Novel markers for the verification of a reliable biological sample and uses thereof
MUC5B and TFF3 markers ensure reliable cervical sampling by verifying the presence of cells from the transition zone, addressing false-negative issues in HPV screening and improving lesion detection accuracy.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- RHEINISCHE FRIEDRICH WILHELMS UNIVERSITAT BONN
- Filing Date
- 2025-11-11
- Publication Date
- 2026-05-15
AI Technical Summary
Existing cervical cancer screening methods, particularly those relying on HPV DNA testing, often yield false-negative results due to inadequate sampling from the transition zone and endocervical canal, where dysplastic and neoplastic lesions arise, leading to missed early detection of pre-neoplastic and neoplastic lesions.
The use of MUC5B and/or TFF3 markers to verify the presence of cells from the cervical transition zone and/or endocervical canal in biological samples, ensuring reliable sampling for HPV detection and dysplastic/neoplastic lesion screening.
The markers enhance the reliability of cervical cancer screening by reducing false-negative results and improving patient stratification for follow-up treatment, ensuring accurate detection of HPV infections and related lesions.
Smart Images

Figure IMGF000009_0001 
Figure IMGF000029_0001 
Figure 00000035_0000
Abstract
Description
[0001] NOVEL MARKERS FOR THE VERIFICATION OF A RELIABLE BIOLOGICAL SAMPLE AND USES THEREOF
[0002] FIELD OF THE INVENTION
[0003] The present invention relates to a combination of markers for detecting human papillomavirus (HPV) in a cervical sample, wherein said combination of markers comprises a first marker selected from MUC5B and / or TFF3 for verifying the reliability of the cervical sample, wherein the expression of the first marker indicates that the cervical sample comprises cells from the cervical transition zone and / or endocervical canal where early dysplastic and neoplastic HPV- related lesions arise; and a second marker for detecting a HPV. Further, the present invention relates to a method for verifying the reliability of a biological sample based on the analysis of one or more markers selected from MUC5B and / or TFF3, wherein the expression of one of these markers indicates that the cervical sample comprises cells from a transition zone and / or endocervical canal. Also provided is the use of at least one of the markers of the invention for verifying the reliability of a biological sample. Positive detection of least one of the markers assures that the biological sample is reliable, thereby prevents false negative screening tests. Furthermore, provided are methods for screening of sexually transmitted infections (STI), such as a HPV-infection, and methods for screening of dysplastic / neoplastic lesions in a biological sample. The present invention also provides a kit of parts for the above-mentioned methods.
[0004] TECHNICAL BACKGROUND
[0005] Cervical cancer is the fourth leading cause of cancer death in women worldwide, causing more than 275 000 deaths annually. This cancer has a very uneven global distribution; over 85% of cases are found in low-resource countries, with incidence and death rates being the highest in sub-Saharan Africa, Central America, South-Central Asia, and Melanesia. This imbalance can be explained by differences in background risk such as the exposure to high-risk human papillomavirus (hrHPV) infection, and the fact that cervical cancer is preventable by an effective screening and intervention system. The impact of population-based screening is reflected in a substantial reduction in the incidence and mortality rates of cervical cancer over the past 50 years in countries with established cytology-based screening programs.
[0006] However, cytology-based cervical screening has some limitations. The major issue is the low sensitivity of a single smear to detect high-grade precursor lesions (50%-70%), which require frequent testing. Infection with hrHPV is a necessary event in the multistep process of cervical carcinogenesis. The causal relationship between infection with hrHPV and cervical cancer has stimulated the application of hrHPV DNA testing, which has been proposed, either alone or in combination with cytology, as a means to improve existing cervical screening programs.
[0007] The application of hrHPV DNA testing enables the identification of patients at risk for HPV related pre-neoplastic / dysplastic lesions and neoplasms arising in the uterine cervix. In order to detect early pre-neoplastic and neoplastic lesions these tests rely on accurate sampling of the endocervical canal, not just the ectocervix, as cancer arises in the transition zone and / or endocervical canal. Cytologic evaluation of endocervical smears contains evaluation for adequacy of sampling (in Germany according to the Munchner Nomenclature III PAP Group 0 is unsatisfactory for evaluation, e.g., because of lack of visible endocervical glandular cells. In these cases the ectocervix or vagina has been sampled containing only ectocervical squamous cells. In the US specimen adequacy is also reported in the BETHESDA classification and in these cases the sampling has to be repeated.
[0008] As increasingly molecular only HPV screening is employed in national screening programs omitting cytology, the adequacy check is missing, raising the need for additional markers. The commonly used screening tests include high-risk Human papillomavirus (hrHPV) specific primer sets for nucleic acid amplification, such as RT-PCR Polymerase chain reaction, isotherm DNA amplification, TMA transcription mediated amplification, ddPCR and the like. The screening tests are utilized on cervical swab samples collected with a small brush, a swab or a spatula and transferred into commercially available transport media, wherein the sample can be collected by a physician or by self-testing of a woman. Physician-obtained sampling aims to comprise endocervical sampling, whereas most self-tests of a women sample are restricted to vaginal or ectocervical sampling.
[0009] Molecular testing alone of the collected cervical swab samples assesses the presence of virus. However, molecular testing does not reveal whether cells from the correct anatomic site are obtained, specifically from the transition zone and / or endocervical canal, where most dys- plastic / neoplastic lesions arise. Therefore, hrHPV testing can yield false-negative test results and very early pre-neoplastic dysplastic lesions (Low-grade squamous intraepithelial lesion (LSIL) and / or High-grade squamous intraepithelial lesion (HSIL)) and / or cancer can be missed.
[0010] One option to enhance the reliability of gynecologic screening tests and the stratification of patients at risk for cervical cancer is the analysis of cervical swabs comprising the detection of the presence of human cells at all, the detection of cells of the cervical epithelium, the detection of the presence of endocervical as well as ectocervical cells and the detection of cells of endometrial origin.
[0011] In particular, the detection of the presence of endocervical cells within the sample is crucial to ensure, that the specimen was taken at the cervical transformation zone, where most dysplasia and neoplasia arise. Without the presence of such cells, the sample is not reliable for the molecular and / or cytological testing procedure, since it is prone to give false negative results.
[0012] Despite all above progress, there are still false-negative test results of cervical screening leading to a lack of an early detection of pre-neoplastic dysplastic lesions (LSIL, HSIL) and / or cancer. In fact, the problem of false-negative test results is not restricted to cervical screening, but similarly applies to the screening for HPV-infections and / or screening for dysplastic / neoplastic lesions at other anatomic sites, such as the anal canal.
[0013] Thus, it is an object of the present invention to verify the reliability of biological samples by indicating that sample cell material has been obtained from the correct anatomic site, e.g., from a transition zone, such as the cervical transition zone, where dysplastic / neoplastic lesions arise.
[0014] SUMMARY OF THE INVENTION
[0015] The present invention provides at least one marker for verifying the reliability of a biological sample, wherein the expression of the at least one marker indicates that the biological sample comprises cells from a transition zone and / or endocervical canal. The problem is solved by subject matter of claims 1 , 2, 13, and 15. Embodiments are subject matter of claims 2 to 12, and 14.
[0016] In particular, the present disclosure provides:
[0017] [1] A combination of markers for detecting human papillomavirus (HPV) in a cervical sample, wherein said combination of markers comprises:
[0018] (i) a first marker selected from MUC5B and / or TFF3 for verifying the reliability of the cervical sample, wherein the expression of the first marker indicates that the cervical sample comprises cells from the cervical transition zone and / or endocervical canal; and
[0019] (ii) a second marker for detecting HPV.
[0020] [2] A method for verifying the reliability of a biological sample, comprising the steps of: (i) determining the expression of at least one marker selected from MUC5B and / or TFF3 in the biological sample, wherein the expression of the at least one marker indicates that the biological sample comprises cells from a transition zone and / or endocervical canal; and
[0021] (ii) classifying the biological sample as a reliable biological sample when the at least one marker is expressed.
[0022] [3] The combination according to [1], or the method according to [2], wherein the transition zone is a zone where a columnar epithelium borders a squamous epithelium, and preferably the transition zone comprises glandular epithelial cells / columnar epithelial cells.
