, HABP-miR-133-EVs can efficiently inhibit calcification in vitro by delivering miR-133 to osteochondrogenic VSMCs.

[0162] As vascular calcification is initiated by the differentiation of contractile VSMCs into the osteochondrogenic phenotype, we investigated whether treating osteochondrogenic VSMCs with the HABP-miR-133-EVs inhibits the osteochondrogenic phenotype. qRT-PCR analysis showed that the osteochondrogenic markers OSX, RUNX2, and BMP2 were significantly reduced after HABP- miR-133-EV treatment compared to the other treatment groups (Fig. 6C). Conversely, HABP-miR- 133-EV treatment upregulated the expression of the contractile VSMC markers MYOCD, ACTA2, MGP, and CNN1, compared to the PBS control. Neither MOVAS-EV or free miR-133 treatment resulted in a significant difference in gene expression after treatment. Additionally, ALP activity, an early indicator of osteoblast differentiation involved in the nucleation of calcification minerals, was found to be significantly decreased on Days 7 and 10, indicating that multiple doses of EVs are required to achieve an anti-calcifying effect (Fig. 6D)

[0051] , Taken together, we show that HABP-miR- 133-EVs can inhibit calcification in vitro by inhibiting osteochondrogenic VSMCs and promotes expression of contractile VSMCs genes.

[0163] 1.3.6. HABP-miR-133-EVs inhibit vascular calcification in vivo]0164| Next, we evaluated the in vivo potential of EVs secreted by ExoMotif-transduced cells. To assess the efficacy of HABP-miR-133-EVs in inhibiting vascular calcification, we utilized a latestage atherosclerosis murine model. Nine-month-old ApoE KO mice, fed a high fat diet for 11 weeks, were intravenous administered either HABP-miR-133-EVs, MOVAS-EVs, free miR-133, or PBS weekly for a total of 10 weeks (Fig. 7A). Von Kossa staining for calcification deposits in serial sections of the aortic root shows substantial calcification (dark brown) at the endpoint. Treatment with either MOVAS-EVs or free miR-133 had no significant effect on total vascular calcification. However, treatment with HABP-miR-133-EVs had ~70 % reduction in calcification deposition in the aortic rootcompared to the untreated PBS control (Fig. 7B and C). Furthermore, whole tissue qRT-PCR of the abdominal aorta at the renal bifurcation showed significantly increased expression of miR-133 compared to the PBS, MOVAS-EV, and free miR-133 treatments (Fig. 7D). Analysis of the VSMC contractile marker ACTA2 showed a marked increase with HABP-miR-133 treatment. Conversely, expression of the osteochondrogenic markers OSX, RUNX2, and BMP2 was significantly decreased relative to the PBS control (Fig. 7E). Moreover, immunohistochemical analysis of the aortic root revealed greater RUNX2 expression within areas of calcification in mice treated with PBS; free miR- 133, MOVAS-EVs, and HABP-miR-133-EVs reduced areas of calcification and RUNX2 expression, with minimal RUNX2 signal detected following treatment with HABP-EVs. ACTA2 was detected in sections for all treatment groups, with HABP-miR-133-EVs and free miR-133 treatments leading to increased ACTA2 expression. Finally, serum levels of D-dimer, a protein that is upregulated after thrombotic events and associated with increased rick of acute cardiovascular events, was evaluated using ELISA [

[0052] ,

[0053] ,

[0054] ]. Treatment with HABP-miR-133 -EVs decreased serum D-dimer levels compared to the PBS control (Fig. 7F).

[0165] To assess the safety and biocompatibility of the EV treatments, we evaluated kidney and liver health markers. BUN and creatinine levels showed no significant difference with any EV treatments compared to the PBS control. Since the majority of our EVs are localized to the liver due to first pass effects, we also evaluated the liver enzymes AST and ALT. Interestingly, AST and ALT levels were decreased to within a healthy baseline range (40-60 mU / mL) following treatment with HABP-miR-133-EVs, indicating a beneficial therapeutic effect on liver health (Fig. 7G and H)

[0055] , Collectively, our results indicate that HABP-miR-133-EVs have a robust effect in attenuating vascular calcification in late-stage atherosclerosis.

[0166] 1.4. Discussion

[0167] Vascular calcification in late stage atherosclerosis presents a significant health challenge correlated with acute cardiovascular events and poor patient outcomes

[0056] , Osteochondrogenic VSMCs are a major driver of calcification within arterial walls. EVs have been shown to play a critical role in maintaining vessel wall homeostasis for multiple cell populations, including endothelial cells, macrophages, and VSMCs [57,58], For example, Kasputin et al. observedthat contractile VSMCs treated with EVs released from osteochondrogenic VSMCs caused contractile VSMCs to differentiate into an osteochondrogenic phenotype

[0030] , Due to the intrinsic role EVs play in atherosclerosis development, we hypothesized that EVs loaded with therapeutic miRs could inhibit osteochondrogenic VSMCs and promote a more contractile phenotype. Specifically, miR-133 is a particularly attractive miR previously shown to inhibit osteochondrogenic VSMCs. To increase miR- 133 loading within our therapeutic EVs, the miR-133 sequence was modified with an ExoMotif sequence; this approach conserves RNA quality and EV stability compared to other miRNA-loading methods [

[0059] ,

[0060] ,

[0061] ,

[0062] ]. This method resulted in high EV loading of miR-133 along with a greater loading of additional atheroprotective miRNAs (miR-21 and miR- 145) and the anti-calcifying protein MGP (Fig. 3I-K). To increase miR-133 EVs binding to vascular calcifications, EVs were functionalized with a HABP using a HABP amphiphilic post-inserted into the EV membrane. HABP- EVs had significantly greater binding both in vitro and in vivo compared to unmodified EVs, demonstrating their ability to target areas of vascular calcification. While this work functionalized EVs after collection and isolation, future studies can further engineer cells to express fusogenic proteins containing the targeting peptide of interest, creating a one-stop cell line for EVs production with enhanced cargo and targeting specificity without the need for exogenous surface modification methods [63,64],

[0168] We observed that HABP-miR-133-EV treatment increased the contractile VSMC markers ACTA2 and CNN1, suggesting that miR-133 promotes a contractile phenotype in VSMCs (Fig. 6C). However, the direct target of miR-133, which mediates the contractile VSMC phenotype, is yet to be elucidated. In the context of the mesenchymal to osteoblast transition, miR-133 was shown to be differentially downregulated [

[0065] ,

[0066] ,

[0067] ]. Additionally, miR-133 was demonstrated to bind specifically to the osteogenic transcription factor RUNX2

[0068] , As RUNX2 is significantly upregulated during the contractile VSMC to osteochondrogenic VSMC transition, we hypothesized that by reducing RUNX2 expression, we could both inhibit the osteochondrogenic phenotype and restore contractile VSMC gene expression

[0069] , Our results suggest that HABP-miR-133-EV treatment reduced RUNX2 expression in osteochondrogenic VSMCs both in vitro and in vivo while promoting the expression of contractile VSMC markers (Fig. 6, Fig. 7E). Reduction in RUNX2expression was also confirmed via immunohistochemistry. By inhibiting osteochondrogenic VSMCs, vascular calcification was significantly decreased (Fig. 7B and C).

[0169] Although we demonstrate the potential of HABP-miR-133-EV therapy for vascular calcification, we note a few study limitations. While we observed accumulation of HABP-miR-133- EVs in the aorta, EVs, like other nanoparticles, also accumulate in the liver due to the first pass effect

[0070] , Interestingly, HABP-miR-133-EVs improved liver health as seen with decreased ALT and AST levels. Previously, miR-133 was found to inhibit liver fibrosis associated with non-alcoholic fatty liver disease that occurs during atherosclerosis

[0071] , However, the mechanism of action of miR-133 within the liver has yet to be fully explored. Furthermore, siRNA, mRNAs, and miRNAs delivered by synthetic nanoparticles that accumulated in the liver have been reported to be repackaged into hepatocyte EVs for continued circulation and a sustained therapeutic effect [72,73], To elucidate such propagation of therapeutic effects, future studies will evaluate hepatocytes EV secretion and cargo content upon miR-133 EV administration.

[0170] 1.5. Conclusion

[0171] Through this work, we developed genetically engineered cell lines to establish cellular factories for therapeutic EVs production for the treatment of vascular calcification in atherosclerosis. We demonstrate the viability of utilizing ExoMotif engineering of miRNA sequences to specifically load miR-133 within EVs, in addition to other atheroprotective cargo. Further, surface functionalization of the EVs with HABP facilitated calcification binding and localization to the aorta in vivo. HABP-miR-133-EVs demonstrated a reduction of osteogenic VSMC markers and significantly reduced vascular calcification in a late-stage atherosclerosis murine model. To the best of our knowledge, this is the first report that utilizes ExoMotif modification of a miR sequence to generate therapeutic EVs. This novelty is further reflected in Table SI, which provides a comprehensive summary of endogenous and exogenous EV small RNA loading techniques [

[0020] ,

[0026] ,

[0074] ,

[0075] ,

[0076] ,

[0077] ,

[0078] ,

[0079] ,

[0080] ,

[0081] ,

[0082] ]. Overall, this work demonstrates the potential of novel EV engineering strategies to develop promising therapies for atherosclerotic vascular calcification.

[0172]

[0173] 2. Developing therapeutically enhanced cell-derived nanoparticles for atherosclerosis therapy

[0174] Atherosclerosis is responsible for one in four deaths in the United States (US) and is characterized as a chronic inflammatory disease in which calcified, lipid-laden lesions can suddenly rupture, resulting in acute fatal events.

[0083] Current treatments for atherosclerosis are aimed at reducing plasma cholesterol through statins, which inhibit low density lipoprotein (LDL) cholesterol synthesis. However, statins only lead to a =20% reduction in the incidence of myocardial infarction or stroke after five years of therapy.

[0084] Further, =60% of the 35 million statin users in the US will experience a secondary event.

[0085] This underscores the urgent need for new therapeutic targets and strategies that extend beyond lipid-lowering interventions for managing atherosclerosis.

[0175] Recently, vascular smooth muscle cells (VSMCs) within the medial layer of the blood vessel wall have gained recognition for their crucial role in the progression of atherosclerosis, emerging as a promising target for treatment.

[0086] In the early stages of atherosclerosis, healthy contractile VSMCs undergo dedifferentiation, leading to excessive proliferation and migration into the intima. As the disease advances, VSMCs transdifferentiate into various phenotypes resembling macrophages, foam cells, and osteochondrogenic cells, which propagate plaque growth.

[0087] Thus, inhibiting this pathogenic transdifferentiation and restoring the contractile phenotype of VSMCs is a promising therapeutic avenue.[0176[ We have previously reported on the use and efficacy of microRNA-145 (miR-145), delivered using micellar nanoparticles, as a therapy for atherosclerosis. [88-90] MicroRNAs (miRs) are short, non-coding RNAs that control gene expression via post-transcriptional inhibition of mRNA.

[0091] miR-145 is a key regulator of the VSMC phenotype by inhibiting Kruppel-like factor 4 (KLF4), which is a transcription factor driving the VSMC transdifferentiation into pathogenic phenotypes.

[0092] Specifically, miR-145 micelles demonstrated remarkable efficacy in murine models of early-, mid-, and late-stage atherosclerosis, with both repeated and single doses of miR-145 micelles inhibiting atherosclerosis progression. [88-89] However, synthetic nanoparticles (e.g., lipid nanoparticles, liposomes, polymeric nanoparticles) have drawbacks for repeated administration in chronic diseases like atherosclerosis, including an immunogenic response after repeated dosing. [93, 94] Moreover, synthetic nanoparticles can be unstable in biological environments, leadingto aggregation or degradation and low delivery efficiency.

[0095] For example, synthetic lipid nanoparticles delivering small nucleic acids have very low in vivo delivery efficiencies (=0.05- 1.0%). [96, 97] Thus, an alternative approach to deliver miR-145 with low immunogenicity and a high delivery efficiency would be an innovation for atherosclerosis therapeutics.[0177| Extracellular vesicles (EVs) are a promising alternative approach to overcome current limitations with synthetic nanoparticle delivery systems. EVs are biological nanoparticles formed of a complex lipid-bilayer membrane comprised of various lipids and transmembrane and surface-bound proteins, enabling EVs to exhibit low immunogenicity.

[0098] Additionally, due to their function in cellcell communication and delivery of intrinsic cargo (e.g., RNA, DNA, and protein), EVs have =30-40 fold greater cell internalization compared to clinically approved lipid nanoparticle formulations and can be used to enhance delivery of therapeutic cargo compared to synthetic nanoparticle platforms. [99, 100] Furthermore, EVs are versatile as drug delivery carriers and can be loaded with endogenous therapeutic cargo via engineering the parent cell and surface functionalized with targeting moieties to direct the therapeutic EVs to specific tissue or cell populations. [101, 102] In the context of atherosclerosis, pathogenic cells such as synthetic VSMCs release pro-atherogenic EVs, leading to plaque propagation.

