A method of one-step fabric dyeing with engineered adherent biofilm

By using pigment-producing bacteria to form adherent biofilms on fabrics, the method addresses the inefficiencies of traditional dyeing processes, enabling sustainable, cost-effective, and flexible fabric dyeing with uniform or patterned results.

WO2026092750A1PCT designated stage Publication Date: 2026-05-07SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI
Filing Date
2025-11-04
Publication Date
2026-05-07

AI Technical Summary

Technical Problem

Existing fabric dyeing processes using microbial pigments are complex, time-consuming, and costly, often requiring toxic chemicals for pigment extraction and dyeing, and do not efficiently utilize biofilm formation for direct fabric dyeing.

Method used

A method involving contacting fabrics with pigment-producing bacteria in a culture medium to form an adherent biofilm, allowing simultaneous pigment production and dyeing, and using engineered bacteria responsive to light for patterned dyeing.

Benefits of technology

Achieves a sustainable, time-saving, and cost-effective one-step fabric dyeing process with uniform or patterned dyeing capabilities, eliminating the need for toxic chemicals and reducing processing time.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025132337-FTAPPB-I100001
    Figure PCTCN2025132337-FTAPPB-I100001
  • Figure PCTCN2025132337-FTAPPB-I100002
    Figure PCTCN2025132337-FTAPPB-I100002
  • Figure PCTCN2025132337-FTAPPB-I100003
    Figure PCTCN2025132337-FTAPPB-I100003
Patent Text Reader

Abstract

The invention relates to the field of fabric dyeing. In particular, the invention relates to a method one-step fabric dyeing with engineered adherent biofilm. More particular, the present invention relates to engineering a bacterium such as Corynebacterium glutamicum so that the bacterium can produce a natural pigment and forms adherent biofilm when cultured in a culture medium. When the engineered bacterium is cultured with a fabric in the culture medium, the fabric will be directly dyed by the biofilm adherent to the fabric.
Need to check novelty before this filing date? Find Prior Art

Description

A METHOD OF ONE-STEP FABRIC DYEING WITH ENGINEERED ADHERENT BIOFILMTechnical Field

[0001] The invention relates to the field of fabric dyeing. In particular, the invention relates to a method of one-step fabric dyeing with engineered adherent biofilm.Background

[0002] Fabric dyeing in the textile industry has shown dramatic growth alongside synthetic chemistry in the last century1. Chemically synthesized dyes with a variety of colors possess water solubility and are low in cost1. However, many synthetic dyes are chemically synthesized using petroleum products, resulting in toxic by-products that cause severe water pollution and raise human health concerns1, 2. To address these problems, using microorganisms to produce pigments as fabric dyes in the textile industry represents a promising and sustainable alternative to synthetic dyes1, 3-5.

[0003] Microbes have been utilized to produce natural pigments, including red astaxanthin6, geen proviolacein1, tyrian purple7 and blue indigo8 or indigoidine9. However, many natural pigments are water-insoluble and accumulate inside or on the cell membrane6. Therefore, when using these biogenic pigments for fabric dyeing, a tedious process is required for pigments extraction and dyeing, often involving the use of toxic chemicals4, 10, 11. Several new strategies have been developed for microbial dyeing, such as employing a biochemical protecting group for a sustainable indigo dyeing approach12 and implementing a consecutive two-cell reaction system for tyrian purple indigoid dye production13. Attachment to the substrate is a crucial step for bacterial biofilm formation on various surfaces14. Regardless of the complex process for upstream dyes production in engineered microbes, the fabric dyeing procedure is another step that further increases the cost and processing time. A simplified, time-saving, and economically efficient microbial dyeing strategy is needed to enhance sustainability.Summary of the Invention

[0004] The present invention provides a sustainable dyeing strategy for directly fabric dyeing through fabrication pigment-producing bacterial biofilm that can adhere to the fabric and produce desire pigments, allowing for simultaneous pigment production and dyeing. By co-culturing pigment producing bacteria with fabrics in a biofilm formation medium for days, the invention makes it possible to achieve uniformly dyed fabrics. Engineering the pigment producing bacteria to be sensitive and responsive to light further enables the fabrication of self-patterning fabrics in a flexible manner. In line with the sustainable goals of microbial pigment dyeing, the present invention presents a simple, time-saving, and cost-effective microbial dyeing procedure.

[0005] In particular, the present invention solves the technical problems in the art by the following technical solutions.

[0006] 1. A method of fabric dyeing, comprising:

[0007] a) contacting a fabric with a bacterium in a culture medium, the bacterium being capable of forming an adherent biofilm and producing a pigment;

[0008] b) culturing the bacterium under conditions that allow the bacteria to form an adherent biofilm on the surface of the fibers of the fabric and to produce the pigment;

[0009] c) allowing deposition of the pigment produced by the bacteria in the adherent biofilm on the fabric; and

[0010] d) inactivating, such as killing the bacteria in the adherent biofilm on the fabric.

[0011] 2. The method according to item 1, wherein the bacterium is a gram-positive bacterium, preferably the bacterium is one of genus Corynebacterium, more preferably, the bacterium is Corynebacterium glutamicum.

[0012] 3. The method according to item 1, wherein the bacterium is a gram-negative bacterium, preferably the bacterium is one of genus Escherichia, more preferably, the bacterium is E. coli.

[0013] 4. The method according to item 2, wherein the bacterium is Corynebacterium glutamicum and the culture medium is M63 medium, or TSB medium, or the TSBG medium, preferably, the culture medium is M63 medium.

[0014] 5. The method according to item 1, wherein steps b) and c) are performed at the same time.

[0015] 6. The method according to any one of items 1-5, wherein the pigment is a natural pigment which can be produced by bacteria, such as indigoidine, melanin, astaxanthin, proviolacein, tyrian purple, or indigo, preferably, the pigment is indigoidine, or melanin.

[0016] 7. The method according to item 1, wherein the bacterium comprises a first polynucleotide encoding indigoidine synthetase under the control of an inducible promoter.

[0017] 8. The method according to item 7, wherein the inducible promoter is an IPTG inducible promoter, and the bacterium is capable of synthesizing indigoidine in the presence of IPTG and glutamine in the culture medium.

[0018] 9. The method according to item 7, wherein the bacterium further comprises a second polynucleotide encoding glutamate dehydrogenase and a third polynucleotide encoding the mutant of glutamine synthetase I (Y405I) , so that the bacterium is capable of synthesizing indigoidine without addition of glutamine to the culture medium.

[0019] 10. The method according to any one of items 1-9, wherein the deposition of the pigment forms a uniform staining on the fabric.

[0020] 11. The method according to any one of items 1-9, wherein the deposition of the pigment forms a pattern on the fabric.

[0021] 12. The method according to item 11, wherein the pattern on the fabric is formed by co-culturing the fabric, the bacterium and a mold having a desired pattern which mold covers on the fabric.

[0022] 13. The method according to item 11, wherein the bacterium comprises an optogenetic tool which enables the bacterium to form a pigment-producing biofilm in response to a light.

[0023] 14. The method according to item 13, wherein the deposition of the pigment-producing biofilm in response to the light forms a pattern on the fabric.

[0024] 15. The method according to item 14, wherein the light is a blue light, red light, or green light.

[0025] 16. The method according to item 14, wherein the optogenetic tool is a blue light activated split-T7RNAP (BLASTR) system comprising a light sensing module and a transcriptional output module,

[0026] wherein the light-sensing module comprises from 5’ to 3’, operatively linked a first inducible promoter, a ribosome binding site (RBS) , the coding sequence of N-T7 RNAP, a linker, and the coding sequence of nMag, and operatively linked a second inducible promoter, a second ribosome binding site (RBS) , the coding sequence of pMag, a linker, and the coding sequence of C-T7RNAP; and

[0027] wherein the transcriptional output module comprises from 5’ to 3’, a third promoter, a third RBS and a target protein coding sequence, wherein the transcription level of the target protein determines the yield of the pigment.

[0028] 17. The method according to item 16, wherein

[0029] step b) further comprises exposing the fabric to a light source which forms a blue light pattern on the fabric, so that the adherent bacterial biofilm exposed to blue light is induced to produce the pigment and dye the fabric with the pigment-producing biofilm.

[0030] 18. The method according to item 17, wherein the bacterium further comprises a second polynucleotide encoding glutamate dehydrogenase and a third polynucleotide encoding the mutant of glutamine synthetase I (Y405I) , so that indigoidine can be synthesized by the bacterium without addition of glutamine to the culture medium.

[0031] 19. The method according to item 18, wherein step b) further comprises adding an inducer of the first inducible promoter such as IPTG and an inducer of the second inducible promoter such as CA to the culture medium to induce the expression of the recombinants of nMag fused to N-T7 RNAP and the pMag fused to C-T7RNAP, respectively, and wherein upon the bacterium being exposed to blue light, the expressed light-sensing module of nMag and pMag bind to each other to form a dimer so that N-T7 RNAP linked to nMag and C-T7 RNAP linked to pMag to form a complete functional T7 RNAP which then triggers the transcription of the third promoter which initiates the transcription of the coding sequence of the target protein;

[0032] wherein the amount of the light determines the amount of the formed complete functional T7 RNAP which then determines the transcriptional level of target protein.

[0033] 20. The method according to item 19, wherein the bacterium is Corynebacterium glutamicum, the target protein is indigoidine synthetase and the first inducible promoter is PtacM, and / or the second inducible promoter is Pspank, and / or the third promoter is P3 as shown in SEQ ID NO: 21.

[0034] 21. The method according to item 20, wherein the first and the second RBS of the light sensing module are both CGR083 and the third RBS is BCD2.

[0035] 22. The method according to any one of items 1-6, wherein the bacterium comprises a polynucleotide encoding MelA-MelC, and the pigment is melanin.

[0036] 23. The method according to item 16, wherein the target protein is MelA-MelC.

[0037] 24. The method according to item 23, wherein step b) further comprises adding an inducer of the first inducible promoter such as IPTG and an inducer of the second inducible promoter such as CA to the culture medium to induce the expression of the recombinants of nMag fused to N-T7 RNAP and the pMag fused to C-T7RNAP, respectively, and wherein upon the bacterium being exposed to blue light, the expressed light-sensing module of nMag and pMag bind to each other to form a dimer so that N-T7 RNAP linked to nMag and C-T7 RNAP linked to pMag form a complete functional T7 RNAP which triggers the transcription of the third promoter which initiates the transcription of the coding sequence (s) of the target protein (s) ;

[0038] wherein the amount of the light such as blue light determines the amount of the formed complete functionalT7 RNAP which then determines the expression level of MelA and MelC enzymes.

[0039] 25. The method according to item 24, wherein the bacterium is Corynebacterium glutamicum and the first inducible promoter is PtacM, and / or the second inducible promoter is Pstank, and / or the third promoter is P3 as shown in SEQ ID NO: 21.

[0040] 26. The method according to item 25, wherein the first and second RBS of the light sensing module are both CGR083 and the third RBS is BCD2.

[0041] 27. The method according to any one of items 1-26, wherein the fabric is nylon, acetate, silk, wool, denim, cotton, rayon, or polyester.

[0042] 28. The method according to any one of items 1-27, wherein step d) comprises sterilizing the fabric to kill the living bacteria.

[0043] 29. The method according to item 28, wherein the sterilizing is achieved by high temperature facilities.

[0044] 30. A fabric produced by the method of any one of items 1-29.

[0045] 31. A clothing made from the fabric of item 30.

[0046] Description of the drawings

[0047] The foregoing aspects and others will be readily appreciated by the skilled artisan from the following description of illustrative embodiments when read in conjunction with the accompanying drawings.

[0048] Figure 1. Engineered C. glutamicum biofilm enabling one-step fabrics dyeing. a, Schematic illustration of the biofilm dyeing fabric workflow. Initially, pigment-producing cells are inoculated into adherent biofilm formation medium with the bare fabric. After hours of culturing, the bare fabric is dyed to the target color through the formation of pigment-producing biofilms on it. Finally, the cells adhering to the fabric are eliminated through sterilization. b, the schematic shows blue pigment indigoidine is converted from colorless substrate glutamine into the blue indigoidine by the blue-pigment synthetase (BpsA) , encoded by the bpsA gene. c, Indigoidine and biofilm production were calculated from the M63 cultured cells after the indicated time periods. d, Nylon, wool, silk and acetate fabric pieces (3x3 cm2) were dyed with the indigoidine produced biofilm under different days. e, the sessile drop assay was performed to measure the contact angle on bare fabrics and indigoidined fabrics. Representative water drop shapes from bare fabrics and indigoidined fabrics are shown above the graph. f, the schematic shows the bacterial killing process by sterilization at 121℃ for 30 minutes. Subsequently, the sterilized fabrics and non-sterilized fabrics were separately cultured in BHI overnight, followed by the absorbance assay. g, the indigoidined fabrics were processed with various procedures and the color depths of these processed fabrics were measured using K / S values. K / S (absorption coefficient, K, and scattering coefficient, S, a value used to determine the depth of color of a dyed fabric) values were measured at 520 nm to determine the depth of color of the dyed fabrics. Mean±s.d., n=3 biological replicates in c, e, f and g. The scale bars in d and g are indicated is 1 cm.

