Ferritin nanocage-integrated vaccine containing flagellin immunoadjuvant and method for preparing same
A ferritin nanocage-based vaccine integrating a flagellin adjuvant and antigen using the SpyTag-SpyCatcher system addresses limitations of current vaccines by enhancing immune responses and providing broad protection against mucosal pathogens.
Patent Information
- Application Number
- PCT/KR2025/013361
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-19
- Filing Date
- 2025-09-01
- Publication Date
- 2026-05-28
AI Technical Summary
Current vaccines, particularly those targeting mucosal surfaces, face challenges in inducing effective antigen-specific immune responses and have limitations in blocking horizontal transmission of infectious diseases due to barriers such as the mucous layer and gut microbiome, with polysaccharide and conjugate vaccines showing limited efficacy in children, the elderly, and immunocompromised individuals.
Development of a ferritin nanocage-based vaccine that integrates a flagellin adjuvant and antigen using the SpyTag-SpyCatcher system, allowing multivalent presentation and enhanced immune response through the SpyTag-SpyCatcher system, which forms stable covalent bonds under various conditions, enabling efficient delivery to lymph nodes and induction of both mucosal and systemic immune responses.
The integrated vaccine enhances B-cell maturation and memory formation, increases T-cell activity, and provides broad protective effects against various serotypes, improving immune responses and vaccine efficacy.
Smart Images

Figure KR2025013361_28052026_PF_FP_ABST
Abstract
Description
Ferritin nanocage integrated vaccine containing flagellin adjuvant and method for manufacturing the same
[0001] The present invention was carried out under project number 2020R1A5A2031185 with the support of the Ministry of Science and ICT, the research management agency for the said project is the National Research Foundation of Korea, the research project name is "Basic Research Project (Leading Research Center Support Project)", the research project name is "Combined Cancer Immunotherapy Research Center", the lead institution is Chonnam National University, and the research period is 2018.06.01 - 2025.02.28.
[0002] In addition, the present invention was carried out under project number RS-2025-00553055 with the support of the Ministry of Science and ICT, the research management agency for the said project is the National Research Foundation of Korea, the research project name is "Basic Research Project (Mid-career Researcher)", the research project name is "Protein complex nanocage containing built-in adjuvant: Multipurpose next-generation vaccine platform", the lead institution is the Industry-Academic Cooperation Foundation of Chonnam National University, and the research period is 2024.03.01 - 2030.02.28.
[0003] In addition, the present invention was carried out under project number RS-2019-NR040056 with the support of the Ministry of Science and ICT, the research management agency for the said project is the National Research Foundation of Korea, the research project name is "Basic Research Project (Leading Research Center Support Project)", the research project name is "Hard Tissue Biointerface Research Center", the lead institution is Chonnam National University, and the research period is 2019.06.01 - 2026.02.28.
[0004] The present invention claims priority to Korean Patent Application No. 10-2024-0164872, filed with the Korean Intellectual Property Office on November 19, 2024, the contents of which are incorporated herein by reference in their entirety.
[0005] The present invention relates to a ferritin nanocage integrated vaccine containing a flagellin adjuvant and a method for manufacturing the same, and more specifically, to an integrated protein nanoparticle vaccine that simultaneously displays a flagellin adjuvant and an antigen using a ferritin nanocage.
[0006] The SARS-CoV-2 pandemic once again demonstrated the significant impact that vaccines and immunotherapy have on human health, clearly showing that these technologies are central to responding to emerging infectious diseases. Even after the SARS-CoV pandemic, the emergence of new infectious diseases such as monkeypox (Mpox) continues to pose a serious threat to humanity, making effective preparedness essential. The development of effective vaccines and immunotherapy has established itself as a vital element in protecting public health and minimizing the risk of future pandemics.
[0007] Achieving these goals urgently requires innovation in vaccine platforms and the establishment of rapid response systems, which are achievable through global cooperation and continuous research and development. In addition to emerging infectious diseases, there are various infectious diseases with persistent unmet medical needs, a significant number of which are caused by mucosal infections. Furthermore, there are non-infectious diseases to which vaccines and immunotherapies targeting mucosal lesions can be applied.
[0008] For successful vaccine development, harmony among 'vaccine research and development teams' from various fields is essential, built upon the foundation of 'vaccine science' led by immunology. This can be achieved through the optimization of the following elements: 1) an optimal protective antigen, 2) a potent and safe adjuvant, and 3) an optimal vaccine delivery system.
[0009] Vaccine platforms currently developed and in use include 1) attenuated vaccines (e.g., measles, mumps, rubella, and chickenpox vaccines), 2) inactivated vaccines (e.g., polio and influenza vaccines), 3) subunit vaccines (e.g., Hib, pneumonia, herpes zoster, hepatitis B, pertussis, meningococcal vaccines), 4) toxoid vaccines (e.g., tetanus and diphtheria vaccines), 5) viral vector vaccines (e.g., Ebola and COVID-19 vaccines), and 6) mRNA-LNP vaccines (e.g., COVID-19 vaccine).
[0010] In addition, research on vaccine development utilizing nanotechnology is actively underway recently. Nanoparticles applicable to vaccines can be classified as follows:
[0011] There are polymer nanoparticles (polymersomes, dendrimers, micelles, nanospheres, etc.), inorganic nanoparticles (silica, quantum dots, iron oxide nanoparticles, gold nanoparticles, etc.), lipid-based nanoparticles (liposomes, lipid nanoparticles (LNP), emulsions, etc.), and protein-based nanoparticles (virus-like particles (VLP), natural protein nanocage, artificial protein nanocage, etc.).
[0012] Advancements in nanotechnology and a growing understanding of the mucosal immune system are providing new opportunities to overcome the limitations of mucosal vaccine delivery. In particular, protein nanocage (PNC)-based mucosal vaccines are attracting attention as delivery vehicles capable of effectively penetrating the mucosal barrier and are establishing themselves as innovative vaccine platforms that induce a potent immune response.
[0013] Protein nanocages are multimeric nanostructures composed of biodegradable multimeric protein subunits. They possess a uniform size (8–100 nm), a high surface-to-volume ratio, strong structural stability, monodispersibility, low cytotoxicity, high biocompatibility, and biodegradability. These characteristics enable the efficient co-delivery of vaccine antigens and adjuvants, allowing the nanocages to be effectively delivered to lymph nodes rich in immune cells. In particular, the surface of protein nanocages is easily genetically or chemically modified, offering the advantage of enabling the multivalent loading of various antigens and adjuvants. Therefore, nanocages can realize an effective vaccine delivery system through functions such as enhanced immunogenicity, maintenance of stability, and antigen protection.
[0014] Protein nanocage-based vaccines not only effectively induce mucosal immune responses but also demonstrate superior efficacy compared to conventional mucosal vaccines in terms of antigen delivery and immune enhancement. Recent studies report that vaccines utilizing protein nanocages induce potent antigen-specific T-cell and B-cell immune responses and enhance immune defenses against various infectious diseases and cancers occurring in mucosal tissues.
[0015] In particular, ferritin is being studied as a vaccine platform in the form of a hollow nanocage composed of 24 subunits due to its stability and flexibility. Ferritin nanocages are suitable for the development of multivalent vaccines because of their ability to bind various antigens to their surface. In addition, the SpyTag-SpyCatcher system spontaneously forms specific covalent bonds between proteins, ensuring stability in diverse environments, and can enhance immunogenicity by conjugating antigens to nanoparticle scaffolds. Superior immune responses compared to unlinked monomeric vaccines have been confirmed in HBV and HIV vaccine studies using this system. Furthermore, the SpyTag-SpyCatcher system allows for the free design of complex protein structures via a plug-and-play method, making it applicable to the future development of personalized vaccines. These technologies can serve as a useful foundation for the development of multivalent and mucosal vaccines.
[0016] Flagellin-based adjuvants are pathogen-associated molecular pattern (PAMP) protein adjuvants that induce a potent immune response by activating the cell surface Toll-like receptor 5 (TLR5) signaling pathway while simultaneously stimulating the cytoplasmic NLRC4 inflammasome pathway. Through this mechanism, flagellin effectively enhances innate and adaptive immune responses and functions as a potent adjuvant. Flagellin adjuvants have been verified to perform immunomodulatory functions in various diseases, including infectious diseases, cancer, allergies, dysbiotic inflammatory diseases, and neurodegenerative diseases (e.g., Alzheimer's disease). In particular, flagellin-based adjuvant strategies are considered a promising platform for the development of vaccines for the prevention and treatment of infectious diseases, as they can maximize the immunogenicity of existing vaccines and simultaneously induce mucosal and systemic immune responses.