[0103] Conversely, healthy VSMCs secrete EVs containing endogenous atheroprotective cargo.

[0104] Thus, by using therapeutically boosted EVs released by healthy contractile VSMCs, we aim to abrogate pathogenic VSMCs.[0178| Herein, we report on the development of miR-145 enriched EVs using a recent discovery in EV biology called ExoMotifs. ExoMotifs are 4-8 nucleotide motifs in miRs that direct loading of the ExoMotif-tagged miR into EVs by binding to RNA binding proteins involved in the endosomal sorting complex required for the transport (ESCRT) EV biogenesis pathway. [105-107] In this study, we demonstrate that genetically engineered VSMCs with an ExoMotif-modified miR-145 sequence allow for the creation of a stable cell line producing EVs with =40-fold enrichment of miR- 145. Moreover, we functionalize the surface of these miR-145-loaded EVs with a monocyte chemoattractant protein 1 (MCP-1) targeting peptide, which can bind to the chemokine receptor 2 (CCR2) expressed on the surface of synthetic pathogenic VSMCs.[108-l 10] We demonstrate in both in vitro assays and in an atherosclerosis ApoE- / - KO murine model that MCP-l-miR-145 EVs inhibit pathogenic VSMCs, promote contractile VSMC gene expression, and inhibit plaque growth. Lastly,we show that MCP-l-miR-145 EVs have significantly greater phenotypic modulation of diseased VSMCs compared to stoichiometrically equivalent doses of miR-145 delivered via micelles or lipid nanoparticles (LNPs). Overall, we demonstrate that MCP-miR-145 EVs are a promising therapeutic approach for the treatment of atherosclerosis.[0179| 2.2 Results

[0180] 2.2.1 Enhancing miR-145 Loading into VSMC EVs

[0181] Loading miRs into EVs has several challenges. To date, EVs have been loaded with small RNAs using either exogenous or endogenous methods. Exogenous methods (e.g., electroporation, freeze / thaw, surfactants, extrusion) load RNAs post-EV isolation and can lead to aggregation or degradation of the loaded RNA, degradation of the physical structure of the EVs, and low yield of RNA-loaded EVs. [111-113] In contrast, endogenous methods (e.g., transient or nonspecific transfection) aim to utilize cellular engineering strategies to increase miR loading into EVs, maintaining the primary benefits of EVs (i.e., low immunogenicity, endogenous therapeutic cargo, stability, biocompatibility) while converting the cell into an EV-producing “factory”. [114, 115] However, a critical aspect that previous endogenous loading strategies have not utilized are ExoMotifs, which direct ExoMotif-tagged miRs specifically into EVs. Thus, in order to enhance miR-145 cargo in EVs to develop an atherosclerosis therapy, we genetically engineered mouse aortic vascular smooth muscle (MOVAS) cells using lentiviral transduction to express miR- 145 modified with an ExoMotif (Figure 8A).[0182| First, we modified the wild-type pre-miR-145 sequence (WT-miR-145) in the mature miR strand with a “CAUG” ExoMotif (ExoMotif-miR-145), which has been shown to bind to Fus and Alyref proteins involved in RNA binding and sorting during EV biogenesis (Figure 8B).

[0105] In silico modeling of RNA structure showed that the ExoMotif modification did not affect the hairpin loop structure of the pre-miR sequence (Figure 8B). We then transduced MOVAS cells with either the ExoMotif-miR-145 sequence or the WT sequence as a control to evaluate the effect of the ExoMotif modification on miR-145 loading into EVs.

[0183] EVs were isolated from unmodified, WT-miR-145 transduced, or ExoMotif-miR-145 transduced MOVAS cells using differential centrifugation and size exclusion chromatography. To determine whether transduction with the WT- or ExoMotif-miR-145 sequences led to an alteration inthe size or physical structure of the EVs, nanoparticle tracking analysis (NTA) and transmission electron microscopy (TEM) were performed. Unmodified, WT-miR-145, and ExoMotif-miR-145 EVs all exhibited similar diameters (=140-170 nm), representative of small EVs (Figure 8C).[116,117] TEM micrographs showed a spherical cup-shaped morphology associated with small EVs (Figure 8D). Lastly, the zeta potential was measured as an indication of EV surface charge and colloidal stability; these properties can impact the ability of the EVs to interact with components on the cell surface.

[0118] The zeta potential for all three EV groups did not change significantly between groups and was shown to be negatively charged (=-30 mV; Figure 8E). Western blots for the EV-specific markers TSG101 and CD9 further validated the isolation and purity of the EVs.

[0117]

[0184] Next, in order to quantify the effects of the lentiviral transduction on the production of miR-145, we evaluated miR-145 expression in the cells after transduction with WT- or ExoMotif- miR-145 lentiviruses. Transduction with WT-miR-145 led to =68-fold increased expression of miR- 145 relative to the unmodified MOVAS cells, while ExoMotif-miR-145 resulted in a slightly lower miR-145 expression (=56-fold increase) in the cells quantified by qRT-PCR (Figure 8F); no significant differences in miR-145 expression in MOVAS cells after transduction were observed between the WT- and ExoMotif-miR-145 sequences. However, miR-145 expression in the EVs released from transduced MOVAS cells showed significant differences. Specifically, ExoMotif-miR-145 EVs had approximately =40-fold greater miR-145 content compared to the unmodified MOVAS EVs, while the WT-miR-145 EVs increased EV miR-145 by = 18-fold compared to the unmodified MOVAS EVs, demonstrating the increased miR loading capability upon modification of miRs with ExoMotifs (Figure 8G).

[0185] As EVs can contain a multitude of miR cargo, we evaluated the presence of additional atheroprotective miRs in the secreted EVs, including miR-1, miR-21, and miR-133. These miRs have all been shown to be downregulated in transdifferentiated VSMCs and play crucial roles in maintaining a contractile VSMC phenotype.f i 19, 120] Interestingly, transduction of MOVAS cells with both the WT- and ExoMotif-miR-145 sequences led to a significant increase for all three miRs in the EVs (Figure 8H). However, there was no difference in the expression of miR-1, miR-21, and miR-133 between the ExoMotif and WT-miR-145 transduced cells, indicating that this increase is likely the result of overexpressed miR-145. Thus, transduction of MOVAS cells with the ExoMotif-miR-145 generated a cell line that produced EVs with significantly enhanced miR-145 cargo, alongside the other therapeutic miR-1 , miR-21 , and miR-133, which further boosted the therapeutic potential of these engineered EVs.[0186| 2.2.2 Surface Functionalization of miR-145-Loaded EVs[0187| To increase ExoMotif-miR-145 EV (miR-145 EV) localization to pathogenic synthetic VSMCs, we functionalized the EV surface with an MCP-1 peptide [YNFTNRKISVQRLASYRRITSSKC] (SEQ ID NO: 7). We have previously demonstrated that this MCP-1 peptide fragment is able to facilitate nanoparticle binding to synthetic VSMCs that express CCR2.[88, 89] The MCP-1 peptide was conjugated to a lipid tail (DSPE-PEG2000-mal eimide) using thiol-ether click chemistry to create peptide amphiphiles; this allowed us to take advantage of the lipidbilayer structure of the EVs, in which post-insertion of the lipid tail of the amphiphile would present the MCP-1 peptide on the EV surface (Figure 9A). In initial experiments with the model amphiphile DSPE-PEG2000-FITC, we found that modified EVs had a maximum of ~ 60 amphiphile copies per EV (0.5 mg mL’1amphiphile). Using this, we modified miR-145 EVs with 0.5 mg mL-1 DSPE- PEG2000-MCP-1. NTA showed that the diameters did not change following MCP-1 modification. TEM micrographs showed similar EV morphology before and after MCP-1 modification (Figures 8D and 9B,C). Zeta potential showed a slight decrease in charge with MCP-1 modification. Finally, through qRT-PCR, we observed no statistical difference in miR-145 loading into EVs following addition of the MCP-1 peptide amphiphile, indicating that the surface functionalization method does not negatively impact the therapeutic cargo within EVs (Figure 9D).

[0188] We then evaluated MCP-l-miR-145 binding to synthetic VSMCs in vitro. First, three doses of miR-145 and MCP-l-miR-145 EVs (l x 108-10 EVs mL-1) were incubated with MOVAS cells for 24 h, and cytotoxicity was measured via metabolic activity using an MTS assay. No cytotoxicity was observed across a range of EV concentrations in MOVAS cells (Figure 9E). In order to evaluate binding to synthetic VSMCs, MOVAS cells were induced with ox-LDL (75 pg mL-1) for 3 days, which has previously been shown to increase CCR2 express! on.

[0121] DiO-labeled miR-145 and MCP-l-miR-145 EVs were incubated with synthetic cells for 30 min, after which binding was accessed with a plate reader and fluorescence microscopy. MCP-l-miR-145 demonstrated significantly increased binding to synthetic MOVAS cells compared to the unmodified miR-145 EVs(Figure 9F). Moreover, preincubation of synthetic MOVAS cells with free MCP-1 peptide followed by treatment with DiO-labeled MCP-l-miR-145 EVs and miR-145 EVs demonstrated a significant decrease in MCP-l-miR-145 EV binding, suggesting that EV-cell interaction and subsequent EV internalization is dependent on expression of CCR2. Thus, MCP-1 -functionalized EVs maintain surface morphology and levels of miR-145 cargo, and lead to enhanced binding of miR-145 EVs to synthetic VSMCs in vitro.

[0189] 2.2.3 Comparison of MCP-l-miR-145 EVs with Synthetic Nanoparticles10190] To fully evaluate the potential of the engineered EVs, we compared MCP-l-miR-145EVs to synthetic nanoparticles. Both LNPs and micelles were chosen as synthetic nanoparticles of interest. LNPs are one of the most used formulations for RNA delivery with multiple FDA-approved therapies.

[0122] Additionally, as we previously demonstrated the therapeutic success of miR-145 utilizing a micellular delivery system, we compared our engineered biologically-derived EVs with micelles. [88, 89]

[0191] Both miR-145 LNPs and micelles were fabricated using ethanol dispersion and thin film hydration, respectively, as previously reported. [88, 89, 123] MCP-l-miR-145 LNPs had an average diameter of - I44 nm, while the non-targeting (NT)-miR-145 LNPs were ~ l !4 nm (Figure 10A). In comparison, MCP-1 miR-145 micelles exhibited a diameter of ~20 nm with a zeta potential of ~9.5 mV (Figure 10A). miR-145 loading efficiency was found to be approximately between 78 and 82% for both the MCP-1- and NT-LNP formulations (Figure 10A). Using a gel shift assay, RNA signal remained in the loading wells, indicating that RNA was protected and incorporated in the nanoparticles (Figure 10B). Lastly, to assess synthetic nanoparticle binding to VSMCs, MOVAS cells were incubated with ox-LDL (75 pg mL-1) for 3 days to induce synthetic differentiation, followed by incubation with either NT- or MCP-l-miR-145 LNPs or micelles (each at 100 pM). After 30 min, it was observed that MCP-1 modification enhanced nanoparticle binding significantly for both LNPs and micelles; no significant difference in binding was observed between LNPs and micelles (Figure 10C,D).

[0192] After confirming that the synthetic nanoparticles could deliver miR-145 to diseased MOVAS cells, we evaluated the therapeutic efficacy of MCP-l-miR-145 EVs relative to synthetic miR-145 nanoparticles. ox-LDL-treated MOVAS cells were incubated with either unmodifiedMOVAS-EVs, NT-miR-145 EVs, MCP-l-miR-145 EVs, MCP-l-miR-145 LNPs, or MCP-l-miR-145 micelles for 4 h. Synthetic MOVAS cells were treated with 1 x 1010 EVs mL-1, while MCP-l-miR- 145 LNP and micelle doses were normalized to the miR-145 concentration present in 1 x 1010 EVs mL-1 (0.01 nM miR-145; Figure 11A). Even at this low miR-145 concentration, MCP-l- miR-145 EVs restored cellular miR-145 levels, exceeding the healthy baseline control (Figure 1 IB). Additionally, the contractile VSMC markers ACTA2 and MYH11 were significantly upregulated following MCP-l-miR-145 EV treatment (3.65 ± 0.75, 3.21 ± 0.40-fold increase, respectively), while NT-miR-145 EVs demonstrated a slightly lower therapeutic effect (2.55 ± 0.34, 2.47 ± 0.70-fold increase); unmodified MOVAS EVs had no significant effect on gene expression (Figure 11C,D).

