Specific analyte detection

The method of nucleic acid tagged antibodies and rolling circle amplification addresses accuracy and throughput issues in analyte detection, enabling sensitive and specific detection of analytes at low concentrations through localized signal generation and redundant probe detection.

WO2026101954A1PCT designated stage Publication Date: 2026-05-15VIDENS BIOSCIENCES INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
VIDENS BIOSCIENCES INC
Filing Date
2025-11-05
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing methods for biological analyte detection face challenges in accuracy and throughput, particularly due to limitations in the number of fluorophores used and the specificity of antibodies, as well as issues with amplicon diffusion and low concentration detection.

Method used

A method involving nucleic acid tagged antibodies that bind to analytes, followed by ligation to form circular molecules for rolling circle amplification, with independent detection using redundant probes and localized signal detection on an array, allowing for high stringency and sensitivity.

Benefits of technology

Enables detection of analytes at concentrations as low as 0.2 fg with high specificity and throughput, utilizing an array of up to 1 million wells for multiplex analysis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025054097_15052026_PF_FP_ABST
    Figure US2025054097_15052026_PF_FP_ABST
Patent Text Reader

Abstract

Compositions methods and systems for specific analyte detection are disclosed. Specificity is attained through redundant antibody binding, and probe binding site amplification via rolling circle amplification so as to create a plurality of probe binding sites that are tethered together to preclude binding site diffusion.
Need to check novelty before this filing date? Find Prior Art

Description

SPECIFIC ANALYTE DETECTIONCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This document claims the benefit of priority to US Prov Ser No 63 / 717,964, filed November 8, 2024, which is hereby incorporated by reference in its entirety.BACKGROUND

[0002] Accurate, high throughput biological analyte detection remains challenging.

[0003] May approaches rely upon direct detection of a labeled antibody. Though generally accurate, these approaches are limited by the number of fluorophores that can be used, and by the specificity of individual antibodies used in detection.

[0004] More recent approaches comprise detecting an analyte in a sample using paired antibodies that are each oligo tagged, such that ligation of the tags generates a template for PCR amplification as an approach for detection. However, these approaches are vulnerable to diffusion of amplicons, and are unable to detect lower level concentrations of target analytes.SUMMARY

[0005] Disclosed herein are methods of assaying for an analyte in a sample. Some such methods comprise one or more of, contacting the sample to a nucleic acid tagged antibody that binds the analyte, contacting the sample to a nucleic acid composition comprising a 5’ end and a 3’ end, contacting the sample to a ligase to ligate the 5’ end and the 3’ end in a ligation reaction guided by the nucleic acid tagged antibody to form a circular molecule comprising a ligated 5’ 3’ junction, contacting the sample to a polymerase to drive synthesis of a detection product comprising a single stranded concatemer comprising multiple copies of the reverse complement of the ligated 5’ 3’ junction, and probing the detection product. Methods often comprise independent, redundant detection of an analyte using a first and a second nucleic acid tagged antibody, amplification of a probe binding site corresponding to the analyte so as to preclude diffusion of independent amplicons, such as through rolling circle amplification, and detection of the analyte signal at a localized position on an array such as a well array. Methods may allow detection of an analyte at a concentration in the sample of as low as 0.2 fg, 2 fg, 200 fg, 2pg, and 200 pg, may be detected with a high level of stringency and in an assay comprising over 1 million well sites.

[0006] Similarly disclosed herein are compositions comprising one or more of a target, a binding moiety bound to the target, a linear nucleic acid strand tethered to the bindingmoiety, and a circular nucleic acid hybridized to the linear nucleic acid strand. Such compositions facilitate amplification such as rolling circle amplification of the circular nucleic acid, so as to generate a plurality of probe biding sites without risking probe site diffusion that may lead to loss of stringency. Compositions may allow detection of an analyte at a concentration in the sample of as low as 0.2 fg, 2 fg, 200 fg, 2pg, and 200 pg, may be detected with a high level of stringency and in an assay comprising over 1 million well sites.

[0007] Similarly disclosed herein are systems comprising an array of wells, such as up to 1 million wells or more, at least one of said wells harboring a nucleic acid molecule comprising a concatemer of monomeric repeats and a 5’ nonrepetitive segment, and a non-nucleic acid anchor tethered to the 5’ end of the 5’ nonrepetitive segment, wherein a labeled probe is annealed to at least one monomeric repeat of the concatemer of monomeric repeats. Some systems further comprise one or more of optics, image capture and fluidics functionalities. Systems may allow detection of an analyte at a concentration in the sample of as low as 0.2 fg, 2 fg, 200 fg, 2pg, and 200 pg, may be detected with a high level of stringency and in an assay comprising over 1 million well sites.

[0008] The disclosure is further summarized in the embodiments and claims as listed below.INCORPORATION BY REFERENCE

[0009] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Fig. 1 depicts successful analyte detection at analyte concentrations of 2 pg / mL.

[0011] Fig. 2 presents a nanowell array harboring sample analytes being assed for using the methods herein.

[0012] Fig. 3 presents an exemplary workflow in which two antibody nucleic acid tags are ligated, and rolling circle amplification is driven by a bead bound primer.

[0013] Fig. 4 presents an exemplary workflow in which two antibody nucleic acid tags are ligated, and rolling circle amplification is driven by a 3’ end exposed after cleavage of one of the nucleic acid tags.

[0014] Fig. 5 presents an exemplary workflow in which a linear nucleic acid is delivered to an analyte by a first antibody nucleic acid tag, and the linear nucleic acid is circularized, and rolling circle amplification is driven by a second antibody nucleic acid tag.

[0015] Fig. 6 presents an exemplar}' workflow in which a bipartite linear nucleic acid is circularized by both a first and a second antibody tagged nucleic acid tag, and rolling circle amplification is driven by a second antibody nucleic acid tag.

[0016] Fig. 7 presents an exemplary workflow in which a linear nucleic acid is circularized by an antibody nucleic acid tag which primes rolling circle amplification, while a second antibody tethered to a bead delivers the complex to a well.

[0017] Fig. 8 presents an exemplary workflow in which a linear nucleic acid is circularized by an antibody nucleic acid tag, and the circular molecule is released and attached to a bead bound primer which primes rolling circle amplification and delivers the complex to a well.

[0018] Fig. 9 presents a linear nucleic acid precursor of a circular rolling circle amplification template.DETAILED DESCRIPTIONIntroduction

[0019] Disclosed herein are compositions, systems and methods related to the sensitive, specific detection of an analyte or analytes in a sample, through the practice of the disclosure herein, one or a large diversity of analytes may be detected in a sample with high specificity, low false positive rate and a high rate of throughput.

[0020] A common feature of many of the compositions, systems and methods herein is that an amplified signal indicative of an analyte in a sample is localized to a well of an array. The localization and in some cases the generation of the signal requires that the analyte be independently bound by two separate antibodies or other binding moieties at two distinct epitope sites, so as to increase stringency of detection. Upon detection, an amplification molecule is generated that comprises a single phosphodiester backbone, such that the amplification molecule or its constituent segments cannot diffuse away from its localization position. Often, this detection molecule is generated through circularization of one or more than one linear probe, so as to form a template for rolling circle amplification of the linear probe as segments of a concatemerized linear signal molecule.

[0021] This high level of stringency and low level of background or diffused detection signal facilitates a high degree of multiplexing, such that many analytes may be detected or quantified concurrently in a single partition array such as a well array. Furthermore, the highlevel of stringency and low level of background or diffused detection signal facilitates a high degree of sensitivity, such that an analyte present at a level from 0.2 fg, 2 fg, 200 fg, 2pg, and 200 pg, may be detected.Compositions and complexes

[0022] Compositions relate to analyte detection, such as by analyte binding. Exemplary' analyte binder are antibodies or antibody binding regions, though other analyte binding moieties such as receptor ligand pairs, oligobinders, aptamers or other specific analyte binders are also contemplated as consistent with the disclosure herein.

[0023] A broad range of analytes is consistent with the disclosure herein. Generally, any analyte that may be independently bound by two distinct binding moieties is suitable for detection through the disclosure herein. Exemplary target analytes include proteins having two distinct epitope regions, such that they may be concurrently bound by two distinct antibodies or antibody binding regions. Throughout the specification herein and in particular in the figures, the protein beta-amyloid 42 (Abeta 42) is used as an exemplary analyte for detection through the disclosure herein. Abeta 42 is in fact an exemplary analyte for detection consistent with the disclosure herein. However, other analytes are also consistent with the disclosure herein, such as circulating proteins or other circulating biomaterials, tissue bound proteins or other tissue bound substances. Generally, any biomolecule that may be independently bound by two binding moieties is suitable as an analyte consistent with the disclosure herein.

[0024] Analytes may be obtained from any of a number of sources, such as a tissue sample, biopsy, FFPE preserved sample or other processed or unprocessed sample source. Exemplary tissue sources are fluid samples, such as circulating blood samples or extracts thereof, such as plasma samples, red blood cell free or other cell free circulating samples.

[0025] Samples are in some cases subjected to stabilization, purification or enrichment, such as through one or more of cell removal, protease or nuclease inactivation, fixation such as formalin fixation and paraffin embedding, freezing, buffer stabilization, fractionation or other pre-analysis manipulation. Alternately, some samples are assayed without post collection processing.

[0026] Generally, analyte detection herein comprises binding of an analyte by at least two binding moieties such as antibodies, so as to independently bind the analyte. In some cases both analyte binders such as antibodies bind the analyte and comprise nucleic acid tags such as independent nucleic acid tags. In alternate embodiments, one binder comprises a nucleic acid tag while the second is not nucleic acid tagged. In some cases the second binder istethered to a bead, for example so as to tether or localize an analyte to a well or a position on a surface.

[0027] The binding moieties such as antibodies are further characterized by nucleic acid tags such as oligo tags, that may be covalently attached to, share a common phosphodiester backbone with, or be noncovalently bound to the binding moieties. In some cases a nucleic acid tag such as an oligo tag comprises sequence that identifies the binding moiety such as an antibody to the exclusion of at least one other binding moiety, or substantially uniquely, uniquely for a given multiplex reaction or in some cases uniquely. Alternately or in combination, an oligo tag comprises sequence that is reverse complementary (sometimes referred to as simply ‘complementary’) to one or more of a 5’ end, 3’ end or internal region of a nucleic acid of the nucleic acid composition discussed below. In some cases a nucleic acid comprises a segment that spans both a 5’ end and 3’ end of a linear nucleic acid, such as may facilitate ligation of the 5’ end and 3’ end of the linear nucleic acid. The segment in some cases spans no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more bases across the 5’ end and 3’ end, so as to act as an ‘overhang’ that may guide ligation. Alternately, the segment may span a region comprising the 5’ end and 3’ end and more substantial portions of the linear nucleic acid molecule, or may bind a region distal from the 5’ end and 3’ end.

[0028] Often, a nucleic acid tag such as an oligo tag is configured such that its 3’ end anneals to a portion of a nucleic acid of the nucleic acid composition discussed below, so as to create an exposed 3’ end of an oligo segment annealed to a reverse complementary strand, so as to from a complex to support DNA polymerase extension. Alternately or in combination, some tags comprise an internal cleavage site that can, upon cleavage, expose a 3’ end such as a 3’ end of a segment annealed to a linear or circularized nucleic acid.

[0029] Some compositions herein comprise a secondary binding moiety such as a secondary antibody or secondary antibody Fab region that binds an analyte binding moiety such as a nucleic acid tagged antibody or a second nucleic acid tagged antibody. This secondary binding moiety such as a secondary antibody in some cases tethers the nucleic acid tagged antibody or a second nucleic acid tagged antibody, or other analyte binder, to a bead, for example so as to localize the nucleic acid tagged antibody or other binding moiety, and its bound analyte, to a location such as a well.