[0017] The SpyTag-SpyCatcher system utilizes an innovative isopeptide coupling technology capable of efficient binding within nanocage structures, offering a novel method for the efficient display of antigens and flagellin-based adjuvants within a single nanocage. This technology induces high-precision binding through an isopeptide bond formation mechanism and is characterized by high binding specificity, temperature and pH stability, and structural robustness maintained under various buffer conditions. Based on these characteristics, the SpyTag-SpyCatcher system can serve as a core technology for next-generation nanocarrier vaccine platforms aimed at designing multivalent vaccines and enhancing immunogenicity. In particular, this system enables the stable display of adjuvants and antigens within a single structure, allowing for the simultaneous induction of potent mucosal and systemic immune responses.
[0018] With the global burden of mortality and morbidity caused by mucosal pathogens remaining high, existing injectable vaccines are effective in inducing systemic immunity but have limitations in inducing antigen-specific immune responses on mucosal surfaces and blocking the horizontal transmission of infectious diseases. Mucosal vaccines can be administered via various routes, including oral, nasal, sublingual, and genital, and offer the advantage of blocking the initial invasion of pathogens and enhancing systemic immunity by inducing secretory IgA and local cellular immune responses. However, due to multilayered barriers such as the mucous layer on mucosal surfaces, ciliary movement in the nasal cavity, proteolytic enzymes in the gastrointestinal tract, and interference from the gut microbiome, the development of effective delivery systems and potent adjuvants is essential. Currently, approved mucosal vaccines are limited to a small number of attenuated vaccines, and there are no approved cases of subunit mucosal vaccines.
[0019] Pneumococcus is a major cause of bacterial pneumonia commonly occurring in children worldwide, claiming approximately 1.2 million lives annually, with children in developing countries being particularly vulnerable. Current polysaccharide vaccines have limited efficacy in children, the elderly, and immunocompromised individuals due to weak cellular immunity and the induction of enduring immune memory; conjugate vaccines (PCVs) also face limitations due to limited coverage of clinical strains and the emergence of new serotypes. To address these issues, protein subunit vaccines such as pneumococcal surface protein A (PspA) are being studied; in particular, FlaB-tPspA fusion proteins can induce a potent immune response and provide broad protective effects against various serotypes.
[0020] To overcome the limitations of existing vaccines composed of adjuvant-antigen fusion proteins, the inventors have invented an integrated protein nanoparticle vaccine that simultaneously displays a flagellin adjuvant and an antigen using ferritin nanocages, and a method for manufacturing the same.
[0021] The present invention enables the multivalent presentation of antigens and flagellin adjuvants on the surface of ferritin nanocages using a SpyTag-SpyCatcher system, and provides increased efficiency of vaccine formulations, enhanced B cell maturation and memory formation, increased T cell activity, and enhanced protective effects.
[0022] To achieve the above objective, the present invention,
[0023] Protein nanocage fused with SpyTag;
[0024] Antigen protein fused with the first SpyCatcher; and
[0025] Another feature is providing nanoparticles containing an adjuvant fused with a second SpyCatcher.
[0026] In addition, the present invention provides a vaccine composition comprising the nanoparticles.
[0027] In addition, the present invention,
[0028] (a) A step of fusing a SpyTag to the N-terminus of a protein nanocage;
[0029] (b) A step of fusing the antigen protein to the C-terminus of the first SpyCatcher;
[0030] (c) fusing an adjuvant to the C-terminus of the second SpyCatcher; and
[0031] (d) A method for manufacturing nanoparticles comprising the step of mixing the nanocage obtained in step (a), the protein complex obtained in step (b), and the protein complex obtained in step (c).
[0032] The present invention provides a method for manufacturing nanoparticles, wherein the mixture of the nanocage obtained in step (a), the protein complex obtained in step (b), and the protein complex obtained in step (c) is formed in a molar ratio of 1:1 to 2:1 to 2.
[0033] The present invention enables the multivalent presentation of antigens and flagellin adjuvants on the surface of ferritin nanocages using a SpyTag-SpyCatcher system, and provides increased efficiency of vaccine formulations, enhanced B-cell maturation and memory formation, increased T-cell activity, and enhanced protective effects.
[0034] Figure 1 is a visual representation of the plasmid configuration of Ftn-tPspA-FlaB nanocage (FPB NC) and a schematic diagram of the three-dimensional simulation of the protein structure of the components.
[0035] Figure 2 shows the results of analyzing recombinant proteins including ST-Ftn, SC-tPspA, SC-FlaB, FPB mixture (24:10:10), and purified FPB NC using SDS-PAGE through ion exchange chromatography.
[0036] Figure 3 shows the results of native-PAGE analysis of FPB NCs loaded onto a 10% native-PAGE gel by mixing FPB NCs purified by ion exchange chromatography with a native loading buffer, or by incubating the Ftn-tPspA-FlaB nanocage mixture at 4°C for 16 hours.
[0037] Figure 4 shows the Western blot results of FPB NCs detected using anti-tPspA, anti-FlaB, or anti-Ftn antibodies after recombinant protein was digested using SDS-PAGE.
[0038] Figure 5 shows the TEM image of the FPB NC and the size measurement results of the FPB NC through DLS.
[0039] Figure 6 shows the results of measuring the TLR5-dependent NF-κB stimulating activity of FPB NC.
[0040] Figure 7 is a schematic diagram showing the schedule of the intranasal (IN) immunization experiment of Experimental Example 3.
[0041] Figure 8 shows the results of measuring tPspA-specific systemic IgG or IgA titers using ELISA. It includes serum IgG evaluation.
[0042] Figure 9 shows the results of measuring tPspA-specific mucosal IgG or IgA titers using ELISA. It includes the evaluation of IgG in bronchoalveolar lavage fluid (BALF), nasal lavage fluid, and saliva.
[0043] Figure 10 shows the measurement results of tPspA-specific plasma cells and memory B cells using the ELISPOT assay.
[0044] Figure 11 shows the results of measuring the tPspA-specific IgG binding avidity using ELISA.
[0045] Figure 12 shows tPspA-specific serum IgG using ELISA. 2a This is the result of evaluating the / IgG1 ratio.
[0046] Figure 13 shows the results of measuring tPspA-specific IFN-γ production using ELISA.
[0047] Figure 14 shows the results of observing the delivery of FPB NC to the draining lymph node using a confocal microscope.
[0048] Figure 15 shows the results of measuring the amount of FPB NC delivered in draining lymph nodes through flow cytometry.
[0049] Figure 16 shows the results of observing immunofluorescence staining of cervical lymph nodes (cLN) using a confocal microscope.
[0050] Figure 17 shows the results of detecting embryonic center B cells through flow cytometry.
[0051] Figure 18 shows the detection results of Tfhs through flow cytometry.
[0052] Figure 19 shows the results of measuring the protective immune response to a lethal challenge using S. pneumoniae WU2 or D39 strains.
[0053] Figure 20 shows the results of measuring pneumococcal colony-forming units (CFU) in lung tissue, bronchoalveolar lavage fluid (BAL-F), and blood samples.
[0054] Figure 21 shows the results of histological analysis of lung tissue after BAL-F preparation using hematoxylin and eosin (H&E) staining (scale bar: 200 μm, original magnification 200 X).
[0055] Throughout this specification, materials, methods, and embodiments are merely illustrative and do not limit the invention. Descriptions of specific terms are provided to enable the practice of various embodiments of the invention.
[0056] One aspect of the present invention is a protein nanocage fused with a SpyTag;
[0057] Antigen protein fused with the first SpyCatcher; and
[0058] This relates to nanoparticles containing an adjuvant fused with a second SpyCatcher.
[0059] In the present invention, the protein nanocage may be a ferritin nanocage, but is not limited thereto.
[0060] In the present invention, the nanoparticles may utilize protein nanocages to simultaneously display an immunoadjuvant and an antigen protein, but are not limited thereto.
[0061] The term "Protein Nanocage" in this specification refers to a protein complex forming a nanometer-sized spherical or polyhedral structure and is a multimeric structure that can be designed to mimic the molecular structure of microorganisms. It can serve as an intracellular storage container, provide structural support for the assembly of enzyme complexes, encapsulate genetic material, and function as a means of transporting molecules within the cell.
[0062] The term "ferritin nanocage" in this specification refers to a protein nanostructure formed by the self-assembly of ferritin, an iron storage protein. The protein consists of 24 subunits and naturally forms a spherical nanocage structure.