[0049] Figure 2. Engineering C. glutamicum to self-produce indigoidine for sustainable fabric dyeing. a, Pathways engineering in C. glutamicum for the conversion of the straw-based carbon source into the blue pigment indigoidine (S004 strain) . The presented genes and their encoding proteins are as follows: gdh, glutamate dehydrogenase; glnA*, glutamine synthetase I mutant of Y405F that is resistant to the downregulation by adenylation of this gene under a high ammonium condition10. b, Indigoidine and biofilm production of indigoidine self-producing strain, S004 strain, were measured after the indicated time periods. Mean±s.d., n=3 biological replicates. c, Dyed scarves (nylon, acetate, silk and wool fabrics, 70x30 cm2) were fabricated after co-culturing the bare-fabrics with self-producing indigoidine C. glutamicum in a biofilm formation medium for 1 day. d, Patterned and dyed fabrics were fabricated through moulding. The schematic showing the procedure for the fabrication patterned blue fabrics by co-culturing indigoidine-producing cells with moulds and bare fabrics in the M63 medium. Multiple fabrics were patterned with clear deep blue lines using the S004 strain in just 1 day. The scale bars in c and d are indicated 5 cm.

[0050] Figure 3. Fabrication of self-patterning fabrics through light-sensing biofilm formation. a, Schematic showing the blue light activated split-T7RNAP (BLASTR) optogenetic tool. The nMag and pMag sense blue light, facilitating the formation of a heterodimer that assists N-T7RNAP and C-T7RNAP in regaining the T7 RNA polymerase activity, initiating transcription of the T7 promoter in response. The expression of N-T7RNAP-nMag and pMag-C-T7RNAP is regulated by isopropyl-β-d-thiogalactoside (IPTG) and cuminic acids (CA) , respectively. b, Fluorescence intensity in C. glutamicum cells transfected with BLASTR V002 design, along with a mCherry reporter plasmid, under 5μM IPTG and differing CA concentration. The fold changes between dark and blue light are shown at top. c, A schematic illustration depicts the formation of self-patterning fabrics through the sensing and response of C. glutamicum. Under blue light, the indigoidined C. glutamicum biofilm is formed on the fabric, as C. glutamicum detects the blue light and responds by expressing the bpsA gene, enabling the conversion of straw-based carbon source into the blue pigment indigoidine. d, Indigoidine production in C. glutamicum cells (S009 strain) , transfected with BLASTR V002 design along with a BpsA expression plasmid under a T7 promoter, was conducted under 5μM IPTG and varying CA concentration. The fold changes between dark and blue light are shown at top. e, Digital camera images of indigoidine produced (top) and gradient indigoidined (down) C. glutamicum biofilm on nylon fabric. Indigoidine-producing cells and bare fabric are co-cultured in M63 solid medium containing 5μM IPTG and200 nM CA, exposed to a complex pattern created by a projector. The scale bars is indicated 10 mm. Mean±s.d., n=3 biological replicates in b and d.

[0051] Figure 4. Robust biofilm dyeing strategy for black fabric fabrication. a, Schematic showing that the use of C. glutamicum BLASTR V002 to produce the black pigment melanin as a response to blue light. Melanin is converted from colorless substrate L-tyrosine into the black pigment by the MelA and MelC enzymes, encoded by the melA and melC genes. b, c, Digital camera images of blue light-controlled C. glutamicum biofilm for melanin pattern (b) and gradient melanin-dyed (c) on nylon fabric. Blue light-sensing melanin-producing strain of S0011 and bare fabric are co-cultured in M63 solid medium containing 5μM IPTG and 200 nM CA, exposed to a complex pattern created by a projector. The gradient melanin-dyeing were formed by projecting light with varying intensities and precise spatial control onto the nylon fabric containing the S0011 strain suspended in the M63 solid medium. The scale bars are indicated 1 cm.

[0052] Figure 5. Dyeing fabrics with adherent C. glutamicum biofilm. a, b, Verification of adherent C. glutamicum biofilm formation in different medium by crystal violet staining (CV-staining) . Images depict C. glutamicum biofilm, including the wild-type and mCherry-expressing variants (a) , along with quantitative results (b) . c, Cultivation of mCherry-expressed C. glutamicum with fabric in various media. d, Confocal microscopy and scanning electron microscope images reveal cells adhesion within the fabric fibers. All the scale bars are indicated in the images. Statistically significant differences were calculated by using a two-tailed t-test in b, ****P<0.0001. Mean±s.d., n=3 biological replicates in b and c.

[0053] Figure 6. Engineering C. glutamicum for converting glutamine into indigoidine. a, Genetic design of BpsA expressing in C. glutamicum under various promoters and induced by the addition of IPTG. b, Indigoidine and biofilm production were measured from the M63 cultured S001 and S002 strains after 1 day with 200μM IPTG. c, Acetate fabrics were co-cultured with S001 and S002 strains in M63 medium for 1 day with 200μM IPTG. Mean ±s.d., n=3 biological replicates in b and c. The scale bar in c is 1 cm.

[0054] Figure 7. Dyeing fabrics using S002 strain under various concentrations of IPTG inducer. a, Indigoidine and biofilm production were measured from the M63 cultured S002 strain after 1 day with various concentration of IPTG. Mean±s.d., n=3 biological replicates. b, Acetate and nylon fabrics were co-cultured with the S002 strain in M63 medium after 1 day with various concentration of IPTG. The scale bar is 1 cm.

[0055] Figure 8. SEM images illustrate the fabrication of dyed fabrics using indigoidine-producing C. glutamicum biofilm. The uniformly indigoidined fabrics of nylon (a) , acetate (b) , silk (c) , and wool (d) . The scale bars are 5 cm.

[0056] Figure 9. Images showing the separately cultured sterilized and non-sterilized fabrics in BHI overnight. n=3 biological replicates.

[0057] Figure 10. Optimizing pathways for high indigoidine production in C. glutamiucm. a, Schematic summary of pathways engineering in C. glutamicum for self-production of blue pigment indigoidine. Different colors indicate the genes combination and parts used to enhance indigoidine production. The image displays the colony colors of S002, S003 and S004 cells.

[0058] b, Indigoidine and biofilm production of C. glutamicum strains harboring different gene circuits were measured after 0.5 day of culturing in M63 medium with 200μM IPTG. Mean ±s.d., n=3 biological replicates.

[0059] c, Acetate fabrics were co-cultured with the S002, S003 and S004 cells in M63 medium after 1 day with 200μM IPTG. The scale bar is 1 cm.

[0060] Figure 11. Dyeing fabrics using S004 strain under various concentrations of IPTG inducer. a, Acetate fabrics were co-cultured with the S004 strain in M63 medium after 1 day with various dose of IPTG. The scale bar is 1 cm. b, Indigoidine and biofilm production were measured from the M63 cultured S004 strain after 1 day with various dose of IPTG. Mean±s.d., n=3 biological replicates.

[0061] Figure 12. Dyeing fabrics using S004 strain under various days.

[0062] Acetate fabrics were co-cultured with the S004 strain in M63 medium after the indicated time periods with 200μM IPTG. The scale bar is 1 cm.

[0063] Figure 13. Dyeing additional commercial fabrics using the S004 strain. Various widely used fabrics on the market, such as the denim, cotton, rayon, and polyester, were also indigoidined after being co-culturing with S004 strain in M63 medium after 2 days with 200μM IPTG.

[0064] Figure 14 Bulk fabric dyeing process.

[0065] Images shows that the colored fabtic is fabricated using the following steps: 1) Infiltrate fabric with the biofilm formation medium of M63 containing 200μM IPTG; 2) Pour the overnight-cultured blue living dye of the Blulive004 onto the fabric, which is laid flat in a sterilized 70x30 cm2 stainless container tray; 3) Use a plastic spreader to evenly spread the living dye on the fabric to ensure uniform dyeing; 4) Cover the tray and co-culture the living dye and fabric at room temperature for several hours; 5) Finally, produce the bulk bule fabric.

[0066] Figure 15. RBS strengths characterized by fluorescence intensity. YFP was regulated by 7 bicistronic ribosome binding site under the same promoter of PtacM. Fluorescence was normalized to biomass. Mean±s.d., n=3 biological replicates.

[0067] Figure 16. Design of T7 promoter for gene expression in C. glutamicum.

[0068] a, Designing T7 promoter, and the expression of T7RNAP is regulated by isopropyl-β-d-thiogalactoside (IPTG) . b, Comparison of the different T7 promoter strengths in C. glutamicum in the presence and absence of40μM IPTG. The results indicate that the T7 promoter of P3, which consists of the T7 promoter and a bicistronic ribosome binding site of BCD2, shows the highest strength. c, Fluorescence intensity of mCherry regulated by P3 under varied dose of IPTG. d, Growth curve of cells containing the T7RNAP and the T7 promoter of P3 or the empty plasmid under varied dose of IPTG, ndicating that the expression T7RNAP affects the growth of C. glutamicum cells. Fluorescence was normalized to biomass. Mean±s.d., n=3 biological replicates.

[0069] Figure 17. Dynamic ranges of IPTG and CA inducible promoters.

[0070] a, The IPTG-and CA-inducible systems are shown. The repressors for each inducible system were placed under the controlof a constitutive promoter (PlacIq-2 and PlacIq) . The sequences for all of the genetic parts are provided in Table 1.

[0071] b, c, The response functions of the IPTG-inducible promoter (b) and the CA-inducible promoter (c) . Data are presented for three experiments.

[0072] Figure 18. Characterization of C. glutamicum BLASTR V001.

[0073] a, Genetic device schematic.

[0074] b-e, Fluorescence intensity in C. glutamicum cells transfected with BLASTR V001 designs, along with a mCherry reporter plasmid, under 0μM IPTG (b) , 2μM IPTG (c) , 5μM IPTG (d) , 10μM IPTG (e) , and differing CA concentration. The expression of N-T7RNAP-nMag and pMag-C-T7RNAP with a strong bicistronic ribosome binding site of BCD2 is regulated by isopropyl-β-d-thiogalactoside (IPTG) and cuminic acids (CA) , respectively. The fold changes between dark and blue light are shown at top.

[0075] Figure 19. Characterization of C. glutamicum BLASTR V002.

[0076] a, Genetic device schematic. b-e, Fluorescence intensity in C. glutamicum cells transfected with BLASTR V001 designs, along with a mCherry reporter plasmid, under 0μM IPTG (b) , 2μM IPTG (c) , 5μM IPTG (d) , 10μM IPTG (e) , and differing CA concentration. The expression of N-T7RNAP-nMag and pMag-C-T7RNAP with a weak bicistronic ribosome binding site of BCD2 is regulated by isopropyl-β-d-thiogalactoside (IPTG) and cuminic acids (CA) , respectively. The fold changes between dark and blue light are shown at top.

[0077] Figure 20. The digital camera image of the red fluorescence-expressing C. glutamicum biofilm. a, The blue light-inducible C. glutamicum biofilm retained its original pattern with a resolution of 1 mm in a 150 mm diameter petri dish, featuring a complex pattern with a black background created by a projector. b, The blue light-inducible C. glutamicum biofilm retained its original pattern with a resolution of 2 mm in a 150 mm diameter petri dish, featuring a complex pattern with a blue background created by a projector.

[0078] Figure 21. The performance of BLASTR V002 for the control of BpsA expression in C. glutamicum. Indigoidine production in C. glutamicum cells transfected with BLASTR V002 design, along with a BpsA expression plasmid under a T7 promoter, was conducted under 2μM IPTG (a) and 10μM IPTG (b) with varying CA concentration. The fold changes between dark and blue light are shown at top. Mean±s.d., n=3 biological replicates.

[0079] Figure 22. The fabric dyeing performance using BLASTR V002 for the control of indigoidined biofilm formation. A Comparison for the dyeing of acetate and nylon fabric between blue light and dark with different IPTG and CA concentrations are shown. The scale bars is indicated 1 cm.

[0080] Figure 23. Digital camera images of indigoidined C. glutamicum biofilm on acetate fabric. Indigoidine-producing cells and bare fabric are co-cultured in M63 solid medium containing 5μM IPTG and200 nM CA, exposed to a complex pattern created by a projector. The scale bars is indicated 10 mm.