[0124] Furthermore, we observed that the pathogenic synthetic VSMC marker KLF4 was reduced to =50% of its baseline expression following MCP-l-miR-145 EV treatment (Figure HE).

[0124] Conversely, both the MCP-l-miR-145 LNPs and micelles had no effect on gene expression relative to the PBS control at this low miR-145 concentration (Figure 11B-E).[01931 Next, to compare the efficacy of synthetic nanoparticles at a therapeutic miR-145 dose, we synthesized micelles and LNPs encapsulating a higher miR-145 concentration (250 nM) 25 OOOx greater than the miR-145 concentration in the EVs; this concentration was chosen, as it has previously been shown to inhibit synthetic VSMCs.[88, 89] (Figure 1 IF). The EV miR-145 dose was held constant at 0.01 nM. Diseased MOVAS cells treated with MCP-l-miR-145 LNPs (12.15 ± 2.9-fold increase) and micelles (10.26 ± 1.54-fold increase) had significantly greater miR-145 expression compared to MCP-l-miR-145 EVs (5.45 ± 1.42-fold increase; Figure 11G). Interestingly, ACTA2 and MYH11 expression after treatment with MCP-l-miR-145 EVs (0.01 nM, 3.65 ± 0.75, 3.21 ± 0.40- fold increase, respectively) was similar to expression following MCP-l-miR-145 LNPs (4.93 ± 1.15, 2.10 ± 0.30-fold increase) and micelle (3.95 ± 0.86, 1.95 ± 0.25-fold increase) treatments, suggesting that total miR-145 expression does not translate directly to increased expression of contractile genes; this is likely due to saturation of the machinery required to process double stranded miRs (Figure 11H, I).

[0125] With regards to the pathogenic marker KLF4, MCP-l-miR-145 LNPs and micelle treatment had the greatest effect at a 250 nM dose, reducing expression by =75% compared to the PBS control (Figure 11 J). However, when KLF4 protein was quantified by ELISA, MCP-l-miR- 145 micelles, LNPs, and EVs all reduced KLF4 protein expression to levels similar to the healthy baseline. Taken together, our results suggest that MCP -miR-145 EVs are therapeutically enhanced,potentially due to the variety of atheroprotective miR cargo, resulting in the ability of the engineered EV to restore contractile VSMC gene expression in pathogenic cells in vitro. Conversely, synthetic nanoparticles required magnitudes greater concentration of miR- 145 to have a comparable effect to the engineered EVs.[0194| 2.2.4 MCP-l-miR-145 Elicits Contractile Functional Effects in Synthetic VSMCs

[0195] After confirming that MCP-l-miR-145 EVs could promote contractile gene expression and restore healthy VSMC markers in vitro, we evaluated the functional effects of EV treatment. During atherogenesis, contractile VSMCs are quiescent and do not migrate or proliferate. However, dedifferentiated synthetic VSMCs proliferate and migrate into the plaque, where they can transdifferentiate into more plaque propagating cell types.

[0126] Thus, inhibiting this proliferative and migratory function is key in inhibiting the progression of atherosclerosis. To evaluate the effect of MCP-l-miR-145 EV treatment on migration and proliferation, MOVAS cells were induced toward a synthetic phenotype and then treated with either MCP-l-miR-145 EVs, MCP-l-miR-145 LNPs, or MCP-l-miR-145 micelles at the EV equivalent miR dose of 0.01 nM miR-145 (Figure 12A). A scratch assay was then performed, and migration was measured over 24 h. Treatment with MCP-l-miR-145 EVs significantly reduced migration of VSMCs (70.4 ± 39.3% decrease at 24 h), while MCP-l-miR- 145 LNP and micelle treatment had no effect compared to the PBS control (Figure 12B,C).

[0196] Synthetic VSMCs can also uptake LDL cholesterol, leading to the formation of foam cells and the formation of a necrotic core within the plaque in vivo.

[0127] While contractile VSMCs are able to efflux excess cholesterol, they lose this function after dedifferentiating into the synthetic phenotype. Thus, we evaluated cholesterol efflux 24 h after treatment with either MCP-l-miR-145 EVs, MCP-l-miR-145 LNPs, or MCP-l-miR-145 micelles at the EV equivalent dose (0.01 nM miR- 145). MCP-l-miR-145 EV treated cells were able to efflux -75% of uptaken cholesterol, which was significantly greater than all other treatment groups (Figure 12D). Previously, miR-145 overexpression in VSMCs was found to enhance cholesterol efflux and maintain expression of contractile markers compared to synthetic VSMCs. Conversely, inhibition of miR-145 in VSMCs led to a synthetic VSMC phenotype with significant cholesterol uptake and limited efflux due to a decrease in the cholesterol transporter ABCA1.

[0128] Treatment with MCP-l-miR-145 EVs demonstrates thatthe contractile VSMC phenotype is maintained, allowing for greater cholesterol efflux compared to the other treatment groups.[0197J Next, scratch and cholesterol efflux assays were performed with the same EV dose (0.01 nM miR-145) and compared to high miR-145 doses for MCP-l-miR-145 LNPs and micelles (250 nM miR-145). (Figure 12E). MCP-l-miR-145 EVs, LNPs, and micelles had similar reductions in migration compared to the PBS control (70.4 ± 39.3%, 61.3 ± 30.3%, 49.5 ± 33.5%, respectively) (Figure 12F,G). With regards to the cholesterol efflux effect, MCP-l-miR-145 EVs, LNPs, and micelles resulted in greater efflux compared to the PBS control, indicating that the treated VSMCs are more resistant to transdifferentiation into a foam cell phenotype (Figure 12H). Regardless, MCP-l- miR-145 EVs were able to inhibit synthetic VSMC function at a miR-145 dose 25 OOOx less than synthetic nanoparticle formulations, demonstrating their therapeutic potential to induce a functional response, driving diseased VSMCs toward a contractile VSMC phenotype.

[0198] 2.5 MCP-l-miR-145 EVs Inhibit Plaque Progression in a Mid-Stage MurineAtherosclerosis Model[O199| In order to evaluate whether MCP-l-miR-145 EVs could inhibit plaque formation in vivo, we evaluated the therapeutic efficacy of our engineered MCP-l-miR-145 EVs in a mid-stage atherosclerosis murine model. Specifically, four-month-old ApoE KO mice were fed a high fat diet for 10 weeks to induce plaque formation, after which MCP-l-miR-145 EVs or unmodified MOVAS EVs (5 doses, 1 x 109EV gram1body weight) were administered intravenously for 30 days. Additionally, MCP-l-miR-145 LNPs and MCP-l-miR-145 micelles (0.001 mg miR-145 per gram body weight) were administered as synthetic nanoparticle controls (Figure 13 A). The synthetic nanoparticle dose was chosen based on our previous reports that showed significant plaque reduction with repeated treatments. [88, 89] Of note, total miR-145 administered via synthetic nanoparticles was -5000 x greater than that of the MCP-l-miR-145 EV dose.[0200J Plaque formation was evaluated through histological cross section of the ascending aorta, in which turbulent blood flow has been associated with significant plaque deposition.

[0129] MCP-l-miR-145 EV treatment reduced plaque size to 5.53 ± 2.54% of the total aortic lumen compared to the PBS control (23.27 ± 6.89%; Figure 13B,C). Moreover, the MCP-l-miR-145 EVs demonstrated an equal or greater plaque reducing efficacy when compared to syntheticnanoparticles (MCP-l-miR-145-LNPs: 10.30 ± 2.99%; MCP-l-miR-145 micelles: 2.98 ± 1.78%; Figure 13B,C). Specifically, MCP-l -miR-145 EVs demonstrated significantly greater plaque inhibition compared to the MCP-l-miR-145 LNPs; no statistically significant difference was observed when compared to the MCP-l-miR-145 micelles. Lastly, unmodified MOVAS EVs did not lead to a significant decrease in plaque size, indicating that the ExoMotif engineering is required to develop EVs with sufficient therapeutic cargo to elicit an anti-atherogenic effect.

[0201] Additionally, lipid accumulation within the vessel wall was evaluated using Oil Red O staining. Lipid deposition correlated with plaque area, with MCP-l-miR-145 EVs and micelles having the lowest level of lipid deposition compared to the PBS control. Interestingly, miR-145 EVs without the MCP-1 modification exhibited similar plaque reduction efficacy compared to MCP-l-miR-145. Further exploration of nanoparticle accumulation within the atherosclerotic plaques showed that MCP- l-miR-145 EVs accumulated at lesion sites, suggesting successful plaque targeting capabilities. miR- 145 EVs also accumulated within the plaque, but to a lesser degree. This suggests that a substantial therapeutic effect is conferred by ExoMotif-modified miR-145 EVs, regardless of the MCP-1 modification. Nonetheless, we demonstrate that at a 5000 x less miR-145 dose, MCP-l-miR-145 could inhibit plaque growth similar to our previously established micelle nanoparticle system. [88, 89]

[0202] Furthermore, whole tissue qRT-PCR of the aortic arch was performed to evaluate expression of miR-145, contractile VSMC markers (MYOCD, ACTA2, MYH11), and the synthetic marker KLF4. miR-145 expression was significantly upregulated following MCP-l-miR-145 EV and -micelle treatment (1.33 ± 0.22 and 1.55 ± 0.29-fold increase, respectively) compared to the PBS control. Treatment with the LNPs or MOVAS EVs did not result in a significant increase in miR-145 (Figure 13D). Similarly, the contractile markers MYOCD, ACTA2, and MYH11 demonstrated significant upregulation with MCP-l-miR-145 EV treatment (1.92 ± 0.32, 1.84 ± 0.25, 2.34 ± 0.36- fold increase, respectively) compared to the PBS control at levels similar to or greater than the synthetic nanoparticles (Figure 13E). The pathogenic marker KLF4 was downregulated with MCP-l- miR-145 treatment (0.81±0.11-fold change); however, this decrease was not statistically significant (Figure 13E). Notably, treatment with MCP-l-miR-145 LNPs, micelles, and EVs led to a reduction in expression of galectin-3, a marker of synthetic VSMCs within the plaque area, compared to the PBS or MOVAS treated groups. Taken together with the significantly increased expression of contractilemarkers throughout the aortic tissue and the reduction in plaque size, MCP-l-miR-145 EVs demonstrate high therapeutic efficacy at 5000 x lower miR-145 dose compared to synthetic nanoparticle formulations.[0203| Lastly, safety and toxicity of MCP-l-miR-145 EV treatment were evaluated using H&E stains of organs, which showed no significant alteration in morphology after treatment. Additionally, as nanoparticle accumulation in the kidneys was observed, blood urea nitrogen and serum creatine levels were evaluated as a measure of kidney health. No significant differences were seen for all treatment groups compared to the PBS control, indicating that the kidneys were not adversely affected by nanoparticle administration. Lastly, since significant nanoparticle accumulation was observed in the liver, liver health was also evaluated by measuring serum levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST), which are upregulated with abnormal liver function. All nanoparticle treatments did not affect AST and ALT levels when compared to the PBS control. In total, MCP-l-miR-145 EVs were demonstrated to be a safe nanoparticle therapy to reduce plaque formation in the vasculature while simultaneously upregulating contractile VSMC markers at a miR dose 5000 x less than synthetic nanoparticle controls.

[0204] 2.3 Discussion and Conclusion

[0205] For chronic diseases like atherosclerosis requiring multiple therapeutic doses for effective treatment, we demonstrate that EVs are an excellent nanotherapeutic option due to their biocompatibility and superior delivery efficiency.

[0130] Specifically, we show the potential of engineering VSMC-derived EVs loaded with therapeutic miR-145 to target synthetic VSMCs and inhibit atherosclerosis. We utilize a novel method of EV engineering known as ExoMotif sequence modification to enhance miR-145 loading within EVs. Specifically, using the ExoMotif sequence “CAUG”, we found that miR-145 EV cargo was enriched by ~40-fold compared to unmodified EVs (Figure 7G). Relative to synthetic nanoparticle formulations, miR-145 copies per engineered EV were 5000-25 OOOx lower. Since one of the biological functions of EVs is to facilitate intercellular communication through the delivery of its cargo, EVs act as superior nucleic acid delivery vehicles. Gibbings et al. demonstrated that EVs loaded with siRNA cargo could achieve comparable knockdown of target mRNA in the liver with 10-300x less siRNA cargo compared with LNPs.

[0131] Our results corroborate this finding, in which MCP-l-miR-145 EVs at a miR-145 dose=5000 x less than the synthetic nanoparticle formulations had similar or better efficacy at inhibiting plaque growth in vivo (Figure 13B,C).

[0206] Interestingly, MCP-l-miR-145 LNPs had diminished efficacy when compared to the MCP-l-miR-145 micelles (Figure 13B-E). This decreased efficacy may be the result of the larger LNP size (=140 nm), as it must pass through the endothelial barrier and a dense extracellular matrix to reach the atherosclerotic lesion.