[0063] In the present invention, the antigen protein may be PspA (Pneumococcal Surface Protein A), but is not limited thereto.
[0064] The term "antigen" as used herein refers to a molecule or protein that stimulates the host immune system to induce an immune response. In vaccine development, antigens serve as a key element in forming immune memory by mimicking pathogen infection. The antigen includes all relevant antigenic epitopes. The terms "epitope" or "antigenic determinant" refer to a region on an antigen to which B cells or T cells respond.
[0065] The term "PspA" as used herein refers to a surface protein of Streptococcus pneumoniae that is an antigen possessing potent immunogenicity. PspA plays a role in evading the host's immune response, and vaccines targeting it may be effective in preventing pneumococcal infection.
[0066] In the present invention, the PspA may be tPspA (truncated pneumococcal surface protein A) comprising an alpha helical region of PspA, but is not limited thereto. For example, the tPspA may be a truncated fragment comprising amino acid residues 3 to 236 corresponding to the alpha helical region of the PspA protein.
[0067] In the present invention, the immunoadjuvant may comprise one or more selected from the group consisting of aluminum salt (Alum), monophosphoryl lipid A (MPL)-liposome complex, MPL-Alum complex, CpG-ODN, CpG oligonucleotide, and FlaB protein (Flagellin B), but is not limited thereto.
[0068] The term "adjuvant" in this specification refers to a substance that enhances the immune response to an antigen to increase the efficacy of a vaccine. The said adjuvant may be used without limitation as long as it can directly or indirectly enhance the function of the antigen that induces the immune response.
[0069] In the present invention, the immunoadjuvant may have the function of promoting the antigen presentation ability of antigen-presenting cells (APCs) and promoting the recruitment of immune cells, but is not limited thereto.
[0070] The term “FlaB (Flagellin B)” in this specification refers to one of the constituent proteins of bacterial flagella, corresponding to a pattern recognition receptor (PRR) ligand capable of activating Toll-like receptor 5 (TLR5) and the NLRC4 inflammasome pathway. Flagellin B can act as a potent adjuvant.
[0071] In the present invention, the nanoparticle may display tPspA and FlaB simultaneously on the surface of a ferritin nanocage to prevent the TLR5 binding domain from being hidden, but is not limited thereto.
[0072] In the present invention, the SpyTag may be fused to the N-terminus of the protein nanocage, but is not limited thereto.
[0073] In the present invention, the antigen protein may be fused to the C-terminus of the first SpyCatcher, but is not limited thereto.
[0074] In the present invention, the immune enhancer may be fused to the C-terminus of the second SpyCatcher, but is not limited thereto.
[0075] The above protein nanocages, antigen proteins, adjuvants, and protein complexes may be obtained by protein separation and purification methods conventional in the art. For example, the Spytag-ferritin nanocage complex may be obtained by size exclusion chromatography (SEC), but is not limited thereto. The above protein nanocages, antigen proteins, adjuvants, and protein complexes may be obtained by performing ion exchange chromatography, Ni-affinity chromatography, Q XL chromatography, butyl chromatography, or UF / DF processes, but is not limited thereto.
[0076] The term "SpyTag-SpyCatcher system" in this specification refers to a covalent bonding system developed based on the protein of Streptococcus pyogenes, which enables displaying or binding specific proteins to a surface.
[0077] A SpyTag is a short peptide sequence capable of genetically fusing with a specific protein, while a SpyCatcher is a protein domain that specifically recognizes it and forms a covalent bond. When a SpyTag encounters a SpyCatcher, it spontaneously forms a covalent bond, resulting in a strong binding force. A SpyCatcher refers to a protein domain (approximately 12–15 kDa in size) that specifically reacts with a SpyTag; upon binding, it forms a covalent bond, creating a strong link between the proteins.
[0078] In the present invention, the first or second SpyCatcher may be in the form of a ΔN1-SpyCatcher with a portion of the N-terminus removed, but is not limited thereto. The ΔN1-SpyCatcher has a portion of the N-terminus region that does not affect binding removed, thereby reducing the size of the protein and increasing the efficiency of expression in an E. coli expression system. The ΔN1-SpyCatcher according to the present invention maintains a covalent binding function that is the same as or equivalent to that of a general SpyCatcher.
[0079] In the present invention, the spy tag and the spy catcher may spontaneously form isopeptide bonds in a temperature range of 4 to 40 ℃ and a pH range of 5 to 10.
[0080] The term "fusion" as used herein is used interchangeably with "tag," "binding," "linking," and "fusion." Fusion includes the fusion of a spy tag or spy catcher to the N-terminus or C-terminus of a specific protein or nanostructure.
[0081] In the present invention, the fusion may be performed by a (G4S)3 linker, but is not limited thereto.
[0082] The term “(G4S)3 linker” in this specification is a flexible peptide linker used for protein fusion, comprising a repeating sequence of glycine (G) and serine (S), for example, (G4S)3 may mean a form in which the “Gly-Gly-Gly-Gly-Ser” sequence is repeated three times.
[0083] The term "N-terminal" as used herein refers to the end portion of a protein or peptide sequence where an amino (NH2) group is present. The structural characteristics of the N-terminal play an important role in protein function and interaction and can be genetically fused with the protein sequence.
[0084] The term "C-terminal" in this specification refers to the end portion of a protein or peptide sequence where a carboxyl (-COOH) group is present. The C-terminal plays an important role in protein function and modification and can be a factor in regulating protein stability and interactions.
[0085] In the present invention, the DNA fragment amplification of the tPspA may be performed by the primer pair of SEQ ID NOs. 1 and 2, but is not limited thereto.
[0086] In the present invention, the DNA fragment amplification of the FlaB protein may be performed by the primer pair of SEQ ID NOs 3 and 4, but is not limited thereto.
[0087] In the present invention, the DNA fragment amplification of the spy tag may be performed by the primer of SEQ ID NO. 5, but is not limited thereto.
[0088] In the present invention, the DNA fragment amplification of the spy catcher may be performed by the primer of SEQ ID NO. 6, but is not limited thereto.
[0089] In the present invention, the DNA fragment amplification of the ferritin nanocage may be performed by the primer of SEQ ID NO. 7, but is not limited thereto.
[0090] In the present invention, the molar ratio of the immunoadjuvant to the antigen protein may be 0.5 to 3, but is not limited thereto.
[0091] In the present invention, the composition ratio or molar ratio of the antigen protein and the immunoadjuvant may be 1:0.1 to 10, 1:0.5 to 10, 1:1 to 10, 1:0.5 to 5, 1:1 to 5, 1:0.5 to 3, 1:1 to 3, 1:0.5 to 2, 1:1 to 2, for example, 1:1. In the present invention, the ratio of the antigen protein and the immunoadjuvant may be controlled by the mixing ratio during the manufacturing process.
[0092] In the present invention, "molar ratio" refers to the ratio of the relative molecular weights of different components within a chemical composition.
[0093] In the present invention, the composition ratio or molar ratio of the protein nanocage:antigen protein:immunostimulator may be 2.0 to 3.0:1:1, for example, 2.4:1:1. Specifically, in the present invention, "the molar ratio of the protein nanocage:antigen protein:immunostimulator is 2.4:1:1" indicates that 2.4 moles of protein nanocage, 1 mole of antigen protein, and 1 mole of immunostimulator are present in the composition, and the molar ratio preferably refers to the ratio of the number of moles of SpyTag-Ftn protein, SC-tPspA antigen protein, and SC-FlaB immunostimulator used in the nanoparticle manufacturing process, and in the present invention, the ratio indicated as "FPB NC (24:10:10)" is normalized and expressed as 2.4:1:1. The above molar ratio was confirmed through a purification process using size exclusion chromatography and anion exchange chromatography and SDS-PAGE analysis, and was experimentally proven to be the ratio with optimized biological activity through TLR5-dependent NF-κB reporter analysis.
[0094] In the present invention, the nanoparticles may have a size of 10 to 200 nm or 15 to 35 nm, but are not limited thereto.
[0095] Another aspect of the present invention relates to a vaccine composition comprising the nanoparticles.
[0096] The term "vaccine composition" as used herein may be used interchangeably with "immunogenic composition." The vaccine composition is a composition of a substance suitable for administration to humans or animals capable of inducing a specific immune response against a pathogen. The vaccine composition comprises one or more antigens (e.g., whole purified virus or antigenic subunit, polypeptide) or antigenic epitopes.