[0030] A secondary antibody or other secondary binding moiety may be tethered to bead or other anchoring moiety directly or through a bridging moiety or moiety complex, such as a biotin streptavidin complex, receptor ligand complex, or other complex or moiety that maytether the secondary antibody or other secondary binding moiety to the bead or other anchoring moiety.

[0031] A number of anchoring moieties are consistent with the disclosure herein. An anchoring moiety serves to anchor a binding complex to a well or location on an array, for example. Exemplary anchoring moieties include hydrogel beads, solid particle beads or other distinct solid moieties that have a mass or are subject to an attraction sufficient to anchor a binding complex, such as a binding complex comprising an amplification nucleic acid, and in some cases also comprising an analyte, an antibody and perhaps other constituents, to a position such as a well. Hydrogel beads may comprise agarose, polyacrylamide, a carbohydrate or other gel. Some beads comprise a magnetic moiety so as to be subject to attraction, as may be used to draw it out of a mixture or hold it in place at a position such as a well of an array.

[0032] Central to many approaches for analyte detection herein is the generation of a circular nucleic acid molecule to be used as a template for rolling circle amplification. The circular nucleic acid is generated from a linear precursor nucleic acid, or in some cases a plurality of linear precursor nucleic acids.

[0033] Linear nucleic acids are provided in nucleic acid compositions to bind analytes or concurrently or prior to delivery of nucleic acid tagged binding moieties, such as nucleic acid bound antibodies. A feature of many of the linear nucleic acids herein is that they comprise 5’ ends and 3’ ends reverse complementary to segments of a binding moiety nucleic acid tag, such that annealing to the binding moiety nucleic acid tag positions a linear nucleic acid 5’ end, 3’ end, or 5;’ end and 3’ end for ligation such that a circular nucleic acid is formed therefrom. Often the ligated 5’ end and 3’ end are ends of a common linear nucleic acid, but in some cases where multiple linear nucleic acids are used for a given analyte, the 5’ and 3’ ends joined via ligation may arise from distinct linear nucleic acids.

[0034] A linear nucleic acid in some cases comprises a barcode or other identifying sequence segment. This sequence segment may correspond to a 5’ or 3’ end sequence or end adjacent sequence, or may be generated through ligation of 5’ and 3’ ends such that end sequences are not individually information rich enough to identify a linear nucleic acid or an analyte, but in combination with ligated adjacent sequence, the ligation product comprises a segment that spans the ligation junction and comprises sufficient information to identify the linear nucleic acid molecule precursor, analyte or binding moiety to the exclusion of another, a plurality or all other linear nucleic acid molecule precursor, analyte or binding moieties in a sample or assayed on an array.

[0035] Alternately or in combination, the sequence may correspond to a segment of the linear nucleic acid distal from the 5’ and 3’ ends, such that the segment exists in full independent of ligation.

[0036] Ligation of 5’ and 3’ ends to from a circular nucleic acid often further comprises or is followed by positioning of a 3’ end of an annealed segment to the circular nucleic acid, so as to generate a configuration suitable for circular nucleic acid templated extension from the 3’ end by a DNA polymerase, such as a polymerase having strand displacement activity to effect rolling circle amplification.

[0037] Through rolling circle amplification of the circular nucleic acids generated herein, one sees generation of an amplified linear detection molecule, comprising concatemeric repeats of a reverse complement of the linear nucleic acid segment, tethered to the 3’ end of the nucleic acid that served as the initial primer for the DNA polymerase activity. The linear detection molecule is tethered, either to an analyte via one or a second nucleic acid tagged antibody or other tagged binding moiety, or to a bead directly through being primed by a bead bound primer. In either case, the amplified linear detection molecule is tethered so as to be localizable to a particular position, such as well in an array or a position on a surface.Furthermore, amplification is effected isothermally, without thermal cycling and without generation of untethered amplification products that may diffuse away from the target analyte or bead. Amplified linear detection molecules variously comprise 10, 20, 50, 100, 200, 500, 1000, or more than 1000 copies of the linear nucleic acid molecule which, upon circularization, serves as its template, and further comprise at their extreme 5’ ends the primer sequence used to initiate DNA polymerase activity, and in some cases additional sequence of a nucleic acid tag of a binding moiety such as the nucleic acid tagged antibody or the second nucleic acid tagged moiety as contemplated herein.

[0038] The amplified linear detection molecule in turn serves as a target for one or more labeled probes or visualization probes, oligos having a portion that is identical to a segment of the linear nucleic acid, such as the segment that identifies the linear nucleic acid, binding moiety or target analyte. This portion is reverse complementary to the portion of the amplified linear detection molecule of which it is a template, such that the amplified linear detection molecule comprises a plurality of visualization probe binding sites. As the amplified linear detection molecule comprises a single phosphodiester backbone, its multiple copies of the visualization probe binding sites are localized to a single site and may be deposited in a well or on a particular site of a surface.

[0039] Visualization probes or labeled probes comprise an oligonucleotide identical to a segment of the linear nucleic acid that is reverse complementary to multiple positions on the amplified linear detection molecule. Visualization or labeled probes further comprise a detection tag, such as a fluorophore that may emit a signal of a wavelength sufficient to identify the labeled probe.

[0040] In some cases the detection tag may upon excitation emit a signal that is distinguished from that of at least one other visualization probe, such that multiple analytes may be assayed in a single detection assay or on a single array of wells or a single surface.

[0041] Some amplified linear detection molecules are detected through more than one round of detection, separated by probe removal or photobleaching. Labeled probes directed to a particular amplified linear detection molecule or analyte are in some cases identical from one to a second round of detection. Alternately, in some cases detection probes targeting a single amplified linear detection molecule are designed to vary in their detection tag, such that the signal corresponding to an amplified linear detection molecule may vary across rounds of detection. By specifying the signal corresponding to an amplified linear detection molecule across each of a plurality of rounds of detection, one may assign a code or emission pattern to the amplified linear detection molecule, such that the diversity of amplified linear detection molecules detected greatly surpasses the number of fluorophores available for amplified linear detection molecule detection, thus facilitating multiplex detection of a plurality of analytes in a single detection run.

[0042] Consistent with the above, a number of complexes are disclosed herein in addition to the individual components discussed above. Complexes variously comprise, for example, a nucleic acid tagged antibody bound to a secondary antibody, such as a secondary antibody tethered to a bead via a biotin streptavidin bridge; a nucleic acid tagged antibody bound to a secondary antibody, such as a secondary antibody tethered to a bead via a biotin streptavidin bridge that is bound to a target analyte; a nucleic acid tagged antibody bound to a secondary antibody, such as a secondary antibody tethered to a bead via a biotin streptavidin bridge that is bound to a target analyte and a second nucleic acid tagged antibody; a nucleic acid tagged antibody bound to a secondary' antibody, such as a secondary antibody tethered to a bead via a biotin streptavidin bridge that is bound to a target analyte and a second nucleic acid tagged antibody, and a linear nucleic acid that is bound to the nucleic acid tag of the antibody and the second antibody; a nucleic acid tagged antibody bound to a secondary antibody, such as a secondary antibody tethered to a bead via a biotin streptavidin bridge that is bound to a target analyte and a second nucleic acid tagged antibody, and a linear nucleic acid that is bound tothe nucleic acid tag of the antibody and the second antibody in contact with a ligase in a buffer comprising reagents to facilitate ligase activity; a nucleic acid tagged antibody bound to a secondary antibody, such as a secondary antibody tethered to a bead via a biotin streptavidin bridge that is bound to a target analyte and a second nucleic acid tagged antibody, and a circular nucleic acid that is bound to the nucleic acid tag of the antibody and the second antibody; a circular nucleic acid bound to a bead tethered oligo; an amplified linear detection molecule tethered to a bead; and an amplified linear detection molecule tethered to a bead and bound to multiple copies of a fluorescent probe.

[0043] Similarly, complexes variously comprise a nucleic acid tagged antibody bound to a secondary antibody, such as a secondary antibody tethered to a bead via a biotin streptavidin bridge that is bound to a target analyte and a second nucleic acid tagged antibody, and a circul ar nucleic acid that is bound to the nucleic acid tag of the antibody and the second antibody, wherein one of the nucleic acid tag and the second antibody nucleic acid tag is bound to a cleavage enzyme, such as a restriction endonuclease and an oligonucleotide that generates a double stranded cleavage site, and a buffer environment consistent with cleavage; a nucleic acid tagged antibody bound to a secondary antibody, such as a secondary' antibody tethered to a bead via a biotin streptavidin bridge that is bound to a target analyte and a second nucleic acid tagged antibody, and a circular nucleic acid that is bound to the nucleic acid tag of the antibody and to a portion cleaved from the nucleic acid tag of the second antibody; a nucleic acid tagged antibody bound to a secondary antibody, such as a secondary antibody tethered to a bead via a biotin streptavidin bridge that is bound to a target analyte and a second nucleic acid tagged antibody, and a circular nucleic acid that is bound to the nucleic acid tag of the antibody and to a portion cleaved from the nucleic acid tag of the second antibody contacted to a polymerase such as a strand displacing DNA polymerase, in contact with buffer and reagents consistent with strand extension such as dNTPs; a nucleic acid tagged antibody bound to a secondary antibody, such as a secondary antibody tethered to a bead via a biotin streptavidin bridge that is bound to a target analyte and a second nucleic acid tagged antibody, and a circular nucleic acid that is bound to the nucleic acid tag of the antibody and to a portion cleaved from the nucleic acid tag of the second antibody tethered to an amplified linear detection molecule; and a nucleic acid tagged antibody bound to a secondary antibody, such as a secondary antibody tethered to a bead via a biotin streptavidin bridge that is bound to a target analyte and a second nucleic acid tagged antibody, and a circular nucleic acid that is bound to the nucleic acid tag of the antibody and to a portioncleaved from the nucleic acid tag of the second antibody tethered to an amplified linear detection molecule bound to multiple copies of a fluorescent probe.