[0023] [4] The method according to [2] or [3], wherein the reliable biological sample is reliable for a screening of HPV-infection and / or screening of dysplastic / neoplastic lesions;
[0024] [5] The method according to any one of [2] - [4], wherein the method verifies the reliability of a HPV-test in the biological sample.
[0025] [6] The method according to any one of [2] - [5], wherein the biological sample is a sample supposed to comprise cells from the transition zone and / or endocervical canal.
[0026] [7] The method according to any one of [2] - [6], wherein the method (further) comprises
[0027] (i) isolating RNA, DNA and / or protein from the biological sample before determining the expression of the at least one marker is performed; and / or
[0028] (ii) comparing the expression of the at least one marker in the biological sample to the expression of the at least one marker in reference; and / or
[0029] (iii) normalizing the expression of the at least one marker to the expression of a housekeeping gene, preferably wherein the housekeeping gene is PPIA.
[0030] [8] The method according to any one of [2] - [7], wherein determining the expression comprises quantifying the amount of RNA, DNA and / or protein of the at least one marker.
[0031] [9] The method according to any one of [2] - [8], wherein the biological sample is obtained from a human subject, preferably wherein the biological sample is obtained from a female human subject, more preferably wherein the biological sample is obtained from female tissue, most preferably wherein the biological sample is a cervical sample.
[0010] The method according to any one of [2] - [9], wherein the biological sample is obtained using a swab, tampon, brush, scraping, and / or biopsy.
[0032]
[0011] The method according to any one of [2] -
[0010] , further comprising a step of screening of a HPV infection in the biological sample, preferably wherein the screening comprises determining the expression of at least a second marker in the biological sample, more preferably wherein the second maker is a HPV marker, such as E6, E7, E2, and / or a cervical dysplastic / neoplastic lesion marker, such as CDKN2A and / or MKI67.
[0033]
[0012] The combination according to [1] or [3], or the method according to
[0011] , wherein the second marker is selected from a group consisting of E6, E7, E2, and combinations thereof.
[0034]
[0013] The combination according to [1] or [3], or the method according to
[0011] or
[0012] , wherein the second marker is for detecting a high-risk and / or low-risk HPV type, preferably the second marker detects splicing variants of E6 and / or E7 of a high-risk HPV type.
[0035]
[0014] The method according to any one of [2] -
[0013] , further comprising a step of,
[0036] (i) stratifying subjects for a follow-up treatment, preferably wherein the stratifying is based on a molecular test; and / or
[0037] (ii) screening for dysplastic / neoplastic lesions, preferably the screening of dysplastic / neoplastic lesions is based on a molecular test.
[0038]
[0015] A use of a marker selected from MUC5B and / or TFF3 for verifying the reliability of a biological sample, wherein the expression of the at least one marker indicates that the biological sample comprises cells from a transition zone and / or endocervical canal.
[0039]
[0016] The use according to
[0015] , wherein the reliability of the biological sample for screening of a HPV infection and / or screening of dysplastic / neoplastic lesions is verified.
[0040]
[0017] The use according to
[0015] or
[0016] , wherein the reliability of a HPV-test in the biological sample is verified.
[0041]
[0018] A kit of parts comprising
[0042] (i) primers, probes or a combination thereof for determining the expression of the at least one marker selected from MUC5B and / or TFF3 in a biological sample, (ii) optionally, primers, probes or a combination thereof for determining the expression in the biological sample of at least one marker of a second marker set which is used for a screening of a HPV infection, preferably high-risk and / or low-risk HPV; and / or
[0043] (iii) optionally, means for obtaining the biological sample.
[0044] BRIEF DESCRIPTION OF THE DRAWINGS
[0045] Figure 1A: Detection of MUC5B in endocervical and ectocervical cervical smears using qRT- PCR for selected samples (Light Cycler analysis, (AAC method). PPIA was used as a housekeeping gene for normalization. Digits indicate fold change compared to control (not shown). N.D: no target gene RNA detected in ectocervical samples.
[0046] Figure 1B: Detection of TFF3 in endocervical and ectocervical cervical smears using qRT- PCR for selected samples (Light Cycler analysis, (AACT method). PPIA was used as a housekeeping gene for normalization. Digits indicate fold change compared to control (not shown). N.D: no target gene RNA detected in ectocervical samples.
[0047] Figure 2A: ROC curve analysis showing the validation of sensitivity and specificity of the MUC5B marker. Samples were taken from the endocervix and endocervical glandular cells confirmed by cytology (gold standard). Control samples were from the ectocervix, devoid of endocervical cells. First plot is before, second plot (below first plot) after cytologic re-evalua- tion.
[0048] Figure 2B: Statistic testing with cut-off 120 (MUC5B expression) on 58 samples. Statistic test results before and after re-evaluation of cytology initially negative for endocervical glandular cells, when re-screened because of positive MUC5B molecular test results.
[0049] Figure 2C: Shown are sparse barely detectable endocervical cells, which were found difficult to discern on initial screen, due to degenerative artefacts, calling for more accurate molecular testing (photomicrograph, PAP, 40x).
[0050] DETAILED DESCRIPTION
[0051] The present invention provides a marker selected from MUC5B and / or TFF3 for verifying the reliability of a biological sample, wherein the expression of said marker indicates that the biological sample comprises cells from a transition zone and / or endocervical canal. Surprisingly, the inventors of the present invention identified markers which allow the verification of the reliability of a molecular cervix cancer screening test. In particular, it is the achievement of the present invention to have identified MUC5B and / or TFF3 as markers for indicating that a biological sample comprises cells form a transition zone, such as the cervical transition zone, where most dysplasia and neoplasia arise. Accordingly, the markers of the present invention allow the verification of the reliability of biological sample, such as a HPV-test sample. In the absence of cells from the transition zone, i.e., in the absence of the expression of the at least one marker selected from MUC5B and / or TFF3, the biological sample is not sufficiently reliable for the screening of Human papillomavirus (HPV) and related infections, as well as screening of dysplastic / neoplastic lesions. In fact, if expression of at least one of MUC5B and / or TFF3 is absent in a biological sample, such biological sample is prone to give false negative test results, when screening for STI, such as HPV infection, dysplastic / neoplastic lesions is performed thereon. Accordingly, the present invention provides markers, which allow to determine the reliability of a biological sample and to reduce the number of false-negative screening tests. HPV for example serves as a surrogate marker that points to high likelihood of HPV-related LSIL, HSIL, squamous cell carcinoma or adenocarcinoma.
[0052] The present invention provides a marker selected from MUC5B and / or TFF3 which improves the reliability of biological sample which is used for a screening test. In line with this, the markers of the present invention and / or methods using said markers improve the stratification of patients for a follow-up treatment. In particular, the present invention allows to classify a biological sample as reliable biological sample for a screening test, if expression of at least one of MUC5B and / or TFF3 is present, or to classify a biological sample as a non-reliable biological sample, if expression of at least one of MUC5B and / or TFF3 is tested and shown to be absent. If a biological sample is classified as non-reliable, re-sampling may be required.
[0053] In particular, the present invention allows for the verification of the reliability of a screening of STI in a biological sample. Preferably, the present invention allows for the verification of the reliability of a HPV-test performed in a biological sample. For example, the present invention provides for an improved screening for STI, such as HPV, performed on a biological sample. Table 1 shows exemplarily a practitioner’s decision matrix based on an improved HPV screening according to the present invention in a biological sample:
[0054] Table 1 : Exemplary decision matrix of a HPV-screening according to the present invention.
[0055] In the following, the features of the present invention will be described in more detail. It should be understood that embodiments may be combined in any manner and in any number to create additional embodiments. The variously described examples and embodiments should not be construed to limit the present invention to only the explicitly described embodiments. This description should be understood to support and encompass embodiments which com- bine the explicitly described embodiments with any number of the disclosed features. Furthermore, any permutations and combinations of all described features in this application should be considered disclosed by the description of the present application unless the context indicates otherwise.