[0097] In the present invention, the vaccine composition may be a mucosal vaccine, but is not limited thereto.
[0098] The term "Mucosal Vaccine" as used in this specification refers to a type of vaccine that stimulates the mucosal immune system to induce humoral and cellular immune responses. Since mucosa is a protective layer covering the inner surfaces of the respiratory, digestive, and genitourinary systems and serves as a major entry point for external pathogens (viruses, bacteria, etc.), activating mucosal immunity can be an effective disease prevention strategy.
[0099] In the present invention, the route of administration of the mucosal vaccine may be oral administration, intranasal administration, or sublingual administration to the subject, but is not limited thereto.
[0100] In the present invention, the vaccine composition may comprise an active ingredient, an inactive ingredient, a stabilizer, a salt, a solvent, a buffer, a preservative, and a pharmaceutically acceptable carrier.
[0101] In the present invention, the vaccine composition comprises a sufficient number of nanocage vaccine nanoparticles for an effective immune response.
[0102] In the present invention, the dosage of the vaccine composition may vary depending on the subject's condition and body weight, the type and severity of the disease, and the form of the composition, and may be appropriately selected by a person skilled in the art. The vaccine composition may be administered to a subject or a group of subjects to induce an immune response that protects the subject against symptoms or pathological conditions induced by a pathogen. The vaccine composition may be administered to prevent, treat, or improve symptoms or diseases caused by a pathogen by inhibiting the replication of the pathogen after exposure to the pathogen.
[0103] The above vaccine composition may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents.
[0104] In the present invention, the object may be a mammal, for example, a human or a mouse, but is not limited thereto.
[0105] The above vaccine composition may be administered to animals other than humans at the same dosage per kg as to humans, or an amount calculated based on the ratio of organ volumes between the target animal and humans.
[0106] In the present invention, the vaccine composition comprises the above-mentioned nanoparticles, and the specific description is based on the description of the above-mentioned nanoparticles.
[0107] In the method for preparing the above-mentioned nanoparticles or vaccine composition, the vector used is not particularly limited as long as it is capable of replicating within a host cell, and any vector known in the art may be used. Commonly used vectors include natural or recombinant plasmids, cosmids, viruses, and bacteriophages. For example, pTYB12, pET30a(+), etc. may be used, and pDZ-based, pBR-based, pUC-based, pTYB-based, pGEM-based, pCL-based, pET-based, pBluescript-II-based vectors may be used, but are not limited thereto.
[0108] The term "vector" as used herein refers to a DNA product containing a polynucleotide sequence encoding a target protein in a suitable host, operably linked to an expression regulatory sequence. The expression regulatory sequence may include a promoter that initiates transcription, any operator sequence, an mRNA ribosome binding coding sequence, and a sequence that terminates transcription and translation. After being transfected into a suitable host cell, the vector may replicate or function independently of the host genome and may be integrated into the genome itself.
[0109] Another aspect of the present invention is (a) fusing a SpyTag to the N-terminus of a protein nanocage;
[0110] (b) A step of fusing the antigen protein to the C-terminus of the first SpyCatcher;
[0111] (c) fusing an adjuvant to the C-terminus of the second SpyCatcher; and
[0112] (d) A method for manufacturing nanoparticles comprising the step of mixing the nanocage obtained in step (a), the protein complex obtained in step (b), and the protein complex obtained in step (c).
[0113] In the present invention, the mixture of the nanocage obtained in step (a), the protein complex obtained in step (b), and the protein complex obtained in step (c) may be formed in a molar ratio of 1:1 to 2:1 to 2, but is not limited thereto.
[0114] In the present invention, the protein complex may be a fusion form of a spy tag and a protein nanocage, a fusion form of a spy catcher and an antigen protein, or a fusion form of a spy catcher and an immunoadjuvant.
[0115] In the present invention, the method for manufacturing nanoparticles may include, but is not limited to, a protein nanocage purification step, an antigen protein purification step, an adjuvant purification step, a Spytag-protein nanocage complex purification step, a Spycatcher-antigen protein complex purification step, or a Spycatcher-adjuvant complex purification step.
[0116] In the present invention, the purification step may include, but is not limited to, a step of producing a protein or nanoparticle.
[0117] In the present invention, the purification step may include, but is not limited to, a DNA amplification step using a primer, a subcloning step, a vector ligation step, or an expression step.
[0118] In the present invention, the protein nanocage may be a ferritin nanocage, but is not limited thereto.
[0119] In the present invention, the antigen protein may be PspA (pneumococcal surface protein A), but is not limited thereto.
[0120] In the present invention, the PspA may be tPspA (truncated pneumococcal surface protein A) comprising an alpha helical region of PspA, but is not limited thereto.
[0121] In the present invention, the immunoadjuvant may comprise one or more selected from the group consisting of aluminum salt (Alum), monophosphoryl lipid A (MPL)-liposome complex, MPL-Alum complex, CpG-ODN, CpG oligonucleotide, and FlaB protein (Flagellin B), but is not limited thereto.
[0122] Throughout this specification, when a part is described as "comprising" a certain component, this means that, unless specifically stated otherwise, it does not exclude other components but may include additional components.
[0123] Additionally, where numerical ranges are disclosed in this specification, such ranges are continuous and, unless otherwise specified, include all values from the minimum value of such range up to the maximum value including the maximum value.
[0124] Throughout this specification, "%" used to indicate the concentration of a particular substance is (weight / weight)% for solid / solid, (weight / volume)% for solid / liquid, and (volume / volume)% for liquid / liquid, unless otherwise noted.
[0125] The present invention will be explained in detail below through experimental examples.
[0126] Preparation Example. Production of nanocage recombinant protein
[0127] The bacterial strains and plasmids used in this study are shown in Table 1 below.
[0128] Strain Description E. coli (Escherichia coli)-DH5αF- recA1 restriction enzyme activity deficiency (restriction negative)ER2566F- λ- fhuA2 [lon] ompT lacZ::T7 gene1 gal sulA11Δ(mcrC-mrr)114::IS10 R(mcr-73::miniTn10-TetS)2R(zgb-210::Tn10)(TetS) endA1 [dcm]BL21 (DE3)-Streptococcus pneumoniae (Source : Nguyen CT, Kim SY, Kim MS, Lee SE, Rhee JH. Intranasal immunization with recombinant PspA fused with a flagellin enhances cross-protective immunity against Streptococcus pneumoniae infection in mice. Vaccine. 2011 Aug 5;29(34):5731-9.)WU2 Wild-type, pathogenic, capsule polysaccharide (type 3), PspA clade 2, family 1D39 Wild-type, pathogenic, capsule polysaccharide (type 2), PspA clade 2, family 1 Plasmid description pTYB12 N-terminal fusion expression vector, in which an Intein-tag is fused to the N-terminus of the target protein; Ap R (Ampicillin resistance) pET30a(+) N-terminal fusion expression vector, where a His-tag is fused to the N-terminus of the target protein; Km R(Kanamycin resistance) pTYB12::FlaB1.5kb The flaB ORF (open reading frame) is cloned into pTYB12 from the EcoRI-PstI fragment; ΔN1-SpyCatcher is linked to flaB in the pET30a(+)::SC::flaBpET30a(+) plasmid, and the two proteins are connected by a 15-amino acid (G4S) 3-linker; the restriction enzyme site is NdeI-XhoIpET30a(+)::ST::ftnpET30a(+) plasmid, and SpyTag is linked to ftn (ferritin), and the two proteins are connected by a 15-amino acid (G4S) 3-linker; The restriction enzyme site is located in the NdeI-XhoIpTYB12::SC::tpspApTYB12 plasmid, where a ΔN1-SpyCatcher is linked to tPspA and connected by a 15-amino acid (G4S)3 linker; the restriction enzyme site is located in the NdeI-PstIpTYB12::tpspApTYB12 plasmid, where a 0.7kb NdeI-SalI fragment is cloned, containing the **PspA α-helical (helical) region (amino acid 3-257) of S. pneumoniae Rx1**; and the pTYB12::flaB::tpspA plasmid, where an 1.8kb NdeI-SmaI fragment is cloned, containing the flaB and tpspA sequences.
[0129] S. pneumoniae strains were cultured in Todd-Hewitt medium supplemented with 5% yeast extract (Becton Dickinson and Co., Le Pont de Claix, France) or on 5% positive blood agar plates (Asan Pharmacy Co., Seoul, Korea) at 37°C and 5% CO2. Plasmids were maintained using E. coli cells grown on Luria bertani (LB) agar plates supplemented with the antibiotics ampicillin (100 μg / ml) or kanamycin (100 μg / ml).