[0132] Micelles, due to their small size (=15-20 nm), have been shown to enter the intima of the vascular wall during atherosclerotic inflammation. [88, 133] While EVs are also larger in size at =100-200 nm in size, they have been demonstrated to be able to cross the endothelium and are able to deform to diffuse through the extracellular matrix, allowing them to reach sites of disease.[134-137]

[0207] EVs also contain a variety of endogenous therapeutic cargo, increasing their therapeutic potential. In this study, we observed that simply overexpressing both WT- and ExoMotif-modified miR-145 sequences resulted in significantly greater loading of the atheroprotective miR-1, miR-133, and miR-21 within the secreted EVs (Figure 13H). This is likely because the overexpression of miR- 145 drives the cell toward a more contractile phenotype and upregulates the expression of contractile gene markers and miRs.[138-140] miR-1 expression is induced by the contractile VSMC transcription factor myocardin and targets the synthetic VSMC transcription factor KLF4, similar to miR- 145.

[0141] miR-133 is a key inhibitor of VSMC transdifferentiation into osteochondrogenic VSMCs, which calcify atherosclerotic plaque.

[0142] Additionally, miR-133 has been demonstrated to inhibit the transcription factor specificity protein 1 (SP-1), which promotes synthetic VSMC gene expression. Similarly, miR-21 has been demonstrated to inhibit synthetic VSMC proliferation and migration by targeting the activator protein-1 (AP-1).

[0143] Thus, the engineered miR-145 EVs are likely delivering multiple atheroprotective miRs that have a synergistic effect in promoting the contractile VSMC phenotype.

[0208] Although we demonstrate the potential of MCP-l-miR-145 EV therapy for atherosclerosis, we note a few study limitations. Like the majority of nanoparticles reported in the literature, EVs are also uptaken into the liver due to the first pass effect.

[0095] While we observed no cytotoxicity in the liver, the effect of miR-145 on hepatocytes is yet to be elucidated. Interestingly, a recent study highlighted that small RNAs delivered via synthetic nanoparticles are delivered to theliver and repackaged into EVs for continued circulation.

[0144] Thus, future studies will aim to understand this mechanism of propagation and the potentially prolonged and enhanced therapeutic action of MCP-l-miR-145 EVs within the liver. Additionally, MCP-l-miR-145 EVs may be interacting with other cells expressing CCR2 within the atherosclerotic plaque.

[0145] For example, monocytes also express CCR2, and previous work has shown that MCP-1 micelles bind to monocytes, allowing for infdtration into the plaque.

[0146] As activated monocytes infiltrate the plaque in response to inflammation, MCP-l-miR-145 EVs may bind to monocytes and get transported into the plaque. Thus, future work will explore the effects of MCP-l-miR-145 EVs on the other plaque resident cell types.

[0209] Through this work, we have highlighted the viability of using ExoMotif-engineering of miR sequences to develop therapeutically enhanced EVs. miR-145 was successfully loaded into EVs through genetic engineering of the cell and these EVs were surface functionalized to target synthetic VSMCs. In vitro, MCP-l-miR-145 EVs restored synthetic VSMCs back to a contractile phenotype in both function and gene expression. Moreover, the MCP-l-miR-145 EVs exhibited therapeutic effects at miR-145 concentrations orders of magnitude lower than synthetic LNPs and micelles, highlighting the potential of EVs as novel therapeutic nanoparticles. In vivo, MCP-l-miR-145 EVs significantly reduced atherosclerotic plaque burden. Together, our findings demonstrate the novel use of VSMC EV engineering to develop therapies for atherosclerosis.[0210| 2.4 Experimental Section

[0211] Cell Culture

[0212] Mouse Aortic Smooth Muscle Cells (MOVAS) (Passage 4-8, purchased from ATCC CRL-2797) were cultured in DMEM with 10% FBS, 1 mmol L1sodium pyruvate, and 4.5 g L1D- glucose. Cells were cultured on 182.5 cm2flasks until ~70% confluent and washed with PBS (pH 7.4). Cell media was replaced with EV isolation media consisting of DMEM, 10% ExoFree FBS, 1 mmol L1sodium pyruvate, and 4.5 g L1D-glucose. After 48 hrs, EV-containing media (EV-CM) was collected.

[0213] EV Isolation

[0214] Cells, cellular debris, and large vesicles (>1000 nm) were removed from EV-CM through sequential centrifugation at 1000 x g and 10 000 x g. EV-CM was then filtered through 0.22 gm PES syringe filters (Millipore Sigma, ME, USA). The filtered EV-CM was then concentrated with Amicon Ultra- 15 10 kDaMWCO centrifuge filters (EMD Millipore, ME, USA) from 15 mL EV- CM to approximately 250 pL concentrated EV-CM. qEV 2 mL per 35 nm SEC columns (Izon, CA, USA) were equilibrated with 50 mL of PBS (pH 7.4) at 4 °C. After flow through, 2 mL of concentrated EV-CM was overlaid on the column followed by elution with 50 mL PBS. A flow through void volume of 14 mL was discarded, per manufacturer's instructions, and 5x EV-containing 2 mL fractions were collected and pooled. The pooled fractions were then concentrated from 10 mL to =100-150 pL using an Amicon Ultra-15 10 kDa MWCO centrifuge filter, yielding a final EV isolate. EV isolate was aliquoted and stored at -80 °C for further use.

[0215] ExoMotif Modification and Transduction

[0216] The mature miR-145 sequence was modified to include the ExoMotif “C AUG” while maintaining the same pre-miRNA stem loop structure as the wild type sequence, as predicted by RNAfold Webserver (University of Vienna). Sequences for 150 base pairs upstream and downstream of the pre-miR-145-ExoMotif sequence were obtained from the Ensembl database and synthesized by System Biosciences (CA, USA), The sequences were cloned into a lentiviral vector containing puromycin resistance cassettes (CD513-A, System Biosciences). 293FT packaging cells (Thermofisher, MA, USA) were transfected with these plasmids, and the lenti virus released were concentrated to a viral titer of 1 * 107IFUs ml1Lentiviruses were applied to MOVAS cells. Plasmid expressing cells were selected after 5 days by puromycin resistance (USC Stem Cell Core).

[0217] TEM Imaging

[0218] 10 pL of concentrated EV isolate was fixed with an equal volume of 1% PFA for a final concentration of 0.5% PFA for 30 min. 10 pL of the fixed EVs or micelles were then pipetted onto a carbon / copper grids (Ted Pella, CA, USA) and incubated for 10 min. The grid was washed with Milli-Q water and stained with 10 pL of 2 wt.% uranyl acetate (5). Dried samples were imaged on a JEM 2100-F (JEOL Ltd., Japan).

[0219] NTA Analysis

[0220] EV size distribution and concentration in EV isolate were determined using Nanoparticle Tracking Analysis (NTA) with the NanoSight NS300 (Malvern Technologies, UK). Samples were diluted 1: 1000 in particle-free PBS to a concentration of approximately 1 x 108EVs ml1(manufacturer's recommended concentration: 107— 109EVs ml1) Samples were then analyzed with 5x, 60-second videos under continuous flow conditions (flow rate: 30 pL min Temp = 25 °C) with a camera level of 10. Data analysis was performed with the NTA 3.1.54 software with a detection threshold of 4.[G221] EV Lysis and Protein Quantification[02221 EV protein concentration was determined using a bicinchoninic acid assay (Pierce BCA Protein Assay Kit, Thermo Scientific, MA, USA). Briefly, 10 pL of Lysis Buffer (lx RIPA Buffer (Thermo Scientific, MA, USA), lx Complete Protease Inhibitor (Roche, Germany), and 1 mM dithiothreitol) was added to 100 pL of concentrated EV isolate and incubated on ice for 30 minutes followed by sonication for 1 min. Lysed EV protein concentration was measured using a BCA assay according to the manufacturer's protocol. Lysed EVs were diluted 1 :5 in PBS and 25 pL were added to a 96 well plate followed by 200 pL of the BCA reagent. The plate was incubated in the dark at 37 °C for 30 min and absorbance was measured at 580 nm. Protein concentration was determined using a BCA standard curve.

[0223] EV miR Quantification

[0224] EV miR was isolated via the miRNEASY micro kit (Qiagen, Germany) based on the manufacturer's instructions. cDNA was synthesized using RT2miR First Strand Kit (Qiagen, Hilden, Germany), according to manufacturer's instructions. miR-145, miR-145-ExoMotif, miR-133, miR-1, and miR-21 expressions were determined by real time-PCR using SYBR Green qPCR Mastermix (Qiagen, Germany) on a CFX384. For miR-145 and miR- 145 -ExoMotif copy number quantification, a qRT-PCR standard curve was created using miR-145 and miR-145-ExoMotif oligonucleotide mimics (IDT, IA, USA) at concentrations ranging from 10' 107copies. EV miR-145 Cq values were then evaluated against this standard curve to determine copies per EV.

[0225] Gel Electrophoresis and Western Blot

[0226] 20 pg EV protein was mixed with 4x Laemmli Sample Buffer (Bio-Rad 1 610 747) and heated at 80 °C for 15 min. Proteins were then separated by gel electrophoresis using a 4-15% Mini- PROTEAN TGX precast gel (Bio-Rad, CA, USA). Gels were run using Tris / Glycine / SDS running buffer (25 mM Tris, 192 mM glycine, 0.1% SDS, pH 8.3) at 150 V for 60 min. Proteins were then transferred to a 0.2 pm PVDF membrane (Bio-Rad, CA, USA) using a mini-Protean II blotting system at 100 V constant voltage for 60 min. The PVDF membranes were blocked for 1 h at room temperature using blocking solution (TBS, 0.1% Tween-20, and 5% Bovine Serum Albumin (Sigma Aldrich, MO, USA). The membrane was then washed three times with TBS. Proteins were detected by incubation with primary antibodies (CD9 1 : 1000 dilution (Invitrogen, CA, USA), TSG101 1 : 1000 dilution (Invitrogen, CA, USA)) diluted in blocking solution overnight at 4 °C. Membranes were washed three times with 0.1% Tween-20 TBS and incubated with the secondary antibody Goat Anti-Rabbit IgG H&L (HRP) (1 :2000 dilution, Abeam, UK) diluted in blocking solution for 1 h at room temperature. After secondary incubation, the membrane was washed three times with 0.1% Tween-20 TBS followed by a wash with TBS. Pierce CN / DAB HRP substrate (ThermoFisher, MA, USA) was added to the membrane and the membrane was imaged using chemiluminescence with the Bio-Rad Chemidoc XRS system (Bio-Rad, CA, USA).

[0227] DSPE-PEG-MCP-1 Synthesis

[0228] MCP-1 (YNFTNRKISVQRLASYRRITSSKC) (SEQ ID NO: 7) was synthesized using standard Fmoc-mediated solid phase peptide synthesis on an automatic PS3 benchtop peptide synthesizer (Protein Technologies, AZ, USA).

[0147] The cysteine residue at the C-terminus was used for thioether linkage. The peptides were N-capped with an acetyl group and cleaved from the rink amide resin using a 94:2.5:2.5: 1 (v / v) ratio of trifluoroacetic acid:l,2 ethanedithiol:H2O:triisopropylsilane. Cleaved peptides were precipitated and washed several times with ice-cold diethyl ether, subsequently dissolved in Milli-Q water, and lyophilized. Lyophilized peptides were stored at -20 °C until purification using reverse-phase high performance liquid chromatography (HPLC, Shimadzu, Japan). Crude peptides were purified using a C8 column at 55 °C using 0.1% formic acid in acetonitrile / water mixture. Purified samples were characterized and verified using Matrix Assisted Laser Desorption / Ionization-Time of Flight (MALDI-TOF) mass spectral analysis (Bruker, MA, USA). Pure peptides were conjugated to create amphiphiles via a thioetherlinkage to 1,2 distearoyl-sn-glycero-3-phosphoethanolamine-N-[maleimide(polyethylene glycol)- 2000], or DSPE-PEG(2000)-maleimide (Nanocs, NY, EISA) by adding a 10% molar excess of the peptide to lipid in water. The pH of the mixture was adjusted to 7 and the solution was left to react at room temperature for 24 h with constant agitation until further purification using a C4 column (Phenomenex, CA, EISA) and verification using MALDI-TOF.

[0229] EV Surface Modification and Fluorescence Labeling

[0230] 1 x 1010EVs mL1were incubated with varying concentrations (0.1, 0.25, 0.5,1.0 mg mL’1) of amphiphile (DSPE-PEG-FITC or DSPE-PEG-MCP-1) in PBS. The EV amphiphile solution was sonicated for 30 s followed by 1 min rest at 37 °C. Sonication and rest was repeated for a total of three times, followed by a 1 h incubation at 37 °C. Following EV modification, free amphiphiles were removed via gravity-driven size exclusion chromatography (Izon Scientific, CA, USA).

