Minimally invasive resilient nanostructured biosensing electrode
The microneedle biosensing platform with a resilient nanostructured bioelectrode addresses the limitations of current dosing practices by providing real-time pharmacokinetic monitoring, ensuring accurate drug dosing and early detection of organ dysfunction, thereby enhancing personalized medicine.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- RGT UNIV OF CALIFORNIA
- Filing Date
- 2025-11-26
- Publication Date
- 2026-06-04
AI Technical Summary
Current clinical dosing practices rely on generalized patient characteristics and sporadic blood tests, failing to account for individual variations in lifestyle, demographics, and genetic factors, leading to inaccurate dosing of highly toxic drugs and delayed detection of organ dysfunction, particularly in underrepresented populations.
A microneedle biosensing platform integrating a resilient nanostructured bioelectrode (RNB) for durable, high-SNR measurements of molecules in-skin, paired with a customized analytical framework to derive blood-equivalent PK parameters, enabling real-time pharmacokinetic monitoring of drug clearance and organ function.
The platform provides early, actionable insights into organ damage and enables personalized dosing strategies by accurately estimating drug exposure and detecting organ dysfunction before conventional biomarkers, reducing the risk of underdosing or overdosing.
Smart Images

Figure US2025057284_04062026_PF_FP_ABST
Abstract
Description
Atty. Dkt. 102352-1171MINIMALLY INVASIVE RESILIENT NANOSTRUCTURED BIOSENSING ELECTRODECROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is based on and claims priority to United States Provisional Patent Application No.: 63 / 726,149 filed November 27, 2024, the contents of which are incorporated herein by reference in their entirety.STATEMENT OF GOVERNMENT SPONSORED RESEARCH
[0002] This invention was made with government support under 1847729 awarded by the National Science Foundation. The government has certain rights in the invention. Research for this invention was supported by awards from the Cystic Fibrosis Foundation.TECHNICAL FIELD
[0003] The present embodiments relate generally to health and more particularly to a minimally invasive resilient nanostructured biosensing electrode that directly monitors renal / hepatic drug clearance.BACKGROUND
[0004] Tailoring treatment strategies to an individual’s dynamic biochemistry and organ function is the cornerstone of personalized medicine (Wishart, D. S. Emerging applications of metabolomics in drug discovery and precision medicine. Nat. Rev. Drug Discov. 15, 473-484 (2016); Gambardella, V. et al. Personalized medicine: recent progress in cancer therapy. Cancers 12, 1009 (2020)). This approach is essential for mitigating lifethreatening complications associated with the precision dosing of highly toxic drugs with narrow therapeutic indices (NTI), such as specific antibiotics and chemotherapeutics (Wicha, S. G. et al. From therapeutic drug monitoring to model-informed precision dosing for antibiotics. Clin. Pharmacol. Ther. 109, 928-941 (2021); de Man, F. M., Goey, A. K. L., van Schaik, R. H. N., Mathijssen, R. H. J. & Bins, S. Individualization of irinotecan treatment: a review of pharmacokinetics, pharmacodynamics, and pharmacogenetics. Clin. Pharmacokinet. 57, 1229-1254 (2018)). Underdosing these drugs reduces their efficacy, while overdosing can lead to irreversible damage to organs responsible for drug clearance (e.g., the kidneys and liver) and other severe side effects (Nolin, T., Naud, J., Leblond, F. &Atty. Dkt. 102352-1171Pichette, V. Emerging evidence of the impact of kidney disease on drug metabolism and transport. Clin. Pharmacol. Ther. 83, 898-903 (2008); Rowland, M., Peck, C. & Tucker, G. Physiologically-based pharmacokinetics in drug development and regulatory science. Annu. Rev. Pharmacol. Toxicol. 51, 45-73 (2011); Verbeeck, R. K. Pharmacokinetics and dosage adjustment in patients with hepatic dysfunction. Eur. J. Clin. Pharmacol. 64, 1147-1161 (2008)).
[0005] Current clinical dosing practices rely on generalized patient characteristics (age, height, weight) and sporadic blood tests that only provide delayed snapshots of drug levels and organ function (Ates, H. C. et al. On-site therapeutic drug monitoring. Trends Biotechnol. 38, 1262-1277 (2020)). Statistical models used to contextualize static blood measurements relative to dynamic clearance processes struggle to account for individual variations in lifestyle, demographics, and genetic factors (FIG. 6A) (de Velde, F., Mouton, J. W., de Winter, B. C. M., van Gelder, T. & Koch, B. C. P. Clinical applications of population pharmacokinetic models of antibiotics: challenges and perspectives. Pharmacol. Res. 134, 280-288 (2018); Darwich, A. S. et al. Model-informed precision dosing: background, requirements, validation, implementation, and forward trajectory of individualizing drug therapy. Annu. Rev. Pharmacol. Toxicol. 61, 225-245 (2021)), particularly leading to poor outcomes for underrepresented populations due to biased training data (Levey, A. S., Titan, S. M., Powe, N. R., Coresh, J. & Inker, L. A. Kidney disease, race, and GFR estimation. Clin. J. Am. Soc. Nephrol. 15, 1203 (2020); Cerdena, J. P., Plaisime, M. V. & Tsai, J. From race-based to race-conscious medicine: how anti -racist uprisings call us to act. The Lancet 396, 1125-1128 (2020)). Moreover, surrogate biomarkers used for organ assessment, such as creatinine for kidney health, suffer from significant delay after onset of organ dysfunction, limiting timely intervention (Edelstein, C. L. Biomarkers of Kidney Disease. (Academic press, 2016)).