[0056] Throughout this specification and the claims, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated member, integer or step or group of members, integers or steps but not the exclusion of any other member, integer or step or group of members, integers or steps. The terms "a" and "an" and "the" and similar reference used in the context of describing the invention (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by the context. Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as", “for example”), provided herein is intended merely to better illustrate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.
[0057] All documents cited or referenced herein (“herein cited documents”), and all documents cited or referenced in herein cited documents, together with any manufacturer's instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.
[0058] Definitions
[0059] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. As used herein, the following terms and phrases have the meanings ascribed to them unless specified otherwise.
[0060] The terms “sample” or “biological sample” as interchangeably used herein refer to any tissue or material derived from a living or dead subject that contains cellular or genetic material that is suitable for detecting the presence, absence and / or quantity of a marker of the present invention. For example, “sample” or “biological sample” as interchangeably used herein refers to any tissue or material derived from a living or dead subject that may contain target nucleic acid of a pathogen causing a sexually transmitted infection (STI), such as human papillomavirus (HPV). For example, “sample” or “biological sample” as interchangeably used herein refers to any tissue or material derived from larynx, oral cavity, oropharynx, tonsil, or esophagus tissue, respiratory tissue or exudates, cervix, such as endocervix and / or ectocervix, anal canal, biopsy tissue including lymph nodes, gastrointestinal tissue, feces, urine, semen, sputum, peripheral blood, plasma, serum or other body fluids, tissues or materials. The sample according to the present invention is for example obtained by using a swab, tampon, brush, scraping and / or biopsy. The sample according to the present invention is for example a sample of a human subject. For example, the sample according to the present invention is a sample of a human female subject. The human female subject is for example a genetically female subject. For example, the sample is obtained from a human subject having a cervix. For example, the biological sample is obtained from female tissue. For example, the biological sample is a cervical sample. For example, the biological sample is a uterine cervical sample. For example, the biological sample is obtained from anal tissue. For example, the sample according to the present invention is a sample supposed to comprise cells from a transition zone and / or endocervical canal. For example, the sample according to the present invention is a sample supposed to comprise cells from a transition zone, such as cervical transition zone.
[0061] The biological sample may be treated to physically or mechanically disrupt tissue or cell structure, thus releasing intracellular components into a solution which may further contain enzymes, buffers, salts, detergents and the like, which are used to prepare, using standard methods, a biological sample for analysis. The skilled person appreciates that suitable buffers are available in the art. Suitable buffers are for example commercially available, e.g., from companies like LAMPseq Diagnostics GmbH and Hologic, Inc.. Suitable buffers for example comprise phosphate-buffered saline (PBS) and methanol-based buffers. Also, samples may include processed samples, such as those obtained from passing samples over or through a filtering device, or following centrifugation, or by adherence to a medium, matrix, or support. Samples may further include cross-linked tissues or material derived from a human, such as samples that are contained in a media such as BD SurePath Preservative Fluid (Becton, Dickinson and Company, Franklin Lakes, NJ), or embedded samples, such as paraffin embedded samples. Samples may further include tissues or material derived from a human and are suspended in a Cytology media such as ThinPrep Cytology Reagent (Hologic, Inc., Bedford, MA). The terms “transition zone”, “transformation zone” or “squamocolumnar junction (SCJ)” as interchangeably used herein refer to a zone between two distinct epithelial tissues. For example, these terms refer to a zone where a columnar epithelium borders a squamous epithelium, and preferably the zone comprises glandular epithelial cells. For example, the terms refer to zone where the endocervix and ectocervix, the outer part of the cervix projecting into the vagina, meet. For example, the zone contains both glandular cells from the columnar epithelium lining the endocervix and stratified squamous epithelial cells lining the ectocervix. For example, in young women the cervical transition zone is partly ectocervical and in older women this zone is deep within the endocervix closer to the uterine corpus.
[0062] “Sexually transmitted infection (STI)” as used herein refers to any disease caused by infection with certain bacteria, viruses, or other microorganisms that can be passed from one person to another through blood, semen, vaginal fluids, or other body fluids, during oral, anal, or genital sex with an infected partner. Pathogens that cause a STI are for example selected from the group of Human Papillomavirus (HPV), Chlamydia trachomatis, Neisseria gonor- rhoeae, Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma urealyticum, Ureaplasma parvum, Trichomonas vaginalis, Herpes Simplex Virus, Gardnerella vaginalis, and / or Treponema pallidum.
[0063] “Human Papillomavirus (HPV)” as used herein refers to a group of more than 200 common viruses. Some human papillomavirus types, called cutaneous human papillomaviruses, are transmitted by casual contact and can infect the skin and cause common skin warts. Other human papillomavirus types, known as mucosal human papillomaviruses, can infect the moist surfaces or inner lining of some organs and body cavities, such as the cervix, vagina, vulva, penis, anus, mouth, and throat. Infection with some mucosal human papillomavirus types for example cause warts in or around the genitals, anus, mouth, and respiratory tract but rarely cause cancer which are referred to as low-risk HPV. Long-lasting infection with other mucosal human papillomavirus types for example cause dysplastic / neoplastic lesions that become cancer over time if not found and removed. HPV causing such long-lasting infections are referred to as high-risk HPV. Human papillomavirus-related cancers include cancers of the cervix, anus, oropharynx, vagina, vulva, and penis. Mucosal human papillomavirus types are transmitted through intimate skin-to-skin contact, most often during vaginal, anal, or oral sex. A high-risk HPV type is for example selected from the group consisting of types 16, 18, 31 , 33, 34, 35, 39, 45, 51 , 52, 56, 58, 59, 66, 68, and 70. A low-risk HPV is for example selected from the group consisting of types 6, 11 , 40, 42, 43, 44, 54, 61 , 72, 81 , and 89. The terms “marker” or “biomarker” as interchangeably used herein refer to a molecule, such as a protein, RNA, e.g. mRNA, DNA, e.g., cDNA, or any detectable fragment thereof, that can be detected in a sample in order to determine the expression level of the at least one marker. For example, the marker is a gene, enzyme, RNA, or fragment thereof. For example, the marker is a mRNA splicing variant or fragment thereof. The markers of the present invention may be in solution or attached to a solid carrier, such as a bead or array. The marker may be suitably labelled, e.g., with a fluorophore, enzymatic, size or weight, antigenic, or otherwise detectable label.
[0064] A marker for verifying the reliability of a biological sample according to the present invention is for example a marker whose expression in a biological sample indicates that the biological sample comprises cells from a transition zone and / or endocervical canal. For example, a marker for verifying the reliability of a biological sample according to the present invention is a marker whose expression indicates that the biological sample comprises cells from a cervical transition zone, such as the cervical transition zone. For example, the marker for verifying the reliability of a biological sample according to the present invention is selected from MUC5B and / or TFF3. For example, the marker for verifying the reliability of a biological sample according to the present invention is TFF3. For example, the marker for verifying the reliability of a biological sample according to the present invention is MUC5B. For example, a marker of the present invention is detected using primers and / or probes specifically targeting the markers. Primers for detection of MUC5B for example comprise SEQ ID NO. 1 (aacgtcac- ctgcgtgaacaa) and / or SEQ ID NO. 2 (ctgagattcccaaagcgtgc). Primers for detection of MUC5B for example comprise sequences having at least 80%, 85%, 90%, or 95% identity with SEQ ID NO. 1 and / or SEQ ID NO. 2. Primers for detection of MUC5B for example comprise sequences having at least 90% identity with SEQ ID NO. 1 and / or SEQ ID NO. 2. Primers for detection of TFF3 for example comprise SEQ ID NO. 3 (gtgccttggtgtttcaagcc) and / or SEQ ID NO. 4 (gaagaactgtcctcgggtgg). Primers for detection of TFF3 for example comprise sequences having at least 80%, 85%, 90%, or 95% identity with SEQ ID NO. 3 and SEQ ID NO. 4. Primers for detection of TFF3 for example comprise sequences having at least 90% identity with SEQ ID NO. 3 and SEQ ID NO. 4. The primers disclosed herein are provided as separate aspects of the invention, as are corresponding probes based on these primers.