[0130]
[0131] (1) Production and purification of nanocage recombinant proteins
[0132] Recombinant proteins were cloned using standard PCR methods and ligation. Inserted genes were verified by Sanger sequencing. In all cases, the SpyCatcher version used was ΔN1-SpyCatcher (SC), and ferritin (Ftn) derived from Pyrococcus furiosus, which exhibits high heat resistance, was selected. The ΔN1-SpyCatcher (SC)::(G4S)3 and spytag(ST)::(G4S)3::ftn genes were codon-optimized to optimize expression in E. coli and synthesized at Macrogen (Seoul, South Korea). The tPspA gene, containing amino acids 3 through 236 containing the alpha-helical structure of the mature Rx1 PspA protein, was used as the antigen (Nguyen et al., 2011; Hu et al., 2013; Oliveira et al., 2010). After amplification, the PspA DNA fragment was ligated to the C-terminus of SC::(G4S)3 within the pET30a(+) vector. For this purpose, the tpspA-F / tpspA-R primer pair was used. Subsequently, the SC::(G4S)3::tpspA DNA fragment was amplified and subcloned into the pTYB12 plasmid using the SC-F / tpspA-R primers.
[0133] The DNA fragment corresponding to Vibrio vulnificusflaB was amplified and fused to the C-terminus of ΔN1-SC containing the flexible linker (G4S)3. After subcloning, the flaB DNA fragment was inserted into the pET30a(+) vector using the flaB-F / flaB-R primers. Additionally, the DNA fragment of ST::(G4S)3::ftn was amplified and inserted into the pET30a(+) plasmid using the ST-F / ftn-R primers. The DNA sequence of the final expression vector was verified using Sanger sequencing (Macrogen, Inc., Seoul, Korea).
[0134] The plasmids were maintained in E. coli and cultured on Luria-Bertani (LB) agar medium in an environment containing ampicillin (100 μg / ml) or kanamycin (100 μg / ml). Gene expression was performed in E. coli BL21. BL21 transformed cells were individually transformed with the pET-30a(+)::SC::flaB, pET-30a(+)::ST::ftn, or pTYB12::SC::tpspA plasmids. Protein expression was OD 600 When this reached 0.6, 1 mM isopropyl-D-thiogalactopyranoside (IPTG) was added to induce the reaction. Subsequently, the cells were cultured under controlled conditions. SC-tPspA and SC-FlaB were cultured at 18 °C for 16 hours, while ST-Ftn was cultured at 37 °C for 4 hours. After culture, the cells were harvested by centrifugation at 11,000 × g for 10 minutes and stored at -80 °C.
[0135] SC-FlaB was purified using a Ni-affinity column. The precipitate was resuspended in a lysis buffer consisting of 50 mM NaH2PO4 (pH=8.0), 300 mM NaCl, 10 mM imidazole, 0.1% Triton X-100, 0.1% Tween 20, and 20 mM phenylmethylsulfonyl fluoride (PMSF). Subsequently, sonication was performed in an ice bath, followed by centrifugation at 37,000 × g for 30 minutes. After centrifugation, the cell lysis supernatant was applied to a column packed with Ni-NTA agarose beads (Qiagen, Hilden, Germany). The purity of the recombinant protein was confirmed using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). For ST-Ftn purification, the bacterial precipitate was resuspended in a lysis buffer consisting of 20 mM Tris-HCl, 50 mM NaCl, and 20 mM PMSF (pH 7.5). After sonication, the solution was centrifuged, and the protein concentration was adjusted to 1 mg / ml. The supernatant was diluted and heated at 70 °C for 15 minutes to separate aggregates. Subsequently, the solution free of aggregates was separated by centrifugation. The lysed protein in the heated supernatant was concentrated and introduced into a Superose 6 column (GE Healthcare) containing the same lysis buffer. For SC-tPspA purification, the precipitate was suspended in a lysis buffer consisting of 20 mM Tris-HCl, 500 mM NaCl, and 1 mM EDTA (pH 7.5). After sonication and centrifugation, the solution was applied to a column packed with chitin agarose beads (New England Biolabs) according to the manufacturer's instructions.
[0136] The PCR primer sequences used in the manufacture of this vaccine are shown in Table 2 below.
[0137] Sequence Number Primer Nucleotide Sequence (5'-3')1tpspA-FAGGTGAATCTCTCCCGTAGCCAGTCAG2tpspA-Rtagcctcgagctcatcaatcttatcacttaac3flaB-FAGGTGAATTCGCAGTGAATGTAAATACAAC4flaB-Rtagcctcgaggcctagtagacttagcgctg5ST-FATCGCATATGGCGCATATTTGTGTGTGTG6SC-Fcaagcatatggatagcgcgacccatattaaatttag7ftn-RTCGACTCGAGTTCGCCGCCCCTGCATCAG
[0138] (2) Optimization and purification of nanocage vaccine
[0139] To assemble ferritin-tPspA-FlaB nanocages (FPB NCs), ST-Ftn, SC-tPspA, and SC-FlaB were mixed in various ratios. The optimal ratio for animal experiments was determined based on stability and TLR5 stimulating activity. The mixtures were incubated overnight at 4 °C. Subsequently, the mixture was dialyzed for 2 hours at 4 °C in Buffer A containing 50 mM Tris-HCl (pH 8.0) and 20 mM NaCl. After dialysis, the solution was introduced into a Q anion exchange column. After separating the protein nanocage fraction, the buffer was exchanged with phosphate-buffered saline (PBS) using a centrifugal filter tube (Amicon® Ultra15 Centrifugal Filter, 10k). The mixture was then treated with Triton X-114 (Sigma Aldrich, St. Louis, MO) to remove lipopolysaccharide (LPS) contamination. To remove remaining Triton X-114, follow the manufacturer's instructions for Bio-Beads TMProtein samples were treated with SM-2 (Bio-Rad Laboratories, Inc., Hercules, CA). Subsequently, the remaining LPS was quantified using the EndoSafe LAL kit (Charles River, Charleston, SC) via gel coagulation. LPS levels in the protein samples were maintained below the U.S. Food and Drug Administration (FDA) guidelines (less than 0.15 EU per 30 g mouse). For the assembly of ferritin-FlaB nanocages (FB NC) and ferritin-tPspA nanocages (FP NC), the ST-Ftn component was mixed with SC-FlaB or SC-tPspA in a 1:1.5 ratio. This mixture was reacted overnight at 4 °C. Subsequent purification and endotoxin removal procedures were performed in the same manner as when preparing the FPB NC.
[0140] (3) 3D simulation of FPB nanocage
[0141] A 3D model of the FPB nanocage was constructed for further structural analysis at the molecular level. The monomer structures of tPspA-ferritin and FlaB-ferritin were predicted using AlphaFold2 and assembled into the ferritin multimer structure (PDB ID: 2JD6). GROMACS was utilized to eliminate structural collisions. An OPLS-AA / L force field was applied, and simulations were performed within a 10 Å extended cubic box containing ionized SPC / E water (580 NA+). A pre-equilibration step was performed to eliminate unrealistic physical and chemical contacts and establish a reliable simulation starting point. A 50,000-step steepest descent energy minimization process was conducted for the ST-Ftn:SC-tPspA:SC-FlaB=24:10:10 system. In this process, a constraint was established on the backbone atoms by applying a force constant of 1,000 kcal / mol-1 Å-2. After energy minimization, NVT (isothermal-isovolume) and NPT (isothermal-isobaric) equilibration processes were carried out for 100 picoseconds. Subsequently, molecular dynamics (MD) simulations were performed for 1 nanosecond to collect relevant data and observation results.
[0142]
[0143] Experimental Example 1. Development of a Ferritin-based Nanocage Vaccine (FPB) Composed of tPspA Antigen and FlaB Adjuvant Using the SpyTag-SpyCatcher System
[0144] To develop a nanocage vaccine targeting *S. pneumoniae*, the SpyTag-SpyCatcher system was incorporated into a ferritin nanocage structure. In this study, the ferritin gene (Pf-ferritin, hereinafter ferritin or Ftn) of *Pyrococcus furiosus*, which has been utilized in the development of HIV-1 vaccines, was selected. First, a recombinant SpyTag-Ftn nanocage scaffold, SpyCatcher-tPspA antigen, and SpyCatcher-FlaB adjuvant were constructed. The composition of each plasmid and the protein structures of the components during the construction of the Ftn-tPspA-FlaB nanocage (FPB NC) are shown in Figure 1.