[0044] Similarly, complexes variously comprise a nucleic acid tagged antibody bound to a secondary antibody, such as a secondary antibody tethered to a bead via a biotin streptavidin bridge, wherein the nucleic acid tag is bound to a linear nucleic acid at a segment distal from the linear nucleic acid 5’ end and 3’ end; a nucleic acid tagged antibody bound to a secondary' antibody, such as a secondary antibody tethered to a bead via a biotin streptavidin bridge, wherein the nucleic acid tag is bound to a linear nucleic acid at a segment distal from the linear nucleic acid 5’ end and 3’ end, the antibody bound to a target analyte that is independently bound by a second oligo tagged antibody, the oligo tag of the second antibody bound to the linear nucleic acid such that its 5’ end and 3’ end are held in proximity; a nucleic acid tagged antibody bound to a secondary antibody, such as a secondary antibody tethered to a bead via a biotin streptavidin bridge, wherein the nucleic acid tag is bound to a linear nucleic acid at a segment distal from the linear nucleic acid 5’ end and 3’ end, the antibody bound to a target analyte that is independently bound by a second oligo tagged antibody, the oligo tag of the second antibody bound to the linear nucleic acid such that its 5’ end and 3’ end are held in proximity and further contacted to a ligase and ligase buffer; a nucleic acid tagged antibody bound to a secondary antibody, such as a secondary antibody-tethered to a bead via a biotin streptavidin bridge, wherein the nucleic acid tag is bound to a circular nucleic acid at a segment distal from the prior linear nucleic acid 5’ end and 3’ end, the antibody bound to a target analyte that is independently bound by a second oligo tagged antibody, the oligo tag of the second antibody bound to the circular nucleic acid at a segment spanning the prior linear nucleic acid 5’ end and 3’ end and the oligo tag of the second antibody has a 3’ end annealed to the circular nucleic acid so as to prime extension; a nucleic acid tagged antibody bound to a secondary antibody, such as a secondary antibody tethered to a bead via a biotin streptavidin bridge, wherein the nucleic acid tag is bound to a circular nucleic acid at a segment distal from the prior linear nucleic acid 5’ end and 3’ end, the antibody bound to a target analyte that is independently bound by a second oligo tagged antibody, the oligo tag of the second antibody bound to the circular nucleic acid at a segment spanning the prior linear nucleic acid 5’ end and 3’ end and the oligo tag of the second antibody has a 3’ end annealed to the circular nucleic acid so as to prime extension, and a DNA polymerase such as a DNA polymerase having strand displacement activity, and extension buffer and reagents to support strand extension; a nucleic acid tagged antibody bound to a secondary antibody, such as a secondary antibody tethered to a bead via a biotinstreptavidin bridge, wherein the nucleic acid tag is bound to a circular nucleic acid at a segment distal from the prior linear nucleic acid 5’ end and 3’ end, the antibody bound to a target analyte that is independently bound by a second oligo tagged antibody, the oligo tag of the second antibody bound to the circular nucleic acid at a segment spanning the prior linear nucl eic acid 5’ end and 3’ end and the oligo tag of the second antibody has a 3’ end tethered to an amplified linear detection molecule; and a nucleic acid tagged antibody bound to a secondary antibody, such as a secondary antibody tethered to a bead via a biotin streptavidin bridge, wherein the nucleic acid tag is bound to a circular nucleic acid at a segment distal from the prior linear nucleic acid 5’ end and 3’ end, the antibody bound to a target analyte that is independently bound by a second oligo tagged antibody, the oligo tag of the second antibody bound to the circular nucleic acid at a segment spanning the prior linear nucleic acid 5’ end and 3’ end and the oligo tag of the second antibody has a 3’ end tethered to an amplified linear detection molecule bound to multiple copies of a fluorescent probe.

[0045] Similarly, disclosed herein is a complex comprising a nucleic acid tagged antibody bound to a secondary antibody, such as a secondary antibody tethered to a bead via a biotin streptavidin bridge, wherein the nucleic acid tag is bound to a linear nucleic acid at a segment distal from the linear nucleic acid 5’ end and 3’ end, the antibody bound to a target analyte that is independently bound by a second oligo tagged antibody, the oligo tag of the second antibody and the oligo tag of the antibody bound to first and second fragments of a linear nucleic acid such that the first and second fragment 5’ ends and 3’ ends are held in proximity; and a complex comprising a nucleic acid tagged antibody bound to a secondary antibody, such as a secondary antibody tethered to a bead via a biotin streptavidin bridge, wherein the nucleic acid tag is bound to a linear nucleic acid at a segment distal from the linear nucleic acid 5’ end and 3’ end, the antibody bound to a target analyte that is independently bound by a second oligo tagged antibody, the oligo tag of the second antibody and the oligo tag of the antibody bound to first and second fragments of a linear nucleic acid such that the first and second fragment 5’ ends and 3’ ends are held in proximity further comprising a ligase that may from a circular nucleic acid from the first segment and second segment.

[0046] Similarly, disclosed herein is a complex comprising a bead tethered to a secondaryantibody via, for example, a biotin streptavidin linkage; a complex comprising a bead tethered to a secondary antibody via, for example, a biotin streptavidin linkage, the secondary antibody bound to a target binding antibody; a complex comprising a bead tethered to a secondary antibody via, for example, a biotin streptavidin linkage, the secondary' antibody bound to a target binding antibody bound to a target analyte; a complex comprising a beadtethered to a secondary antibody via, for example, a biotin streptavidin linkage, the secondary antibody bound to a target binding antibody bound to a target analyte that is also bound to a second detection antibody that comprises an oligo tag; a complex comprising a bead tethered to a secondary antibody via, for example, a biotin streptavidin linkage, the secondary' antibody bound to a target binding antibody bound to a target analyte that is also bound to a second detection antibody that is bound to a secondary antibody having an oligo tag, that in some cases is bound to a linear nucleic acid molecule such that the linear nucleic acid 5’ end and 3’ end are held in proximity, and in some cases further comprising a ligase and ligase buffer; a complex comprising a bead tethered to a secondary antibody via, for example, a biotin streptavidin linkage, the secondary antibody bound to a target binding antibody bound to a target analyte that is also bound to a second detection antibody that is bound to a secondary antibody having an oligo tag, that is bound to a circular nucleic acid molecule, and in some cases further comprising a primer bound to the circular nucleic acid and tethered to a bead; a detection bead comprising a plurality of bead bound amplified linear detection molecules; and a detection bead comprising a plurality of bead bound amplified linear detection molecules further bound to a plurality of detection probes.

[0047] In various embodiments one or more of the complexes above is localized to a partition, such as a well of a multi-well array.

[0048] In each case, complexes facilitate analyte detection by having amplified linear detection molecule deposition into a well being predicated upon binding of the analyte by two independent binding moieties such as antibodies.

[0049] Representative examples of complexes disclosed herein are found, for example, at Fig s 3-8.Nucleic acid compositions

[0050] Compositions and methods herein compri se or comprise use of a number of interrelated nucleic acids. Sequence of these nucleic acids is often flexible, while the interrelation among reverse complementary segments of these nucleic acids dictates or facilitates the analyte detection approaches herein.

[0051] One set of nucleic acids disclosed herein comprises antibody (or other detection moiety) tagging nucleic acids. An antibody tagging nucleic acid is bound, often covalently, to an antibody or other binding moiety.

[0052] Exemplary linking chemistry is “oYo-link” antibody conjugation chemistry, though other linking technologies are compatible with the disclosure herein.

[0053] Binding may be effected at the nucleic acid 5’ end or 3’ end. Oligos may comprise a linkage site adjacent poly-T segment of 9 or up to 10-15 bases or more.

[0054] An oligo often comprises an antibody identifying or target identifying segment. The segment may be unique to the antibody or unique to the target, or may specify the antibody or target among others in a particular run, or may partially specify a target such that, in combination with a second target binding antibody nucleotide tag sequence, one may identify or recognize a particular target in a heterogeneous sample.

[0055] The identifying segment is often found at or adjacent to the non-tethered terminus of the nucleic acid, although alternatives having an identifying segment internal to a nucleotide tag are also contemplated. In some cases an identifying sequence is generated by the adjacent positioning of a first partial identifying segment at a 5’ end of a first target binding oligo nucleic acid tag and a second partial identifying segment at a 3’ end of a second target binding oligo nucleic acid tag.

[0056] Some antibody tagging nucleic acids comprise a cleavage site, such as a restriction endonuclease cleavage site, that may serve as an endonuclease or other cleavage target. The cleavage site may serve as a target alone, or upon hybridization to a reverse complementary segment so as to form a double stranded target region. Alternate cleavage sites are generated or tagged by uracil, pseudouracil, a 2’ OH, methylation, or other moiety that may target the location for degradation or cleavage, which in some cases is used to generate a free 3’ OH to prime extension of an annealed template.

[0057] A broad range antibody tagging nucleic acid lengths are consistent with the disclosure herein. Exemplary tags are 40-70 bases, though lengths from, say, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150 or greater, or any length falling within or adjacent to a length listed herein is also contemplated. Tags are sometimes limited so as to be long enough that both nucleic acid tags of antibodies to a common analyte target may concurrently anneal to a bridging or padlock oligo that bridges them.

[0058] A second category of nucleic acids disclosed herein comprises a linear nucleic acid strand that may serve as a detection, or bridging, or padlock oligo. This linear nucleic acid is a precursor that, when circularized, serves as template for rolling circle amplification to generate an amplified linear detection molecule.

[0059] A linear nucleic acid strand as contemplated herein comprises a 5’ end and a 3’ end having segments that are anneal to adjacent regions of an antibody tagging oligo, such that the antibody tagging oligo serves to guide a ligation or nick repair reaction to circularize the linear nucleic acid. Alternately, 5’ end and 3’ end segments of the linear nucleic acid may bereverse complementary to 3’ end and 5’ end segments of a first antibody oligo tag and a second antibody oligo tag, such that upon annealing a pair of blunt ends are formed that are available for blunt end ligation. Alternately, annealing is ‘offset’ by one or a few bases, such as 1, 2, 3, 4, 5, 6, or more bases, such that upon annealing a pair of complementary sticky end overhangs are formed so as to facilitate ligation.

[0060] Some linear nucleic acid strands are fragmented, such that the constituents are delivered in more than one segment or on more than one phosphodiester backbone, which are assembled by guide sequence in a first or a first and a second antibody nucleic acid tags to from a circular nucleic acid.

[0061] A linear nucleic acid may comprise a segment or segments that collectively comprise an antibody identifying or target identifying segment. The segment may be unique to the linear nucleic acid or unique to the target, or may specify the linear nucleic acid or target among others in a particular run, such that one may identify or recognize a particular target in a heterogeneous sample.

[0062] The identifying segment is often found at or adjacent to the 5’ and 3’ ends of the linear nucleic acid, although alternatives having an identifying segment internal to a nucleotide tag are also contemplated. In some cases an identifying sequence is generated by the adjacent positioning of a first partial identifying segment at a 5’ end and a second partial identifying segment at a 3’ end of the linear nucleic acid.

[0063] In some cases, the linear nucleic acid 5’ and 3’ identifying segments are reverse complementary to the 5’ end and 3’ end identifying segments of the antibody tagging nucleic acid

[0064] Alternately, the identifying segment is in some cases distinct from the 5’ and 3’ ends of the linear nucleic acid used for circularization. In these cases, 5’ and 3’ ends may anneal to specific regions of target bound first and second antibody nucleic acid tags, and this annealing may be specific, but a distinct region or segment of the linear nucleic acid serves to identify the target analyte.

[0065] Upon positioning of the linear nucleic acid 5’ and 3’ ends in proximity, ligation, nick repair or other process may be used to form a circular nucleic acid from the linear nucleic acid. The circular nucleic acid in turn may serve as a template for rolling circle amplification to form an amplified linear detection molecule.

[0066] Rolling circle amplification is primed in some cases by an ‘original’ antibody tagging nucleic acid 3’ end, or a 3’ end created through cleavage of an antibody tagging nucleic acid to expose a previously internal 3 ’OH. Alternately, rolling circle amplification may be primedby a bead tethered primer to which the circular nucleic acid is annealed concurrent with or subsequent to removal from an antibody tagging nucleic acid.

[0067] The rolling circle amplification product forms an amplified linear detection molecule, comprising concatemeric reverse complements of the linear nucleic acid detection molecule that is circularized in a process guided by one or both antibody tagging nucleic acids as discussed above. The reverse complement of the linear nucleic acid identifying segment is thus present in multiple concatemers of the amplified linear detection molecule.

[0068] A third category of nucleic acids herein comprises probes, such as fluorophore labeled probes, that anneal to the multiple copies of the reverse complement of the linear nucleic acid identifying segment in the amplified linear detection molecule. That is, the probes often comprise bases having sequence identical to identifier segment sequence in the linear nucleic acid probes or in the circular nucleic acids, and this reverse complementary to the amplified linear detection molecules generated therefrom.