[0065] “MUC5B" refers to the human Mucin-5B gene and / or mRNA and / or protein or a functional fragment thereof that can be detected. The sequence of human Mucin-5B (MUC5B_HUMAN) can be found in the UniProt database, accession number Q9HC84, NCBI mRNA accession number NM_002458.3. MUC5B is a gel-forming mucin that is thought to contribute to the lubricating and viscoelastic properties of whole saliva and cervical mucus. “TFF3" refers to the human trefoil factor 3 gene and / or mRNA and / or protein or a functional fragment thereof that can be detected. The sequence of human trefoil factor 3 (TFF3_H LIMAN) can be found in the UniProt database, accession number Q07654, NCBI mRNA accession number NM_003226.4. TFF3 is involved in the maintenance and repair of mucosa. Additionally, it promotes the mobility of epithelial cells in healing processes.
[0066] A marker for detecting sexually transmitted infections (STI) (STI-marker) for example refers to any STI specific protein, DNA, RNA, or any detectable fragment thereof, that can be detected in a sample in order to determine the expression level of the at least one marker. For example, the STI-marker is a gene, enzyme, RNA, or fragment thereof, which is derived from a pathogen causing a STI, such as HPV. For example, the marker is a mRNA splicing variant or fragment thereof derived from a pathogen causing a STI, such as HPV.
[0067] A marker for detecting HPV or a HPV-infection (HPV-marker) for example refers to any HPV specific protein, DNA, RNA, or any detectable fragment thereof, that can be detected in a sample in order to determine the expression level of the at least one marker. For example, the HPV-marker is a gene, enzyme, RNA, or fragment thereof, which is derived from a HPV. For example, the marker is a mRNA splicing variant or fragment thereof derived from a HPV. For example, the HPV-marker is specific to a HPV type, such as a high-risk HPV type. For example, the HPV-marker is specific to a HPV type, such as a low-risk HPV type. For example, the HPV-marker is specific to at least two HPV types, such as at least two high-risk HPV- types. A high-risk HPV type is for example selected from the group consisting of types 16, 18, 31 , 33, 34, 35, 39, 45, 51 , 52, 56, 58, 59, 66, 68, and 70. A low-risk HPV is for example selected from the group consisting of types 6, 11 , 40, 42, 43, 44, 54, 61 , 72, 81 , and 89. A HPV-marker according to the present invention is for example selected from the group consisting of E6, E7, E2, and combinations thereof. A HPV-marker according to the present invention includes for example any splicing variant of E6, E7, and / or E2. A HPV-marker according to the present invention is for example E6 and / or E7 selected from HPV-types 16, 18, 31 , 33, 35, 39, 45, 51 , 52, 56, 58, 59, 66, 68 and combinations thereof.
[0068] A marker for screening of dysplastic / neoplastic lesions (dysplastic / neoplastic lesion-marker) according to the present invention is for example any DNA, RNA, protein or fragment thereof which allows specific detection of a dysplastic / neoplastic lesion, preferably cancer. For example, the dysplastic / neoplastic lesion-marker according to the present invention allows specific detection of cervical dysplastic / neoplastic lesions, such as cervical cancer. For example, the dysplastic / neoplastic lesion-marker of the present invention is CDKN2A (cyclin- dependent kinase inhibitor 2A) and / or MKI67 (also referred to as Ki-67 marker of proliferation Kiel 67).
[0069] The terms “reference” or “control” as interchangeably used herein refer for example to the expression level of at least one marker of the present invention which is measured in a reference sample, wherein the comparison of the expression level of at least one marker, measured in a biological sample, with the expression level in the reference sample provides a meaningful interpretation about the presence of cells from a transition zone and / or endocer- vical canal. For example, a reference is the expression level of the at least one marker in a sample comprising cells of a transition zone and / or endocervical glandular cells. Alternatively, a reference is a negative control. A negative control is for example the expression level of the at least one marker of the present invention in ectocervical cells. For example, the reference is a threshold value. A threshold value, used as a reference, is for example the expression level of the at least one marker of the present invention in a standardized sample. For example, the reference is a control plasmid (plasmid control). For example, a titration control may serve as a reference.
[0070] The term “normalization” as used herein refers to adjusting levels measured on different scales to a notionally common scale, optionally prior to averaging. Normalization facilitates the correction of variations across samples.
[0071] The term “screening” as used herein refers to a testing strategy used to look for conditions or risk markers. For example, screening is applied to individuals or to a whole population without symptoms or signs of the disease being screened. For example, screening is applied to individuals or to a whole population with symptoms or signs of the disease being screened. Screening is for example performed to identify conditions which could at some future point turn into disease, thus enabling earlier intervention and management in the hope to reduce mortality and suffering from a disease.
[0072] The term “dysplastic / neoplastic lesions” as used herein refers to any formation of abnormal (non-normal) tissue. The term includes (abnormally) altered cell growth, cell division, cell differentiation and cell apoptosis, which is for example caused by infections, such as HPV infection. Dysplastic / neoplastic lesions according to the present invention for example refer to any benign or malignant abnormal mass of tissue (neoplasms). Dysplastic / neoplastic lesions according to the present invention for example refer to mild, moderate of severe formation of abnormal cells (dysplasia). Dysplastic / neoplastic lesions according to the present invention for example refers to the formation of cervical intraepithelial neoplasia (CIN) / squamous Intraepithelial lesions (SIL). CIN is for example graded on a 1-3 scale, with 3 being the most abnormal. Cl N 1 is also considered as “low-grade squamous intraepithelial lesion” (LSIL) and CIN 2 as well as CIN 3 is also considered as “high-grade squamous intraepithelial lesion” (HSIL). Dysplastic / neoplastic lesions according to the present invention for example refers to the formation of cancer, such as cervical cancer and / or anal cancer. Cervical cancer for example comprises squamous cell carcinoma, adenocarcinoma, other types of neoplastic lesions arising in the cervical transition zone of the uterus, other types of neoplastic lesions arising in the endocervix of the uterus, and combinations thereof. Anal cancer for example comprises squamous cell carcinoma, adenocarcinoma, other types of neoplastic lesions arising in the recto-anal junction, other types of neoplastic lesions arising in the columnar epithelium lining the gastrointestinal tract’s secretory areas.
[0073] In one aspect, the present invention refers to a combination of markers for detecting human papillomavirus (HPV) in a cervical sample, wherein said combination of markers comprises:
[0074] (i) a first marker selected from MUC5B and / or TFF3 for verifying the reliability of the cervical sample, wherein the expression of the first marker indicates that the cervical sample comprises cells from the cervical transition zone and / or endocervical canal; and
[0075] (ii) a second marker for detecting HPV.
[0076] For example, in step (i) the expression of the first marker indicates that the cervical sample comprises cells from the cervical transition zone. For example, the fist marker is selected from MUC5B. For example, the fist marker is TFF3.
[0077] For example, the second marker for detection HPV is a HPV-marker which detects high-risk and / or low risk HPV. For example, the second marker is a HPV-marker detecting high-risk HPV types. For example, the second marker for detecting HPV is selected from E6, E7 and / or E2, including splicing variants thereof. For example, the second marker is a marker for detecting the E6 / E7 region of HPV type 33 and / or HPV type 31 . For example, the second marker is a marker for detecting the E6 region of HPV type 33 and / or HPV type 31 . For example, the second marker is a marker for specifically detecting the E7 region of HPV type 33 and / or HPV type 31. For example, the second marker is a marker specifically detecting E6 / E7 splicing variants of HPV type 33 and / or HPV type 31 . For example, the second marker is a marker for specifically detecting the E6 / E7 region of HPV type 16 and / or HPV type 18.
[0078] The second maker is for example a HPV marker, such as E6, E7, E2, and / or a cervical dysplastic / neoplastic lesion marker, such as CDKN2A and / or MKI67. For example, the second marker is selected from the group consisting of E6, E7, E2, CDKN2A, MKI67, and combinations thereof. For example, the second marker for detecting HPV comprises CDKN2A and / or MKI67.