[0081] Figure 24. Engineering C. glutamicum biofilm to produce melanin for fabrication black fabrics. a, The schematic shows black pigment melanin is converted from tyrosine into the black pigment by the MelA and MelC enzymes, encoded by the melA and melC genes. The MelA and MelC enzymes are co-expressed, placed under the control of a constitutive promoter (PH1m) and a strong bicistronic ribosome binding site (BCD2) . The strain contains the MelA and MelC expressing plasmid, referred to as the S0010 strain. b, Melanin and biofilm production of S0010 strain were measured after the indicated time periods. Mean±s.d., n=3 biological replicates. c, Nylon, acetate, wool and silk fabric pieces (3x3 cm2) were dyed with the melanin produced biofilm under different days. The scale bars indicate 1 cm.

[0082] Figure 25. The performance of BLASTR V002 for the control of black pigment melanin production in C. glutamicum. Melanin production in C. glutamicum transfected with BLASTR V002 design, along with a MelA-MelC expression plasmid under a T7 promoter, the S007 strain, was conducted under 2μM IPTG (a) , 5μM IPTG (b) and 10μM IPTG (c) with varying CA concentration. The fold changes between dark and blue light are shown at top. Mean±s.d., n=3 biological replicates.

[0083] Figure 26. The fabric dyeing performance using BLASTR V002 for the control of melanined biofilm formation. A Comparison for the dyeing of acetate and nylon fabric between blue light and dark with different IPTG and CA concentrations are shown. The scale bars is indicated 1 cm.

[0084] Figure 27. Digital camera images of melanined C. glutamicum biofilm on acetate fabric. Melanin-producing cells and bare fabric are co-cultured in M63 solid medium containing 5μM IPTG and200 nM CA, exposed to a complex pattern created by a projector. The scale bars is indicated 10 mm.

[0085] Figure 28. a to e are plasmid maps of pGA1-000, pGA1-001, pGA1-002, pGA1-003, and pGA1-004, respectively.

[0086] Figure 29. a to c are Plasmid maps of pGA1-005, pGA1-006, and pGA1-007, respectively.

[0087] Figure 30. a to c are Plasmid maps of PCG1-001, PCG1-003 and PCG1-004, respectively.

[0088] Figure 31. Plasmid map of PCG1-002.

[0089] Figure 32. Fabric dyeing via melanin produced by adherent E. coli biofilm.Detailed description of the invention

[0090] Before the invention is described in detail, it is to be understood that, unless otherwise indicated, this invention is not limited to particular sequences, expression vectors, enzymes, host microorganisms, or processes, as such may vary. It is also to be understood that the terminology used herein is for purposes of describing particular embodiments only, and is not intended to be limiting.

[0091] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited.

[0092] In this specification and in the claims that follow, reference will be made to a number of terms that shall be defined to have the following meanings:

[0093] The terms “optional” or “optionally” as used herein mean that the subsequently described feature or structure may or may not be present, or that the subsequently described event or circumstance may or may not occur, and that the description includes instances where a particular feature or structure is present and instances where the feature or structure is absent, or instances where the event or circumstance occurs and instances where it does not.

[0094] As used in the specification and the appended claims, the singular forms “a, ” “an, ” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to an “expression vector” includes a single expression vector as well as a plurality of expression vectors, either the same (e.g., the same operon) or different; reference to “cell” includes a single cell as well as a plurality of cells; and the like.

[0095] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0096] The term “about” refers to a value including 10%more than the stated value and 10%less than the stated value.

[0097] The terms “host cell” is used herein to refer to a living biological cell that can be transformed via insertion ofan expression vector.

[0098] The term “heterologous” as used herein refers to a material, or nucleotide or amino acid sequence, that is found in or is linked to another material, or nucleotide or amino acid sequence, wherein the materials, or nucleotide or amino acid sequences, are foreign to each other (i.e., not found or linked together in nature) .

[0099] The terms “expression vector” or “vector” refer to a compound and / or composition that transduces, transforms, or infects a host cell, thereby causing the cell to express nucleic acids and / or proteins other than those native to the cell, or in a manner not native to the cell. An “expression vector” contains a sequence of nucleic acids (ordinarily RNA or DNA) to be expressed by the host cell. Optionally, the expression vector also comprises materials to aid in achieving entry of the nucleic acid into the host cell, such as a virus, liposome, protein coating, or the like. The expression vectors contemplated for use in the present invention include those into which a nucleic acid sequence can be inserted, along with any preferred or required operational elements. Further, the expression vector must be one that can be transferred into a host cell and replicated therein. Particular expression vectors are plasmids, particularly those with restriction sites that have been well documented and that contain the operational elements preferred or required for transcription of the nucleic acid sequence. Such plasmids, as well as other expression vectors, are well known to those of ordinary skill in the art.

[0100] The terms “polynucleotide” and “nucleic acid” are used interchangeably and refer to a single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5′to the 3′end. A nucleic acid of the present invention will generally contain phosphodiester bonds, although in some cases, nucleic acid analogs may be used that may have alternate backbones, comprising, e.g., phosphoramidate, phosphorothioate, phosphorodithioate, or O-methylphophoroamidite linkages (see Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University Press) ; positive backbones; non-ionic backbones, and non-ribose backbones. Thus, nucleic acids or polynucleotides may also include modified nucleotides that permit correct read-through by a polymerase. “Polynucleotide sequence” or “nucleic acid sequence” includes both the sense and antisense strands of a nucleic acid as either individual single strands or in a duplex. As will be appreciated by those in the art, the depiction of a single strand also defines the sequence of the complementary strand; thus the sequences described herein also provide the complement of the sequence. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated. The nucleic acid may be DNA, both genomic and cDNA, RNA or a hybrid, where the nucleic acid may contain combinations of deoxyribo-and ribo-nucleotides, and combinations of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine, isoguanine, etc.

[0101] The term “promoter” as used herein, refers to a polynucleotide sequence capable of driving transcription of a DNA sequence in a cell. Thus, promoters used in the polynucleotide constructs of the invention include cis-and trans-acting transcriptional control elements and regulatory sequences that are involved in regulating or modulating the timing and / or rate of transcription of a gene. For example, a promoter can be a cis-acting transcriptional control element, including an enhancer, a promoter, a transcription terminator, an origin of replication, a chromosomal integration sequence, 5′ and 3′ untranslated regions, or an intronic sequence, which are involved in transcriptional regulation. These cis-acting sequences typically interact with proteins or other biomolecules to carry out (turn on / off, regulate, modulate, etc. ) gene transcription. Promoters are located 5′ to the transcribed gene, and as used herein, include the sequence 5′ from the translation start codon (i.e., including the 5′untranslated region of the mRNA, typically comprising 100-200 bp) . Most often the core promoter sequences lie within 1-2 kb of the translation start site, more often within 1 kbp and often within 500 bp of the translation start site. By convention, the promoter sequence is usually provided as the sequence on the coding strand of the gene it controls. A polynucleotide is “heterologous” to a host cell or a second polynucleotide sequence if it originates from a foreign species, or, if from the same species, is modified from its original form. For example, when a polynucleotide encoding a polypeptide sequence is said to be operatively linked to a heterologous promoter, it means that the polynucleotide coding sequence encoding the polypeptide is derived from one species whereas the promoter sequence is derived from another, different species; or, if both are derived from the same species, the coding sequence is not naturally associated with the promoter (e.g., is a genetically engineered coding sequence, e.g., from a different gene in the same species, or an allele from a different ecotype or variety) .

[0102] The term “operatively linked” refers to a functional relationship between two or more polynucleotide (e.g., DNA) segments. Typically, it refers to the functional relationship of a transcriptional regulatory sequence to a transcribed sequence. For example, a promoter or enhancer sequence is operatively linked to a DNA or RNA sequence if it stimulates or modulates the transcription of the DNA or RNA sequence in an appropriate host cell or other expression system. Generally, promoter transcriptional regulatory sequences that are operatively linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are cis-acting. However, some transcriptional regulatory sequences, such as enhancers, need not be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance.

[0103] The term “bacterial cell” , “bacteria” , “bacterial cells” , “bacterial strain” and “bacterium” herein may be used interchangely.

[0104] The term “optogenetic tool” is known in the art and includes but not limited to blue light activated split-T7RNAP (BLASTR) system.

[0105] In an embodiment, the present application provides a method offabric dyeing, comprising:

[0106] a) contacting a fabric with a bacterium in a culture medium, the bacterium being capable of forming an adherent biofilm and producing a pigment;

[0107] b) culturing the bacterium under conditions that allow the bacteria to form an adherent biofilm on the surface of the fibers of the fabric and to produce the pigment;

[0108] c) allowing deposition of the pigment produced by the bacteria in the adherent biofilm on the fabric; and

[0109] d) inactivating, such as killing the bacteria in the adherent biofilm on the fabric.

[0110] The term “bacterium being capable of forming an adherent biofilm and producing a pigment” as used herein, refers to any bacterium that when cultured in a culture medium and a fabric, can produce adherent biofilm on the fabric and produce a pigment, so that the fabric is dyed by the adherent biofilm while the bacterium is being cultured.

[0111] In some embodiments, steps b) and c) are performed at the same time, that when the bacterium is cultured under conditions that allow the bacterium to form adherent biofilm on the surface of the fibers of the fabric and to produce the pigment, the pigment produced by the bacterium has deposited on the fabric, so that one-step fabric dyeing is achieved. There is no need to isolate the pigment from the bacteria and then dye the fabric with the isolated dye.

[0112] In some embodiments, the bacterium can be a gram-positive bacterium, preferably the bacterium is one of genus Corynebacterium, more preferably, the bacterium is Corynebacterium glutamicum. The bacterium can also be a gram-negative bacterium, such as the genus of Escherichia, preferably E. coli.

[0113] In some embodiments, the culture medium can be any culture medium for the bacterium as long as the bacterium can form an adherent biofilm on the fabric and produce a pigment when cultured in the culture medium with the fabric. In an embodiment, the culture medium is M63 medium, or TSB medium, or the TSBG medium. Preferably, the culture medium is M63 medium.

[0114] In some embodiments, the pigment that can be produced herein may be any natural pigment which can be produced by bacteria, such as indigoidine, melanin, astaxanthin, proviolacein, tyrian purple, and indigo.

[0115] In some embodiments, the fabric in the present application can be made from nylon, acetate, silk, wool, denim, cotton, rayon, or polyester, etc.

[0116] In some embodiments, the pigment is deposited in a confined area of the fabric, so that a patterned dyeing is achieved. The patterned dyeing can be achieved by for example the following two methods, one is moulding, i.e., covering the fabric with a pattern such as a mould with a pattern (such as a flower) , so that when the bacterium is cultured in the culture medium with the patterned fabric (covered with the mould) , the adherent biofilm will only be formed in those uncovered areas in the fabric. When the mould is removed, and the fabric will be dyed with a flower. The other method is to produce a photo sensitive engineered bacterium which is sensitive to light, such as blue light. For example, when the engineered bacterium is cultured on a bare fabric in a culture medium, the adherent biofilm will be formed on the surface of the bare fabric but no pigment is produced during culture. When a light source such as a projector is used to project a light pattern on the surface of the fabric, the bacteria in the adherent biofilm in the areas illuminated by light are stimulated by the light to produce the pigment, so that the areas are dyed. Compared with the first method which needs to design a particular mould to cover the bara fabric, the second method of dyeing is relatively easier and flexible. For example, the pattern can be designed with a software in a computer which is linked to a projector, and the computer may control the projector to illuminate a bare fabric with a patterned light. In some embodiments, the pigment is produced in a controllable manner. For example, the bacterium may comprise a first polynucleotide encoding indigoidine synthetase under control of an inducible promoter. When an inducer such as IPTG is added to the culture medium, the inducible promoter is activated by IPTG to initiate expression of indigoidine synthetase which will synthesize the pigment indigoidine. Theoretically, the timing and amount of IPTG added to the culture medium will determine the amount of indigoidine produced.

[0117] In some embodiments, the bacterium such as Corynebacterium glutamicum cannot synthesize glutamine, so that glutamine has to be added to the culture medium for the bacterium to synthesize indigoidine. In other embodiments, the bacterium has been engineered to express glutamate dehydrogenase and a mutant of glutamine synthetase I (Y405I) so that glutamine can be synthesize by the engineered bacterium and used to further synthesize indigoidine.

[0118] In some embodiments, the bacterium comprises a blue light activated split-T7RNAP (BLASTR) system, wherein the BLASTR system comprises a light sensing module and a transcriptional output module. In some embodiments, the light-sensing module comprises from 5’ to 3’, operatively linked a first inducible promoter, a ribosome binding site (RBS) , the coding sequence of N-T7 RNAP, a linker, and the coding sequence of nMag, and operatively linked a second inducible promoter, a second ribosome binding site (RBS) , the coding sequence of pMag, a linker, and the coding sequence of C-T7RNAP; and wherein the transcriptional output module comprises from 5’ to 3’, a third promoter, a third RBS and a target protein encoding sequence, wherein the transcription level of the target protein determines the production level of the pigment. With this BLASTR system, the bare fabric can be used to achieve patterned dyeing with a light source such as a projector which is controlled by a computer.