[0231] Micelle Synthesis and Characterization

[0232] miR-145 containing the sense sequence, 5'-GUCCAGUUUUCCCAGGAAUCCCU-3'(SEQ ID NO: 8), was custom ordered from IDT (IA, USA) and modified with a thiol group on the 5' end of the sense (functional) strand for covalent conjugation to the micelle lipid tail. miR-145-SH (MW = 14490 g mol-1, 117.5 nmol, 1.70 mg) was added to DEPC-treated water to make 0.1 mM miR- 145 solution. TCEP was added to the miR-145 solution and stirred in the dark at room temperature for 4 h at 1600 rpm. Thiolated miR-145 was conjugated to DSPE-PEG2ooo-maleimide (Avanti Polar Lipids, Alabaster, AL) via a thioether bond by adding a 10% molar excess of lipid to reduce thiolated miR in DEPC-treated water. The resulting products were characterized using MALDI. The expected m / z peaks for DSPE-PEG2ooo-miR-145 was [M + H]+= 17047.

[0233] miR-145 micelles were self-assembled by first dissolving MCP-1 peptide amphiphiles and DSPE-PEG2ooo-methoxy (49:50 mol ratio) in methanol. Methanol was completely evaporated under nitrogen and further vacuum dried overnight. The resulting film was hydrated with water, DSPE-PEG2ooo-miR-145 (1 mol%) in nuclease-free water added to the hydrated film, and the complete solution incubated at 60 °C for 30 min. For the 0.01 nM dose, the micelles were formed at a (49:50.0006:0.0004) molar ratio (MCP-1 ampiphile:DSPE-PEG2ooo-methoxy:DSPE-PEG2ooo-miR- 145). For fluorescence imaging DSPE-PEG2000-FITC or DSPE-PEG2ooo-Cy7 was incorporated at 5mol%. After incubation, the micelle solution was cooled to room temperature prior to use. The particle size and zeta potential of micelles at 100 pM were determined by a Mobius Zetasizer (Wyatt, CA, USA), and measurements were carried out in 25 °C in three replicates.[0234| LNP Synthesis and Characterization[0235| DLin-MC3-DMA (Broadpharm, CA, USA), l,2-distearoyl-sn-glycero-3- phosphocholine (DSPC) (Avanti Polar Lipids, AL), cholesterol (Sigma Aldrich, MO, USA), DMG- PEG (Avanti Polar Lipids, AL, USA), and DSPE-PEG2000-MCP-I or DSPE-PEG2ooo-Methoxy was dissolved in ethanol or methanol at a molar ratio of DLin-MC3-DMA / DSPC / Chol / DMG-PEG / DSPE- PEG2000 (40 / 10 / 38.5 / 1.5 / 10). The aqueous phase was prepared in 10 mM citrate buffer (pH 4) with miR-145. The aqueous and organic phases were combined with rapid mixing by pipette at a miR:ionizable lipid weight ratio of 1 : 10. LNPs were dialyzed in lx PBS in a 50 kDa MWCO cassette for 12 h. LNPs were evaluated for size and zeta potential by dynamic light scattering then stored at 4 °C for use. Encapsulation efficiency was evaluated using a PicoGreen assay. For in vitro assay, LNPs were dosed based off of total RNA dose (0.01 nM or 250 nM for in vitro assay, 0.001 mg g1body weight for in vivo administration). For EV normalized dose LNPs were synthesized at a miR:ionizable lipid ratio of 1 : 1000, and total particle were diluted by tenfold in PBS before administration to cells. Free RNA was evaluated using a NanoDrop (ThermoFisher, MA, USA).

[0236] Synthetic MOVAS Culture[0237J MOVAS cells (ATCC, VA, USA) were cultured in Dulbecco's Modified Eagle Medium (Gibco, MA, USA) with 10 vol% ExoFree FBS. Cells were grown to confluence then introduced to synthetic media containing 75 pg ml1ox-LDL (Sigma-Aldrich, MO, USA). Cells were cultured in synthetic media for 3 days.

[0238] In Vitro Biocompatibility

[0239] MOVAS cells were incubated with miR-145 EVs and MCP-l-miR-145 EVs (1x108'10EV niL or PBS for 24 h before biocompatibility was assessed using an MTS (3-(4,5- dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) cell proliferation assay (Biovision, CA, USA). MOVAS cells were incubated with MTS reagent for 1 h at37 °C. The absorbance of the MTS reagent was measured using a plate reader at 490 nm (N = 5). Cell viability was calculated by comparing with the PBS control.

[0240] Gel Shift Assay

[0241] MCP-l-miR-145 micelles, MCP-l-miR-145 LNPs, or free miR-145 containing 10 pg miR were incubated with 20 pL nu cl ease-treated fetal bovine serum (FBS) for 1 h at 37 °C. The integrity of miR-145 was observed by gel electrophoresis on a 2% (w / v) agarose gel at 56 V. The gel was imaged on a ChemiDoc XRS+ (Bio-Rad, CA, USA).

[0242] In Vitro Cellular Binding Assays[0243| MOVAS cells were dedifferentiated for 3 days in synthetic media and binding of MCP- l-miR-145 -E Vs, miR-145-EVs, MCP-lmiR-145 LNPs, NT-miR-145-LNPs, MCP-l-miR-145 micelles, and NT-miR- 145 micelles was assessed. EV binding was determined indirectly by measuring the amount of unbound EVs. DiO-labeled EVs (1x109EV mL '), DSPE-PEG2000-FITC labeled NT- and MCP-1 LNPs and micelles (25 pM) were incubated with synthetic MOVAS cells at 37 °C for 30 min. EVs, LNPs, or micelles were then removed, and cells were measured for DiO or FITC fluorescence at 490 / 525 nm using a plate reader (Varioskan LUX, Thermo Fisher, MA, USA, N= 5). Nanoparticle binding to cells was also confirmed through fluorescence microscopy. After removing the EVs, LNPs, or micelles, cells grown in synthetic media were fixed in 4% PF A, and imaged on a fluorescence microscope (Leica DMi8, Leica, Germany). DAPI was used to stain nuclei. For CCR2 saturation by MCP-1 preincubation, MOVAS cells were dedifferentiated for 3 days in synthetic media followed by incubation with 250 pM MCP-1 peptide for 1 h. Cells were then washed and treated with MCP-l-miR-145-EVs or miR-145-EVs (1 x 109EV ml1) at 37 °C for 30 min. Nanoparticle binding to cells was confirmed through fluorescence microscopy. After removing the EVs, cells were fixed in 4% PFA and imaged on a fluorescence microscope (Leica DMi8).

[0244] In Vitro mRNA Expression After Treatment

[0245] MOVAS cells at 3 days of synthetic media were incubated with EVs (1 x 109EVs ml.1), micelles (0.01 nM, or 250 nM miR-145), LNPs (0.01 nM, or 250 nM miR-145), or PBS in serum-free media. Following the 4 h incubation period, the media was replaced healthy DMEMfor 20 h (N = 5). RNA was isolated via Trizol (Invitrogen, CA, USA), and cDNA was synthesized using the RT2First Strand Kit (Qiagen, Germany) according to the manufacturer's instructions. miR- 145, ACTA2, MYH11, and KLF4 expressions were determined by real time-PCR using RT2SYBR Green qPCR Mastermix (Qiagen, Germany) on a CFX384. GAPDH was used as an internal control. The 2AACT method was used to quantify mRNA expression.

[0246] In Vitro KLF4 Protein Quantification After Treatment

[0247] MOVAS cells at 3 days of synthetic media were incubated with EVs (1 x 109EVs mL micelles (250 nM miR-145), LNPs (250 nM miR-145), or PBS in serum-free media. Following the 4 h incubation period, the media was replaced with healthy DMEM for 20 h (N = 3). Cells were then lysed with RIPA buffer and total cellular protein was quantified using a BCA assay. KLF4 protein was quantified using a mouse KLF4 sandwich enzyme-linked immunosorbent assay (ELISA) (Abeam, UK) according to manufacturer's protocol and normalized to total cellular protein.

[0248] Functional Assays on VSMCs

[0249] To assess cholesterol efflux, MOVAS were activated with 10 pg ml ' of cholesterol- methyl-P-cyclodextrin for 72 h. Then, following the manufacturer's protocol (Abeam, Cambridge, United Kingdom), MOVAS were loaded overnight with fluorescently-labeled cholesterol before treatment with EVs (1 x 109EVs ml.1), micelles (0.01 nM or 250 nM miR-145), or LNPs (0.01 nM or 250 nM miR-145) for 4 h (N = 3). The amount of cholesterol effluxed out of cells was quantified via fluorescence. Additionally, a migration assay was performed on synthetic MOVAS. MOVAS cells were induced into a synthetic phenotype and treated with EVs (1 x 109EVs mL '), micelles (0.01 nM or 250 nM miR-145), or LNPs (0.01 nM or 250 nM miR-145) for 4 h. Afterwards, a wound in the monolayer of cells was created with a pipette tip and cells migrating into the wound region were imaged using a fluorescence microscope (Leica DMi8, Leica, Germany). Cells were counted after 24 h using brightfield images and quantified with ImageJ.10250] In Vivo Treatment

[0251] Female, 4-month-old ApoE ' mice (Jackson Laboratory, ME, USA) were fed a Western diet for 10 weeks (Envigo, UK). Mice were injected with MCP-l-miR-145-EVs, miR-145-EVs, MOVAS EVs (N= 6, 1 x 109EVs per gram bodyweight), MCP-l-miR-145 LNP and micelles (0.001 mg miR-145 / gram bodyweight), and PBS every 5 days for 30 days. MCP-l-miR-145 micelles and LNPs were modified with DSPE-PEG-Cy7 and MCP-l-miR-145, miR-145 EVs, and MOVAS EVs were labeled with DiR for a final injection to evaluate biodistribution. Mice were then euthanized after 24 h and the aorta and organs harvested, including the heart, lungs, liver, kidneys, spleen, stomach, and intestines. Harvested tissues were embedded in OCT compound, flash frozen in 2- methylbutane and liquid nitrogen, and sectioned using a cryostat (10 pm thickness, Leica CM3O5OS, Leica, Germany). Tissue sections were then stained with hematoxylin and eosin (H&E) or Oil Red O counterstained with hematoxylin, mounted, and imaged using a brightfield microscope (Leica DMi8). Immunohistochemical analysis of galectin-3 was also performed. Briefly, slides were fixed in 4% PFA blocked with 5% normal goat serum, immunostained with rat anti-mouse galectin-3 (1 :500 dilution, Invitrogen, CA, USA) and anti -rat Alexa Fluor 594 secondary antibodies (1 : 1000, Invitrogen, CA, USA), and counterstained with 2 pg ml. DAPI, and imaged using a DMi8 inverted fluorescence microscope. Animal protocols (20504-CR014) were approved by the University of Southern California Institutional Animal Care and Use Committee (IACUC, A-3518-01).

[0252] Whole Tissue Gene Expression

[0253] Mouse abdominal aorta and renal bifurcation was harvested, weighed, and lysed with Trizol (Invitrogen, CA, USA). Real-time PCR was conducted on a CFX384 (Bio-Rad, CA, USA) to evaluate tissue miR-145, ACTA2, MYH11, KLF4. GAPDH or RNU6 was used as an internal loading control. The 2V''CT method was used to calculate relative expression changes.[0254| In Vivo Evaluation of Biocompatibility and Toxicity[0255| Blood urea nitrogen (BUN, Bioo Scientific, TX, USA) and serum creatinine (Crystal Chem, IL, USA) levels were measured in mouse serum following manufacturer's protocols to assess any renal toxicity. Alanine transaminase (ALT, Sigma Aldrich, MO, USA) and aspartate transferase (AST, Sigma Aldrich, MO, USA) activity was measured in mouse serum following manufacturer's protocol to assess liver health.[0256J Statistical Analysis

[0257] Results were expressed as means ± standard deviation (S.D.). K-S normality test was used to determine normal distribution for further statistical analysis. Two-tailed Student / -tests were used to determine statistical significance between two groups, while a one-way analysis of variance (ANOVA) was used to determine statistical significance between more than two groups. A p- value < 0.05 was considered statistically significant. All statistical analyses were conducted using GraphPad Prism 8 (GraphPad Software, CA, USA).