[0145] Subsequently, high purity of the SpyTag-Ftn protein was secured using size exclusion chromatography. Vaccine nanocages were assembled by mixing the three components at various molar ratios at 4°C, and each component of the assembled nanocages was verified by SDS-PAGE. Two new bands (62.3 kDa and 76.1 kDa) appeared through the covalent reaction of SpyTag-SpyCatcher, corresponding to Ftn-ST-SC-tPspA and Ftn-ST-SC-FlaB, respectively.
[0146] Subsequently, the Ftn-tPspA-FlaB nanocage (FPB NC) was further purified via anion exchange chromatography and is shown in Figure 2. As a result, the high purity of the FPB NC was confirmed through SDS-PAGE analysis. The intensity of the Ftn-ST-SC-tPspA band increased as the relative amount of tPspA antigen contained in the nanocage (NC) increased; conversely, the Ftn-ST-SC-FlaB band became more prominent when the amount of FlaB adjuvant was higher. These results suggested that the ratio of antigen to FlaB adjuvant could be adjusted by controlling the concentration of each component. Next, a TLR5-dependent NF-κB reporter assay was performed to identify optimal nanocage candidates capable of preserving the biological activity of FlaB. For this purpose, the same amount of FlaB as the control was used. As a result, compared to simple FlaB protein, nanocages with compositions of FPB NC (24:10:10), FPB NC (24:05:15), and FPB NC (24:6.7:13) were found to have similar or increased TLR5 stimulating activity. On the other hand, FPB NC (24:13.3:6.7) showed a tendency for significantly reduced NF-κB activation. Considering these results and previous research findings comprehensively, FPB NC (24:10:10), which possesses the optimal ratio of antigen and adjuvant and exhibits potent TLR5 stimulating activity, was selected as the subject for follow-up research.
[0147]
[0148] Experimental Example 2. Characterization of Ferritin-tPspA-FlaB Nanocage (FPB NC) Vaccine
[0149] To further confirm whether the FPB NCs were successfully assembled, native-gel electrophoresis was performed, and the results are shown in Figure 3. As a result, the FPB NCs remained within the stacking gel, whereas the ST-Ftn was located between the stacking gel and the resolving gel. This result suggested that the FPB NCs were stably formed and possessed a physically much larger mass than the ST-Ftn core. Notably, no ST-Ftn NC bands were observed in the native gel for the FPB Mix (24:10:10) and pre-formed FPB NCs. This implies that tPspA or FlaB bound to all ferritin cores, leaving no free ST-Ftn. In addition, the small amount of free ST-Ftn bands observed in the SDS-PAGE gel of FPB NC may be due to some SpyTag molecules trapped inside the nanocage or fine fractions not covalently bonded with the SpyCatcher being integrated into the nanocage structure.
[0150] To further verify that the nanocages were correctly assembled, Western blot analysis was performed and is shown in Figure 4. As a result, the anti-tPspA antibody (Ab) detected SC-tPspA (38.5 kDa band) and Ftn-ST-SC-tPspA (62.3 kDa band), confirming that tPspA maintains appropriate antigenicity in the nanocages. Similarly, the anti-FlaB antibody recognized SC-FlaB (52.3 kDa band) and Ftn-ST-SC-FlaB (76.1 kDa band). Additionally, the anti-Ftn antibody detected ST-Ftn, Ftn-ST-SC-tPspA, and Ftn-ST-SC-FlaB, confirming that ferritin maintains the correct structural arrangement for forming nanocages. These results suggest that the FPB NC vaccine maintains high physical structural integrity and will provide appropriate antigenicity and immunoadjuvantage for tPspA and FlaB, respectively.
[0151] To further characterize the FPB NCs, their homogeneity and size were evaluated using a transmission electron microscope (TEM) and a dynamic light scattering (DLS) analyzer, as shown in Figure 5. TEM analysis confirmed that the FPB NCs form a uniform and clearly defined spherical nanocage structure. The average size of the FPB NCs was measured to be 24.8 ± 6.3 nm. Meanwhile, the ST-Ftn cores forming the 24-multimer nanocages were found to have an average diameter of 11.8 ± 2.3 nm, which is 2.1 times smaller than that of the FPB NCs. This indicates that the FPB NCs were assembled to have a much larger size than the ST-Ftn.
[0152] In addition, to evaluate the in vitro functionality of purified FPB NC, TLR5 stimulating activity was analyzed in comparison with free FlaB, and the results are shown in Figure 6. Free FlaB and FPB NC were compared at two concentrations (6 nM and 12 nM) while adjusted to the same molar ratio. As a result, FPB NC induced an increase in NF-κB activity of 3.50 times (6 nM) and 2.82 times (12 nM) compared to free FlaB. These results indicate that FPB NC exposes more TLR5 binding domains on its surface than free FlaB. In the case of free FlaB, the TLR5 binding domain is partially obscured due to the axial assembly of monomers; however, in FPB NC, it appears that the simultaneous binding of tPspA to the ferritin core prevented the obscuration of the TLR5 binding domain caused by the homologous polymerization of FlaB. This prediction was also confirmed by the structural simulation results in Figure 1. By utilizing the SpyTag / SpyCatcher click model, functional FlaB adjuvants and tPspA antigens could be successfully expressed on the surface of ferritin core nanocages.
[0153]
[0154] Experimental Example 3. Experiment on mucosal immune response to intranasal immunization of FPB NC compared with FlaB-tPspA inoculation
[0155] Previous studies have shown that FlaB-tPspA fusion proteins administered intranasally (IN) induce a stronger antibody response in the mucosa and systemic immune system than a mixture of FlaB and tPspA. Furthermore, it was hypothesized that FPB NC would induce a stronger immune response to tPspA than FlaB-tPspA because it can more potently induce TLR5 activity and present antigens multivalency.
[0156] To compare the tPspA-specific antibody responses induced by FPB NC and FlaB-tPspA fusion proteins, intranasal immunization was performed on BALB / c mice. The experimental groups consisted of three different compositions: PBS alone, FlaB-tPspA 6.5 μg, or FPB NC 14.5 μg. Two weeks after the final vaccination, serum, nasal wash, bronchoalveolar lavage fluid (BALF), and saliva were collected, and tPspA-specific antibody titers were analyzed using an enzyme immunoassay (ELISA) and are shown in Figures 8 and 9. As a result, as shown in Figure 8, the FlaB-tPspA (13.8 ± 0.742 Log2) and FPB NC (14.6 ± 0.521 Log2) inoculated groups showed similar levels of tPspA-specific serum IgG titers (not statistically significant when comparing FlaB-tPspA vs. FPB NC, nsP > 0.05). Nevertheless, compared to FlaB-tPspA (5.4 ± 0.846 Log2) inoculation, FPB NC inoculation (10.4 ± 0.581 Log2) induced a more potent anti-tPspA serum IgA response (***P < 0.001). These results suggest that FPB NC may induce IgA class switching more potently, and that IgG responses are similarly activated between FPB NC and FlaB-tPspA.
[0157] In particular, as shown in Figure 9, FPB NC-inoculated mice (BALF 6.4 ± 0.562; nasal lavage 6.4 ± 0.476; saliva 6.4 ± 0.338 Log2) showed significantly increased secretory IgA (sIgA) responses in BALF, nasal lavage, and saliva compared to FlaB-tPspA-inoculated mice (BALF 1.8 ± 0.757; nasal lavage 2.7 ± 0.616; saliva 3.4 ± 0.542 Log2).
[0158] Taken together, these results indicate that intranasal FPB NC vaccination induces a stronger sIgA response than tPspA-FlaB fusion vaccination.
[0159]
[0160] Experimental Example 4. Experiment to Confirm the Efficient B-Cell Differentiation and Antibody Maturation Effects of FPB NC Vaccine Compared with FlaB-tPspA
[0161] Experiments were conducted to confirm the induction effect on long-term plasma cells and memory B cells, which are one of the important functions of preventive vaccines. To confirm the superior effect of FPB NC compared to FlaB-tPspA, long-term plasma cells in the bone marrow and memory B cells in the spleen were investigated using the ELISPOT assay and are shown in Figure 10. As a result, FPB NC (12.25 ± 2.839 IgA-producing plasma cells / 10 6 Bone marrow cells; 13.5 ± 2.901 memory B cells / 10 6 FlaB-tPspA (3.5 ± 0.645 IgA-producing plasma cells / 10) in mice immunized with splenocytes 6 Bone marrow cells; 1.0 ± 0.707 memory B cells / 10 6The number of IgA-producing plasma cells and memory B cells was significantly higher than in mice immunized with splenocytes. This result is consistent with the systemic and secreted IgA production patterns in serum and mucosal secretions. It was confirmed that the FPB NC inoculation group had a superior ability to induce long-term memory B cells and plasma cells that produce IgA antibodies.