[0119] In some embodiments, the pigment is melanin. The MelA-MelC enzymes catalyze the conversion of tyrosine into L-dopaquinone, which spontaneously polymerizes into melanin23. In some embodiments, the bacterium is engineered to constitutively expressing the melA and melC genes with a strong promoter such as PH1m and a strong RBS of BCD2 to ensure high melanin production (S0010 strain) . In some embodiments, the bacterium is engineered to comprise the BLASTR system to control the expression of MelA-MelC and the S0011 strain is constructed.

[0120] In some embodiments, the present application provides a fabric produced by the method of the present application. In further embodiments, the present application provides clothing or clothes made from the dyed fabric, such as shirts, pants, socks, shoes, scarfs, skirts, jeans, underwear, hats, or handbags, etc.

[0121] Examples

[0122] A further understanding of the present invention may be obtained by reference to the specific examples set forth herein, which are only intended to illustrate the invention, and are not intended to limit the scope of the invention. It is apparent that various modifications and variations may be made to the present invention without departing from the spirit of the invention, and such modifications and variations are therefore also within the scope of the present invention.

[0123] Materials and Methods

[0124] General methods.

[0125] The original DNA sequence was PCR-generated or fully synthesized (Azenta, Nanjing, China) . KOD DNA polymerase (TOYOBO, Japan) was used for PCR production generation. All plasmid constructions were performed using the NEB Builder HiFi DNA Assembly Master Mix (New England BioLabs, Boston, MA) for assembly or the T4 DNA ligase (New England BioLabs, Boston, MA) for ligations. All plasmids were confirmed by DNA sequencing (Tsingke, Guangzhou, China) .

[0126] Growth media.

[0127] Trans1-T1 (TransGen Biotech, Shenzhen, China) was used as the cloning host for plasmid construction. E. coli was cultured in LB medium at 37℃. Antibiotics for E. coli culture were kanamycin (50μg mL-1) and chloramphenicol (30μg mL-1) .

[0128] C. glutamicum ATCC 14067 was provided by Dr. Zheng’s research group at the South China University of Technology. C. glutamicum ATCC 14067 was grown in BHI liquid medium for recovery (37 g L-1 brain heart infusion (Becton, Dickinson and company) ) at 30℃, 250 rpm, overnight. For biofilm formation, C. glutamicum ATCC 14067 was inoculated into M63 liquid medium (15.6 g L-1 M63 Broth (Sangon Biotech, Guangzhou, China) , supplemented with 1 mM MgSO4, 0.2% (wt / vol) glucose or 0.3% (vol / vol) straw-based carbon resource (Polynovo Biotechnology, Suzhou, China) ) and cultivated in an incubator at 30℃ without shaking. Isopropyl-β-d-thiogalactoside (IPTG) or cuminic acid (CA) was used to induce gene expression. Antibiotics for C. glutamicum culture were kanamycin (25μg mL-1) and chloramphenicol (7.5μg mL-1) . All strains used in this study are listed in Table 1.

[0129] Plasmid construction.

[0130] Construction of the pGA1-000, pGA1-001, pGA1-002, pGA1-003, and pGA1-004 plasmids (the plasmid maps are shown in Fig. 28) . To create plasmids for constitutive high expression of mCherry reporter, the pEC-XC99E plasmid (NCBI link : https:  / / www. ncbi. nlm. nih. gov / nuccore / 29164935) was used as an original plasmid. First, DNA fragments of the pEC-XC99E backbone, the coding sequences of mCherry along with the high constitutive promoter of PH1 were generated via PCR, and then all the DNA fragments were assembled by NEB Builder HiFi DNA Assembly Master Mix to construct the pGA1-000 plasmid.

[0131] For the pGA1-001 plasmid construction, we utilized the synthetic PH36-LacO-CGR083 DNA sequence (TATTAACGGGCCCAGGGTGGTCGCACCTTGGTTGGTAGGAGTAGCATGGGATCCAttgtgagcggataacaaGGGCCCAAGTTCACTTAAAAAGGAGATCAACAATGAAAGCAATTTTCGTACTGAAACATCTTAATCATGCGATGCACGGTTTCTAA) (SEQ ID NO:1) and the synthetic, code-optimized BpsA gene sequence as templates to PCR (BpsA DNA sequence: ATGACCTTGCAGGAGACTAGCGTATTGGAACCAACCCTTCAGGGTACCACTACTCTCCCAGGACTTTTGGCCCAACGGGTGGCTGAGCATCCAGAAGCCATCGCAGTTGCCTACCGGGATGATAAACTTACTTTCCGTGAGCTTGCCTCCCGTTCGGCGGCATTGGCCGATTACCTGGAGCACCTGGGCGTGTCCGCGGACGACTGTGTAGGTCTCTTTGTGGAACCTTCGATCGATCTCATGGTCGGAGCCTGGGGCATCCTCAACGCCGGCGCAGCATACCTGCCCCTCAGCCCTGAATATCCTGAGGACCGTCTGCGCTATATGATTGAGAACTCCGAGACCAAAATCATTCTGGCGCAACAGCGCCTCGTTAGCCGCCTTCGGGAATTGGCTCCCAAGGACGTTACGATCGTGACGTTGCGTGAATCAGAGGCATTCGTCCGCCCTGAAGGAACTGAAGCCCCGGCAGCACGGTCGGCGCGGCCCGACACGCTGGCATATGTGATCTACACCTCTGGCTCCACGGGAAAACCGAAGGGTGTAATGATTGAGCATCGCAGCATTGTAAATCAACTCGGCTGGCTGCGGGAGACGTATGCAATCGATCGTTCCAAGGTTATCCTCCAAAAAACTCCGATGAGCTTCGATGCAGCGCAATGGGAGATTCTGTCGCCGGCCAACGGCGCGACCGTGGTTATGGGTGCACCGGGCGTCTACGCTGATCCAGAAGGCCTGATTGAAACGATTGTGAAACATAACGTTACTACTTTGCAATGTGTTCCTACGCTCCTCCAAGGATTGATTGATACGGAAAAATTTCCTGAGTGCGTTTCGTTGCAACAAATCTTTTCAGGTGGTGAGGCATTGTCGCGTCTCTTGGCGATCCAGACGACGCAAGAAATGCCAGGTCGCGCATTGATCAATGTATACGGACCAACGGAGACGACCATCAATTCATCCTCCTTTCCAGTTGATCCGGCGGACCTGGACGAGGGACCACAGTCAATCTCGATTGGTTCACCTGTACACGGAACCACTTATCATATTCTGGATAAAGAAACGCTCAAGCCAGTAGGAGTTGGAGAAATTGGAGAGTTGTATATCGGCGGTATCCAACTGGCGCGTGGTTACCTCCACCGTGACGACTTGACCGCCGAGCGGTTCTTGGAAATCGAGCTTGAAGAGGGAGCAGAACCAGTGCGGCTCTATAAGACGGGCGACCTGGGCCAGTGGAATAATGATGGAACCGTTCAGTTCGCGGGCCGCGCTGACAACCAGGTGAAGCTGCGGGGCTACCGCGTGGAGCTCGATGAAATCAGCTTGGCCATCGAGAACCATGATTGGGTCCGGAACGCGGCAGTGATCGTCAAAAATGATGGACGCACGGGCTTCCAAAATCTTATCGCTTGCATTGAACTGTCGGAAAAAGAGGCTGCCCTTATGGACCAAGGTAACCACGGCTCCCACCATGCCAGCAAGAAGTCTAAGCTTCAAGTGAAAGCGCAGTTGTCCAATCCAGGTCTCCGCGACGATGCTGAACTTGCAGCTCGCCCGGCATTCGACCTTGAAGGAGCCGAACCCACGCCGGAGCAGCGCGCTCGGGTTTTTGCGCGTAAAACCTATCGGTTTTATGAAGGCGGCGCCGTCACGCAGGCGGACCTTTTGGGTCTTCTGGGTGCTACCGTAACGGCAGGTTACTCCCGCAAAGCTGCCGACTTGGCCCCGGCAGAGTTGGGACAAATCCTGCGTTGGTTTGGCCAGTATATCTCTGAAGAGCGCCTCCTGCCCAAGTATGGCTATGCGTCCCCCGGAGCTCTCTACGCAACGCAAATGTATTTCGAGCTGGAAGGTGTAGGCGGCCTCAAGCCAGGATACTATTACTATCAACCCGTACGGCATCAGTTGGTGCTCATCAGCGAACGCGAGGCCACCGGTAAGGCTACTGCACAGATCCACTTTATTGGTAAGAAATCCGGTATCGAACCGGTTTATAAAAATAACATCTTGGAAGTTCTGGAGATTGAAACCGGACATATGGTCGGTTTGTTCGAGCAAATTCTGCCCGCCTACGGCCTGGACATTCACGACCGTGCGTACGAGCCCGCGGTTAAGGATCTGCTCGACGTTGCAGACGAGGACTACTATCTGGGCACCTTCGAGCTTGTTCCCCATGCCGGTGCTCGTGATGACCAAGCGGAAGTTTATGTTCAGACCCACGGAGGTAAGGTGGCTGGTCTCCCTGAGGGACAGTACCGCTACGAGAATGGCGAATTGACTCGGTTTTCAGACGATATCGTTCTCAAGAAACACGTAATTGCGATTAACCAGAGCGTCTATCAGGCAGCGTCATTCGGCATTAGCGTATATTCTCGTGCTGAGGAAGAGTGGTTGAAATACATTACCTTGGGAAAAAAGCTTCAGCATCTCATGATGAATGGCCTGAATTTGGGCTTCATGAGCTCTGGTTATAGCTCCAAGACGGGTAATCCGCTTCCTGCATCCCGCCGCATGGATGCCGTCCTGGGTGCCAACGGTGTTGATTCGGCTCCAATGTACTTTTTTGTTGGTGGCCGCATCTCCGACGAGCAGATTGGACACGAGGGCATGCGTGAGGACTCAGTTCACATGCGGGGTCCAGCCGAGCTGATCCGTGACGATCTTGTGTCTTTTCTGCCCGACTATATGATCCCTAATCGCGTAGTAGTCTTTGACCGCCTTCCGCTCAGCGCGAATGGTAAAATTGATGTTAAAGCCCTTGCGGCGTCAGACCAGGTTAACGCAGAGTTGGTAGAACGCCCGTTCGTAGCCCCTCGCACTGAAACTGAAAAAGAAATTGCTGCGGTTTGGGAAAAAGCCCTGCGCCGCGAAAATGCTTCTGTACAGGACGACTTTTTTGAGTCCGGAGGCAACTCTCTCATCGCTGTCGGTTTGGTCCGTGAACTCAACGCTCGTCTGGGAGTATCTCTGCCGCTGCAATCGGTCTTGGAGTCGCCAACGATCGAAAAGCTTGCACGCCGTCTCGAGCGGGAGGTGGCTCAAGAATCATCCCGCTTCGTCCGGCTTCATGCCGAGACTGGTAAGGCCCGTCCGGTTATTTGCTGGCCGGGCTTGGGCGGTTATCCTATGAACCTCCGTTCACTGGCCGGAGAGATCGGACTTGGCCGTTCATTCTATGGAGTTCAGTCATACGGCATCAACGAGGGTGAGACTCCATACGAGACGATCACGGAAATGGCAAAAAAGGACATTGAGGCATTGAAGGAAATTCAACCCGCAGGTCCCTACACGTTGTGGGGCTACTCATTCGGAGCTCGGGTCGCTTTTGAGACGGCTTACCAATTGGAACAAGCCGGTGAAAAGGTAGACAATTTGTTTCTGATCGCCCCTGGTTCGCCTAAGGTGCGCGCGGAGAACGGCAAAGTTTGGGGTCGGGAGGCGTCTTTTGCCAATCGCGGCTATACGACCATCCTTTTCTCGGTTTTTACTGGCACTATTTCGGGACCGGACCTCGACCGCTGCCTGGAGACCGTAACCGATGAGGCCTCGTTCGCCGAATTTATCAGCGAGTTGAAGGGAATTGATGTGGACCTTGCACGGCGGATTATTTCAGTGGTGGGACAAACGTACGAGTTCGAGTATTCCTTTCATGAGCTTGCAGAACGTACTCTTCAGGCACCCATTTCCATCTTTAAAGCCGTGGGTGACGACTACTCATTCCTCGAGAATTCTTCGGGTTATTCGGCTGAACCACCTACGGTGATCGATCTCGATGCCGATCACTACTCGCTTCTCCGTGAGGATATCGGCGAACTTGTAAAGCATATTCGTTACCTTCTCGGTGAGTAA (SEQ ID NO: 45) ) amplification of the relevant fragments. Subsequently, these fragments were assembled with the pEC-XC99E backbone using the prim NEB Builder HiFi DNA Assembly Master Mix. Using a similar strategy, we generated the pGA1-002, pGA1-003, and pGA1-004 plasmids.