[0079] The expression of the second marker is for example determined before, after or simultaneously with determining the expression of the first marker selected from MUC5B and / or TFF3. The expression of the second marker is for example determined simultaneously with determining the expression of the first marker selected from MUC5B and / or TFF3. The expression of the second marker is for example determined simultaneously with determining the expression of MUC5B.
[0080] In a second aspect, the present invention refers a method for verifying the reliability of a biological sample, comprising the steps of:
[0081] (i) determining the expression of at least one marker selected from MUC5B and / or TFF3 in the biological sample, wherein the expression of the at least one marker indicates that the biological sample comprises cells from a transition zone and / or endocervical canal; and
[0082] (ii) classifying the biological sample as a reliable biological sample when the at least one marker is expressed.
[0083] For example, the first marker is MUC5B. For example, the transition zone is a zone where a columnar epithelium borders a squamous epithelium. Preferably the transition zone comprises glandular epithelial cells / columnar epithelial cells.
[0084] For example, the biological sample is classified as non-reliable, if at least one marker selected from MUC5B and / or TFF3 is not expressed. For example, the biological sample is classified as non-reliable if MUC5B is not expressed.
[0085] For example, the biological sample classified as reliable, i.e., presence of MUC5B and / or TFF3 expression, is reliable for a screening of a STI. For example, the biological sample classified as reliable, i.e., presence of MUC5B and / or TFF3 expression, is reliable for a screening of HPV-infection. For example, the reliable biological sample is reliable for screening of a high-risk and / or low-risk HPV infection. The reliable biological sample is for example reliable for screening of a high-risk HPV infection caused by a HPV type selected from types 16, 18, 31 , 33, 34, 35, 39, 45, 51 , 52, 56, 58, 59, 66, 68, and / or 70. The reliable biological sample is for example reliable for screening of a high-risk HPV type 33 and / or high-risk HPV type 31. For example, the reliable biological sample is reliable for screening of dysplastic / neoplastic lesions. For example, the reliable biological sample is reliable for screening cancer, such as cervical cancer or anal cancer. For example, the reliable biological sample is reliable for screening cervical cancer.
[0086] For example, the reliable biological sample is reliable for performing a HPV-test in the biological sample. For, example the method according to the present invention verifies the reliability of a HPV-test performed in the biological sample.
[0087] The biological sample according to the present invention is for example a sample supposed to comprise cells from a transition zone and / or endocervical canal. For example, the sample is supposed to comprise cells from a transition zone, such as a cervical transition zone. For example, the biological test sample is collected with the aim to include cells from a transition zone, such as a cervical transition zone. For example, the biological test sample is collected using a device, such as a brush, which is inserted in the vaginal tract with sufficient depth that the device (brush) is brought in contact with the transition zone and / or endocervical canal.
[0088] The method according to the present invention for example further comprises a step of isolating RNA, DNA and / or protein from the biological sample before determining the expression of the at least one marker is performed. For example, the method further comprises a step of isolating RNA and / or protein from the biological sample before determining the expression of the at least one marker is performed. For example, the method further comprises a step of isolating RNA, preferably mRNA, from the biological sample before determining the expression of the at least one marker is performed.
[0089] General methods for RNA, DNA and / or protein extraction / isolation are well known in the art. For example, RNA isolation is performed using purification kit, buffer set and protease from commercial manufacturers according to the manufacturer's instructions. For example, isolation of DNA is likewise performed using a DNA purification kit. For example, protein isolation is performed using a protein purification kit.
[0090] The expression levels of the marker for example refers to the protein levels translated from the mRNAs of the markers of the present invention. Determining the expression levels of the markers by protein detection may be performed by any method known in the art including ELISA, immunocytochemistry, flow cytometry, Western blotting, proteomic as well as mass spectrometry. Protein detection as used herein may include detection of full-length proteins, truncated proteins, peptides, polypeptides and combinations thereof.
[0091] The method according to the present invention for example further comprises a step of comparing the expression of at least one marker in the biological sample to the expression of the at least one marker in reference. For example, the method further comprises a step of comparing the expression of MUC5B and / or TFF3 to the expression of the at least one marker in reference. As reference, a plasmid control and / or titration control is for example used. Alternatively, a reference is for example the expression level of the at least one marker of the present invention in a standardized sample. For example, a suitable reference is a sample, which contains cells from a transition zone. For example, a suitable reference is a sample, which does not contain cells for a transition zone. For example, a suitable reference is a sample obtained from the ectocervix in which MUC5B and / or TFF3 is not expressed. For example, a reference is a threshold level of expression of MUC5B and / or TFF3 in a standardized sample, such as a sample comprising cells from a transition zone. For example, a reference is a threshold level of expression of MUC5B and / or TFF3 in a standardized sample, such as a sample not-comprising cells from a transition zone and / or columnar epithelial cells.
[0092] The method according to the present invention for example further comprises a step of normalizing the expression of the at least one marker to the expression of a normalization gene. For example, the expression of the at least one marker selected from MUC5B and / or TFF3 is normalized to a gene which is constitutively expressed, preferably a housekeeping gene. A housekeeping gene according to the present invention is for example selected from PPIA and / or beta-actin (b-actin). For example, the expression of the at least one marker selected from MUC5B and / or TFF3 is normalized to PPIA (Peptidylprolyl isomerase A). The sequence of human PPIA can be found in the UniProt database, accession number P62937, NCBI mRNA accession number NM_021130.5. PPIA catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. Primers for detection of PPIA for example comprise SEQ ID NO. 5 (gctggacccaacacaaatgg) and / or SEQ ID NO. 6 (ggcctccacaatattcatgcct). Primers for detection of PPIA for example comprise sequences having at least 80%, 85%, 90%, or 95% identity with SEQ ID NO. 5 and / or SEQ ID NO. 6. Primers for detection of PPIA for example comprise sequences having at least 90% identity with SEQ ID NO. 5 and / or SEQ ID NO. 6. These primers together with the primers for MUC5B and / or TFF3 disclosed elsewhere herein are provided as separate aspects of the invention, as are corresponding probes based on these primers.
[0093] For example, the method of the present invention further comprises a step of quantifying the amount of RNA, DNA and / or protein of the at least one marker selected from MUC5B and / or TFF3. For example, quantifying the expression level of at least one marker selected from MUC5B and / or TFF3 is performed using polymerase chain reaction (PCR), real-time quantitative PCR (qPCR), droplet digital PCR (ddPCR) quantification, isotherm DNA amplification, TMA transcription mediated amplification, enzyme-linked immunosorbent assay (ELISA), mass spectrometry, mass spectrometry immunoassay (MSI A), antibody-based protein chips, 2-dimensional gel electrophoresis, stable isotope standard capture with anti-peptide antibodies (SISCAPA), high-performance liquid chromatography (HPLC), genetic testing, western blot, cytometry bead array (CBA), radio immunoassay, immunohistochemical staining, and combinations thereof. For example, quantifying the expression level of at least one marker according to the invention is performed using real-time quantitative PCR (qPCR) and / or droplet digital PCR (ddPCR) quantification.
[0094] The biological sample of the present invention is obtained from a human subject. For example, the biological sample is obtained from a female human subject. For example, the biological sample is obtained from female tissue. For example, the biological sample is a cervical sample or an anal sample. For example, the biological sample is a uterine cervical sample. The biological sample is for example obtained using a swab, tampon, brush, scraping and / or biopsy. For example, the biological sample is obtained using a brush.
[0095] The method of the present invention for example further comprises a step of screening of a sexually transmitted infection (STI) in the biological sample. The screening of a screening of a sexually transmitted infection for example comprises screening of an infection caused by Human Papillomavirus, Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genita- lium, Mycoplasma hominis, Ureaplasma urealyticum, Ureaplasma parvum, Trichomonas vaginalis, Herpes Simplex Virus, Gardnerella vaginalis, and / or Treponema pallidum. The screening of a STI for example is a molecular screening (molecular test) and / or a cytological screening. For example, the screening of a STI comprises determining the expression of a second marker (STI-marker) in the biological sample. The expression of a second marker is for example determined before, after or simultaneously with determining the expression of the at least one marker selected from MUC5B and / or TFF3. The expression of a second marker is for example determined simultaneously with determining the expression of MUC5B. The expression of a second marker is for example determined simultaneously with determining the expression of TFF3.