[0258] While exemplary embodiments are described above, it is not intended that these embodiments describe all possible forms of the invention. Rather, the words used in the specification are words of description rather than limitation, and it is understood that various changes may be made without departing from the spirit and scope of the invention. Additionally, the features of various implementing embodiments may be combined to form further embodiments of the invention.|'<)259] References|0260] [1] M. Vaduganathan, et al., The global burden of cardiovascular diseases and risk, J.Am. Coll. Cardiol. 80 (25) (2022) 2361-2371.

[0261] [2] M. Li, et al., The influence of cardiac valvular calcification on all-cause and cardiovascular mortality in maintenance hemodialysis patients, Int. Urol. Nephrol. 52 (5) (2020) 943- 951.

[0262] [3] A. Lehker, D. Mukherjee, Coronary calcium risk score and cardiovascular risk,Curr. Vase. Pharmacol. 19 (3) (2021) 280-284.

[0263] [4] A. Javaid, et al., Distribution of coronary artery calcium by age, sex, and race among patients 30-45 years old, J. Am. Coll. Cardiol. 79 (19) (2022) 1873-1886.

[0264] [5] P. Lanzer, et al., Medial vascular calcification revisited: review and perspectives,Eur. Heart J. 35 (23) (2014) 1515-1525.

[0265] [6] G.L. Basatemur, et al., Vascular smooth muscle cells in atherosclerosis, Nat. Rev.Cardiol. 16 (12) (2019) 727-744.

[0266] [7] M.R. Bennett, S. Sinha, G.K. Owens, Vascular smooth muscle cells in atherosclerosis, Circ. Res. 1 18 (4) (2016) 692-702.

[0267] [8] M.O.J. Grootaert, M.R. Bennett, Vascular smooth muscle cells in atherosclerosis: time for a re-assessment, Cardiovasc. Res. 117 (11) (2021) 2326-2339.

[0268] [9] M.Y. Speer, et al., Smooth muscle cells give rise to osteochondrogenic precursors and chondrocytes in calcifying arteries, Circ. Res. 104 (6) (2009) 733-741.[0269[

[0010] A.L. Durham, et al., Role of smooth muscle cells in vascular calcification: implications in atherosclerosis and arterial stiffness, Cardiovasc. Res. 114 (4) (2018) 590-600.[0270|

[0011] M. Wu, C. Rementer, C M. Giachelli, Vascular calcification: an update on mechanisms and challenges in treatment, Calcif Tissue Int. 93 (4) (2013) 365-373.

[0271]

[0012] H. Peng, et al., MiR-133a inhibits fracture healing via targeting RUNX2 / BMP2,Eur. Rev. Med. Pharmacol. Sci. 22 (9) (2018) 2519-2526.

[0272]

[0013] L. Cheng, A.F. Hill, Therapeutically harnessing extracellular vesicles, Nat. Rev.Drug Discov. 21 (5) (2022) 379-399.

[0273]

[0014] D.E. Murphy, et al., Extracellular vesicle-based therapeutics: natural versus engineered targeting and trafficking, Exp. Mol. Med. 51 (3) (2019) 1-12.[0274|

[0015] D.E. Murphy, et al., Natural or synthetic RNA delivery: a stoichiometric comparison of extracellular vesicles and synthetic nanoparticles, Nano Lett. 21 (4) (2021) 1888-1895.[0275|

[0016] C. Chen, et al., Active cargo loading into extracellular vesicles: highlights the heterogeneous encapsulation behaviour, J. Extracell. Vesicles 10 (13) (2021) el2163.

[0276]

[0017] Y. Han, et al., Overview and update on methods for cargo loading into extracellular vesicles, Processes 9 (2) (2021).10277]

[0018] S. Sadeghi, et al., Exosome engineering in cell therapy and drug delivery,Inflammopharmacology 31 (1) (2023) 145-169.

[0278]

[0019] X. Luan, et al., Engineering exosomes as refined biological nanoplatforms for drug delivery, Acta Pharmacol. Sin. 38 (6) (2017) 754-763.

[0279]

[0020] M. Muskan, et al., Therapeutic potential of RNA-Enriched extracellular vesicles: the next generation in RNA delivery via biogenic nanoparticles, Mol. Ther. 32 (9) (2024) 2939-2949.

[0280]

[0021] C.A. Rene, R.J. Parks, Bioengineering extracellular vesicle cargo for optimal therapeutic efficiency, Molecular Therapy Methods & Clinical Development 32 (2) (2024).[0281 [

[0022] S. Bheri, et al., Customized loading of microRNA-126 to small extracellular vesicle- derived vehicles improves cardiac function after myocardial infarction, ACS Nano 17 (20) (2023) 19613-19624.

[0282]

[0023] M. Albanese, et al., MicroRNAs are minor constituents of extracellular vesicles that are rarely delivered to target cells, PLoS Genet. 17 (12) (2021) el009951.10283]

[0024] W. Yang, et al., Mesenchymal stem-cell-derived exosomal miR-145 inhibits atherosclerosis by targeting JAM-A, Mol. Ther. Nucleic Acids 23 (2021) 119-131.

[0284]

[0025] L. Lu, W. Ling, Z. Ruan, TAM-derived extracellular vesicles containing microRNA-29a-3p explain the deterioration of ovarian cancer, Mol. Ther. Nucleic Acids 25 (2021) 468-482.

[0285]

[0026] R. Garcia-Martin, et al., MicroRNA sequence codes for small extracellular vesicle release and cellular retention, Nature 601 (7893) (2022) 446-451.

[0286]

[0027] G. Lo Sasso, et al., The Apoe(- / -) mouse model: a suitable model to study cardiovascular and respiratory diseases in the context of cigarette smoke exposure and harm reduction, J. Transl. Med. 14 (1) (2016) 146.

[0287]

[0028] K.S. Meir, E. Leitersdorf, Atherosclerosis in the apolipoprotein E-Deficient mouse, Arterioscler. Thromb. Vase. Biol. 24 (6) (2004) 1006-1014.

[0288]

[0029] D.D. Chin, et al., Hydroxyapatite-binding micelles for the detection of vascular calcification in atherosclerosis, J. Mater. Chem. B 7 (41) (2019) 6449-6457.

[0289]

[0030] A.N. Kapustin, et al., Vascular smooth muscle cell calcification is mediated by regulated exosome secretion, Circ. Res. 116 (8) (2015) 1312-1323.

[0290]

[0031] W. Pustlauk, et al., Induced osteogenic differentiation of human smooth muscle cells as a model of vascular calcification, Sci. Rep. 10 (1) (2020) 5951.[0291 [

[0032] A. Koutsoulidou, et al., Expression of miR-1, miR-133a, miR-133b and miR-206 increases during development of human skeletal muscle, BMC Dev. Biol. 11 (2011) 34.[02921

[0033] K. Shintani-Ishida, R. Tsurumi, H. Ikegaya, Decrease in the expression of musclespecific miRNAs, miR-133a and miR-1, in myoblasts with replicative senescence, PLoS One 18 (1) (2023) e0280527.

[0293]

[0034] S. Zhu, et al., Cell signaling and transcriptional regulation of osteoblast lineage commitment, differentiation, bone formation, and homeostasis, Cell Discovery 10 (1) (2024) 71.

[0294]

[0035] Q. Zhang, et al., Comprehensive isolation of extracellular vesicles and nanoparticles, Nat. Protoc. 18 (5) (2023) 1462-1487.[0295[

[0036] N. Viphakone, et al., Co-transcriptional loading of RNA export factors shapes the human transcriptome, Mol. Cell 75 (2) (2019) 310-323. e8.[0296|

[0037] T. Zhang, et al., FUS regulates activity of MicroRNA-Mediated gene silencing,Mol. Cell 69 (5) (2018) 787-80 l.e8.

[0297]

[0038] G. Bjorklund, et al., The role of Matrix Gia Protein (MGP) in vascular calcification, Curr. Med. Chem. 27 (10) (2020) 1647-1660.|0298]

[0039] N.J. Patel, A. Ashraf, E.J. Chung, Extracellular vesicles as regulators of the extracellular matrix, Bioengineering (Basel) 10 (2) (2023).

[0299]

[0040] L. Yaker, et al., Extracellular vesicles from LPS-Treated macrophages aggravate smooth muscle cell calcification by propagating inflammation and oxidative stress, Front. Cell Dev. Biol. 10 (2022).

[0300]

[0041] M.D. Roy, et al., Identification of a highly specific hydroxyapatite-binding peptide using phage display, Adv. Mater. 20 (10) (2008) 1830-1836.[03011

[0042] T. Duanis-Assaf, et al., Understanding the adhesion mechanism of hydroxyapatitebinding peptide, Langmuir 38 (3) (2022) 968-978.

[0302]

[0043] A.C. Montezano, et al., Vascular smooth muscle cell differentiation to an osteogenic phenotype involves TRPM7 modulation by magnesium, Hypertension 56 (3) (2010) 453- 462.|0303]

[0044] S. Rayamajhi, S. Aryal, Surface functionalization strategies of extracellular vesicles, J. Mater. Chem. B 8 (21) (2020) 4552-4569.

[0304]

[0045] D. Zheng, et al., Advances in extracellular vesicle functionalization strategies for tissue regeneration, Bioact. Mater. 25 (2023) 500-526.

[0305]

[0046] A.S. Kashirina, et al., Monitoring membrane viscosity in differentiating stem cells using BODIPY-based molecular rotors and FLIM, Sci. Rep. 10 (1) (2020) 14063.

[0306]

[0047] A. Greco, et al., Molecular imaging and quantification of smooth muscle cell and aortic tissue calcification in vitro and ex vivo with a fluorescent hydroxyapatite-specific probe, Biomedicines 10 (2022), https: / / doi.org / 10.3390 / biomedicinesl0092271|0307]

[0308]

[0048] C.M. Prado, et al., Turbulent blood flow plays an essential localizing role in the development of atherosclerotic lesions in experimentally induced hypercholesterolaemia in rats, Int. J. Exp. Pathol. 89 (1) (2008) 72-80.

[0309]

[0049] A. Trion, et al., Modulation of calcification of vascular smooth muscle cells in culture by calcium antagonists, statins, and their combination, Mol. Cell. Biochem. 308 (1-2) (2008) 25-33.

[0310]

[0050] X.B. Liao, et al., MiR-133a modulates osteogenic differentiation of vascular smooth muscle cells, Endocrinology 154 (9) (2013) 3344-3352.[03111

[0051] S. Narisawa, et al., Novel inhibitors of alkaline phosphatase suppress vascular smooth muscle cell calcification, J. Bone Miner. Res. 22 (11) (2007) 1700-1710.

[0312]

[0052] V.A. Myasoedova, P. Poggio, A. Parolari, A prominent role of D-dimer in inflammation and atherosclerosis, Vessel Plus 1 (2017) 96-97.

[0313]

[0053] W. Koenig, et al., Plasma fibrin D-Dimer levels and risk of stable coronary artery disease, Arterioscler. Thromb. Vase. Biol. 21 (10) (2001) 1701-1705.

[0314]

[0054] P. Gong, et al., Plasma d-Dimer as a useful marker predicts severity of atherosclerotic lesion and short-term outcome in patients with coronary artery disease, Clin. Appl. Thromb. Hemost. 22 (7) (2016) 633-640.

[0315]

[0055] G.P. Otto, et al., Clinical Chemistry Reference Intervals for C57BL / 6J,C57BL / 6N, and C3HeB / FeJ Mice (Mus musculus), J Am Assoc Lab Anim Sci 55 (4) (2016) 375- 386.

[0316]

[0056] D. Zhu, et al., Mechanisms and clinical consequences of vascular calcification,Front. Endocrinol. 3 (2012) 95.

[0317]

[0057] E. Charla, et al., Extracellular vesicle signalling in atherosclerosis, Cell. Signal.75 (2020) 109751.

[0318]

[0058] N. Patel, D.D. Chin, E.J. Chung, Exosomes in atherosclerosis, a double-edged sword: their role in disease pathogenesis and their potential as novel therapeutics, AAPS J. 23 (5) (2021) 95.

[0319]

[0059] W.M. Usman, et al., Efficient RNA drug delivery using red blood cell extracellular vesicles, Nat. Commun. 9 (1) (2018) 2359.|0320]

[0060] Z.A. Nizamudeen, et al., Low-power sonication can alter extracellular vesicle size and properties, Cells 10 (9) (2021).

[0321]

[0061] K. O’Brien, et al., RNA delivery by extracellular vesicles in mammalian cells and its applications, Nat. Rev. Mol. Cell Biol. 21 (10) (2020) 585-606.[0322[

[0062] R.C. de Abreu, et al., Exogenous loading of miRNAs into small extracellular vesicles, J. Extracell. Vesicles 10 (10) (2021) el2111.[0323|

[0063] N. Curley, et al., Sequential deletion of CD63 identifies topologically distinct scaffolds for surface engineering of exosomes in living human cells, Nanoscale 12 (22) (2020) 12014- 12026.