[0132] The related DNA sequences are as follows:

[0133] PH36-LacO-CGR083-BpsA in pGA1-001

[0134] PtacM-LacO-CGR083-BpsA in pGA1-002

[0135] PtacM-LacO-CGR083-BpsA-PH1-CGR083-glnA in pGA1-003

[0136] PH36-LacO-CGR083-BpsA-PH1-CGR083-glnA-CgRBS-gdh in pGA1-004

[0137] Construction of the pGA1-005, pGA1-006, pGA1-007 plasmids (the plasmid maps are shown in Fig. 29) . Using the synthetic sequence containing the sequences of T7 promoter and BCD2 as template, we amplified (forward primer: aactgtcgGTGCTAATACGACTCACTATAG (SEQ ID NO: 46) reverse primer: GCCCTTGGAAACCATtagaaaacctccttagcatgattaagat (SEQ ID NO: 47) ) the T7-BCD2 sequence (TAATACGACTCACTATAGGGGGCCCAAGTTCACTTAAAAAGGAGATCAACAATGAAAGCAATTTTCGTACTGAAACATCTTAATCATGCTAAGGAGGTTTTCTAA) . We used the pGA1-000 plasmid to PCR (forward primer: aggttttctaATGGTTTCCAAGGGCGAGGAGGA (SEQ ID NO: 48) reverse primer: GCCTGGCAGTTTATGGCTTACTTGTAGAGTTCGTCCATGC (SEQ ID NO: 49) ) amplify the mCherry sequence. Finally, we assembled these amplified two fragments (T7-BCD2 sequence and the mCherry sequence) into the pGA1-003 backbone (forward primer: TAAGCCATAAACTGCCAGGCATCAAATTAAGCAG (SEQ ID NO: 50) reverse primer: GTCGTATTAGCACcgacagttcataggtga (SEQ ID NO: 51) template: pGA1-003) to generate the pGA1-005 plasmid. A similar strategy was employed for the generation of pGA1-006 and pGA1-007 plasmids.

[0138] P3-mCherry in pGA1-005

[0139] P3-BpsA-PH1-CGR083-glnA-CgRBS-gdh in pGA1-006

[0140] P3-melA-melC in pGA1-007

[0141] Construction of PCG1-001, PCG1-003, PCG1-004 plasmids (the plasmid maps are shown in Fig. 30) . First, the basic plasmid PCG1-001 was constructed with additional restriction sites ofPstI, XbaI, SmaI and SalI using Gibson assembly. PstI and XbaI were employed to insert the recombinant of N-T7 RNAP-nMag related DNA sequences, while SmaI and SalI were used to insert the recombinant of pMag-C-T7RNAP related DNA sequences. To create the PCG1-003 plasmids, we amplified the PtacM-BCD2-N-T7RNAP-nMag fragment with PstI and XbaI sites from the synthetic fragment. Subsequently, we cloned it into the PstI and XbaI sites in PCG1-001 through ligation. Next, we used this constructed plasmid for ligating the pMag-C-T7RNAP fragment with SmaI and SalI sites to generate the PCG1-003 plasmid. The pMag-C-T7RNAP fragment was obtained by amplifying from the synthetic Pspank-BCD2-pMag-C-T7RNAP sequence. PCG1-004 plasmid was constructed by replacing the BCD2 sequence with the CGR083 sequence.

[0142] CymR-LacI-PtacM-BCD2-mCherry-T7 / terminator-Pspank-BCD2-YFP-T7 / terminator in PCG1-001

[0143] PtacM-BCD2-N-T7RNAP-nMag-T7 / terminator-Pspank-BCD2-pMag-C-T7RNAP-T7 / ter minator in PCG1-003

[0144] CGR083 sequence in PCG1-004

[0145] Construction of PCG1-002and PCG1-005plasmids (the plasmid maps are shown in Fig. 30) . To generate the PCG1-002 plasmid, we initially amplified fragments of PtacM-BCD2-N-T7RNAP and the C-T7RNAP-T7-terminator from the synthetic fragments of Pspank-BCD2-pMag-C-T7RNAP and PtacM-BCD2-N-T7RNAP-nMag, respectively. Then, we assembled these two fragments into the backbone of PEC-XK99E (NCBI LInk: https:  / / www. ncbi. nlm. nih. gov / nuccore / 29164935) , resulting in the generation of the PCG1-002 plasmid. For the construction of the PCG1-005 plasmid, we amplify the MelA-MelC coding sequence from the synthetic PH1m-BCD2-MelA-MelC fragment. Following this, we assembled it into the PEC-XK99E backbone.

[0146] PtacM-BCD2-T7RNAP in PCG1-002

[0147] PH1m-BCD2-MelA-MelC in PCG1-005

[0148] Dyeing procedure.

[0149] For small piece fabric dyeing. The pigment-producing strain was inoculated into BHI medium and cultured overnight. Then, 2%seeding into the 3 mL M63 medium containing the target concentration inducer of IPTG into the 6 well plate with 1 piece of sterilized 3 x 3 cm2 circle of bare fabrics, including nylon, wool, silk, acetate, denim, cotton, rayon and polyester. For S002 strain the substrate of2.92 g / L glutamine needs to be added to the M63 medium for indigoidine production. For S004 strain glutamine doesn’ t need to be added. Subsequently, the bare fabrics and pigment producing strains in M63 medium with chloramphenicol (7.5μg mL-1) are co-cultured in incubator without shaking for days at 30℃. After ending the culture, we picked the fabrics from the medium and dried them by natural-draft. Finally, we put the dried fabrics into the 121℃incubator for 20 minutes to fix color and kill the living cells. After all these steps, we achieve the dyed fabrics.

[0150] For large sizefabric dyeing. The S004 strain was used to dye scarves of different materials. We prepared 200 mL M63 medium (replacement the glucose with straw-based carbon source) containing 200μM IPTG and chloramphenicol (7.5μg mL-1) . Then, infiltrate fabric with M63 mixture, 50 ml 1 OD of the overnight cultured S004 strain were poured to the M63 infiltrated and flatted fabric in the sterilized 70 x 30 cm2 stainless steel tray. 3) Use a plastic spreader to evenly spread the living dye on the fabric to ensure uniform dyeing; 4) Cover the tray and co-culture the S004 stain and fabric at room temperature for several hours. After the culture, we picked the dyed fabric from the liquid medium, dried them, and sterilized them at 121℃for 20 minutes for color fixation and cells killing. After all these steps, we achieve the large-sized dyed fabrics, the scarves made of nylon, silk, acetate and wool.

[0151] For fabric molding. We tailored a 25 x 25 cm2 silicone mold with desired pattern from Taobao. Then we placed a piece of sterilized fabric into the sterilized mold along its lines. Subsquently, we poured the mixed M63 medium (replacement the glucose with straw-based carbon source) with2%S004 strain, straw-based carbon source, 200μM IPTG, and chloramphenicol (7.5μg mL-1) . The liquid only needs to be covered the fabric. Then they were co-cultured at 30℃without shaking for 1 day. After the culture, we picked the patterned fabric from the liquid medium, dried them, and sterilized them at 121℃for 20 minutes for color fixation and cells killing. After all these steps, we achieve the patterned fabrics.

[0152] For fabric patterning. The S009 strain is used as a bule light-sensing living blue dye for the fabrication of blue patterned fabrics. Firstly, the S009 strain is cultured in BHI medium at 30℃, 250 rpm for~16h. Then, we diluted the overnight cultured S009 strain into 1.5 OD with sterilized ddH2O. We picked one piece of sterilized 15 x15 cm2 fabric and placed it into the 150 cm circle Petri dish containing the M63 agar (containing chloramphenicol 7.5μg mL-1, kanamycin 25μg mL-1, IPTG 5μM, CA 200 nM, and replacement the glucose with straw-based carbon source) . We applied 2 mL of 1.5 OD S009 cells to the whole fabric and wracked the excessed liquid, and placed in an incubator with a projector mounted on top. After incubation under the projected pattern at 30℃ for hours. After the culture, the patterned fabrics were dried and then sterilized at 121℃for 20 minutes for color fixation and cells killing. After all these steps, we achieve the optogenetic tools patterned fabrics.

[0153] Example 1 Establishing conditions for adherent C. glutamicum biofilm formation on fabrics

[0154] Bacterial biofilms consist of cells encased in a self-produced matrix of extracellular polymeric substances15. Bacteria in biofilms exhibit a set ofemergent properties that differ from free-living bacterial cells-such as adhesion, resource capture and enhanced survival15. Biofilms provide a robust environment to shield the cells, similar to the vacuole protecting pigment in flowers. Taking inspiration from the natural process of pigment production in flower vacuoles, we aim to harness the adherent biofilms that can stick to fabric fibers and engineered them to produce water-insoluble pigment. This strategy is directed towards fabricating living dyes that can achieve both pigment production and fabric dyeing in just one step.

[0155] Our initial investigation focused on examination the conditions for adherent biofilm formation of C. glutamicum, a widely used workhorse for pigment production. Using C. glutamicum ATCC 14067, Our preliminary exploration unveiled that C. glutamicum could produce a significant adherent biofilm on the petri dishes in M63 medium, increasing biofilm production by 5.03-fold compared to the biofilm culturing medium for actinomycetes, specifically TSB medium (ref) . Furthermore, it was unable to form adherent biofilms in the nutrient-rich BHI medium (ref) (Fig. 5a-b) . Next, we tested biofilm formation on fabrics by culturing mCherry-expressed C. glutamicum with fabrics in verified media. The results showed that abundant biofilm formation in M63 medium enabled the 85.7%of the fabric to exhibit fluorescence, while fabrics cultured in TSB and BHI medium showed only 25.7%and 6.1%fluorescence coverage, respectively (Fig. 5c) . Confocal microscopy and SEM images indicated that the C. glutamicum cells could form the adherent biofilms in the fabric fibers when cultured in M63 medium, allowing each fabric fiber to exhibit fluorescence (Fig. 5d) . These results demonstrate that C. glutamicum can form a uniform coating on the fabrics through adherent biofilm formation.

[0156] Construction of strains S000 to S011

[0157] Wild-type Corynebacterium glutamicum ATCC 14067 competent cells were prepared and the competent cells were transformed with pGA1-000 plasmid by electroporation and the successfully transformed cells were screened on plates supplemented with corresponding antibiotics (for example, if a plasmid was chloramphenicol resitant, then chloramphenicol was added to the medium in the plate, final concentration of chloramphenicol: 7.5μg / mL; final concentration of kanamycin: 25μg / mL) . The screened strain was named strain S000. Similalry, strains S001 and S011 were papared and screened (see Table 1 for the details of the relationship of the strain used, and the plasmid used for transformation, the antibiotic resistance and the name of the transfomed strain) .

[0158] Preparation of competent cells of Corynebacterium glutamicum:

[0159] (1) a single colony of 14067-recE / T was inoculated into BHI-containing liquid culture medium (the corresponding antibiotic (s) was / were added to the plasmid-containing strain) , and shaked overnight at 30℃, 250 rpm;

[0160] (2) the resulting bacterial cells were transferred into 30 mL EPO culture medium (for a strains containing a plasmid, adding corresponding antibiotic (s) ) . The cells (the starting OD≈0. ) were cultured1were controling, 30℃, 250 rpm, and cultured for 3 to 4 hours to keep the OD at 1.0 about;

[0161] (3) the bacterial solution was transferred to a sterilized50mL centrifuge tube and placed on ice for20minutes;

[0162] (4) the tube was centrifuged at 4℃ and 4000 rpm for 10 minutes, the supernatant was remove, and the bacteria cells were collect;

[0163] (5) Wash the bacterial cells with 30 mL of pre-cooled 10%glycerol, centrifuge at4℃ and 4000rpm for 10min, remove the supernatant, and collect the bacterial cells;

[0164] (6) Repeat step (5) 2times;

[0165] (7) Resuspend the cells in 400μL of pre-cooled 10%glycerol, and aliquot into pre-cooled 1.5mL EP tubes. Dispense 80μL into each tube and store it at-80℃for later use.

[0166] Electroporation transformation and culture of Corynebacterium glutamicum

[0167] (1) Take the pre-cooled dsDNA plasmid, add it to the prepared competent cells, flick the wall to mix the cells well, and keep them in ice bath for5 to 10minutes;

[0168] (2) Add the above mixture into a pre-cooled 0.1 cm electrophoration cup for electrophoration 1.8 KV / cm (Ec1) . After continuous electric shock, pipet the bacterial solution with 1 mL of LBHIS recovery medium and transfer it to 5 mL of LBHIS recovery medium. (For strains containing plasmids, add the corresponding antibiotic (s) ) . After 6 minutes in a hot water bath at46℃, resuscitate and culture the cells at30℃ and250rpm for 1 hour;

[0169] (3) Centrifuge the cells at 4000 rpm for 10 minutes, discard part of the supernatant, resuspend the bacterial cells in the remaining approximately200μL of the liquid, spread the cells on BHISG solid recovery medium (containing corresponding antibiotic (s) ) , and culture them at30℃for 36~48h.