[0069] Probes are configured to be detectable upon hybridization to an amplified linear detection molecule. Generally, probes are rendered detectable by conjugation to a fluorophore, such as a fluorophore that responds to an excitation energy by emitting a detectable signal. Exemplary' excitation energies include 488 nm, 532 nm, 645 nm, although a broad range of excitation wavelengths are consistent with the disclosure herein. A probe of a given sequence may be used in concert with more than one fluorophore. That is, a probe population sharing a common sequence may be subdivided into a first subpopulation having a first fluorophore and a second subpopulation having a second fluorophore. The first subpopulation and second subpopulation may be used in distinct rounds of amplified linear detection molecule detection, such that a single target analyte or amplified linear detection molecule may correspond to distinct, different fluorophore signals in different detection rounds. This facilitates analyte detection using not a single fluorophore but a temporal pattern of signals corresponding to a signal code for that analyte. Alternate detection approaches are also contemplated, such as detection approaches wherein a population comprising a first subpopulation and second subpopulation may be used concurrently to generate a signal of two or more wavelengths intermingled.

[0070] Probes lacking fluorophores may also be used, either alone to create a ‘zero’ signal in one or more rounds of a multi round detection approach, or in combination with labeled probes to create a ‘half or reduced fluorophore signal for a given round.? Mso, in some systems unlabeled probes are used in combination with double stranded nonspecific detectionreagents such as Ethidium bromide or SyBR green, particularly for single analyte detection assays.

[0071] For each of the nucleic acid features disclosed herein,a broad range of sequences are suitable. Some constraints, relating to melting temperature or reduction of secondary structure, may limit the sequence options for these segments, but most embodiments do not require a particular sequence, and individual components in isolation may not have distinct sequence limitations. However, when viewed as a system comprising multiple of the above-mentioned nucleic acid components, one sees that sequence constraints emerge related to the roles that each nucleic acid plays and the interactions that occur among the nucleic acids.

[0072] For example, a broad range of sequences are available for both antibody tags and for the linear nucleic acid. However, antibody probe tags and linear nucleic acids must in manycases exist in paired groups for a given analyte, such that the antibody tagging nucleic acids alone or in combination serve to guide circularization of the linear nucleic acid. This requires some degree of reverse complementarity between these nucleic acid sets, and some degree of exclusivity such that a linear nucleic acid is circularized in combination with only one or one pair of analy te antibody tags.

[0073] That is, a linear nucleic acid may comprise a segment that is reverse complementary to an analyte targeting antibody nucleic acid tag over a segment of, for example, at least, exactly, about or no more than 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases. The reverse complementarity may be exact, or at least, exactly, about or no more than 97%, 94%, 90%, 85%, 80% or less. The segment may be unique or specific to one set of nucleic acids directed to one analyte in an analyte detection regimen, such that other nucleic acids used to assay the sample for distinct analytes may not anneal to the region of a set directed to a first analyte in the sample, thereby providing specificity to the multiplex assay. Detection systems are not limited to specific sequences in most cases, but detection nucleic acid sets directed to distinct analytes must have regions which are sufficiently distinct to preclude cross-annealing.

[0074] Similarly, probe sequence is in many cases not limited beyond constraints of melting temperature and absence of hairpin formation, for example, but a probe population of a given detection set will often exhibit sequence that is identical or highly similar to a corresponding region of a linear nucleic acid for that set, such that upon hybridization to an amplified linear detection molecules generated therefrom, the probe binds only to an intended amplified linear detection molecule, again so as to convey specificity to the nucleic acid set in the assay system. Probes may be identical to regions of asset-correspondent linear nucleic acid. Aprobe generally comprises a segment that is identical to an analyte targeting linear nucleic acid segment over a segment of, for example, at least, exactly, about or no more than 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases. The identity may be exact, or at least, exactly, about or no more than 97%, 94%, 90%, 85%, 80% or less. Again, the sequence itself is only loosely constrained, but detection nucleic acid sets directed to distinct analytes must have regions which are sufficiently distinct to preclude crossannealing.

[0075] Some linear nucleic acids further comprise a ‘zipper’ region that corresponds to a zipper oligo that may be added to an amplified linear detection molecule so as to configure the amplified linear detection molecule to facilitate probe annealing.

[0076] Compositions herein facilitate or are consistent with an analyte being independently bound by two distinct binding moieties, and an amplified linear detection molecule being deposited at a distinct location so as to facilitate signal detection and multiplexing with a high level of sensitivity. Many analytes may be detected or quantified concurrently in a single partition array such as a well array. Furthermore, the high level of stringency and low level of background or diffused detection signal facilitates a high degree of sensitivity, such that an analyte present at a level from 0.2 fg, 2 fg, 200 fg, 2pg, and 200 pg, may be detected.Methods

[0077] Methods herein often share common elements of an analyte being independently bound by two distinct binding moieties, and an amplified linear detection molecule being deposited at a distinct location so as to facilitate signal detection and multiplexing.

[0078] Steps in various exemplary methods are depicted at Fig s 3-8.

[0079] Methods often comprise or are predicated upon collection of a sample for which presence of an analyte or a plurality of analytes is to be assayed. Some methods are directed to single analyte detection, for example so as to detect the analyte even if present at low concentrations in a sample, or to quantify the level of the analyte in the sample. Methods may further comprise detection of a plurality of distinct analytes, or detection and quantification of a plurality of distinct analytes, such as at least 2, 5, 10, 20, 50, 100, 200, 500, 1000, 2000, 5000, 10,000, 20,000, or more than 20,000 distinct analytes. Scaling the detection process is limited only by availability of binding moieties such as antibodies, the availability of distinct detection markers of the detection probes such as fluorophores, or the resilience of the amplified linear detection molecules to iterative detection using detection markers in the case of using coded fluorescence or other signal pattern over an iterative number of cycles. Forexample, for a number of fluorophores n and a number of cycles c, the number of coded detection combinations is n raised to the exponent c. So, for example, four cycles of two-fluor ophore detection may yield 2 raised to the 4 combinations, or 16, while four cycles of ten-fluorophore detection may yield 10 raised to the 4 combinations, or 10,000.

[0080] Methods variously comprise contacting a sample for which an analyte is to be assayed using two separate moieties that bind the analyte if present. In most embodiments binding moieties are antibodies, and for much of the remainder of this section antibodies will be referred to, but one is reminded that alternate binding moieties are also disclosed herein and otherwise contemplated.

[0081] Antibodies are added to a sample concurrently or in series, and often to not compete for binding at a single site. Rather, they bind distinct epitopes or other binding sites of an analyte, so as to facilitate redundant detection. One of the antibodies is tethered to an anchoring particle such as a bead, so as to localize the antibody to a position such as a location on a surface, or a well of a well array. Often the other antibody, or the two antibodies in combination, facilitate activation of a detection moiety upon co-binding to the analyte.

[0082] Activation of a detection moiety comprises, for example, circularization of a linear nucleic acid or a plurality of linear nucleic acids, through hybridization of distinct nucleic acid oligo tags of the first antibody and the second antibody. The circularization is often effected by contacting the sample to a ligase, though other approaches of circularization are also consistent with the disclosure herein. Activation further comprises priming of rolling circle amplification templated by the circular nucleic acid and catalyzed by, for example, a strand displacing DNA polymerase provided with dNTPs and an appropriate extension buffer, such as one comprising magnesium ions. Alternatives comprising, for example, transcription of the circular DNA template to form a concatemeric RNA molecule are also contemplated herein,

[0083] A broad range of circularization approaches are consistent with the disclosure herein, such as those depicted in Fig.s 3-8. Circularization often comprises localizing linear nucleic acid 5’ and 3’ ends through their adjacent hybridization to a segment of an antibody tag oligo.

[0084] Rolling circle amplification is primed by a 3’ end of an oligo tag, either of an original molecule or subsequent to endonuclease cleavage of an oligo tag, so as to prime extension of a rolling circle amplicon, or amplified linear detection molecule, that shares a common phosphodiester backbone with an antibody oligo tag, such as the antibody oligo tag of the bead-tethered antibody. Alternately, in some cases the circular nucleic acid is released and bound to a primer tethered to a bead, so as to drive rolling circle amplicon, or amplified lineardetection molecule generation, tethered to the bead, which is localized to a position on a surface or a well within an array.

[0085] Alternate detection moieties and detection moiety activation approaches are consistent with the disclosure herein, and some methods are not limited by specific examples provided herein.

[0086] Detection is effected through probing using a labeled probe such as a fluorescent probe. The probe is often selected to match a segment of the circular nucleic acid molecule that correlates to an analyte, identifies the analyte to the exclusion of one or more than one other analytes, or specifically or uniquely identifies an analyte in a particular sample or run, or compared to all other analytes.

[0087] Alternate detection approaches are also contemplated herein, particularly for single analyte detection or quantification. For example, some approaches comprise contacting an amplified linear detection molecule to a nonspecific nucleic acid binding moiety such as single stranded DNA binding proteins, which may be labeled using a fluorophore or a fluorescent protein. Alternately, an amplified linear detection molecule may be bound by unlabeled probe and assayed using a double stranded nucleic acid detection moiety such as SyBR Green or Ethidium bromide or other nonspecific double stranded nucleic acid binding signal molecule.

[0088] Detection may be effected in a single cycle or through multiple cycles comprising contacting amplified linear detection molecules using differentially labeled probes across multiple rounds of detection, punctuated by photobleaching or probe removal such as by denaturing. Such an approach allows one to change the fluorophore that binds to a particular probe and thus to the amplified linear detection molecule of a particular analyte, so as to allow one to dictate or specify a temporal order of signals for a particular analyte or diverse plurality of distinct analytes concurrently analyzed.

[0089] Fluorophore tagged amplified linear detection molecules are retained in, for example, wells of a well microarray, often localized via tethering to a particle such as a hydrogel bead. The microarray or other surface is exposed to excitation energy, and fluorophore emission energy is captured and assigned to the position of the well or surface. If the emissi on energy is above a threshold, the well or other position is scored as positive for the detection probe.

[0090] The signal may directly indicate presence of the amplified linear detection molecule and a specific analyte, or may be scored as part of a code, such as a code that collectively indicates a particular amplified linear detection molecule or analyte.

[0091] If the signal is part of a code, the surface may be exposed to photobleaching energy, or may be chemically treated to deactivate the fluorophores or other signal generating moiety. Alternately, the detection probe or probes may be removed via denaturation and washing, such as via heating or buffer concentration driven denaturation or probe stripping. The surface or well array is then optionally washed and subjected to additional iterations of probing, detection and signal removal so as to assay code patterns for one or more of the positions on the surface or well array. Importantly, the probe populations having common nucleotide sequences used across various probing cycles may vary as to affixed fluorophore or other label, such that the pattern of emission for various cycles of probing of a particular amplified linear detection molecule may be determined by the pattern of fluorophores attached to the reverse complementary probe of the amplified linear detection molecule over various cycles of detection.

[0092] Independent of whether the signal is directly indicative of presence of an analyte or is scored as part of an analyte code that may be used in combination with other analyte codes to detect a plurality of analytes, one may use the outcome of the analysis to determine presence of an analyte or concentration of that analyte or those analytes as a function of the sampl e amount. The number of wells corresponding to an analyte signal may, for example, correlate to or indicate the number or concentration of the analy te in the sample. In some cases the signal count is assessed relative to the total sample, or in some cases the abundance of signal of a second analyte. The predicted concentration is in some cases assessed with a higher degree of confidence when the number of wells corresponding to the signal is less than that of a fraction of the total wells, such that an array that is saturated or near to being saturated with signal may indicate a lower threshold of analyte abundance rather than actual analyte levels in a sample. Accordingly, samples are in some cases diluted or selected to be in portions or amounts to have an analyte or analytes at concentrations that are below or well below current stringency levels.