[0096] The method of the present invention for example further comprises a step of screening of a HPV infection in the biological sample. The screening of a HPV infection for example is a molecular screening (molecular test) and / or a cytological screening. For example, the screening of a HPV infection comprises determining the expression of a second marker in the biological sample. The expression of the at least a second marker is for example determined before, after or simultaneously with determining the expression of the at least one marker selected from MUC5B and / or TFF3. For example, the screening of a HPV infection comprises determining the expression of at least a second marker in the biological sample, wherein the expression of the second marker is determined simultaneously with determining the expression of MUC5B and / or TFF3. For example, the screening of a HPV infection comprises determining the expression of at least a second marker in the biological sample, wherein the expression of the second marker is determined simultaneously with determining the expression of MUC5B. For example, the screening of a HPV infection comprises determining the expression of at least a second marker in the biological sample, wherein the expression of the second marker is determined simultaneously with determining the expression of TFF3.
[0097] The second maker is for example a HPV marker, such as E6, E7, E2, and / or a cervical dys- plastic / neoplastic lesion marker, such as CDKN2A and / or MKI67. For example, the second marker is selected from the group consisting of E6, E7, E2, CDKN2A, MKI67, and combinations thereof. For example, the second marker for detection HPV is a HPV-marker which detects high-risk and / or low risk HPV. For example, the second marker is a HPV-marker specifically detecting high-risk HPV types. For example, the second marker for detecting HPV is selected from E6, E7 and / or E2, including splicing variants thereof. For example, the second marker is a marker for detecting the E6 / E7 region of HPV type 33 and / or HPV type 31. For example, the second marker is a marker for detecting the E6 region of HPV type 33 and / or HPV type 31 . For example, the second marker is a marker for detecting the E7 region of HPV type 33 and / or HPV type 31. For example, the second marker is a marker detecting E6 / E7 splicing variants of HPV type 33 and / or HPV type 31. For example, the second marker comprises CDKN2A and / or MKI67.
[0098] The method of the present invention for example further comprises a step of stratifying subjects for a follow-up treatment. For example, stratifying subjects for a follow-up comprises determining HPV-type in a biological sample obtained from the subject. For example, stratifying a subject for a follow-up treatment comprises a molecular test and / or cytological test. For example, determining HPV-type in a biological sample is performed by determining the expression of a HPV-marker according to the present invention. For example, stratifying subjects for a follow up comprises determining the expression of a dysplastic / neoplastic lesion marker according to the present invention in the biological sample obtained from the subject. For example, stratifying a subject for a follow-up treatment is based on a molecular test.
[0099] A follow-up treatment according to the invention is any treatment which may be given to the subject in need thereof. For example, a follow-up treatment is selected from surgery, immu- notherapy, hormone therapy, chemotherapy, radiation therapy, hyperthermia, targeted therapy, and / or stem cell transplant. For example, a follow-up treatment comprises a surgery. For example, a follow-up treatment comprises an immunotherapy.
[0100] The method of the present invention for example further comprises a step of screening dys- plastic / neoplastic lesions. The screening of dysplastic / neoplastic lesions for example is a molecular screening (molecular test) and / or a cytological screening. For example, the screening of dysplastic / neoplastic lesions is based on a molecular test. The screening of dysplastic I neoplastic lesions is for example performed according to the CIN 1 - 3 and / or L / H-SIL grading system. For example, the screening of dysplastic / neoplastic lesions is a molecular screening (molecular test) comprising a second marker set for detecting dysplastic / neoplastic lesions, i.e., comprising at least one dysplastic / neoplastic lesion - marker. For example, the dysplastic / neoplastic lesion - marker is selected from CDKN2A and / or MKI67. The screening of dysplastic / neoplastic lesions is for example a screening of cancer. The screening of dysplastic / neoplastic lesions for example is for example a screening for cervical cancer and / or anal cancer. The screening of dysplastic / neoplastic lesions for example is for example a screening for cervical cancer.
[0101] In a further aspect, the present invention refers to a use of a marker selected from MUC5B and / or TFF3 for verifying the reliability of a biological sample, wherein the expression of the at least one marker indicates that the biological sample comprises cells from a transition zone and / or endocervical canal. For example, the present invention refers to a use of the marker MUC5B for verifying the reliability of a biological sample. The expression of at least one of the markers in a biological sample for example indicates that the biological sample comprises cells from a transition zone. For example, the maker for verifying the reliability of a biological sample selected from MUC5B and / or TFF3 is used in combination with a second marker. For example, the maker for verifying the reliability of a biological sample selected from MUC5B and / or TFF3 is used in combination with a second marker, wherein the second marker is a STI-marker as described above. For example, the maker for verifying the reliability of a biological sample selected from MUC5B and / or TFF3 is used in combination with a second marker, wherein the second marker is a HPV-marker as described above. For example, the maker for verifying the reliability of a biological sample selected from MUC5B and / or TFF3 is used in combination with a second marker, wherein the second marker is a dysplastic / neoplastic lesion - marker as described above.
[0102] For example, the marker selected from MUC5B and / or TFF3 is used to verify the reliability of a biological sample for screening of a sexually transmitted infection (STI), such as an HPV infection, and / or screening of dysplastic I neoplastic lesions. For example, the marker selected from MUC5B and / or TFF3 is used to verify the reliability of a biological sample for screening of a HPV infection. For example, the marker selected from MUC5B and / or TFF3 is used to verify the reliability of a HPV-test in a biological sample. For example, the marker selected from MUC5B and / or TFF3 is used to improve the reliability of a screening test for sexually transmitted infections (STI), such as an HPV infection. For example, the marker selected from MUC5B and / or TFF3 is used to reduce the number of false-negative test results in a screening test for sexually transmitted infections (STI), such as an HPV infection, and / or screening of dysplastic / neoplastic lesions. For example, the marker for the use according to the invention is MUC5B. For example, the marker for the use according to the invention is TFF3.
[0103] In a further aspect, the present invention refers to a kit of parts which is used to perform the method according to the present invention. The kit of parts according to the present invention comprises for example the means to detect the markers as described above in a biological test sample. For example, the kit of parts according to the present invention comprises means to detect at least one of MUC5B and / or TFF3 in a biological test sample. For example, the kit of parts according to the present invention comprises means to detect at least one of MUC5B in a biological test sample. For example, the kit of parts according to the present invention comprises means to detect TFF3 in a biological test sample. For example, the kit of parts according to the present invention comprises means to detect at least one of MUC5B and / or TFF3 as first marker for verifying the reliability of a biological sample. For example, the kit of parts according to the present invention comprises means to detect STI, such as a HPV- infection. For example, the kit of parts according to the present invention comprises means to detect a second marker which is a STI marker, such as a HPV-marker as described above. For example, the kit of parts according to the present invention comprises means to detect a high-risk and / or low-risk HPV-type. For example, the kit of parts according to the present invention comprises means to detect a high-risk HPV-type. For example, the kit of parts according to the present invention comprises means to detect high-risk HPV-type 33 and / or high- risk HPV-type 31. For example, the kit may further comprise means to detect the expression of at least one housekeeping gene which may be used for normalization, such as PPIA.