[0170] BHI medium: brain heart infusion 37g / L, sterilized at 121℃for 20 minutes.

[0171] EPO medium: yeast extract 5 g / L, peptone 10 g / L, NaCl 10 g / L, glycine 25 g / L, sterilized at 121℃ for20min, and after the temperature dropped to room temperature, add 1 mL 20 g / L isoniazid (filtration sterilization) and 500μL 10% (v / v) Tween 80 (filtration sterilization)  / 50mL.

[0172] BHISG medium: brain heart infusion37 g / L (BD) , sorbitol9.1 g / L, glucose 10g / L.

[0173] Example2 Engineering C. glutamicum biofilm for one-step fabric dyeing

[0174] Having established the conditions for C. glutamicum biofilm formation on fabric, we proposed a one-step biofilm dyeing fabric strategy (Fig. 1a) . As a proof of concept, we aimed to express the indigoidine synthetase BpsA16in C. glutamicum to produce the natural blue pigment for the fabrication of blue living dye (Fig. 1b) . We initially induced the expression of the bpsA gene under different strength promoters in C. glutamicum to assess suitable BpsA expression levels by adding the colorless substrate of glutamine to the M63 medium (Fig. 6a-b) . The results indicated that the S002 strain performed well and resulted in the uniform dyeing of fabrics with a deep blue color under 200μM IPTG induction compared to the S001 strain (Fig. 6c) . Subsequently, we further explored the IPTG concentrations and culture time periods conditions, revealing that indigoidine production of S002 strain remained stable after 1 day of culture with200μM IPTG (Fig. 1c, Fig. 7a-b) . Additionally, we observed that the S002 strain exhibited excellent dyeing performance on both the hydrophobic fabrics such as nylon and wool and the hydrophilic fabrics like acetate and silk (Fig. 1d-e) . All fabrics achieved uniform dyeing within 0.5 days, and the exhibited blue or green color deepened as the dyeing time increased (Fig. 1d) . Moreover, we noted a decrease in surface wettability for hydrophilic silk and acetate after the fabrics dyed by the engineered blue living dye, resulting in average contact angles changing from 78.6 to 109.2 for silk and40.6 to 57.6 for acetate before and after dyeing, respectively (Fig. 1e) . However, for hydrophobic nylon, there was an increased in surface wettability, with a contact angle changed from 135.3 to 113.9 (Fig. 1e) . The hydrophobic property of the indigoidine pigment may be contributing to the variation in the dyed fabrics (ref) .

[0175] The hydrophobic nylon showed almost no change after the dyeing process (Fig. 1e) . SEM images indicated that the engineered living dye formed abundant biofilms along the fabric fibers (Fig. 7) . The varying nature of different fabrics fibers provided a scaffold for the attachment and formation of pigment-producing biofilms, potentially resulting in varied colors for different fabrics (ref) . To address the biosecurity concerns, sterilization was performed to effectively eliminate all living cells (Fig. 1f and Fig. 9) . This process didn’ t significantly affect the color of dyed fabrics (Fig. 1g) , ensuring the safety of the engineered living dyes for market applications. Additionally, the biofilm-dyed fabrics also showed high durability, maintaining stable K / S values even with 60 minutes washing with water or laundry detergent (Fig. 1g) .

[0176] Example 3 Towards the fabrication of a self-producing blue living dye.

[0177] The engineered blue living dye of S002 strain, which only overexpresses BpsA without adding the substrate of glutamine, is ineffectively in fabrics dyeing due to the low-production of indigoidine (Fig. 10) . C. glutamicum is used widely for amino acid biosynthesis in metabolic engineering and has the potential to be engineered for the self-accumulation of the substrate L-glutamine17. In our pursuit of fabricating a self-producing blue living dye, we subsequently engineered C. glutamicum to possess the capability to convert straw-based carbon sources into the blue pigment indigoidine (Fig. 2a) . The optimized strain, S004, which combined the overexpression of glutamate dehydrogenase (GDH) and the glutamine synthetase I mutant (GlnA*) 10, exhibited excellent performance in fabric dyeing without the addition of glutamine, achieving the highest production of indigoidine, albeit with a slight reduction in the yield of biofilm (Fig. 10) . Culturing the S004 strain for 1 day in M63 medium with 200μM IPTG (Fig. 11) resulted in indigoidine production reaching 583.6 mg / L (Fig. 2b) , enabling effective dyeing offabrics (Fig. 12) .

[0178] Then we utilized the engineered S004 strain as a self-producing blue living dye to color 70x30 cm2 nylon, acetate, silk, and wool scarves, resulting in uniformly colored scarves (Fig. 2c) . Additionally, various commercial fabrics such as denim, cotton, rayon, and polyester were subjected to testing, and all exhibited uniform dyeing with the engineered blue living dye (Fig. 13) , showcasing the versatility of the one-step biofilm dyeing strategy for fabric dyeing.

[0179] In everyday life, patterned fabrics are widely used. Therefore, we employed a moulding strategy to create patterned fabrics. Using a mold with the desired pattern, a bare fabric, and the S004 strain co-cultured in the biofilm formation M63 medium, we successfully formed the desired patterns on nylon, acetate, silk, and wool fabrics after a 1 day culture (Fig. 2d) .

[0180] Example 4 Designing light sensitive and responsive living dyes for spatial fabric patterning

[0181] In the pursuit for a more convenient and flexible fabric patterning strategy, transcending traditional moulding approach, the application of optogenetic tools for spatially controlling the production of living dyes emerges as a potential solution. Optogenetics not only provides unprecedented spatiotemporal precision but also offers greater flexibility and cost-effectiveness18-20. Our primary focus was on developing the Blue Light Activated Split-T7RNAP (BLASTR) optogenetic tool in C. glutamicum, featuring two distinct modules: the light-sensing module and the transcriptional output model (Fig. 3a) . This design leveraged insights from the previously engineered E. coli opto-T7RNAPs system21, 22 .Blue light induced dimerization of nMag and pMag completed the split T7RNAP, triggering transcription of the T7 promoter (Fig. 3a) . To adapt this system for use in C. glutamicum, we initially designed a highly responsive T7 promoter, P3, incorporating the original T7 promoter sequence and a bicistronic ribosome binding site (RBS) of BCD2. This design facilitated the high expression of mCherry as the reporter of the BLASTR system in C. glutamicum (Fig. 15 and Fig. 16) .

[0182] Following, we created BLASTR V001, where the recombinant fusion of the N-terminal of T7RNAP with the nMag (N-T7RNAP-nMag) was expressed from the IPTG-inducible PtacM promoter along with the strong RBS of BCD2. Simultaneously, the recombinant fusion of the pMag with the C-terminal of T7RNAP (pMag-C-T7RNAP) was expressed from the CA-inducible Pspank promoter along with the strong RBS of BCD2 (Fig. 3a, Fig. 17 and Fig. 18a) . In characterizing BLASTR V001, we induced the expression of N-T7 RNAP-nMag and pMag-C-T7 RNAP by adding different combinations of IPTG and CA concentrations under blue light. However, we observed a relatively low Light / Dark contrast, with the highest being 6.8-fold induction (Fig. 18b-e) . Furthermore, the output was high in the dark even without adding IPTG and CA. These results were likely due to high leakiness leading to the self-aggregation of N-T7 RNAP-nMag and pMag-C-T7 RNAP in the dark (Fig. 18b) .

[0183] To reduce leakiness and enhance the Light / Dark contrast of BLASTR V001, BLASTR V002 was developed by substituting the strong BCD2 RBS with the weak RBS of CGR083 (Fig. 3b, Fig. 15, and Fig. 19) , thereby reducing the expression level of N-T7RNAP-nMag and pMag-C-T7RNAP. With BLASTR V002, background expression significantly decreased, and the Light / Dark contrast was enhanced to approximately a 30-fold induction (Fig. 3b and Fig. 19) . Leveraging the optimal optogenetic tool BLASTR V002 established in C. glutamicum, we initially utilized it to manipulate biofilm formation in space. This began with testing the blue light-induced control of mCherry-expressed spatial biofilm distribution patterning in polystyrene Petri dishes using the projected light pattern. The corresponding patterning resolutions were approximately 1 mm under blue light and 2 mm in dark, respectively (Fig. 20) .

[0184] To demonstrate the potential for spatially patterning fabrics in a one-step process using engineered living dye, we employed the BLASTR V002 optogenetic tool to control the expression of the BspA enzyme (Fig. 3c) . The highest Light / Dark contrast in indigoidine production exhibited an almost 1150-fold induction (Fig. 21) . Taking into account both indigoidine production and Light / Dark contrast on fabric dyeing (Fig. 22) , we selected the condition of5μM IPTG and 200 nM CA (with 725-fold induction) for the subsequent fabric patterning using the projected light pattern (Fig. 3d) . With nylon fabric or acetate fabric containing the light-sensing blue living dye (S009 strain) , we grew them in the dark for~7 hours with a project. The blue living dye produced a sharper pattern at resolutions of 2 mm on hydrophobic nylon (Fig. 3e) and 3 mm on hydrophilic acetate (Fig. 23) . Furthermore, color-depth-controllable gradient-patterned fabrics could also be flexibly fabricated by tuning the light intensity to regulate the indigoidine production level (Fig. 3e and Fig. 23) . Notably, these results indicate that we have established a sensitive optogenetic tool, BLASTR V002, in C. glutamicum, enabling the fabrication of light sensing blue living dye for sharper spatial patterning on various fabrics.

[0185] Example 5 Engineering a black living dye for fabric dyeing in C. glutamicum

[0186] To demonstrate the versatility of our one-step biofilm dyeing strategy, we sought to explore the potential for developing a black living dye for crafting fabrics in black. Initially, we introduced two enzymes, a tyrosine of MelA and its activator MelC, responsible for the intracellular water-insoluble black pigment melanin biosynthesis23, into C. glutamicum (Fig. 24a) . The MelA-MelC enzymes catalyze the conversion of tyrosine into L-dopaquinone, which spontaneously polymerizes into melanin23. We began by constitutively expressing the melA and melC genes with a strong promoter PH1m and a strong RBS of BCD2 to ensure high melanin production (Fig. 24a) . Quantitative analysis of melanin and biofilm production confirmed the successful engineering of melanin-producing biofilm (Fig. 24b) . Utilizing the melanin-producing biofilm as a black living dye (S0010 stain) for co-culturing with various bare fabrics enabled the fabrication of various black fabrics (Fig. 24c) .

[0187] To design patterned black fabrics, we employed C. glutamicum BLASTR V002 to control the expression of MelA-MelC and constructed the S0011 strain (Fig. 4a) . The S0011 strain demonstrated the highest Light / Dark contrast in melanin production, with an almost 6.9-fold induction (Fig. 25) . Considering both melanin production and Light / Dark contrast on fabric dyeing (Fig. 25 and Fig. 26) , we selected the condition of 5μM IPTG and 200 nM CA (resulting in 5.9-fold induction) for the subsequent fabric patterning (Fig. 25) . Ultimately, harnessing the S0011 strain we successfully patterned nylon and acetate fabrics with the project patterns (Fig. 4b) and achieved the formation of depth-controllable gradient fabrics by tuning the light intensity from 100%to 10% (Fig. 4c and Fig. 27) . These experiments collectively emphasize the versatility of engineered biofilm-based living dyes for one-step fabric dyeing across a range of colors and in the fabrication of both pure and patterned fabrics.