[0093] That is, methods herein facilitate or are consistent with an analyte being independently bound by two distinct binding moieties, and an amplified linear detection molecule being deposited at a distinct location so as to facilitate signal detection and multiplexing with a high level of sensitivity. Many analytes may be detected or quantified concurrently in a single partition array such as a well array. Furthermore, the high level of stringency and low level of background or diffused detection signal facilitates a high degree of sensitivity, such that an analyte present at a level from 0.2 fg, 2 fg, 200 fg, 2pg, and 200 pg, may be detected.Systems

[0094] The compositions and methods herein are consistent with systems for analyte detection. Systems variously comprise a flow cell, surface or well array, alone or in combination with thermal regulation, an optics system comprising excitation energy generation and emission collection or imaging, a data analysis module or data transmission module or both data analysis and data transmission module, and a microfluidics platform comprising one or more reservoirs and pressure modulators for delivery' of reagents to a flow cell such as a flow cell comprising a microwell array.

[0095] Various well array densities or surface position are consistent with the disclosure herein. Some well arrays comprise at least or no more than 1,000, 2,000, 5,000, 10,000, 20,000, 50,000, 100,000, 200,000, 500,000, 1,000,000, 2,000,000, 5,000,000, 10,000,000, 20,000,000, 50,000,000, 100,000,000, 200,000,000, 500,000,000 or more wells or surface positions. Some well configurations or densities are limited by target analyte size, target anchoring bead size, or imaging system resolution. Often, array densities or sample densities or amounts are selected such that well occupancy is not saturated by sample analytes or by bead-bound amplified linear detection molecules, such that the number of wells harboring amplified linear detection molecules is substantially less than the total number of wells, such as in some case no more than 90%, 75%, 50%, 40%, 33%, 30%, 25%, 20%, 15% 10% or less than 10% of the wells or surface positions. Similarly, some methods practiced on systems herein comprise selecting a sample amount such that no more than 90%, 75%, 50%, 40%, 33%, 30%, 25%, 20%, 15% 10% or less than 10% of the wells or surface positions are occupied. In some cases where iterative rounds of sample detection are performed, the amount of sample used in a second iteration of sample detection is adjusted relative to that of a first iteration such that a more desired occupancy density or occupancy rate is achieved, such as an occupancy density or occupancy rate mentioned above.

[0096] A number of optics systems are consistent with the disclosure herein. Atypical optics system comprises a fluorescence microscope type system, comprising an excitation source generating one or more excitation wavelengths, such as 2, 3, 4, or more than 4 wavelengths of excitation energy. Various embodiments employ, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 excitation wavelengths. Often, the number of excitation wavelengths corresponds to the number of fluorophore types used in probe labeling of harboring amplified linear detection molecules.

[0097] Excitation energy is generated through any of a broad range of approaches, such as light emitting diodes. Exemplary wavelengths of excitation energy include 488 nm, 532 nm,645 nm, although a broad range of excitation wavelengths are consistent with the disclosure herein. Wavelengths are often selected such that, in combination with fluorophore emission wavelengths, distinct or nonoverlapping emission signals are generated for various fluorophores, as may facilitate distinct signal recognition.

[0098] Emission energy images are captured through an objective that may magnify images lOx or 20x, or an amount such as 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, lOx, llx, 12x, 13x, 14x, 15x, 16x, 17x, 18x, 19x, 20x, 25x, 50x or more.

[0099] Images are collected and either scored directly or held to be analyzed in the context of one or more prior, subsequent, or prior and subsequent images, as may be collected pursuant to multiplex sample signal code deconvolution or pattern detection. In some cases, signal code detection is facilitated through the use of one, two, three or more than three fiducial or orienting wells or markers, such that multiple images may be readily aligned so as to score image signal for a given well or position over a plurality of images such as repeats of a single run or distinct iterative steps in a multi step detection process that may comprise probing an amplified linear detection molecule using a first fluorophore labeled probe at a first step and probing the amplified linear detection molecule using a second fluorophore labeled probe at a second step, and then using the pattern of fluorophore signals from a well or position over a plurality of steps comprising a first step and a second step to identify the amplified linear detection molecule at that position.

[0100] Captured images are scored at a particular position on a presence absence scale for a particular signal, and may in some cases be scored for multiple signals in a single round. Scoring is often automated and data for particular well or position status is in some cases saved immediately after image capture, such that images are not stored between rounds or cycles of image capture. Alternately, some approaches comprise image capture and image retention across multiple cycles, such that images may be aligned or otherwise scored subsequent to a collection run.

[0101] Systems are in some cases configured to accommodate a plurality of probing and detection cycles. Iterative cycles are accommodated through, for example, a fluidics system having reservoir capacities sufficient to store reagent volumes necessary' for multiple cycles of cycle steps such as probe binding, one or more washing steps, imaging, probe inactivation via cleavage, denaturing, photobleaching or other approach, and in some cases additional washes. Various iterations comprise, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 cycles. Some systems are accordingly configured to hold or accommodate reagents and wash buffers sufficient for 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 cycles.

[0102] Reservoirs are configured to store, separately or in combination, one or more of antibodies or other analyte binding moieties conjugated to beads or unconjugated, washing buffers, ligase enzymes and ligase buffer and activity supporting reagents, rolling circle amplification reagent such as a polymerase, such as a polymerase having strand displacement activity, buffer having sufficient ionic conditions for activity, dNTP or NTP raw materials for extension to form a DNA or RNA rolling circle amplification product, hybridization buffer, labeled probes for one or more cycles of detection, some probes differing across cycles in their fluorophore despite having common or identical nucleic acid sequence, probe removal or stripping buffer or additional reagents.

[0103] To facilitate one or mor cycles of analyte probing and signal detection, some systems have or are contacted to a heat block or other system for controlling temperature at the well array, surface and in some cases elsewhere in the system, such as channels flowing to the well array or other surface, or reservoirs themselves. Heat blocks are often fairly simple, as the methods herein do not require thermocycling pursuant to target probe binding site amplification, for example via rolling circle amplification. Heat blocks or other temperature regulators may regulate the system as a whole or only particular location such as the well array or surface. Some temperature regulators direct different heat levels to different system components, such as reservoirs and well arrays.

[0104] A system may be configured to accept and to interface with a flow cell, such as a flow cell that is disposable after a single run or sample analysis. Flow cells are in some cases barcoded or otherwise identifiable, such as by a scanning or other flow cell identification moiety. Flow cells often harbor the well array or surface for analyte detection, and are configured to be accessible to LED or other excitation energy and to allow emission energy to be detected by image capture functionality. Flow cells may have inlets and outlets that from light seals with flow channels or reagent delivery' courses so as to facilitate low leak or leak free delivery of reagents, buffers and washes to the flow' cell reaction site, such as the well array or surface.

[0105] A system may also comprise a communication module so as to facilitate image or image assessment transmission to a remote source.

[0106] As used herein, the term “about” in the context of a number refers to a range spanning 10% below that number to 10% above that number, or in some cases one unit below that number to one unit above that number, while in the context of a range, the term about refers to an expanded range spanning from 10% below the stated lower limit to 10% above the stated upper limit.

[0107] As used herein, the phrase one or more of A, B, and C refers to a set that may include A, A and B, A and C, B and C, or A, B, and C, and may or may not further comprise additional elements.

[0108] The disclosure is further understood in light of the following partial list of embodiments of the disclosure. Various embodiments consistent with the disclosure herein include the following, which may be understood independently or in combination with one another.

[0109] A method of assaying for an analyte in a sample, comprising contacting the sample to a nucleic acid tagged antibody that binds the analyte, contacting the sample to a nucleic acid composition comprising a 5’ end and a 3’ end, contacting the sample to a ligase to ligate the 5’ end and the 3’ end in a ligation reaction guided by the nucleic acid tagged antibody to form a circular molecule comprising a ligated 5’ 3’ junction, contacting the sample to a polymerase to drive synthesis of a detection product comprising a single stranded concatemer comprising multiple copies of the reverse complement of the ligated 5’ 3’ junction, and probing the detection product. The method of any embodiment herein, wherein the contacting occurs in a partition. The method of any embodiment herein, wherein the partition is a well of a microwell array. The method of any embodiment herein, wherein the nucleic acid tagged antibody is bound by a secondary antibody. The method of any embodiment herein, wherein the secondary antibody is tethered to a bead. The method of any embodiment herein, wherein the secondary antibody is tethered to the bead by a biotin streptavidin interaction. The method of any embodiment herein, wherein the bead is localized to a partition. The method of any embodiment herein, wherein the partition is a well of a microarray. The method of any embodiment herein, wherein density of the analyte in the sample corresponds to density of wells harboring signal in the microarray. The method of any embodiment herein, wherein density of the analyte in the sample corresponds to density of partitions harboring signal relative to a total number of partitions. The method of any embodiment herein, comprising contacting the sample to a second nucleic acid tagged antibody, wherein the nucleic acid tagged antibody and the second nucleic acid tagged antibody comprise segments that anneal to the nucleic acid composition 5’ end and 3’ end. The method of any embodiment herein, wherein the nucleic acid tagged antibody and the second nucleic acid tagged antibody are ligated at their nucleic acid tag ends in the ligation reaction. The method of any embodiment herein, wherein the ligation reaction guided by the nucleic acid tagged antibody to form a ligated 5’ 3’ junction generates a circular nucleic acid molecule from the nucleic acid composition. The method of any embodiment herein, comprising removing the circularnucleic acid molecule from the nucleic acid tagged antibody and contacting the circular nucleic acid molecule to a bead tethered to a primer that anneals to the circular nucleic acid molecule. The method of any embodiment herein, comprising cleaving a nucleic acid bond of the second nucleic acid tagged antibody nucleic acid, so as to expose a second nucleic acid tagged antibody nucleic acid 3’ end to prime reverse complement strand synthesis templated by the circular nucleic acid molecule. The method of any embodiment herein, wherein the second nucleic acid tagged antibody nucleic acid 3’ end is tethered to the nucleic acid tagged antibody through the ligation of the nucleic acid tag ends of the nucleic acid tagged antibody and the second nucleic acid tagged antibody. The method of any embodiment herein, wherein the second nucleic acid tagged antibody nucleic acid 3’ end is tethered to the analyte via the antibody, such that second nucleic acid tagged antibody nucleic acid 3’ end priming of the circul ar nucleic acid molecule generates a concatemer compri sing multimer units of the circular nucleic acid tethered to the analyte. The method of any embodiment herein, comprising contacting the sample to a second nucleic acid tagged antibody, wherein the second nucleic acid tagged antibody comprises a segment that anneal to the nucleic acid composition 5’ end and 3’ end, and the nucleic acid tagged antibody comprises a nucleic acid tagged antibody 3’ end that anneals to the nucleic acid composition distal to the nucleic acid composition 5’ end and 3’ end. The method of any embodiment herein, wherein the nucleic acid comprises a first segment and a second segment, such that the nucleic acid composition 5’ end and 3’ end anneal to a segment of the second nucleic acid tagged antibody, and the nucleic acid composition further comprises a second 5’ end and a second 3’ end, wherein the nucleic acid composition second 5’ end and second 3’ end anneal to a segment of the nucleic acid tagged antibody. The method of any embodiment herein, wherein the contacting the sample to a ligase results in ligating the nucleic acid 5’ end and 3’ end together, and ligating the nucleic acid composition second 5’ end and second 3’ end together, thereby circularizing the first segment and the second segment in a single circular nucleic acid of the nucleic acid composition. The method of any embodiment herein, wherein ligating the nucleic acid composition 5’ end and 3’ end forms a circular nucleic acid molecule. The method of any embodiment herein, wherein contacting the sample to a polymerase leads to extension of the nucleic acid tagged antibody 3’ end, so as to displace the circular nucleic acid from the second nucleic acid tagged antibody. The method of any embodiment herein, wherein the nucleic acid tagged antibody nucleic acid 3’ end is tethered to the analyte via the antibody, such that nucleic acid tagged antibody nucleic acid 3’ end priming of the circular nucleic acid molecule generates a concatemer comprising multimer units of the circular nucleic acidtethered to the analyte. The method of any embodiment herein, comprising contacting the sample to a second antibody that binds the analyte. The method of any embodiment herein, wherein the second antibody is tethered to a bead. The method of any embodiment herein, wherein the second antibody is bound by a secondary antibody. The method of any embodiment herein, wherein the secondary antibody is tethered to a bead. The method of any embodiment herein, wherein the secondary antibody is tethered to a biotin tag. The method of any embodiment herein, wherein the biotin tag is bound by a bead tethered streptavidin binding partner. The method of any embodiment herein, wherein the ligation reaction guided by the nucleic acid tagged antibody to form a ligated 5’ 3’ junction generates a circular nucleic acid molecule from the nucleic acid composition. The method of any embodiment herein, wherein the synthesis of a detection product comprising a single stranded concatemer comprising multiple copies of the reverse complement of the ligated 5’ 3’ junction comprises rolling circle amplification of the circular nucleic acid molecule. The method of any embodiment herein, wherein probing the detection product comprises contacting the detection product to a labeled probe population having sequence identical to a segment of the nucleic acid of the nucleic acid tagged antibody. The method of any embodiment herein, wherein probing the detection product comprises contacting the detection product to a labeled probe population having sequence reverse complementary to a segment of the nucleic acid composition. The method of any embodiment herein, wherein probing the detection product detects the analyte in the sample at a concentration of as low as 100 fg / mL such as 90 fg / mL, 80 fg / mL, 70 fg / mL, 60 fg / mL, 50 fg / mL, 40 fg / mL, 30 fg / mL, 20 fg / mL, 15 fg / mL, 10 fg / mL, 5 fg / mL, 4 fg / mL, 3 fg / mL, 2 fg / mL, 1 fg / mL, or a number spanned by or adjacent to this range. The method of any embodiment herein, wherein probing the detection product detects the analyte in the sample at a concentration of as low as 5 fg / mL. The method of any embodiment herein, wherein contacting the sample to a polymerase does not comprise thermocycling.