[0104] Means for marker detection which are comprised in the kit of the present invention are for example primers, probes or a combination thereof. Primers for detection of MUC5B for example comprise SEQ ID NO. 1 and / or SEQ ID NO. 2. Primers for detection of MUC5B for example comprise sequences having at least 80%, 85%, 90%, or 95% identity with SEQ ID NO. 1 and / or SEQ ID NO. 2. Primers for detection of MUC5B for example comprise sequences having at least 90% identity with SEQ ID NO. 1 and / or SEQ ID NO. 2. Primers for detection of TFF3 for example comprise SEQ ID NO. 3 and / or SEQ ID NO. 4. Primers for detection of TFF3 for example comprise sequences having at least 80%, 85%, 90%, or 95% identity to SEQ ID NO. 3 and SEQ ID NO. 4. Primers for detection of TFF3 for example comprise sequences having at least 90% identity with SEQ ID NO. 3 and SEQ ID NO. 4. Primers for detection of PPIA for example comprise SEQ ID NO. 5 and / or SEQ ID NO. 6. Primers for detection of PPIA for example comprise sequences having at least 80%, 85%, 90%, or 95% identity to SEQ ID NO. 5 and SEQ ID NO. 6. Primers for detection of PPIA for example comprise sequences having at least 90% identity with SEQ ID NO. 5 and SEQ ID NO. 6. For example, the kit comprises primers and / or probes for only one target region of an HPV genome. For example, the kit comprises primers and / or probes for at least two HPV target regions. For example, the kit comprises primers and / or probes for the detection of only one HPV type, such as a high-risk HPV type. For example, the kit comprises primers and / or probes for the detection of at least two HPV types, such as two high-risk HPV types. For example, the kit includes primers and / or probes for detecting high-risk HPV-type specific splice variants of E6 and / or E7. For example, the kit of parts according to the present invention comprises means to detect dysplastic / neoplastic lesions in a biological test sample. For example, the kit of parts according to the present invention comprises means to detect cancer, such as cervical cancer, in a biological sample. For example, the kit further comprises at least one reference as described above in order to interpret the obtained expression levels of the markers.
[0105] The kits for example comprises means for obtaining the biological sample as described above. The kit may further include a number of optional components such as, for example, arrays of capture probe nucleic acids. Other reagents that may be present in the kits include reagents suitable for performing in vitro amplification such as, e.g., buffers, salt solutions, appropriate nucleotide triphosphates (e.g., dATP, dCTP, dGTP, dTTP, ATP, CTP, GTP and UTP), and / or enzymes (e.g., reverse transcriptase, and / or RNA polymerase). The kit further includes for example a set of instructions for practicing methods in accordance with the present invention, where the instructions may be associated with a package insert and / or the packaging of the kit or the components thereof.
[0106] In a further aspect, the present invention also refers to methods for treating a viral infection, in particular a HPV infection, or an STI infection, such as an HPV infection, and / or treating dysplastic / neoplastic lesions (associated with viral infections, in particular HPV infections), including treating corresponding cancer, comprising determining the expression of at least one marker selected from MUC5B and / or TFF3 in a biological sample obtained from a subject as described elsewhere herein, and administering to the subject an agent for treating the disease or disorder. The disease or disorder is a viral infection, in particular a HPV infection, or an STI infection, such as an HPV infection, and / or dysplastic / neoplastic lesions (associated with viral infections, in particular HPV infections), or cancer, in particular cervical cancer. The subject may be a subject that is supposed to suffer from any such disease or disorder. For example, the present invention refers to a method for treating a HPV infection, comprising the detection of the HPV infection in a biological sample using the combination of markers for detecting HPV of the present invention as described above and elsewhere herein or performing the method for verifying the reliability of the biological sample as described above or elsewhere herein. For example, the method of treating HPV infection according to the present invention comprises the steps of (i) determining the expression of a first marker selected from MUC5B and / or TFF3 for verifying the reliability of a biological sample, wherein the expression of the first marker indicates that the biological sample comprises cells from the cervical transition zone and / or endocervical canal; (ii) determining the expression of a second marker for detecting HPV (HPV-marker); and (iii) performing a treatment of the HPV infection, if expression of the second marker (HPV-marker) in the biological sample is determined. For example, the method of treating a HPV infection comprises re-sampling and / or re-testing of a HPV infection, if the expression of at least one of MUC5B and / or TFF3 has not been detected in the (first) biological sample. The treatment comprises administering to the subject an agent for treating the HPV infection. The agent is an anti-viral infection, in particular an anti-HPV agent. Likewise, the method of treatment of the present invention is exemplified by a method of treating a dysplastic or neoplastic lesion (associated with viral infections, in particular HPV infections), including treating corresponding cancer, in particular cervical cancer, comprising the steps of (i) determining the expression of a first marker selected from MUC5B and / or TFF3 for verifying the reliability of a biological sample, wherein the expression of the first marker indicates that the biological sample comprises cells from the cervical transition zone and / or endocervical canal; (ii) determining the expression of a second marker for detecting HPV (HPV-marker); and (iii) performing a treatment of the dysplastic or neoplastic lesion or corresponding cancer, if expression of the second marker (HPV-marker) in the biological sample is determined. For example, the method of treating the dysplastic or neoplastic lesion or corresponding cancer comprises re-sampling and / or re-testing of a HPV infection, if the expression of at least one of MUC5B and / or TFF3 has not been detected in the (first) biological sample. The treatment comprises administering to the subject an agent for treating the dysplastic or neoplastic lesion or corresponding cancer. The agent is in particular an anti-cancer agent. The present invention further provides the following aspects and embodiments:
[0107] [1] A method for detecting human papillomavirus (HPV) in a biological sample, the method comprising:
[0108] (i) determining the expression of at least one marker selected from MUC5B and / or TFF3 in the biological sample, wherein the expression of the at least one marker indicates that the biological sample comprises cells from a transition zone and / or endocervical canal; and
[0109] (ii) determining the expression of a (HPV) marker for detecting HPV.
[0110] [2] The method according to [1], wherein the transition zone is a zone where a columnar epithelium borders a squamous epithelium, and preferably the transition zone comprises glandular epithelial cells / columnar epithelial cells. Preferably, the transition zone is a cervical transition zone.
[0111] [3] The method according to [1] or [2], wherein the biological sample is reliable for a screening of HPV-infection and / or screening of dysplastic / neoplastic lesions.
[0112] [4] The method according to any one of [1] - [3], wherein the method verifies the reliability of a HPV-test in / based on the biological sample.
[0113] [5] The method according to any one of [1] - [4], wherein the biological sample is a sample supposed to comprise cells from the transition zone and / or endocervical canal.
[0114] [6] The method according to any one of [1] - [5], wherein the method comprises
[0115] (i) isolating RNA, DNA and / or protein from the biological sample before determining the expression of the at least one marker is performed; and / or
[0116] (ii) comparing the expression of the at least one marker in the biological sample to the expression of the at least one marker in a reference sample; and / or
[0117] (iii) normalizing the expression of the at least one marker to the expression of a housekeeping gene, preferably wherein the housekeeping gene is PPIA.
[0118] [7] The method according to any one of [1] - [6], wherein determining the expression comprises quantifying the amount of RNA, DNA and / or protein of the at least one marker.
[0119] [8] The method according to any one of [1] - [7], wherein the biological sample is obtained from a human subject, preferably wherein the biological sample is obtained from a female human subject, more preferably wherein the biological sample is obtained from female tissue, even more preferably, or most preferably, wherein the biological sample is a cervical sample.
[0120] [9] The method according to any one of [1] - [8], wherein the biological sample is obtained using a swab, tampon, brush, scraping, and / or biopsy.
[0121]
[0010] The method according to any one of [1] - [9], wherein the HPV marker is for detecting a high-risk and / or low-risk HPV type.
[0122]
[0011] The method according to any one of [1] -
[0010] , wherein the HPV marker is a marker such as E6, E7, E2, or any combination thereof.
[0123]
[0012] The method according to
[0010] or
[0011] , wherein the HPV marker detects splicing variants of E6 and / or E7 of a high-risk HPV type.
[0124]
[0013] The method according to any one of [1] -
[0012] , further comprising a step of screening of a cervical dysplastic / neoplastic lesion in / based on the biological sample, using a cervical dysplastic / neoplastic lesion marker, preferably wherein the cervical dysplastic / neoplastic lesion marker is a marker such as CDKN2A and / or MKI67.
[0125]
[0014] The method according to any one of [1] -
[0013] , further comprising a step of,
[0126] (i) stratifying subjects for a follow-up treatment, preferably wherein the stratifying is based on a molecular test; and / or
[0127] (ii) screening for dysplastic / neoplastic lesions, preferably the screening of dysplastic / neoplastic lesions is based on a molecular test.
[0128]
[0015] Use of a marker selected from MUC5B and / or TFF3 for detecting human papillomavirus (HPV) in a biological sample, wherein the expression of the at least one marker indicates that the biological sample comprises cells from a transition zone and / or en- docervical canal.