[0162] In addition, to evaluate the qualitative difference in antibody response between FPB NC and FlaB-tPspA vaccine, a modified ELISA capable of evaluating the affinity (binding power, avidity) of tPspA-specific antibodies was performed, and the results are shown in Fig. 11.
[0163] As a result, as shown in Figure 11, after the second immunization, FPB NC immunization induced a higher affinity index (affinity index, 0.500 ± 0.023) of tPspA-specific serum IgG than FlaB-tPspA immunization (affinity index, 0.235 ± 0.066) (*P< 0.01, FlaB-tPspA vs. FPB NC). After the third immunization, there was no significant difference, suggesting that antibody maturation had stalled. These results suggest that the FPB NC vaccine promotes B-cell differentiation and antibody maturation more efficiently than the FlaB-tPspA fusion protein vaccine.
[0164]
[0165] Experimental Example 5. Confirmation of a balanced immune response to the FPB NC vaccine
[0166] To evaluate the extent of Th1 / Th2 immune balance induced by FPB NC vaccination compared to the FlaB-tPspA group, tPspA-specific IgG in antiserum 2aThe / IgG1 ratio was measured, and the tPspA-specific production of IFN-γ, IL-4, and IL-17 in splenocytes was evaluated. The results of the measurements and evaluations are shown in Figures 12 and 13. As a result, a statistically significant difference was observed, with tPspA-specific IgG in the FPB NC immune group (0.925 ± 0.045) compared to the FlaB-tPspA group (0.581 ± 0.084). 2a The / IgG1 ratio was significantly higher (**P< 0.01; Figure 4D). IgG observed in the FPB NC vaccine group 2a The fact that the / IgG1 ratio is higher than that of the FlaB-tPspA group suggests that the FPB NC vaccine may be more effective in inducing a cell-mediated immune response.
[0167] In addition, as can be seen in Figure 13, mice vaccinated with the FPB NC vaccine showed significantly increased production of IFN-γ (7.56 ± 0.841 ng / ml) and IL-17 (1932.8 ± 198.15 pg / ml) compared to mice not vaccinated with the vaccine compared to FlaB-tPspA-immunized mice (3.69 ± 0.631 ng / ml IFN-γ and 584.4 ± 214.18 pg / ml IL-17) (FlaB-tPspA vs. FPB NC; IFN-γ, *P< 0.05 and IL-17, **P< 0.01). These results suggest that the nanocage mucosal vaccine may be more effective than the protein hybrid vaccine in activating antigen-specific Th1 and Th17 responses.
[0168]
[0169] Experimental Example 6. Confirmation of the delivery effect of antigen and flagellin enhancer to drainage lymph nodes
[0170] In light of the principle that to induce an effective antibody response, antigens must encounter B cells in the germinal center (GC) after reaching the draining lymph node and receive sufficient assistance from follicular helper T cells (Tfh) and follicular dendritic cells (FDC), and that GC-B-Tfh-FDC interactions have a significant impact on isotype conversion, affinity maturation, and memory formation, the distribution of FPB NCs in the lymph nodes after in vivo administration was tracked. FPB NCs and FlaB-tPspA were conjugated with the FNR675 dye and injected subcutaneously (SC) into the groin of mice. Specifically, 7-week-old BALB / c mice were immunized subcutaneously (SC) into the groin with PBS, 30 μg of FNR675-conjugated FlaB-tPspA, or 30 μg of FNR675-conjugated FPB NCs. Three hours after administration, inguinal lymph node (iLN) sections were prepared and confocal microscopy was performed using anti-CD11c, anti-B220, and anti-CD169 antibodies, and the results are shown in Fig. 14.
[0171] As a result, distinct antigen distribution patterns between FPB NC and FlaB-tPspA were observed using a confocal microscope 3 hours after administration. Animals vaccinated with FPB NC showed a higher frequency of red fluorescence corresponding to FNR675-conjugated FPB NC compared to animals vaccinated with FlaB-tPspA. Additionally, more CD11c+ dendritic cells were recruited to the FPB NC release sites, suggesting that more potent antigen presentation may have contributed to the enhanced efficacy of humoral and cellular immune responses.
[0172] FBP NC delivery in drained lymph nodes was confirmed by flow cytometry following administration using the method described above, as shown in Figure 15. As a result, when the same amount was administered, a higher number of CD11c+ cells were observed in the drained lymph nodes (2.202 ± 0.087% for FPB NC and 1.622 ± 0.141% for FlaB-tPspA). In mice administered FPB NC (1.38 ± 0.245%), CD11c+ cells were associated with a higher FNR675 signal than in mice administered FlaB-tPspA (0.628 ± 0.112%) (P<0.05). FPB NC was shown to actively interact with and expand CD169+ subcapsular macrophages. The subcapsular macrophage layer was significantly thicker in lymph nodes immunized with FPB NC than in lymph nodes immunized with FlaB-tPspA. In the thickened subcapsular macrophage layer, FPB NCs were closely associated with macrophages.
[0173] To evaluate the involvement of FlaB enhancers interacting with CD169+ subcapsular sinus macrophages, ferritin nanocages expressing only the FlaB enhancer (Ftn:FlaB:FB NC) and ferritin nanocages expressing only the tPspA antigen (Ftn:tPspA; FP NC) were designed. Both nanocages were then conjugated to FNR675. Subsequently, these conjugated proteins were subcutaneously injected into BALB / c mice, and inguinal lymph nodes (iLN) were collected 3 hours later to investigate the cavitation of NCs and CD169+ cells via FACS analysis. FNR675 signals associated with CD169+ cells in drained lymph nodes were observed to be significantly higher in mice administered FPB NC (3.76 ± 0.499%) and FB NC (3.06 ± 0.324%) compared to the Ftn NC group (0.623 ± 0.123%) or FP NC (1.147 ± 0.253%). These results suggest that FlaB plays an important role in the association between nanocages and CD169+ subcapsular sinus macrophages. Nanoparticles are known to have easy access to the lymphatic system and are drained directly into lymph node sinuses, including the subcapsular and medullary sinuses, within minutes. While B cell regions were extensively expanded even after 3 hours following FPB NC administration, this was not the case with FlaB-tPspA administration. This implies that nanocage molecules were efficiently delivered to lymph nodes, and their translocation to B cell regions presumed to have been piggybacked by sinus macrophages was promoted, thereby inducing more robust B cell expansion and differentiation.
[0174]
[0175] Experimental Example 7. Confirmation of GC formation and Tfh expansion effects of FPB NC
[0176] Germinal centers (GCs) play a crucial role in humoral immune responses by promoting the production of high-affinity antibodies, isotype class switching, and long-term memory B cells. To evaluate GC formation, FPB NCs and FlaB-tPspA were administered intranasally twice at one-week intervals. Specifically, BALB / c mice were inoculated intranasally (IN) twice at one-week intervals with a total of 20 μl PBS, 50 μg FlaB-tPspA, or 50 μg FPB NC per mouse. One week after the last immunization, cLNs were collected, and fresh LNs isolated after frozen sectioning were observed for GCs; the results are shown in Figures 16 and 17. Tissue sections (7 μm) were cut and placed on charged slides, and the tissue sections were stained with markers for FDCs (CD21 / 35), B cells (B220), activated GC B cells (GL7), and T cells (CD3).
[0177] As a result, GC formation was confirmed by the co-localization of B220 and GL7. FPB NC (716.0 ± 61.45 counts) significantly enhanced GC formation compared to the FlaB-tPspA (418.59 ± 30.73 counts) group. GC formation induced by FPB NC administration was eliminated in TLR5KO mice, suggesting an essential role for the flagella-TLR5 signaling axis in the GC response induced by FPB NC. Furthermore, the same experiment was repeated with a single subcutaneous (SC) administration in iLN. The same results were observed, with FPB NC appearing to significantly induce GC formation, and this effect being eliminated in TLR5KO mice.