[0110] A composition comprising a target, a binding moiety bound to the target, a linear nucleic acid strand tethered to the binding moiety, and a circular nucleic acid hybridized to the linear nucleic acid strand. The composition of any embodiment herein, wherein the target is a protein. The composition of any embodiment herein, wherein the target is a carbohydrate. The composition of any embodiment herein, wherein the target is a lipid. The composition of any embodiment herein, wherein the binding moiety comprises an antibody binding region. The composition of any embodiment herein, wherein the binding moiety comprises an antibody variable domain. The composition of any embodiment herein, wherein the bindingmoiety comprises an antibody Fab. The composition of any embodiment herein, wherein the binding moiety comprises an antibody. The composition of any embodiment herein, wherein the linear nucleic acid strand is covalently tethered to the binding moiety. The composition of any embodiment herein, wherein the linear nucleic acid strand comprises a plurality of reverse complementary repeats of monomeric units of the circular nucleic acid. The composition of any embodiment herein, wherein at least one monomeric unit of the reverse complementary repeats of the circular nucleic acid is bound by a labeled probe. The composition of any embodiment herein, wherein at least 50% of the monomeric units of the reverse complementary repeats of the circular nucleic acid are bound by at least one labeled probe per monomeric unit. The composition of any embodiment herein, wherein the linear nucleic acid strand comprises a single segment that is reverse complementary' to a segment of the circular nucleic acid comprising no more than 30% of the circular nucleic acid. The composition of any embodiment herein, wherein the linear nucleic acid strand comprises a single segment that is reverse complementary to a segment of the circular nucleic acid comprising no more than 10% of the circular nucleic acid. The composition of any embodiment herein, wherein the linear nucleic acid strand comprises a segment indicative of the epitope. The composition of any embodiment herein, wherein the circular nucleic acid is hybridized to the linear nucleic acid strand such that no more than 30% of its bases are paired to bases of the linear nucleic acid strand. The composition of any embodiment herein, wherein the circular nucleic acid is hybridized to the linear nucleic acid strand such that no more than 10% of its bases are paired to bases of the linear nucleic acid strand. The composition of any embodiment herein, wherein the circular nucleic acid is hybridized to the linear nucleic acid strand such that at least 80% of its bases are paired to bases of the linear nucleic acid strand. The composition of any embodiment herein, wherein the circular nucleic acid comprises a segment indi cati ve of the epitope. The compositi on of any embodiment herein, comprising a capture bead. The composition of any embodiment herein, wherein the composition is contained in a partition. The composition of any embodiment herein, wherein the partition is a well in a well array. The composition of any embodiment herein, wherein the partition is a droplet of an emulsion.

[0111] A system comprising an array of wells, at least one of said wells harboring a nucleic acid molecule comprising a concatemer of monomeric repeats and a 5’ nonrepetitive segment, and a non-nucleic acid anchor tethered to the 5’ end of the 5’ nonrepetitive segment, wherein a labeled probe is annealed to at least one monomeric repeat of the concatemer of monomeric repeats. The system of any embodiment herein, wherein the non-nucleic acidanchor comprises an oligo labeled bead. The system of any embodiment herein, wherein the non-nucleic acid anchor comprises a binding moiety. The system of any embodiment herein, wherein the binding moiety comprises an antibody binding domain. The system of any embodiment herein, wherein the binding moiety comprises an antibody. The system of any embodiment herein, wherein the antibody is bound to an epitope of a target analyte. The system of any embodiment herein, wherein the antibody is bound by a secondary antibody. The system of any embodiment herein, wherein the secondary antibody is tethered to a bead. The system of any embodiment herein, wherein the secondary antibody is tethered to a biotin tag. The system of any embodiment herein, wherein the biotin tag is bound by a bead tethered streptavidin binding partner. The system of any embodiment herein, wherein the target is bound by an independent antibody. The system of any embodiment herein, wherein the independent antibody is bound by a secondary antibody. The system of any embodiment herein, wherein the secondary antibody is tethered to a bead. The system of any embodiment herein, wherein the secondary antibody is tethered to a biotin tag. The system of any embodiment herein, wherein the biotin tag is bound by a bead tethered streptavidin binding partner. The system of any embodiment herein, wherein the antibody is tethered to a bead. The system of any embodiment herein, wherein the non-nucleic acid anchor comprises biotin. The system of any embodiment herein, wherein the biotin is bound to a detection bead comprising a streptavidin. The system of any embodiment herein, wherein the detection bead comprises a plurality of strepatvidins. The system of any embodiment herein, wherein labeled probe occupancy of the array of wells reflects abundance of a target analyte in a sample assayed to form the nucleic acid molecule. The system of any embodiment herein, wherein the abundance is no more than 100 fg / mL, such as 90 fg / mL, 80 fg / mL, 70 fg / mL, 60 fg / mL, 50 fg / mL, 40 fg / mL, 30 fg / mL, 20 fg / mL, 15 fg / mL, 10 fg / mL or less than 10 fg / mL, or a number spanned by or adjacent to this range. The system of any embodiment herein, wherein the abundance is no more than 10 fg / mL, such as 10 fg / mL, 9 fg / mL, 8 fg / mL, 7 fg / mL, 6 fg / mL, 5 fg / mL, 4 fg / mL, 3 fg / mL, 2 fg / mL, 1 fg / mL, or less than 1, or a number spanned by or adj cent to this range. The system of any embodiment herein, wherein the system does not comprise a thermocycler. The system of any embodiment herein, wherein the system comprises an optical detection moiety that detects emission light of at least two wavelengths.

[0112] Turning to the Figures, one sees the following.

[0113] At Fig. 1, one sees data indicative of the threshold of detection using systems herein.

[0114] As a control, Abetal-42 epitope was detected using a rolling circle / probe assay. Epitopes were bound by a nucleic acid tagged antibody and contacted to a nucleic acidcomposition comprising a linear probe having 5’ and 3’ ends capable of annealing to the nucleic acid tag so as to hold the linear probe 5’ and 3’ ends in proximity. The ends were ligated to circularize the linear probe, which was then removed from the nucleic acid tag an annealed to a bead-localized primer. The primer / circular template complex was used to drive synthesis of a linear concatemer of the circularized probe via rolling circle amplification, that could then be probed using fluorophore labeled probes that anneal to the multimeric repetitive regions of the linear concatemer. The bead-tethered concatemeric product was assayed first via flow cytometry and then a second run of the assay was deposited on an array.

[0115] At Fig. 1, top, one sees results of the flow cytometry assay at various concentrations of Abetal-42 epitope ranging from 0.2 fg at left, 2 fg, 200 fg, 2pg, and 200 pg, right. For each result, the y axis represents signal count on a scale ranging from 0 to about 400, in intervals of 80, 80, 100, 80 and 60, from left to right respectively. The x- axis represents APH-C counts ranging on a logarithmic scale, with -10A3, 0, 10A3, 10A4 and 10A5 marked on the axis.

[0116] For each panel, the results present detection events for a no-epitope control, left, and for Abetal-42 epitope at the concentrations indicated above. One sees that even at concentrations as low as 0.2fg, one readily detects Abetal-42 epitope using the rolling circle approach herein.

[0117] At Fig. 2, one sees the results of detection of probe labeled, bead tethered concatemer amplicons deposited into wells of an array. One sees that by quantifying the number of wells correlating to strong signal, one may both detect and quantify the concentration of the target epitope such as Abetal-42 epitope.

[0118] At Fig. 3, one sees a workflow consistent with the disclosure herein. At top left, panel 1, one sees a complex comprising a nucleic acid tagged antibody, labeled 1stantibody herein, bound at its conserved domain by a secondary' antibody, labeled 2ndantibody herein, that is biotin tagged and tethered to a bead by a streptavidin moiety. The bead is localized in a well of an array. At panel 2, the nucleic acid tagged antibody binds an Abeta 42 molecule that is concurrently bound to a second nucleic acid tagged antibody, labeled detective antibody B The DNA oligos of the nucleic acid tagged antibody and the second nucleic acid tagged antibody are not reverse complementary and do not bind to one another. At panel 3, a nucleic acid composition comprising a linear nucleic acid is added to the antibody target complex. The linear nucleic acid anneals to the ends of the nucleic acid tagged antibody and the second nucleic acid tagged antibody oligo tags such that the linear nucleic acid 5’ and 3’ ends are inclose proximity for ligation by a ligase added to the composition. At panel 4, one sees that the ligase has joined the linear nucleic acid 5’ and 3’ ends, such that a circular nucleic acid is formed. The antibody oligo tags are also ligated to one another. At panel 5, the circular nucleic acid is removed from the ends of the nucleic acid tags of the nucleic acid tagged antibody and the second nucleic acid tagged antibody. At panel 6, the circular nucleic acid is annealed to a primer-tagged bead and a polymerase, and reagents necessary for primer extension under extension conditions. At panel 7, one sees the product of the rolling circle amplification begun at 6. The product is a concatemer of multiple copies of the linear probe, bounded at its 5’ end by the original bead bound primer. At panel 8, the RCA extension product is contacted to a fluorescent probe that anneals to a site within the linear probe, repeated multiple times in the concatemer.

[0119] At Fig. 4 one sees an alternate workflow consistent with the disclosure herein. Panels 1-4 are as described in the context of Fig. 3, above. At panel 5, rather than melting the circular nucleic acid off of the ligated antibody oligo tags, one of the antibody oligo tags is cleaved distal of the ligation junction but at a region that remains annealed to the circular nucleic acid. This exposed 3’ end serves as a primer for rolling circle amplification of the circular nucleic acid. At panel 6, one sees an extended concatemer being generated through rolling circle amplification of the circular nucleic acid. At panel 7, one sees the product of the rolling circle amplification underway at 6. The product is a concatemer of multiple copies of the linear probe, bounded at its 5’ end by a portion of the oligo of the second oligo bound antibody and by the oligo of the nucleic acid bound antibody. The RCA extension product is contacted to a fluorescent probe that anneals to a site within the linear probe, repeated multiple times in the concatemer.