[0324]

[0064] K.I. Mentkowski, J.K. Lang, Exosomes engineered to express a cardiomyocyte binding peptide demonstrate improved cardiac retention in vivo, Sci. Rep. 9 (1) (2019) 10041.

[0325]

[0065] J. Wang, Z. Gao, P. Gao, MiR-133b modulates the osteoblast differentiation to prevent osteoporosis via targeting GNB4, Biochem. Genet. 59 (5) (2021) 1 146-1157.[0326[

[0066] Y. Zhou, et al., MiR-133a delivery to osteoblasts ameliorates mechanical unloading-triggered osteopenia progression in vitro and in vivo, Int. Immunopharmacol. 97 (2021) 107613.

[0327]

[0067] H. Inose, et al., A microRNA regulatory mechanism of osteoblast differentiation,Proc. Natl. Acad. Sci. 106 (49) (2009) 20794-20799.|<)328}

[0068] W. Zhang, et al., miRNA-133a-5p inhibits the expression of osteoblast differentiation-associated markers by targeting the 3’ UTR of RUNX2, DNA Cell Biol. 37 (3) (2018) 199-209.

[0329]

[0069] A.M. Cobb, et al., Runx2 (Runt-Related transcription factor 2) links the DNA damage response to osteogenic reprogramming and apoptosis of vascular smooth muscle cells, Arterioscler. Thromb. Vase. Biol. 41 (4) (2021) 1339-1357.

[0330]

[0070] T. Driedonks, et al., Pharmacokinetics and biodistribution of extracellular vesicles administered intravenously and intranasally to Macaca nemestrina, Journal of Extracellular Biology 1 (10) (2022) e59.

[0331]

[0071] C. Roderburg, et al., miR-133a mediates TGF-0-dependent derepression of collagen synthesis in hepatic stellate cells during liver fibrosis, J. Hepatol. 58 (4) (2013) 736-742.

[0332]

[0072] G. Zhang, et al., Extracellular vesicles: natural liver-accumulating drug delivery vehicles for the treatment of liver diseases, J. Extracell. Vesicles 10 (2) (2020) el2030.|0333]

[0073] Melamed, J.R., et al., Ionizable lipid nanoparticles deliver mRNA to pancreatic cells via macrophage-mediated gene transfer, Sci. Adv. 9 (4) (2023) eadel444.

[0334]

[0074] T.N. Lamichhane, et al., Oncogene knockdown via active loading of small RNAs into extracellular vesicles by sonication, Cell. Mol. Bioeng. 9 (3) (2016) 315-324.

[0335]

[0075] A. J. Lennard, et al., Optimised electroporation for loading of extracellular vesicles with Doxorubicin, Pharmaceutics 14 (1) (2021).

[0336]

[0076] M.A.C. Pomatto, et al., Improved loading of plasma-derived extracellular vesicles to encapsulate antitumor miRNAs, Molecular Therapy - Methods & Clinical Development 13 (2019) 133-144.

[0337]

[0077] Y. Wen, et al., Cell-derived nanovesicles prepared by membrane extrusion are good substitutes for natural extracellular vesicles, Extracellular Vesicle 1 (2022) 100004.

[0338]

[0078] C.L. Alter, et al., High efficiency preparation of monodisperse plasma membrane derived extracellular vesicles for therapeutic applications, Commun. Biol. 6 (1) (2023) 478.

[0339]

[0079] J. Roerig, et al., Synergistic siRNA loading of extracellular vesicles enables functional delivery into cells, Small Methods 6 (12) (2022) 2201001.|0340]

[0080] A.I. Salazar-Puerta, et al., Engineered extracellular vesicles derived from dermal fibroblasts attenuate inflammation in a murine model of acute lung injury, Adv. Mater. 35 (28) (2023) 2210579.[03411

[0081] S. Baldari, et al., Extracellular vesicles-encapsulated MicroRNA-125b produced in genetically modified mesenchymal stromal cells inhibits hepatocellular carcinoma cell proliferation, Cells 8 (12) (2019).

[0342]

[0082] M. Morente-Lopez, et al., Effect of miR-21 in mesenchymal stem cells-derived extracellular vesicles behavior, Stem Cell Res. Ther. 14 (1) (2023) 383.

[0343]

[0083] W. Herrington, B. Lacey, P. Sherliker, J. Armitage, S. Lewington, Circ. Res. 2016,118, 535.

[0344]

[0084] S. S. Virani, JAMA Network Open 2022, 5, 2228538.

[0345]

[0085] P. Amarenco, J. Labreuche, P. Lavallee, P. J. Touboul, Stroke 2004, 35, 2902.

[0346]

[0086] G. L. Basatemur, H. F. Jorgensen, M. C. H. Clark, M. R. Bennett, Z. Mallat, Nat.Rev. Cardiol. 2019, 16, 727.[0347[

[0087] M. R. Bennett, S. Sinha, G. K. Owens, Circ Res. 2016, 118, 692.

[0348]

[0088] D. D. Chin, C. Poon, J. Wang, J. Joo, V. Ong, Z. Jiang, E. J. Chung, Biomaterials2021, 273, 120810.

[0349]

[0089] D. D. Chin, N. Patel, W. Lee, S. Kanaya, J. Cook, E. J. Chung, Bioactive Materials2023, 27, 327.

[0350]

[0090] N. Patel, D. D. Chin, G. A. Magee, E. J. Chung, Frontiers in Digital Health 2022,4.

[0351]

[0091] R. Shang, S. Lee, G. Senavirathne, E. C. Lai, Nat. Rev. Genet. 2023, 24, 816.

[0352]

[0092] Y. Wei, M. Nazari-Jahantigh, P. Neth, C. Weber, A. Schober, Arterioscler.,Thromb., Vase. Biol. 2013, 33, 449.10353]

[0093] Y. Ju, J.M. Carreno, V. Simon, K. Dawson, F. Krammer, S. J. Kent, Nat. Rev.Immunol. 2023, 23, 135.

[0354]

[0094] B.-M. Chen, T.-L. Cheng, S. R. Roffler, ACS Nano 2021, 15, 14022.

[0355]

[0095] M. J. Mitchell, M. M. Billingsley, R. M. Haley, M. E. Wechsler, N. A. Peppas, R.L. Langer, Nat. Rev. Drug Discovery 2021, 20, 101.

[0356]

[0096] Y. Pie, P. J. Hancock, H. Zhang, R. Bartz, C. Cherrin, N. Innocent, C. J.Pomerantz, J. Seitzer, M. L. Koser, M. T. Abrams, Y. Xu, N. A. Kuklin, P. A. Burke, A. B. Sachs, L. Sepp-Lorenzino, S. F. Barnett, RNA 2010, 16, 2553.

[0357]

[0097] A. Wittrup, A. Ai, X. Liu, P. Hamar, R. Trifonova, K. Charisse, M. Manoharan,T. Kirchhausen, J. Lieberman, Nat. Biotechnol. 2015, 33, 870.

[0358]

[0098] M. Yanez-M6, P. R.-M. Siljander, Z. Andreu, A. Bedina Zavec, F. E. Borras, E. I.Buzas, K. Buzas, E. Casal, F. Cappello, J. Carvalho, E. Colas, A. Cordeiro-da Silva, S. Fais, J. M. Falcon-Perez, I. M. Ghobrial, B. Giebel, M. Gimona, M. Graner, I. Gursel, M. Gursel, N. H. H. Heegaard, A. Hendrix, P. Kierulf, K. Kokubun, M. Kosanovic, V. Kralj-Iglic, E.-M. Kramer- Albers, S. Laitinen, C. Lasser, T. Lener, et al., J Extracell Vesicles 2015, 4, 27066.

[0359]

[0099] D. E. Murphy, O. G. de Jong, M. J. W. Evers, M. Nurazizah, R. M. Schiffelers, P.Vader, Nano Lett. 2021, 21, 1888.|0360]

[0100] K. W. Witwer, J. Wolfram, Nat. Rev. Mater. 2021, 6, 103.|0361]

[0101] C. A. Rene, R. J. Parks, Mol Ther Methods Clin Dev 2024, 32, 101259.|0362]

[0102] H. I. Kim, J. Park, Y. Zhu, X. Wang, Y. Han, D. Zhang, Exp. Mol. Med. 2024,56, 836.

[0363]

[0103] A. N. Kapustin, M. L. L. Chatrou, I. Drozdov, Y. Zheng, S. M. Davidson, D.Soong, M. Furmanik, P. Sanchis, R. T. M. De Rosales, D. Alvarez-Hernandez, R. Shroff, X. Yin, K. Muller, J. N. Skepper, M. Mayr, C. P. Reutelingsperger, A. Chester, S. Bertazzo, L. J. Schurgers, C. M. Shanahan, Circ. Res. 2015, 116, 1312.[0364[

[0104] L. Zisser, C. J. Binder, J Lipid Atheroscler 2024, 13, 232.[0365|

[0105] R. Garcia-Martin, G. Wang, B. B. Brandao, T. M. Zanotto, S. Shah, S. KumarPatel, B. Schilling, C. R. Kahn, Nature 2022, 601, 446.

[0366]

[0106] T. Zhang, Y.-C. Wu, P. Mullane, Y. J. Ji, H. Liu, L. He, A. Arora, H.-Y. Hwang,A. F. Alessi, A. G. Niaki, G. Periz, L. Guo, H. Wang, E. Elkayam, L. Joshua-Tor, S. Myong, J. K. Kim, J. Shorter, S.-E. Ong, A. K. L. Leung, J. Wang, Mol. Cell 2018, 69, 787.

[0367]

[0107] M. Shi, H. Zhang, X. Wu, Z. He, L. Wang, S. Yin, B. Tian, G. Li, H. Cheng,Nucleic Acids Res. 2017, 45, 9640.

[0368]

[0108] G. Spinetti, M. Wang, R. Monticone, J. Zhang, D. Zhao, E. G. Lakatta,Arterioscler Thromb Vase Biol 2004, 24, 1397.[0369|

[0109] Y. Fu, D. Ma, Y. Liu, H. Li, J. Chi, W. Liu, F. Lin, J. Hu, X. Zhang, M. Zhu, Y.Zhao, X. Yin, Laboratory Investigation 2015, 95, 1246.

[0370] [HO] P. Lacolley, V. Regnault, A. Nicoletti, Z. Li, J.-B. Michel, Cardiovasc. Res. 2012, 95, 194.

[0371] [H l] M. Muskan, P. Abeysinghe, R. Cecchin, H. Branscome, K. V. Morris, F. Kashanchi, Mol. Ther. 2024, 32, 2939.

[0372] [H2] Y. Han, T. W. Jones, S. Dutta, Y. Zhu, X. Wang, S. P. Narayanan, S. C. Fagan,D. Zhang, Processes (Basel) 2021, 9, 356.

[0373]

[0113] A. Das, Biologies 2024, 4, 88.

[0374] [H4] A. A. Danilushkina, C. C. Emene, N. A. Barlev, M. O. Gomzikova, Int. J. Mol.Sci. 2023, 24, 13247.

[0375]

[0115] J. N. Ziegler, C. Tian, Int. J. Mol. Sci. 2023, 24, 15206.

[0376] [H6] Q. Zhang, D. K. Jeppesen, J. N. Higginbotham, J. L. Franklin, R. J. Coffey, Nat.Protoc. 2023, 18, 1462.

[0377] [H7] J. A. Welsh, D. C. I. Goberdhan, L. O’Driscoll, E. I. Buzas, C. Blenkiron, B.Bussolati, H. Cai, D. Di Vizio, T. A. P. Driedonks, U. Erdbriigger, J. M. Falcon-Perez, Q.-L. Fu, A.F. Hill, M. Lenassi, S. K. Lim, M. G. Mahoney, S. Mohanty, A. Moller, R. Nieuwland, T. Ochiya, S. Sahoo, A. C. Torrecilhas, L. Zheng, A. Zijlstra, S. Abuelreich, R. Bagabas, P. Bergese, E. M. Bridges, M. Brucale, D. Burger, et al., J. Extracell. Vesicles 2024, 13, 12404.|0378]

[0118] G. Midekessa, K. Godakumara, J. Ord, J. Viil, F. Lattekivi, K. Dissanayake, S.Kopanchuk, A. Rinken, A. Andronowska, S. Bhattacharjee, T. Rinken, A. Fazeli, ACS Omega 2020, 5, 16701.[0379| [H9] R. A. Boon, E. Hergenreider, S. Dimmeler, Thromb. Haemost. 2012, 108, 616.[0380|

[0120] T. Andreou, X. Sun, P. H. Stone, E. R. Edelman, M. W. Feinberg, Trends Mol.Med. 2015, 21, 307.