[0178] Tfh cells assist GC B cells in promoting proliferation, survival, and differentiation through TB-like cell interactions. Here, Tfh induction was evaluated by flow cytometry, and the results are shown in Figure 18. FPB NC (0.219 ± 0.0090%) induced a much larger number of Tfh cells compared to the FlaB-tPspA (0.138 ± 0.011%) and PBS (0.106 ± 0.018%) groups, which implies that FPB NC has a better effect on B cell expansion, activation, and differentiation in GC.
[0179]
[0180] Experimental Example 8. Confirmation of protective effect of FPB NC vaccine against lethal pathogens
[0181] To evaluate the protective efficacy of the FPB NC vaccine, experiments were conducted by infecting the nasal cavity with a lethal dose of Streptococcus pneumoniae following the final immunization. 1.9 × LD50 was administered to each BALB / c mouse inoculated with FPB NC or FlaB-tPspA. 50 of S. pneumoniae WU2 and 1.7 × LD50 50S. pneumoniae D39 was administered intranasally. Specifically, mouse groups were vaccinated intranasally (IN) with PBS, 6.5 μg of FlaB-tPspA, or 14.5 μg of FPB NC at 2-week intervals for three doses. Subsequently, the animals were closely monitored for clinical signs of disease, including body weight loss and reduced quality of life, and the results are shown in Figure 19. As a result, on day 6 after vaccination with the pneumococcal WU2 homologous serotype, 100% of the FPB NC vaccination group survived (***P< 0.001, FPB NC versus PBS). As indicated by the 55.6% survival rate observed on day 6 (*P< 0.05, compared to the PBS group), FlaB-tPspA vaccination also elicited a significant protective response. The protective effect of FPB NC was significantly superior to that of FlaB-tPspA (*P< 0.05, FlaB-tPspA vs. FPB NC), and in an experiment against the heterologous serotype D39 of S. pneumoniae, the FPB NC vaccine showed a 100% survival rate on day 6 (***P< 0.001 for PBS vs. FPB NC). Furthermore, in both experiments, the quality of life of animals vaccinated with the FPB NC vaccine was significantly better. The group vaccinated with FPB NC did not exhibit noticeably severe symptoms such as rapid heart rate, lethargy, or fur wrinkles. In contrast, the FlaB-tPspA group showed mild symptoms, while the PBS group showed distinct pathological symptoms. These results suggest that the FPB NC vaccine significantly enhances defense against lethal challenges from both homologous and heterologous pneumococci compared to the FlaB-tPspA fusion protein vaccine. The FPB NC vaccine induces a superior antibody response and a more comprehensive range of protective immune responses (cross-protection).
[0182] To investigate the significant improvement in protective effects of FPB NC vaccination compared to FlaB-tPspA, bacterial loads in lung tissue, bronchoalveolar lavage fluid (BAL-F), and blood were evaluated. Balb / c mice were inoculated intranasally with either the FlaB-tPspA fusion protein or FPB NC three times. After 2 weeks, mice were given live Streptococcus pneumoniae WU2 (0.6 × 10⁸ CFU / mouse; 0.6 × LD⁻¹ 50) was administered intranasally. 72 hours after administration, colony-forming units (CFU) of Streptococcus pneumoniae were measured in lung tissue, BAL-F, and blood. Additionally, the presence of Streptococcus pneumoniae in these compartments was quantified by qPCR using primers targeting the 16S rRNA gene. Unlike the unvaccinated PBS control group (5.707 ± 0.244; log10 CFU / g) or the FlaB-tPspA (4.290 ± 0.696 log10 CFU / g) vaccinated group (PBS vs. FlaB-tPspA: nsP > 0.05), no colony-forming bacteria were detected in the lung tissue of FPB NC vaccinated mice (PBS vs. FPB NC: ***P< 0.001; FlaB-tPspA vs. FPB NC: **P< 0.01) (Fig. 20). These results indicate that the FPB NC vaccine induced a stronger protective immune response than the FlaB-tPspA vaccine in inhibiting the growth of Streptococcus pneumoniae in the lungs. In the qPCR data summarizing the results regarding colony formation, the FPB NC group (4.130 ± 0.294; log10 count / g) also showed a significant reduction in bacteria compared to the FlaB-tPspA group (6.537 ± 0.511; log10 count / g) (FlaB-tPspA vs FPB NC: **P< 0.01). The bacterial count in the BAL-F samples was similar to that of lung tissue. When live Streptococcus pneumoniae WU2 was administered to PBS control mice 72 hours after intranasal infection, a bacterial count of 5.93 ± 0.42 (log10 CFU / ml) was detected in the blood, suggesting the bloodstream invasiveness of the WU2 strain. On the other hand, CFU and qPCR tests could not detect trace amounts of bacteria in the blood of the FlaB-tPspA or FPB NC vaccinated groups (Fig. 20), which indicates that both vaccinations effectively inhibit bacterial invasion into the bloodstream.Histological examination of lung tissue after BAL-F preparation revealed that the FPB NC vaccine group had less lung damage than other groups, and in particular, parenchymal inflammation and bronchitis characteristics were reduced (Fig. 21). These results indicate that the FPB NC vaccine induces a quantitatively and qualitatively improved protective immune response compared to the FlaB-tPspA vaccine, significantly reducing the bacterial load in the lower respiratory tract and preventing subsequent entry into the bloodstream.
[0183] In summary, the FPB NC vaccine induces a significantly enhanced sIgA response in the mucosal compartment and balanced systemic Th1 / Th2 immune modulation, showing enhanced protective effects against S. pneumoniae infection compared to the FlaB-tPspA vaccine.
[0184] The scope of protection of the present invention is not limited to the description of the embodiments explicitly explained above. Furthermore, the scope of protection of the present invention cannot be limited by obvious modifications or substitutions in the technical field to which the present invention belongs.
[0185] The present invention enables the multivalent presentation of antigens and flagellin adjuvants on the surface of ferritin nanocages using a SpyTag-SpyCatcher system, and provides increased efficiency of vaccine formulations, enhanced B cell maturation and memory formation, increased T cell activity, and enhanced protective effects.
Claims
1. Protein nanocage fused with SpyTag; Antigen protein fused with the first SpyCatcher; and Nanoparticles containing an adjuvant fused with a second SpyCatcher.
2. In Paragraph 1, The above protein nanocage is a nanoparticle that is a ferritin nanocage.
3. In Paragraph 1, The above antigen protein is a nanoparticle in which the antigen protein is PspA (pneumococcal surface protein A).
4. In Paragraph 3, The above PspA is a nanoparticle in which tPspA (truncated pneumococcal surface protein A) containing an alpha helical region of PspA.
5. In Paragraph 1, The above-mentioned adjuvant is a nanoparticle that is FlaB protein (Flagellin B).
6. In Paragraph 1, The above SpyTag is a nanoparticle that is fused to the N-terminus of the above protein nanocage.
7. In Paragraph 1, The above antigen protein is a nanoparticle that is fused to the C-terminus of the above first SpyCatcher.
8. In Paragraph 1, The above-mentioned immunoadjuvant is a nanoparticle that is fused to the C-terminus of the above-mentioned second SpyCatcher.
9. In Paragraph 1, Nanoparticles in which the molar ratio of the immunoadjuvant to the antigen protein is 0.5 to 3.
10. In Paragraph 1, The above nanoparticles are nanoparticles having a size of 10 to 200 nm.
11. A vaccine composition comprising any one of the nanoparticles of claims 1 to 10.
12. In Paragraph 11, The above vaccine composition is a mucosal vaccine. 13.(a) A step of fusing a SpyTag to the N-terminus of a protein nanocage; (b) A step of fusing the antigen protein to the C-terminus of the first SpyCatcher; (c) fusing an adjuvant to the C-terminus of the second SpyCatcher; and (d) A method for manufacturing nanoparticles comprising the step of mixing the nanocage obtained in step (a), the protein complex obtained in step (b), and the protein complex obtained in step (c). A method for manufacturing nanoparticles, wherein the mixture of the nanocage obtained in step (a), the protein complex obtained in step (b), and the protein complex obtained in step (c) is formed in a molar ratio of 1:1 to 2:1 to 2.
14. In Paragraph 13, A method for manufacturing nanoparticles in which the above protein nanocage is a ferritin nanocage.
15. In Paragraph 13, A method for manufacturing nanoparticles in which the antigen protein is PspA (pneumococcal surface protein A).
16. In Paragraph 13, A method for manufacturing nanoparticles, wherein the above PspA is tPspA (truncated pneumococcal surface protein A) containing an alpha helical region of PspA.
17. In Paragraph 13, A method for manufacturing nanoparticles in which the above-mentioned immune adjuvant is FlaB protein (Flagellin B).