[0120] At Fig. 5 one sees an alternate workflow consistent with the disclosure herein. At panel 1, one sees a nucleic acid tagged antibody ‘ 1stAntibody A’. The nucleic acid tagged antibody is bound at its conserved domain by a secondary antibody, labeled ‘2ndantibody’ herein, that is biotin tagged and tethered to a bead by a streptavidin moiety. The bead is localized in a well of an array. The nucleic acid of the nucleic acid tagged antibody is bound by a linear nucleic acid of the nucleic acid composition contacted to the antibody. The linear nucleic acid binds the nucleic acid of the nucleic acid tagged antibody at a location removed from the linear nucleic acid 5’ end or 3’ end, such that the linear nucleic acid ends are not held in proximity to one anotherAt panel 2, the complex of panel 1 is contacted to a second nucleic acid tagged antibody ‘detective antibody B’ and to a target analyte, Ab eta 42. The nucleic acid tag of the second nucleic acid tagged antibody anneals to the 5’ end and the 3’end of the linear nucleic acid, holding them in local proximity. At panel 3, the complex is contacted to a ligase that circularizes the linear nucleic acid by ligating its 5’ and 3’ ends, as shown in panel 4. At panel 5, the complex is contacted to a polymerase and extension reagents under extension conditions, such that the nucleic acid tag of the second nucleic acid tagged antibody 3’ end primes rolling circle amplification of the circularized nucleic acid, displacing the nucleic acid of the nucleic acid tagged antibody. At panel 6, one sees a product of this extension reaction, a concatemer of multiple copies of the linear probe, bounded at its 5’ end by a portion of the oligo of the second oligo bound antibody to the second antibody. At panel 7, one sees the product of the rolling circle amplification underway at 6. The product is a concatemer of multiple copies of the linear probe, bounded at its 5’ end by a portion of the oligo of the second oligo bound antibody and by the oligo of the nucleic acid bound antibody. The RCA extension product is contacted to a fluorescent probe that anneals to a site within the linear probe, repeated multiple times in the concatemer.

[0121] At Fig. 6, one sees an alternate workflow consistent with the disclosure herein. At panel 1, one sees a complex comprising a nucleic acid tagged antibody, labeled 1stantibody herein, bound at its conserved domain by a secondary antibody, labeled 2ndantibody herein, that is biotin tagged and tethered to a bead by a streptavidin moiety. The bead is localized in a well of an array. The bead is localized in a well of an array. At panel 2, the nucleic acid tagged antibody binds an Abeta 42 molecule that is concurrently bound to a second nucleic acid tagged antibody, labeled detective antibody B. The DNA oligos of the nucleic acid tagged antibody and the second nucleic acid tagged antibody are not reverse complementary and do not bind to one another. At panel 3, one sees the complex is contacted to a nucleic acid composition comprising a first segment and a second segment, such that the nucleic acid composition 5’ end and 3’ end anneal to a segment of the second nucleic acid tagged antibody, and the nucleic acid composition further comprises a second 5’ end and a second 3’ end, wherein the nucleic acid composition second 5’ end and second 3’ end anneal to a segment of the nucleic acid tagged antibody. The respective 5’ and 3’ end pairs are held in proximity, such that upon addition of a ligase the first segment and second segment are ligated to form a circular nucleic acid, as shown in panel 4. At panel 5, the complex is contacted to a polymerase and extension reagents under extension conditions, such that the nucleic acid tag of the nucleic acid tagged antibody 3’ end primes rolling circle amplification of the circularized nucleic acid, displacing the nucleic acid of the second nucleic acid tagged antibody. At panel 6, one sees a product of this extension reaction, a concatemer of multiple copies of the linear probe, bounded at its 5’ end by a portion of the oligo of the oligo boundantibody to the antibody. At panel 7, one sees the product of the rolling circle amplification underway at 6. The product is a concatemer of multiple copies of the linear probe, bounded at its 5’ end by a portion of the oligo of the oligo bound antibody. The RCA extension product is contacted to a fluorescent probe that anneals to a site within the linear probe, repeated multiple times in the concatemer.

[0122] At Fig. 7, one sees an alternate workflow consistent with the disclosure herein. At panel 1, one sees a complex residing in a well comprising a bead tethered to an antibody fragment antigen binding region via a biotin streptavidin complex. At panel 2, one sees, in succession, addition of an analyte binding antibody that is bound by the Fab, addition of a target analyte, and addition of a nucleic acid tagged target antibody that binds the target analyte. At panel 3, one sees the addition of a nucleic acid composition comprising a linear nucleic acid ‘padlock’. The linear nucleic acid anneals to the nucleic acid tagged antibody such that the linear nucleic acid 5’ and 3’ ends are in close proximity for ligation by a ligase added to the composition. At panel 4, one sees that the ligase has circularized the linear nucleic acid, and the 3’ end of the nucleic acid tagged target antibody nucleic acid is annealed to the circular nucleic acid in a configuration so as to prime nucleic acid synthesis in an extension reaction upon addition of a polymerase and extension reagents under extension conditions. At panel 5, one sees a product of this extension reaction, a concatemer of multiple copies of the linear probe, bounded at its 5’ end by a portion of the oligo of the oligo bound antibody to the antibody. At panel 6, one sees the product of the rolling circle amplification underway at 6. The product is a concatemer of multiple copies of the linear probe, bounded at its 5’ end by a portion of the oligo of the oligo bound antibody. The RCA extension product is contacted to a fluorescent probe that anneals to a site within the linear probe, repeated multiple times in the concatemer.

[0123] At Fig. 8, one sees an alternate workflow consistent with the disclosure herein. At panel 1, one sees a complex residing in a well comprising a bead tethered to an antibody fragment antigen binding region via a biotin streptavidin complex. At panel 2, one sees, in succession, addition of an analyte binding antibody that is bound by the Fab, addition of a target analyte, and addition of a nucleic acid tagged target antibody that binds the target analyte. At panel 3, one sees the addition of a nucleic acid composition comprising a linear nucleic acid ‘padlock’. The linear nucleic acid anneals to the nucleic acid tagged antibody such that the linear nucleic acid 5’ and 3’ ends are in close proximity for ligation by a ligase added to the composition. At panel 4, one sees that the ligase has circularized the linear nucleic acid, and the 3’ end of the nucleic acid tagged target antibody nucleic acid is annealedto the circular nucleic acid in a configuration so as to prime nucleic acid synthesis in an extension reaction upon addition of a polymerase and extension reagents under extension conditions. At panel 5, one sees removal of a circular template and annealing to a biotin coated bead-bound primer. At panel 6 one sees rolling circle amplification. At panel 7, one sees binding of the biotin bead to a streptavidin coated bead, along with other copies of the rolling circle amplification product. At panel 8 one sees probing with a fluorophore labeled probe.. The RCA extension product is contacted to a fluorescent probe that anneals to a site within the linear probe, repeated multiple times in the concatemer, and repeated multiple times for the multiple concatemers bound to the streptavidin coated bead.

[0124] A common feature of many of these figures is that, for an analyte to be detected in a well, it must be redundantly bound by two separate antibodies. Furthermore, amplification of the nucleic acid to be targeted by a labeled probe does not comprise generation of a diffusible product that may leave the well or become untethered from the analyte, thereby reducing background signal. Both of these features, individually and in combination, serve to increase stringency of detection methods and systems disclosed herein.

[0125] At Fig. 9, one sees a linear nucleic acid that serves as a circular template precursor. In this example the detection oligo site is removed from the downstream probe and upstream probe sites, which are brought in proximity to facilitate circul arization by one or both of the antibody nucleic acid tags. The detection oligo sequence is identical to the sequence of probes used to assay for amplification of the circular product of ligation. The zipper region is used to facilitate formation of a rolling circle amplification product in a configuration conducive to detection.EXAMPLESExample 1. Amyloid detection protocol.

[0126] Streptavidin coated beads are treated with PEG (5k-50k) and salmon sperm DNA, loaded onto a well array chip and washed twice with phosphate buffered saline - Tween (PBST). The beads and well array are blocked at 37C for 30-60 minutes in a blocking solution of 10% donkey serum, 0,lmg / mL salmon DNA, 5mM EDTA, 0,1% Tween in PBS.

[0127] Concurrently, test samples are prepared Biotin-mAnti-Amyloidl-16 antibody at 1 OOng per reaction is incubated in 2% donkey serum with test samples at 37C for 1 hour. Negative and positive controls are included.

[0128] The antibody-antigen mixture is added to the well array, incubated at room temperature for 30 minutes and washed twice with PBST.

[0129] The well array, antibody and sample are blocked in blocking solution at 37C for 30 minutes.

[0130] Concurrently, rabbit anti-human Amyloidl-42 detection antibodies VI and V3 are prepared at 50ng-100ng each, along with linear nucleic acid at 25-50 nM. The sample is incubated at 37C for 30 minutes with the antibodies and linear nucleic acid in ligation solution comprising PBST (0.01% tween), 1% BSA, 25mM L-Cysteine, 250mM NaCl, T4 ligase at 0.02U / uL, VI (5.2uM, 50-100ng), and padlock (2uM, 25-50 nM).

[0131] Circularized padlock is added to the well array and incubated for 1 hour at 37C.

[0132] Beads are washed twice at 37C for 10 minutes each in elution buffer (Tris HC1 pH 8.0 20mM, EDTA ImM, KC1 0.1M, second wash also including PBST).

[0133] RCA is initiated by adding a polymerase solution comprising albumin, 250uM dNTPs, 0.5U / uL phi29 polymerase in lx polymerase buffer (New England Biolabs) and incubating for 1.5 hours at 37C.

[0134] A single cycle of signal detection is accomplished by adding a detecting solution comprising 300 ng / mL salmon DNA, 2x SSC, 20% formamide, and 100 nM of the detection oligonucleotide, and incubating with RCA product for 20 minutes at room temperature.

[0135] Chips are then washed twice with PBST and contacted to a screening mixture, and subjected to imaging and analysis.Example 2. Nucleic acid detection set.

[0136] A nucleic acid detection set is presented. The set comprises a linear nucleic acid as presented in Fig. 9.

[0137] The downstream probe segment has sequence Padlock-PLA-OA: / 5Phos / AG GCA AGA CCT AGT AAT CAG TAG CCG TGA CTA TCG ACT GGT TCA AAG AAT TCC ACT GGT AAA ATA GTA GTG GCG T.

[0138] The upstream probe segment has sequence Padlock-PLA-OB: / 5Phos / AGTTGGAGCTG AGTAATC AGTAGCCGTGACT ATCGACTGG TTCAAA GAATTCCACTGGTA AAA TA AGTCCACTGGT.

[0139] The combined region has sequence Padlock A+B. / 5Phos / GTGGCGTAGGCAAGACCTCAGCCATCCTAGTAATCAGTA GCCGTGACTATCGACTGGTTCAAAGAATTCCACTGGTAGTTGGAGCTGGTA.

[0140] The first antibody tagging nucleic acid has sequence Oligo A: 5' oYo-TTTTTTTTT CTCCTGAGGT AGGTAGTTGA GCAGC TGAGGT CTTGCCTACGCCAC TAC, and is tethered to an antibody at the nucleic acid 5’ end by a oYo linkage.

[0141] The second antibody tagging nucleic acid has sequence Oligo B: 5’p CAGCTCCAACTACCA GTGGA CTCCTGAGGT AGGTAGTTGA GCAGC TTTTTTTTT0Y0 link 3’, and is tethered to an antibody at the nucleic acid 3’ end by a oYo linkage.