[0129]
[0016] The use according to
[0015] , wherein the reliability of the biological sample for screening of a HPV infection and / or screening of dysplastic / neoplastic lesions is verified.
[0130]
[0017] The use according to
[0015] or
[0016] , wherein the reliability of a HPV-test in the biological sample is verified.
[0131] All embodiments described elsewhere herein in relation to other aspects of the present disclosure (invention) apply, mutatis mutandis, to the above aspects and embodiments [1] to
[0017] , and in case of doubt to the extent considered technically meaningful by a person skilled in the art.
[0132] EXAMPLES
[0133] Materials and Methods
[0134] Clinical specimen collection. Human endocervical swab samples and ectocervical swab samples were collected from different patients in the Gynaecology and Gynaecological Oncology Hospital of Bonn University, Germany. All patients gave informed consent and clinical information, including age, menstrual status, FIGO stage, histological type, HPV status, and treatment. This study was approved by the ethics committee of the Gynaecology and Gynaecological Oncology Hospital of Bonn University, Germany.
[0135] Sample preparation. Total RNA was isolated from human endocervical swab material and human ectocervical swab material using the RNeasy Plus Mini Kit (cat# 74136, Qiagen). An on-column DNase digest step was included to remove potentially contaminating genomic DNA. Total RNA quantity was determined using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific). cDNA conversions were performed as recommended using mRNA Reverse Transcription kits (Thermo Scientific). qRT-PCR analyses were performed with a 96- well 7500Fast real-time PCR machine (Applied Biosystems) using 2X FastStart Universal SYBR Green Master Mix (Thermo Scientific, K0222). The qRT-PCR primer specific for human genomes were MUC5B forward primer, 5’-aacgtcacctgcgtgaacaa-3’ (SEQ ID No. 1); MUC5B reverse primer, 5’-ctgagattcccaaagcgtgc-3’ (SEQ ID No. 2); TFF3 forward primer, 5’-gtgcctt- ggtgtttcaagcc-3’ (SEQ ID No. 3); TFF3 reverse primer, 5’-gaagaactgtcctcgggtgg-3’ (SEQ ID No. 4). Gene expression was normalized to the reference gene PPIA with PPIA forward primer, 5’-gctggacccaacacaaatgg-3’ (SEQ ID No. 5) and PPIA reverse primer, 5’-ggcctccacaa- tattcatgcct-3’ (SEQ ID No. 6). A plasmid including the gene of one of the biomarkers as positive control for the qPCR was utilized. Differential expressions of mRNAs were calculated using the AACT method. Digits indicate fold change compared to control (not shown). N.D: no target gene RNA detected in ectocervical samples.
[0136] Table 2: Sequences of primers used to detect MUC5B, TFF3 and PPIA by qRT-PCR: primer location and orientation with respect to NCBI mRNA reference sequence is displayed as — >
[0137] (forward), <— (reverse). FW = forward primer; RV = reverse primer.
[0138] Example 1 : Cell specific expression of the identified biomarkers
[0139] The MLIC5B and TFF3 expression levels were examined by qRT-PCR analysis in endocervi- cal swab material and ectocervical swab material as control samples. The qRT-PCR performed on seven different endocervical swab materials confirmed expression of MUC5B and TFF3.
[0140] There was a biologically significant increase in the MUC5B and TFF3 expression in each of the seven endocervical swab samples relative to the corresponding ectocervical swab samples from the same human subject as shown in Figure 1 A and 1 B. PPIA was used as housekeeping control for normalization.
[0141] The qRT-PCR analysis demonstrated the specific expression of MUC5B and TFF3 in endocervical swab samples including endocervical glandular cells and the absence of the expression in ectocervical swab samples.
[0142] Consequently, MUC5B and TFF3 represent cell type specific biomarker for endocervical glandular cells in endocervical swab samples and therefore, they are suitable as a positive control in a reliability check test of cells for a following cervical dysplasia or cervical carcinoma test.
[0143] Example 2: Statistic test results
[0144] For the validation of sensitivity and specificity of the MUC5B marker, the receiver operating characteristics (ROC) curve and a statistic testing was used. The statistic testing as well as the ROC curve demonstrated that the MUC5 molecular test results have an excellent specificity before and even better, after re-evaluation of cytologic smears which upon initial screen did not all show endocervical glandular cells (Figs. 2A and 2B). The operating points on the graph in the ROC curve suggest best cutoff at approximate expression of 120 (2A(-CT)) for MUC5B. The ROC curves compare MLIC5B molecular test performance before and after re- evaluation for endocervical cells by cytologic screen. (The area under the ROC curve (AUC) is the combined measure of sensitivity and specificity. The AUC is with a number of 0.980 close to 1 , showing an almost accurate overall diagnostic performance of the test, and a test with an AUC value of 1 is one that is perfectly accurate.) Figure 2C shows sparse barely detectable endocervical cells, which were found difficult to discern at initial screen, due to degenerative artefacts (photomicrograph, PAP, 40x), strengthening the importance of MUC5B testing.
Claims
AMENDED CLAIMS received by the International Bureau on 17 April 2026 (17.04.2026)1. A method for verifying the reliability of a biological sample, comprising the steps of:(i) determining the expression of at least one marker molecule, which is MUC5B, in the biological sample, wherein the expression of the at least one marker molecule indicates that the biological sample comprises cells from a transition zone and / or endocervical canal; and(ii) classifying the biological sample as a reliable biological sample when the at least one marker molecule is expressed; wherein the biological sample is a cervical sample.
2. The method according to claim 1 , wherein the transition zone is a zone where a columnar epithelium borders a squamous epithelium, and preferably the transition zone comprises glandular epithelial cells / columnar epithelial cells.
3. The method according to claim 1 or claim 2, wherein the reliable biological sample is reliable for a screening of HPV-infection and / or screening of dysplastic / neoplastic lesions; and / or wherein the method verifies the reliability of a HPV-test in the biological sample.
4. The method according to any one of claims 1 - 3, wherein the biological sample is a sample supposed to comprise cells from the transition zone and / or endocervical canal.
5. The method according to any one of claims 1 - 4, wherein the method further comprises(i) isolating RNA, DNA and / or protein from the biological sample before determining the expression of the at least one marker molecule is performed; and / or(ii) comparing the expression of the at least one marker molecule in the biological sample to the expression of the at least one marker in a reference; and / or(iii) normalizing the expression of the at least one marker molecule to the expression of a housekeeping gene, preferably wherein the housekeeping gene is PPIA.
6. The method according to any one of claims 1 - 5, wherein determining the expression comprises quantifying the amount of RNA, DNA and / or protein of the at least one marker molecule.
7. The method according to any one of claims 1 - 6, wherein the biological sample is obtained using a swab, tampon, brush, scraping, and / or biopsy.
8. The method according to any one of claims 1 -7, further comprising a step of screening of a HPV infection in the biological sample, preferably wherein the screening comprises determining the expression of at least a second marker molecule in the biological sample, more preferably wherein the second maker is a HPV marker, such as E6, E7, E2, and / or a cervical dysplastic / neoplastic lesion marker molecule, such as CDKN2A and / or MKI67.
9. The method according to claim 8, wherein the second marker molecule is selected from a group consisting of E6, E7, E2, and combinations thereof.
10. The method according to any one of claims 1 - 9, further comprising a step of(i) stratifying subjects for a follow-up treatment, preferably wherein the stratifying is based on a molecular test; and / or(ii) screening for dysplastic / neoplastic lesions, preferably the screening of dysplastic / neoplastic lesions is based on a molecular test.
11. Use of a marker molecule, which is MUC5B, for verifying the reliability of a biological sample, wherein the expression of the marker molecule indicates that the biological sample comprises cells from a transition zone and / or endocervical canal, wherein the biological sample is a cervical sample.
12. The use according to claim 11, wherein the reliability of the biological sample for screening of a HPV infection and / or screening of dysplastic / neoplastic lesions is verified; and / or wherein the reliability of a HPV-test in the biological sample is verified.