[0381]

[0121] S. Damian-Zamacona, P. Toledo-Ibelles, M. Z. Ibarra-Abundis, L. Uribe-Figureueroa, E. Hernandez-Lemus, K. P. Macedo-Alcibia, B. Delgado-Coello, J. Mas-Oliva, J. P. Reyes-Grajeda, PLoS One 2016, 11, 0163924.

[0382]

[0122] T. T. H. Thi, E. J. A. Suys, J. S. Lee, D. H. Nguyen, K. D. Park, N. P. Truong,Vaccines (Basel) 2021, 9, 359.

[0383]

[0123] K. Gokita, J. Inoue, H. Ishihara, K. Kojima, J. Inazawa, Molecular TherapyNucleic Acids 2020, 19, 330.

[0384]

[0124] R. Chen, D. G. McVey, D. Shen, X. Huang, S. Ye, J. Am. Heart Assoc. 2023,12, 031 121.

[0385]

[0125] S. Mukheiji, M. S. Ebert, G. X. Y. Zheng, J. S. Tsang, P. A. Sharp, A. vanOudenaarden, Nat. Genet. 2011, 43, 854.

[0386]

[0126] G. Cao, X. Xuan, J. Hu, R. Zhang, H. Jin, H. Dong, Cell Commun. Signaling2022, 20, 180.[0387[

[0127] O. Oladosu, I. C. Esobi, R. R. Powell, T. Bruce, A. Stamatikos, J Cardiovasc DevDis 2023, 10, 416.[0388|

[0128] Y. Vengrenyuk, H. Nishi, X. Long, M. Ouimet, N. Savji, F. O. Martinez, C. P.Cassella, K. J. Moore, S. A. Ramsey, J. M. Miano, E. A. Fisher, Arterioscler., Thromb., Vase. Biol. 2015, 35, 535.

[0389]

[0129] Y.-Q. Zhou, S.-N. Zhu, F. S. Foster, M. I. Cybulsky, R. M. Henkelman,Arterioscler. Thromb. Vase. Biol. 2010, 30, 1181.

[0390]

[0130] I. Hetherington, H. Totary-Jain, Mol. Ther. 2022, 30, 3106.

[0391]

[0131] R. Reshke, J. A. Taylor, A. Savard, H. Guo, L. H. Rhym, P. S. Kowalski, M. T.Trung, C. Campbell, W. Little, D. G. Anderson, D. Gibbings, Nat. Biomed. Eng. 2020, 4, 52.[0392|

[0132] T. J. Beldman, T. S. Malinova, E. Desclos, A. E. Grootemaat, A. L. S. Misiak, S. van der Velden, C. P. A. A. van Roomen, L. Beckers, H. A. van Veen, P. M. Krawczyk, R. A. Hoebe, J. C. Sluimer, A. E. Neele, M. P. J. de Winther, N. N. van der Wei, E. Lutgens, W. J. M. Mulder, S. Huveneers, E. Kluza, ACS Nano 2019, 13, 13759.

[0393]

[0133] Z. Zhou, C.-F. Yeh, M. Melias, M.-J. Oh, J. Zhu, J. Li, R.-T. Huang, D. L.Harrison, T.-P. Shentu, D. Wu, M. Lueckheide, L. Carver, E. J. Chung, L. Leon, K.-C. Yang, M. V. Tirrell, Y. Fang, Proc. Natl. Acad. Sci. USA 2021, 118, 2114842118.

[0394]

[0134] H. M. Ramos-Zaldivar, I. Polakovicova, E. Salas-Huenuleo, A. H. Corvalan, M.J. Kogan, C. P. Yefi, M. E. Andia, Fluids and Barriers of the CNS 2022, 19, 60.

[0395]

[0135] L. Alvarez-Erviti, Y. Seow, H. Yin, C. Betts, S. Lakhal, M. J. A. Wood, Nat.Biotechnol. 2011, 29, 341.

[0396]

[0136] N. J. Patel, A. Ashraf, E. J. Chung, Bioengineering (Basel) 2023, 10, 136.

[0397]

[0137] S. Lenzini, R. Bargi, G. Chung, J.-W. Shin, Nat. Nanotechnol. 2020, 15, 217.

[0398]

[0138] W. Wang, L. Chen, C. Shang, Z. Jin, F. Yao, L. Bai, R. Wang, S. Zhao, E. Liu,J. Cell. Mol. Med. 2020, 24, 6658.

[0399]

[0139] X. Guo, D. Li, M. Chen, L. Chen, B. Zhang, T. Wu, R. Guo, Sci. Rep. 2016, 6,35302.[0400|

[0140] L. Li, D. Mao, C. Li, M. Li, Med Sci Monit 2018, 24, 4894.[04011

[0141] J. Chen, H. Yin, Y. Jiang, S. K. Radhakrishnan, Z.-P. Huang, J. Li, Z. Shi, E. P.C. Kilsdonk, Y. Gui, D.-Z. Wang, X.-L. Zheng, Arterioscler., Thromb., Vase. Biol. 2011, 31, 368.

[0402]

[0142] S. Li, F. Zhi, M. Hu, X. Xue, Y. Mo, Int Urol Nephrol 2022, 54, 217.

[0403]

[0143] Y. Li, L. Yan, W. Zhang, N. Hu, W. Chen, H. Wang, M. Kang, H. Ou, Am. J.Transl. Res. 2014, 6, 507.

[0404]

[0144] J. R. Melamed, S. S. Yemeni, M. L. Arral, S. T. LoPresti, N. Chaudhary, A.Sehrawat, H. Muramatsu, M.-G. Alameh, N. P. Pardi, D. Weissman, G. K. Gittes, K. A. Whitehead, Sci. Adv. 2023, 9, adel444.

[0405]

[0145] M. A. C. Depuydt, K. H. M. Prange, L. Slenders, T. Ord, D. Elbersen, A. Boltjes,S. C. A. de Jager, F. W. Asselbergs, G. J. de Borst, E. Aavik, T. Lonnberg, E. Lutgens, C. K. Glass, H. M. den Ruijter, M. U. Kaikkonen, I. Bot, B. Slutter, S. W. van der Laan, S. Yla-Herttuala, M. Mokry, J. Kuiper, M. P. J. de Winther, G. Pasterkamp, Circ. Res. 2020, 127, 1437.

[0406]

[0146] N. Trac, Z. Chen, H.-S. Oh, L. Jones, Y. Huang, J. Giblin, M. Gross, N. S. StaMaria, R. E. Jacobs, E. J. Chung, ACS Nano 2024, 18, 2091 .

[0407]

[0147] D. D. Chin, J. Wang, M. Mel de Fontenay, A. Plotkin, G. A. Magee, E. J. Chung,J. Mater. Chem. B 2019, 7, 6449.

Claims

77WHAT IS CLAIMED IS:

1. A biological nanoparticle for targeted therapeutic delivery comprising: a plurality of extracellular vesicles, wherein each extracellular vesicle includes: a microRNA modified with an ExoMotif sequence to enhance selective loading of the microRNA into the extracellular vesicle, the microRNA configured to inhibit plaque formation and vascular calcification; and a hydroxyapatite-binding peptide (HABP) attached to a surface of the extracellular vesicle, configured to target calcified tissues.

2. The biological nanoparticle of claim 1, wherein the microRNA comprises a component selected from the group consisting of miR-1, miR-21, miR-25-3p, miR-126-3p, miR-133a, miR-142- 3p, miR-143 / 145, miR-146a, miR-150-5p, miR-221, and members of the let-7 family, and combinations thereof3. The biological nanoparticle of claim 1, wherein the microRNA comprises one or more members of the miR-133 family, selected from the group consisting of precursor miR-133a-l, miR- 133a-2, and miR-133b, and the corresponding mature sequences miR-133a-3p, miR-133a-5p, miR- 133b-3p, and miR-133b-5p.

4. The biological nanoparticle of claim 1, wherein the microRNA is miR-145.

5. The biological nanoparticle of claim 1 , wherein the ExoMotif sequences are configured to bind to RNA-binding proteins during biogenesis to promote selective incorporation of the microRNA into the extracellular vesicles.

6. The biological nanoparticle of claim 1, wherein the ExoMotif sequences include a component selected from the group consisting of CGGGAG, CAUG, UGUG, or GGAG, and combinations thereof.

7. The biological nanoparticle of claim 1, wherein the hydroxyapatite-binding peptide (HABP) comprises a sequence selected from CSVSVGMKPSPRP (SEQ ID NO: 1) or derivatives thereof.

8. The biological nanoparticle of claim 1 further comprising a targeting peptide that includes a CCR2 binding motif of MCP-1.

789. The biological nanoparticle of claim 8, wherein the targeting peptide includes a component selected from the group consisting of MCP-1 a sequence having CYNFTNRKISVQRLASYRRITSSK (SEQ ID NO: 2), a VLA-4 peptide having sequence CVHPKQHR (SEQ ID NO: 3), a fibrin-targeting peptide having sequence CREKA (SEQ ID NO: 4), a collagenase-targeting peptide having sequence CVPMSMRGG (SEQ ID NO: 5), and derivatives thereof, the derivatives including modification of cysteines and other functional groups on either peptide side.

10. The biological nanoparticle of claim 8, wherein the targeting peptide includes a polypeptide having sequence YNFTNRKISVQRLASYRRITSSK (SEQ ID NO: 6) or a fragment thereof that binds to CCR2.

11. The biological nanoparticle of claim 1, wherein the microRNA is configured to inhibit osteochondrogenic transformation of vascular smooth muscle cells (VSMCs) and promote a contractile phenotype.

12. The biological nanoparticle of claim 1, wherein the microRNA is configured to inhibit osteochondrogenic transformation of endothelial cells, macrophages, fibroblasts, stem cells, and / or T cells.

13. The biological nanoparticle of claim 1, configured for treating atherosclerosis or chronic kidney disease.

14. The biological nanoparticle of claim 1, configured for treating vascular calcification in a subject, by delivering the microRNA to calcified vascular tissues to reduce or prevent calcification progression.

15. The biological nanoparticle of claim 1, wherein the extracellular vesicles are produced by genetically engineered vascular smooth muscle cells (VSMCs) modified to overexpress the microRNA with ExoMotif sequences, wherein the microRNA is selectively loaded into the extracellular vesicles.

16. The biological nanoparticle of any of claims 1 to 15, further comprising modifying surfaces of the extracellular vesicles to include a hydroxyapatite-binding peptide (HABP) for targeted delivery to calcified tissues.7917. The biological nanoparticle of claim 1, wherein the extracellular vesicles are derived from a mammalian cell culture of genetically engineered vascular smooth muscle cells (VSMCs), Mesenchymal Stem Cells (MSCs), monocytes, macrophages, endothelial cells, or cells of the nephron including urinary stem cells, podocytes, cortical collecting duct, proximal tubule cells, or distal tubule cells.

18. The biological nanoparticle of claim 1, wherein the extracellular vesicles have an average size range between 20-500 nm in diameter.

19. The biological nanoparticle of claim 1 , wherein the hydroxyapatite-binding peptide (HABP) provides specificity for calcified tissues, facilitating targeted delivery in therapeutic applications for treating or preventing vascular calcification.

20. A pharmaceutical composition comprising: the biological nanoparticle of any of claims 1 to 19; and a pharmaceutically acceptable carrier.

21. The pharmaceutical composition of claim 20 further comprising genetically engineered cells with ExoMotif-modified microRNA sequences that produce EV nanoparticles.

22. The pharmaceutical composition of claim 20, wherein the composition is formulated for intravenous administration.

23. A method of manufacturing extracellular vesicles for targeted therapeutic delivery, comprising: a) genetically engineering a vascular smooth muscle cell (VSMC) or other cell types to express microRNA modified with ExoMotif sequences; b) culturing the VSMC or other cell types under conditions that promote production and release of EVs in a culture medium; and80 c) isolating the extracellular vesicles from the culture medium and modifying extracellular vesicle surfaces with targeting peptides in an isolation step.

24. The method of claim 23, wherein the isolation step involves sequential centrifugation and filtration to purify the extracellular vesicles.

25. The method of claim 23, wherein the targeting peptides include hydroxyapatitebinding peptide (HABP).

26. The method of claim 25, wherein surface modification includes a conjugation process that attaches the hydroxyapatite-binding peptide (HABP) to the extracellular vesicle surfaces.

27. The method of claim 23, wherein the other cell types include endothelial cells, macrophages, fibroblasts, or T cells.

28. A method for treating vascular calcification in a subject, comprising: a) administering to the subject a therapeutically effective amount of the extracellular vesicles (EVs) of any of claims 1 to 19; and b) allowing the EVs to deliver the microRNA to calcified vascular tissues to inhibit calcification processes and promote a contractile phenotype in vascular smooth muscle cells (VSMCs).

Images