[0142] Two probes share a common sequence but differ in fluorophore:5Cy5 / AGTAGCCGTGACTATCGACT, and 5Cy3 / AGTAGCCGTGACTATCGACT

[0143] Collectively, these nucleic acids form a set used to detect the analyte bound by the first and second antibodies.

[0144] Also presented is a Compact Oligo “Zipper” has sequence / 5’TCG ACT GGT TCA AAT CGA CTG GTT CmUmUmU. This oligo is general to the process rather than being specific to a set.

Claims

1. CLAIMS2.What is claimed is as follows:

1. A method of assaying for an analyte in a sample, comprising contacting the sample to a nucleic acid tagged antibody that binds the analyte, contacting the sample to a nucleic acid composition comprising a 5’ end and a 3’ end, contacting the sample to a ligase to ligate the 5’ end and the 3’ end in a ligation reaction guided by the nucleic acid tagged antibody to form a circular molecule comprising a ligated 5’ 3’ junction, contacting the sample to a polymerase to drive synthesis of a detection product comprising a single stranded concatemer comprising multiple copies of the reverse complement of the ligated 5’ 3’ junction, and probing the detection product.

2. The method of claim 1, wherein the contacting occurs in a partition.

3. The method of claim 2, wherein the partition is a well of a microwell array.

4. The method of claim 1, wherein the nucleic acid tagged antibody is bound by a secondary antibody.

5. The method of claim 4, wherein the secondary antibody is tethered to a bead.

6. The method of claim 5, wherein the secondary antibody is tethered to the bead by a biotin streptavidin interaction.

7. The method of claim 5, wherein the bead is localized to a partition.

8. The method of claim 7, wherein the partition is a well of a microarray.

9. The method of claim 8, wherein density of the analyte in the sample corresponds to density of wells harboring signal in the microarray.

10. The method of claim 7, wherein density of the analyte in the sample corresponds to density of partitions harboring signal relative to a total number of partitions.

11. The method of claim 1, comprising contacting the sample to a second nucleic acid tagged antibody, wherein the nucleic acid tagged antibody and the second nucleic acid tagged antibody comprise segments that anneal to the nucleic acid composition 5’ end and 3’ end.

12. The method of claim 11, wherein the nucleic acid tagged antibody and the second nucleic acid tagged antibody are ligated at their nucleic acid tag ends in the ligation reaction.

13. The method of claim 12, wherein the ligation reaction guided by the nucleic acid tagged antibody to form a ligated 5’ 3’ junction generates a circular nucleic acid molecule from the nucleic acid composition,14. The method of claim 13, comprising removing the circular nucleic acid molecule from the nucleic acid tagged antibody and contacting the circular nucleic acid molecule to a bead tethered to a primer that anneals to the circular nucleic acid molecule.

15. The method of claim 13, comprising cleaving a nucleic acid bond of the second nucleic acid tagged antibody nucleic acid, so as to expose a second nucleic acid tagged antibody nucleic acid 3’ end to prime reverse complement strand synthesis templated by the circular nucleic acid molecule.

16. The method of claim 15, wherein the second nucleic acid tagged antibody nucleic acid 3’ end is tethered to the nucleic acid tagged antibody through the ligation of the nucleic acid tag ends of the nucleic acid tagged antibody and the second nucleic acid tagged antibody.

17. The method of claim 16, wherein the second nucleic acid tagged antibody nucleic acid 3’ end is tethered to the analyte via the antibody, such that second nucleic acid tagged antibody nucleic acid 3’ end priming of the circular nucleic acid molecule generates a concatemer comprising multimer units of the circular nucleic acid tethered to the analyte.

18. The method of claim 1, comprising contacting the sample to a second nucleic acid tagged antibody, wherein the second nucleic acid tagged antibody comprises a segment that anneal to the nucleic acid composition 5’ end and 3’ end, and the nucleic acid tagged antibody comprises a nucleic acid tagged antibody 3’ end that anneals to the nucleic acid composition distal to the nucleic acid composition 5’ end and 3’ end.

19. The method of claim 18, wherein the nucleic acid comprises a first segment and a second segment, such that the nucleic acid composition 5’ end and 3’ end anneal to a segment of the second nucleic acid tagged antibody, and the nucleic acid composition further comprises a second 5’ end and a second 3’ end, wherein the nucleic acid composition second 5’ end and second 3’ end anneal to a segment of the nucleic acid tagged antibody.

20. The method of claim 19, wherein the contacting the sample to a ligase results in ligating the nucleic acid 5’ end and 3’ end together, and ligating the nucleic acid composition second 5’ end and second 3’ end together, thereby circularizing the first segment and the second segment in a single circular nucleic acid of the nucleic acid composition.

21. The method of claim 18, wherein ligating the nucleic acid composition 5’ end and 3’ end forms a circular nucleic acid molecule.

22. The method of claim 20 or claim 21, wherein contacting the sample to a polymerase leads to extension of the nucleic acid tagged antibody 3’ end, so as to displace the circular nucleic acid from the second nucleic acid tagged antibody.

23. The method of claim 22, wherein the nucleic acid tagged antibody nucleic acid 3’ end is tethered to the analyte via the antibody, such that nucleic acid tagged antibody nucleic acid 3’ end priming of the circular nucleic acid molecule generates a concatemer comprising multimer units of the circular nucleic acid tethered to the analyte.

24. The method of claim 1, comprising contacting the sample to a second antibody that binds the analyte.

25. The method of claim 24, wherein the second antibody is tethered to a bead.

26. The method of claim 25, wherein the second antibody is bound by a secondary' antibody.

27. The method of claim 26, wherein the secondary antibody is tethered to a bead.

28. The method of claim 27, wherein the secondary antibody is tethered to a biotin tag, 29. The method of claim 28, wherein the biotin tag is bound by a bead tethered streptavidin binding partner.

30. The method of claim 1, wherein the ligation reaction guided by the nucleic acid tagged antibody to form a ligated 5’ 3’ junction generates a circular nucleic acid molecule from the nucleic acid composition.

31. The method of claim 30, wherein the synthesis of a detection product comprising a single stranded concatemer comprising multiple copies of the reverse complement of the ligated 5’ 3’ junction comprises rolling circle amplification of the circular nucleic acid molecule.

32. The method of claim 1, wherein probing the detection product comprises contacting the detection product to a labeled probe population having sequence identical to a segment of the nucleic acid of the nucleic acid tagged antibody.

33. The method of claim 1, wherein probing the detection product comprises contacting the detection product to a labeled probe population having sequence reverse complementary to a segment of the nucleic acid composition.

34. The method of claim 1, wherein probing the detection product detects the analyte in the sample at a concentration of as low as 100 fg / mL.

35. The method of claim 1, wherein probing the detection product detects the analyte in the sample at a concentration of as low as 5 fg / mL.

36. The method of claim 1, wherein contacting the sample to a polymerase does not comprise thermocycling.

37. A composition comprising a target, a binding moiety bound to the target, a linear nucleic acid strand tethered to the binding moiety, and a circular nucleic acid hybridized to the linear nucleic acid strand.

38. The composition of claim 37, wherein the target is a protein.

39. The composition of claim 37, wherein the target is a carbohydrate.

40. The composition of claim 37, wherein the target is a lipid.

41. The composition of claim 37, wherein the binding moiety comprises an antibody binding region.

42. The composition of claim 37, wherein the binding moiety comprises an antibody variable domain.

43. The composition of claim 37, wherein the binding moiety comprises an antibody Fab.

44. The composition of claim 37, wherein the binding moiety comprises an antibody.

45. The composition of claim 37, wherein the linear nucleic acid strand is covalently tethered to the binding moiety.

46. The composition of claim 37, wherein the linear nucleic acid strand comprises a plurality of reverse complementary repeats of monomeric units of the circular nucleic acid.

47. The composition of claim 46, wherein at least one monomeric unit of the reverse complementary repeats of the circular nucleic acid is bound by a labeled probe.

48. The composition of claim 46, wherein at least 50% of the monomeric units of the reverse complementary repeats of the circular nucleic acid are bound by at least one labeled probe per monomeric unit.

49. The composition of claim 37, wherein the linear nucleic acid strand comprises a single segment that is reverse complementary to a segment of the circular nucleic acid compri sing no more than 30% of the circular nucleic acid.

50. The composition of claim 37, wherein the linear nucleic acid strand comprises a single segment that is reverse complementary to a segment of the circular nucleic acid comprising no more than 10% of the circular nucleic acid.

51. The composition of claim 37, wherein the linear nucleic acid strand comprises a segment indicative of the epitope.

52. The composition of claim 37, wherein the circular nucleic acid is hybridized to the linear nucleic acid strand such that no more than 30% of its bases are paired to bases of the linear nucleic acid strand.

53. The composition of claim 37, wherein the circular nucleic acid is hybridized to the linear nucleic acid strand such that no more than 10% of its bases are paired to bases of the linear nucleic acid strand.

54. The composition of claim 37, wherein the circular nucleic acid is hybridized to the linear nucleic acid strand such that at least 80% of its bases are paired to bases of the linear nucleic acid strand.

55. The composition of claim 37, wherein the circular nucleic acid comprises a segment indicative of the epitope.

56. The composition of claim 37, comprising a capture bead.

57. The composition of claim 37, wherein the composition is contained in a partition.

58. The composition of claim 57, wherein the partition is a well in a well array.

59. The composition of claim 57, wherein the partition is a droplet of an emulsion.

60. A system comprising an array of wells, at least one of said wells harboring a nucleic acid molecule comprising a concatemer of monomeric repeats and a 5’ nonrepetitive segment, and a non-nucleic acid anchor tethered to the 5’ end of the 5’ nonrepetitive segment, wherein a labeled probe is annealed to at least one monomeric repeat of the concatemer of monomeric repeats.

61. The system of claim 60, wherein the non-nucleic acid anchor comprises an oligo labeled bead.

62. The system of claim 60, wherein the non-nucleic acid anchor comprises a binding moiety.

63. The system of claim 62, wherein the binding moiety comprises an antibody binding domain.

64. The system of claim 62, wherein the binding moiety comprises an antibody.

65. The system of claim 64, wherein the antibody is bound to an epitope of a target analyte.

66. The system of claim 65, wherein the antibody is bound by a secondary' antibody.

67. The system of claim 65, wherein the secondary' antibody is tethered to a bead.

68. The system of claim 67, wherein the secondary antibody is tethered to a biotin tag.

69. The system of claim 68, wherein the biotin tag is bound by a bead tethered streptavidin binding partner.

70. The system of claim 65, wherein the target is bound by an independent antibody.

71. The system of claim 70, wherein the independent antibody is bound by a secondary antibody.

72. The system of claim 71, wherein the secondary antibody is tethered to a bead.

73. The system of claim 71, wherein the secondary antibody is tethered to a biotin tag.

74. The system of claim 73, wherein the biotin tag is bound by a bead tethered streptavidin binding partner.

75. The system of claim 65, wherein the antibody is tethered to a bead.

76. The system of claim 60, wherein the non-nucleic acid anchor comprises biotin.

77. The system of claim 76, wherein the biotin is bound to a detection bead comprising a streptavidin.

78. The system of claim 77, wherein the detection bead comprises a plurality of strepatvidins.

79. The system of claim 60, wherein labeled probe occupancy of the array of wells reflects abundance of a target analyte in a sample assayed to form the nucleic acid molecule.

80. The system of claim 79, wherein the abundance is no more than 100 fg / mL.

81. The system of claim 79, wherein the abundance is no more than 10 fg / mL.

82. The system of claim 60, wherein the system does not comprise a thermocycler.

83. The system of claim 60, wherein the system comprises an optical detection moiety that detects emission light of at least two wavelengths.