[0188] Example 6 Engineering a black living dye for fabric dyeing in E. coli

[0189] We first transformed (Calcium chloride method) plasmid ofPatc-CsgA (ref: An B, Wang Y, Jiang X, et al. Programming living glue systems to perform autonomous mechanical repairs [J] . Matter, 2020, 3 (6) : 2080-2092. ) (Chloramphenicol resistance, 35 ug / ml) into E. coli MG1655△CsgA (ref: Wang Y, An B, Xue B, et al. Living materials fabricated via gradient mineralization of light-inducible biofilms [J] . Nature chemical biology, 2021, 17 (3) : 351-359. ) to construct the strain E1 for inducible expression the amyloid protein, CsgA, for E. coli adherent biofilm formation. Subsequently, the Pahl-melA-melC plasmid (Carbenicillin resistance, 100 ug / ml, the sequence of the plasmid is as follows: ATCTATCAACAGGAGTCCAAGCGAGCTCGATATCAAATTACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCACAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGGAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAGATATCGACGTCAAAGGGCCCAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCATGGGGAGACCCCACACTACCATCGGCGCTACGGCGTTTCACTTCTGAGTTCGGCATGGGGTCAGGTGGGACCACCGCGCTACTGCCGCCAGGCATCTAGAGATATATGGTAGTAGTAAGTTAATTTTCATTAACCACCACTACCAATCACCTCCTGGATTTAGCTGTCGACTATTCGACTATAACAAAcCATTTTCTTGCGTAAACCTGTACGATCCTACAGGTGCTTATGTTAAGTAATTGTATTCCCAGCGATACAATAGTGTGACAAAAATCCAATTTATTAGAATCAAATGTCAATCCATTACCGTTTTAATGATATATAACACGCAAAACTTGCGACAAACAATAGGTAAGGATAAAGAGATGGGTCTCGAGTTAATTTTTAAAGTATGGGCAATCAATTGCTCCTGTTAAAATTGCTTTAGAAATACTTTGGCAGCGGTTTGTTGTATTGAGTTTCATTTGCGCATTGGTTAAATGGAAAGTGACAGTACGCTCACTGCAGCCTAATATTTTTGAAATATCCCAAGAGCTTTTTCCTTCGCATGCCCACGCTAAACATTCTTTTTCTCTTTTGGTTAAATCGTTGTTTGATTTATTATTTGCTATATTTATTTTTCGATAATTATCAACTAGAGAAGGAACAATTAATGGTATGTTCATACACGCATGTAAAAATAAACTATCTATATAGTTGTCTTTTTCTGAATGTGCAAAACTAAGCATTCCGAAGCCATTGTTAGCCGTATGAATAGGGAAACTAAACCCAGTGATAAGACCTGATGTTTTCGCTTCTTTAATTACATTTGGAGATTTTTTATTTACAGCATTGTTTTCAAATATATTCCAATTAATTGGTGAATGATTGGAGTTAGAATAATCTACTATAGGATCATATTTTATTAAATTAGCGTCATCATAATATTGCCTCCATTTTTTAGGGTAATTATCTAGAATTGAAATATCAGATTTAACCATAGAATGAGGATAAATGATCGCGAGTAAATAATATTCACAATGTACCATTTTAGTCATATCAGATAAGCATTGATTAATATCATTATTGCTTCTACAAGCTTTAATTTTATTAATTATTCTGTATGTGTCGTCGGCATTTATGTTTTTCATGATTTATATTTGGGCAAAGTTAATGTTTGTGTTAATTGTCAAGTAGCGGCGGAACACTTTGTGGGAACTTTCACCACTCCACGTCAAGAATAAACTTTTAAAGAGGTGTAAGGTTCCGAAGTATGCAAAGATGAGCATTCCGAAGCCATTTTTAGCCGTAAGAATATGGCAAACTGAACCCCTGTGATCAGACCTGATGTTGGTGTTGCTAAAAATGCATGGGGGTGATATATTATTTACATCCGTATTTTCAAATGTATTTCAATCAGTACGGGAGTGACTGGAGTTCGAATAATCTGCTATAGGATCCTAGTAAATTTAACCAGCCCCTTCATAATATTGCCTCCGGTAATTAGGGTGATTTTGTACAAGGTAAAGATCAGATTTAACCAGAGAAGGAGGATCAATGATCGGGAGTAAATAATACTCACAATGTACCATATTGCACATATCAGATAAGCACCGATTAACATCATTATTGCGGCACAAGCTTTACTTTTGATCAATCTTCTGTCAGCGTTTTCGTCAATGATATTCATCTTACCCATCTTATTAACGTAACCTATCATCAGTAGCAAGTTAAGAATGTATTATATCATTAAAACGGTAATGGATAGACAGGTGATTATAATAAATTGGATTTTCGTCACACTGTGGTATCGTTGGGAATACAATTACTTAACATAAGCACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATATCAGCAGGACGCACTGACCGAATTCTACCATTCACCTCTTGGATTTAGCTATTAAAGAGGAGAAAGGTACCATGACTATGACAAGACTGAAGATTTCGAAAACTCTGCTGGCTGTAATGTTGACCTCTGCCGTCGCGACCGGCTCTGCCTACGCGGAAAACAACGCGCAGACTACCAATGAAAGCGCAGGGCAAAAAGTCGATAGCTCTATGAATAAAGTCGGTAATTTCATGGATGACAGCGCCATCACCGCGAAAGTGAAGGCGGCCCTGGTGGATCATGACAACATCAAGAGCACCGATATCTCTGTAAAAACCGATCAAAAAGTCGTGACCCTGAGCGGTTTCGTTGAAAGCCAGGCCCAGGCCGAAGAGGCAGTGAAAGTGGCGAAAGGCGTTGAAGGGGTGACCTCTGTCAGCGACAAACTGCACGTTCGCGACGCTAAAGAAGGCTCGGTGAAGGGCTACGCGGGTGACACCGCCACCACCAGTGAAATCAAAGCCAAACTGCTGGCGGACGATATCGTCCCTTCCCGTCATGTGAAAGTTGAAACCACCGACGGCGTGGTTCAGCTCTCCGGTACCGTCGATTCTCAGGCACAAAGTGACCGTGCTGAAAGTATCGCCAAAGCGGTAGATGGTGTGAAAAGCGTTAAAAATGATCTGAAAACTAAGGGAGGTGGAAGTATGACAGTCCGTAAAAATCAAGCATCCTTGACGGCGGAAGAGAAACGTCGTTTTGTAGCGGCATTACTTGAATTAAAACGTACCGGCCGTTATGACGCGTTCGTGACTACCCACAATGCATTCATTCTGGGGGATACCGATAACGGTGAACGCACAGGCCACCGCTCGCCCAGCTTTCTGCCCTGGCATCGCCGCTTCTTGTTGGAGTTTGAACGCGCACTGCAATCGGTCGATGCGAGCGTCGCCCTGCCGTATTGGGATTGGTCCGCGGATCGCTCAACCCGCTCTTCGCTGTGGGCGCCAGATTTTTTGGGCGGCACGGGCCGTAGCCGCGACGGCCAGGTTATGGATGGCCCTTTCGCAGCCTCGGCAGGTAATTGGCCGATTAATGTCCGTGTGGACGGCCGCACGTTCCTCCGCCGTGCGTTAGGCGCCGGCGTGAGCGAACTGCCAACCCGCGCTGAAGTGGACAGCGTCCTGGCCATGGCTACCTACGATATGGCGCCCTGGAACTCCGGCAGCGATGGCTTTCGCAATCATTTAGAGGGTTGGCGCGGTGTCAATCTGCATAACCGCGTGCACGTTTGGGTTGGTGGTCAAATGGCCACGGGCGTTAGCCCCAATGATCCGGTTTTCTGGTTACACCATGCCTATATTGATAAATTATGGGCGGAATGGCAGCGCCGTCATCCGAGCAGCCCGTATTTGCCAGGCGGAGGTACGCCCAACGTGGTGGACTTAAATGAAACTATGAAGCCGTGGAATGACACGACCCCCGCAGCCCTGTTAGATCATACCCGTCACTATACCTTTGATGTCTAATCACACAGAATTCATTAAAGAGGAGAAAGGTACCATGCCAGAACTCACACGCCGTCGCGCGCTGGGAGCTGCAGCGGTCGTGGCTGCGGGAGTCCCACTGGTGGCCCTCCCGGCCGCACGTGCAGACGATCGCGGGCACCATACGCCCGAAGTTCCGGGCAACCCAGCGGCATCGGGTGCCCCCGCCGCCTTTGATGAGATCTACAAGGGCCGCCGTATTCAGGGTCGTACTGTGACGGATGGCGGCGGACACCATGGAGGTGGTCATGGTGGTGATGGCCACGGCGGTGGTCACCACGGTGGCGGTTATGCGGTTTTTGTTGACGGGGTCGAGCTCCATGTAATGCGTAACGCGGATGGGAGCTGGATCTCGGTGGTGAGCCACTACGAACCGGTCGATACTCCTCGCGCGGCCGCGCGCGCAGCGGTAGATGAATTACAGGGAGCCCGCCTGCTCCCGTTCCCTAGCAATTAAACGCGTGCTAGAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGCCCTAGACCTAGGGATATATTCCGCTTCCTCGCTCACTGACTCGCTACGCTCGGTCGTTCGACTGCGGCGAGCGGAAATGGCTTACGAACGGGGCGGAGATTTCCTGGAAGATGCCAGGAAGATACTTAACAGGGAAGTGAGAGGGCCGCGGCAAAGCCGTTTTTCCATAGGCTCCGCCCCCCTGACAAGCATCACGAAATCTGACGCTCAAATCAGTGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGCGGCTCCCTCGTGCGCTCTCCTGTTCCTGCCTTTCGGTTTACCGGTGTCATTCCGCTGTTATGGCCGCGTTTGTCTCATTCCACGCCTGACACTCAGTTCCGGGTAGGCAGTTCGCTCCAAGCTGGACTGTATGCACGAACCCCCCGTTCAGTCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGAAAGACATGCAAAAGCACCACTGGCAGCAGCCACTGGTAATTGATTTAGAGGAGTTAGTCTTGAAGTCATGCGCCGGTTAAGGCTAAACTGAAAGGACAAGTTTTGGTGACTGCGCTCCTCCAAGCCAGTTACCTCGGTTCAAAGAGTTGGTAGCTCAGAGAACCTTCGAAAAACCGCCCTGCAAGGCGGTTTTTTCGTTTTCAGAGCAAGAGATTACGCGCAGACCAAAACGATCTCAAGAAGATCATCTTATTAATCAGATAAAATATTTCTAGATTTCAGTGCAATTTATCTCTTCAAATGTAGCACCTGAAGTCAGCCCCATACGATATAAGTTGTTACTAGTGCTTGGATTCTCACCAATAAAAAACGCCCGGCGGCAACCGAGCGTTCTGAACAAATCCAGATGGAGTTCTGAGGTCATTACTGG (SEQ ID NO: 52) ) was transformed into the strain E1 to construct the strain E2. The E2 can inducibly express CsgA by the addition of 250 ng / ml anhydrotetracycline and inducibly expressed MelA-MelC by the addition of 1mM AHL. For black pigment production in engineered E. coli biofilm, the strain E2 was cultured in M63 medium by addition of 3‰ (v / v) straw-based carbon resource, 0.032 g / L CuSO4, 0.3 g / L tyrosine, 250 ng / ml anhydrotetracycline and 1mM AHL.

[0190] For fabric dyeing with the engineered melanin produced E. coli adherent biofilm, various fabrics are co-cultured with the strain E2 in M63 medium by addition of 3‰ (v / v) straw-based carbon resource, 0.032 g / L CuSO4, 0.3 g / L tyrosine, 250 ng / ml anhydrotetracycline and 1mM AHL and cultured in 30℃without shaking.

[0191] As can be seen from Figure 32, E. coli can also achieve one step dyeing for fabric as C. glutamicum.

[0192] Table 1

[0193] Table 2 Promoter sequences used in this work.

[0194] Table 3 Ribosome binding sites (RBS) used in this work.

[0195] Table 4

[0196] DNA sequences for the coding of proteins used in the present study

[0197] Notes:

[0198] 1) Underlined letters indicate the linker sequence

[0199] Table 5 other elements in the plasmids used in the present application

[0200] The foregoing description of the specific embodiments will so fully reveal the general nature of the disclosure that others can, by applying knowledge within the skill of the relevant art (s) (including the contents of the documents cited and incorporated by reference herein) , readily modify and / or adapt for various applications such specific embodiments, without undue experimentation, without departing from the general concept of the present disclosure. Such adaptations and modifications are therefore intended to be within the meaning and range of equivalents of the disclosed embodiments, based on the teaching and guidance presented herein. It is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance presented herein, in combination with the knowledge of one skilled in the relevant art (s) .

[0201] While various embodiments of the present disclosure have been described above, it should be understood that they have been presented by way of examples, and not limitation. It would be apparent to one skilled in the relevant art (s) that various changes in form and detail could be made therein without departing from the spirit and scope of the disclosure. Thus, the present disclosure should not be limited by any of the above-described exemplary embodiments but should be defined only in accordance with the following claims and their equivalents.

[0202] All references cited herein are incorporated herein by reference in their entirety and for all purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes.

[0203] References

[0204] 1. Fried, R.; Oprea, I.; Fleck, K.; Rudroff, F.J.G.C., Biogenic colourants in the textile industry–a promising and sustainable alternative to synthetic dyes. 2022, 24 (1) , 13-35.

[0205] 2. Tkaczyk, A.; Mitrowska, K.; Posyniak, A.J.S. o. t. t. e., Synthetic organic dyes as contaminants of the aquatic environment and their implications for ecosystems: A review. 2020, 717, 137222.

[0206] 3. Rather, L.J.; Mir, S.S.; Ganie, S.A.; Li, Q.J.D.; Pigments, Research progress, challenges, and perspectives in microbial pigment production for industrial applications-A review. 2023, 210, 110989.

[0207] 4. Kramar, A.; Kostic, M.M.J.T., Bacterial secondary metabolites as biopigments for textile dyeing. 2022, 2 (2) , 252-264.

[0208] 5. An, B.; Wang, Y.; Huang, Y.; Wang, X.; Liu, Y.; Xun, D.; Church, G. M.; Dai, Z.; Yi, X.;

[0209] Tang, T. -C. J.C.R., Engineered living materials for sustainability. 2022, 123 (5) , 2349-2419.

[0210] 6. Yang, D.; Park, S.Y.; Lee, S.Y.J.A.S., Production of rainbow colorants by metabolically engineered Escherichia coli. 2021, 8 (13) , 2100743.

[0211] 7. Li, F.; Chen, Q.; Deng, H.; Ye, S.; Chen, R.; Keasling, J.D.; Luo, X.J.M.E., One-pot selective biosynthesis of Tyrian purple in Escherichia coli. 2023.

[0212] 8. Yin, H.; Chen, H.; Yan, M.; Li, Z.; Yang, R.; Li, Y.; Wang, Y.; Guan, J.; Mao, H.; Wang, Y. J. A. o., Efficient bioproduction of indigo and indirubin by optimizing a novel terpenoid cyclase XiaI in Escherichia coli. 2021, 6 (31) , 20569-20576.

[0213] 9. Banerjee, D.; Eng, T.; Lau, A. K.; Sasaki, Y.; Wang, B.; Chen, Y.; Prahl, J. -P.; Singan, V.R.; Herbert, R. A.; Liu, Y. J. N. c., Genome-scale metabolic rewiring improves titers rates and yields of the non-native product indigoidine at scale. 2020, 11 (1) , 5385.

[0214] 10. Ghiffary, M. R.; Prabowo, C. P. S.; Sharma, K.; Yan, Y.; Lee, S. Y.; Kim, H. U. J. A. S. C.; Engineering, High-level production of the natural blue pigment indigoidine from metabolically engineered Corynebacterium glutamicum for sustainable fabric dyes. 2021, 9 (19) , 6613-6622.

[0215] 11. Linke, J.A.; Rayat, A.; Ward, J.M.J.B.; Bioprocessing, Production of indigo by recombinant bacteria. 2023, 10 (1) , 20.

[0216] 12. Hsu, T.M.; Welner, D.H.; Russ, Z.N.; Cervantes, B.; Prathuri, R.L.; Adams, P.D.; Dueber, J.E.J.N. c. b., Employing a biochemical protecting group for a sustainable indigo dyeing strategy. 2018, 14 (3) , 256-261.

[0217] 13. Lee, J.; Kim, J.; Song, J. E.; Song, W. -S.; Kim, E. -J.; Kim, Y. -G.; Jeong, H. -J.; Kim, H.R.; Choi, K. -Y.; Kim, B. -G. J. N. C. B., Production of Tyrian purple indigoid dye from tryptophan in Escherichia coli. 2021, 17 (1) , 104-112.

[0218] 14. Sauer, K.; Stoodley, P.; Goeres, D.M.; Hall-Stoodley, L.;  M.; Stewart, P.S.; Bjarnsholt, T. J. N. R. M., The biofilm life cycle: Expanding the conceptual model of biofilm formation. 2022, 20 (10) , 608-620.

[0219] 15. Rumbaugh, K.P.; Sauer, K.J.N.R.M., Biofilm dispersion. 2020, 18 (10) , 571-586.

[0220] 16. Brown, A.S.; Calcott, M.J.; Collins, V.M.; Owen, J.G.; Ackerley, D.F.J.B.L., The indigoidine synthetase BpsA provides a colorimetric ATP assay that can be adapted to quantify the substrate preferences of other NRPS enzymes. 2020, 42, 2665-2671.

[0221] 17. Lv, Q.; Hu, M.; Tian, L.; Liu, F.; Wang, Q.; Xu, M.; Rao, Z.J.B.T., Enhancing l-glutamine production in Corynebacterium glutamicum by rational metabolic engineering combined with a two-stage pH control strategy. 2021, 341, 125799.

[0222] 18. Wang, Y.; An, B.; Xue, B.; Pu, J.; Zhang, X.; Huang, Y.; Yu, Y.; Cao, Y.; Zhong, C.J.N.C.B., Living materials fabricated via gradient mineralization of light-inducible biofilms. 2021, 17 (3) , 351-359.

[0223] 19. Emiliani, V.; Entcheva, E.; Hedrich, R.; Hegemann, P.; Konrad, K. R.; Lüscher, C.; Mahn, M.; Pan, Z. -H.; Sims, R. R.; Vierock, J. J. N. R. M. P., Optogenetics for light control of biological systems. 2022, 2 (1) , 55.

[0224] 20. Reshetnikov, V.V.; Smolskaya, S.V.; Feoktistova, S.G.; Verkhusha, V.V.J.T.i.B., Optogenetic approaches in biotechnology and biomaterials. 2022.

[0225] 21. Baumschlager, A.; Aoki, S.K.; Khammash, M.J.A.s.b., Dynamic blue light-inducible T7 RNA polymerases (Opto-T7RNAPs) for precise spatiotemporal gene expression control. 2017, 6 (11) , 2157-2167.

[0226] 22. Han, T.; Chen, Q.; Liu, H.J.A.s.b., Engineered photoactivatable genetic switches based on the bacterium phage T7 RNA polymerase. 2017, 6 (2) , 357-366.

[0227] 23. Meng, D.; Mukhitov, N.; Neitzey, D.; Lucht, M.; Schaak, D.D.; Voigt, C.A.J.M.E., Rapid and simultaneous screening of pathway designs and chassis organisms, applied to engineered living materials. 2021, 66, 308-318.

[0228] 24. Choi, S.Y.; Lim, S.; Yoon, K. -h.; Lee, J.I.; Mitchell, R.J.J.J.o.B.E., Biotechnological activities and applications of bacterial pigments violacein and prodigiosin. 2021, 15 (1) , 1-16.

[0229] 25. Tang, T. -C.; An, B.; Huang, Y.; Vasikaran, S.; Wang, Y.; Jiang, X.; Lu, T. K.; Zhong, C.J.N.R.M., Materials design by synthetic biology. 2021, 6 (4) , 332-350.

Claims

1.Amethod offabric dyeing, comprising:a)contacting a fabric with a bacterium in a culture medium, the bacterium being capable of forming an adherent biofilm and producing a pigment;b)culturing the bacterium under conditions that allow the bacteria to form an adherent biofilm on the surface ofthe fibers ofthe fabric and to produce the pigment;c)allowing deposition ofthe pigment produced by the bacteria in the adherent biofilm on the fabric; andd)inactivating, such as killing the bacteria in the adherent biofilm on the fabric.2.The method according to claim 1, wherein the bacterium is a gram-positive bacterium, preferably the bacterium is one ofgenus Corynebacterium, more preferably, the bacterium is Corynebacterium glutamicum.3.The method according to claim 1, wherein the bacterium is a gram-negative bacterium, preferably the bacterium is one of genus Escherichia, more preferably, the bacterium is E. coli.4.The method according to claim 2, wherein the bacterium is Corynebacterium glutamicum and the culture medium is M63 medium, or TSB medium, or the TSBG medium, preferably, the culture medium is M63 medium.5.The method according to claim 1, wherein steps b) and c) are performed at the same time.6.The method according to any one of claims 1-5, wherein the pigment is a natural pigment which can be produced by bacteria, such as indigoidine, melanin, astaxanthin, proviolacein, tyrian purple, or indigo, preferably, the pigment is indigoidine, or melanin.7.The method according to claim 1, wherein the bacterium comprises a first polynucleotide encoding indigoidine synthetase under the control ofan inducible promoter.8.The method according to claim 7, wherein the inducible promoter is an IPTG inducible promoter, and the bacterium is capable of synthesizing indigoidine in the presence ofIPTG and glutamine in the culture medium.9.The method according to claim 7, wherein the bacterium further comprises a second polynucleotide encoding glutamate dehydrogenase and a third polynucleotide encoding the mutant of glutamine synthetase I (Y405I) , so that the bacterium is capable of synthesizing indigoidine without addition ofglutamine to the culture medium.10.The method according to any one ofclaims 1-9, wherein the deposition ofthe pigment forms a uniform staining on the fabric.11.The method according to any one ofclaims 1-9, wherein the deposition ofthe pigment forms apattern on the fabric.12.The method according to claim 11, wherein the pattern on the fabric is formed by co-culturing the fabric, the bacterium and a mold having a desired pattern which mold covers on the fabric.13.The method according to claim 11, wherein the bacterium comprises an optogenetic tool which enables the bacterium to form a pigment-producing biofilm in response to a light.14.The method according to claim 13, wherein the deposition of the pigment-producing biofilm in response to the light forms a pattern on the fabric.15.The method according to claim 14, wherein the light is a blue light, red light, or green light.16.The method according to claim 14, wherein the optogenetic tool is a blue light activated split-T7RNAP (BLASTR) system comprising a light sensing module and a transcriptional output module,wherein the light-sensing module comprises from 5’ to 3’ , operatively linked a first inducible promoter, aribosome binding site (RBS) , the coding sequence ofN-T7 RNAP, alinker, and the coding sequence of nMag, and operatively linked a second inducible promoter, asecond ribosome binding site (RBS) , the coding sequence of pMag, alinker, and the coding sequence ofC-T7RNAP; andwherein the transcriptional output module comprises from 5’ to 3’ , athird promoter, athird RBS and a target protein coding sequence, wherein the transcription level of the target protein determines the yield ofthe pigment.17.The method according to claim 16, whereinstep b) further comprises exposing the fabric to a light source which forms a blue light pattern on the fabric, so that the adherent bacterial biofilm exposed to blue light in the adherent biofilm is induced to produce the pigment and dye the fabric with the pigment-producing biofilm.18.The method according to claim 17, wherein the bacterium further comprises a second polynucleotide encoding glutamate dehydrogenase and a third polynucleotide encoding the mutant of glutamine synthetase I (Y405I) , so that indigoidine can be synthesized by the bacterium without addition ofglutamine to the culture medium.19.The method according to claim 18, wherein step b) further comprises adding an inducer of the first inducible promoter such as IPTG and an inducer of the second inducible promoter such as CA to the culture medium to induce the expression of the recombinants of nMag fused to N-T7 RNAP and the pMag fused to C-T7RNAP, respectively, and wherein upon the bacterium being exposed to blue light, the expressed light-sensing module ofnMag and pMag bind to each other to form a dimer so that N-T7 RNAP linked to nMag and C-T7 RNAP linked to pMag to form a complete functional T7 RNAP which then triggers the transcription of the third promoter which initiates the transcription ofthe coding sequence ofthe target protein;wherein the amount ofthe light determines the amount ofthe formed complete functional T7 RNAP which then determines the transcriptional level oftarget protein.20.The method according to claim 19, wherein the bacterium is Corynebacterium glutamicum, the target protein is indigoidine synthetase and the first inducible promoter is PtacM, and / or the second inducible promoter is Pstpank, and / or the third promoter is P3 as shown in SEQ ID NO: 21.21.The method according to claim 20, wherein the first and the second RBS of the light sensing module are both CGR083 and the third RBS is BCD2.22.The method according to any one of claims 1-6, wherein the bacterium comprises a polynucleotide encoding MelA-MelC, and the pigment is melanin.23.The method according to claim 16, wherein the target protein is MelA-MelC.24.The method according to claim 23, wherein step b) further comprises adding an inducer of the first inducible promoter such as IPTG and an inducer of the second inducible promoter such as CA to the culture medium to induce the expression of the recombinants of nMag fused to N-T7 RNAP and the pMag fused to C-T7RNAP, respectively, and wherein upon the bacterium being exposed to blue light, the expressed light-sensing module ofnMag and pMag bind to each other to form a dimer so that N-T7 RNAP linked to nMag and C-T7 RNAP linked to pMag form a complete functional T7 RNAP which triggers the transcription of the third promoter which initiates the transcription ofthe coding sequence (s) ofthe target protein (s) ;wherein the amount of the light such as blue light determines the amount of the formed complete functionalT7 RNAP which then determines the expression level of MelA and MelC enzymes.25.The method according to claim 24, wherein the bacterium is Corynebacterium glutamicum and the first inducible promoter is PtacM, and / or the second inducible promoter is Pstank, and / or the thirdpromoter is P3 as shown in SEQ ID NO: 21.26.The method according to claim 25, wherein the first and second RBS of the light sensing module are both CGR083 and the third RBS is BCD2.27.The method according to any one ofclaims 1-26, wherein the fabric is nylon, acetate, silk, wool, denim, cotton, rayon, or polyester.28.The method according to any one ofclaims 1-27, wherein step d) comprises sterilizing the fabric to kill the living bacteria.29.The method according to claim 28, wherein the sterilizing is achieved by high temperature facilities.30.A fabric producedby the method ofany one ofclaims 1-29.31.A clothing made from the fabric ofclaim 30.