[0006] It is against this technological backdrop that the present Applicant sought a technological solution to these and other problems rooted in this technology.SUMMARY
[0007] The present embodiments relate to a microneedle biosensing platform for dual therapeutic drug monitoring (TDM) and metabolic organ function assessment. This platform integrates a resilient nanostructured bioelectrode (RNB) onto microneedle forAtty. Dkt. 102352-1171 durable, high-SNR measurements of molecules in-skin and pairs the RNB’s readings with a customized analytical framework to derive blood-equivalent PK parameters. A resilient nanostructured bioelectrode of embodiments supports various sensing interfaces and transduction mechanisms beyond aptamer-based surfaces and electrochemical transduction. For example, it is compatible with enzymatic sensors, molecular pendulum electrochemical sensors, and sensors based on electrical transduction via field-effect transistors. A biosensing electrode of embodiments can be integrated into diverse devices beyond microneedles. For example, it can be equivalently incorporated onto soft, stretchable, or flexible substrates for sensing scenarios requiring conformal coverage. A biosensing platform of embodiments can monitor biomarker dynamics across different biofluid and tissue environments beyond interstitial fluid and skin. For example, it can be used to monitor blood, sweat, urine, saliva, cerebrospinal fluid (CSF) and can be applied to monitor various organs and tumors.BRIEF DESCRIPTION OF THE DRAWINGS
[0008] These and other aspects and features of the present embodiments will become apparent to those ordinarily skilled in the art upon review of the following description of specific embodiments in conjunction with the accompanying figures, wherein:
[0009] FIGs.1 A to ID illustrate aspects of a wearable therapeutic drug monitoring (TDM) and online organ function assessment via resilient nanostructured bioelectrode (RNB) according to embodiments.
[0010] FIGs. 2 A to 2Q illustrate aspects of fabrication and functionalization of RNB for electrochemical sensors according to embodiments.
[0011] FIGs.3 A to 3H illustrate aspects of surface mechanical characterization of RNB according to embodiments.
[0012] FIGs.4A to 4K illustrates aspects of integrated wearable TDM device and hepatic clearance according to embodiments.
[0013] FIGs. 5 A to 50 illustrate aspects of kidney clearance quantification and early prediction according to embodiments.Atty. Dkt. 102352-1171
[0014] FIGs. 6A and 6B illustrate a comparison between conventional blood-based TDM and wearable ISF-based TDM for drug monitoring and organ function assessment according to embodiments.
[0015] FIG. 7 illustrates an example fabrication process comparison between the method of embodiments and conventional methods for nanoporous functionalization.
[0016] FIGs. 8A to 8F illustrate a comparison of electrochemical dealloying techniques for nanoporous gold (npAu) film fabrication according to embodiments.
[0017] FIGs. 9A to 9D illustrate a characterization of reagent-free electrochemical sensors on RNB according to embodimnets.
[0018] FIGs. 10A to 10F illustrate an example customized wireless potentiostat according to embodiments.
[0019] FIGs. 11 A to 1 IF illustrate example principles and performance of tissue specific kinetic differential measurement (TKDM) for drift canceling according to embodiments.
[0020] FIG. 12 illustrates two-compartment pharmacokinetic model for peripheral monitoring. The central compartment represents the central bloodstream, while the peripheral compartment represents tissue fluids. mO is the total amount of drug dosed. Drug transfer between these compartments occurs via perfusion and circulation at rates K12 and K21, with elimination at rate K10. Vc and Vp are the volumes of distribution in the central and peripheral compartments, and Xc and Xp represent the drug concentrations in these compartments, respectively.
[0021] FIG. 13 illustrates example cyclic voltammetry patterns electrode with different adhesion layers in PBS. CV profiles of electrodes with heterogeneous adhesion, non-adhesion, and homogeneous adhesion (our solution). Experiment performed in an electrochemical cell containing phosphate buffered saline. Scan rate: 0.1 V / s.
[0022] FIG. 14 illustrates corrosion current of different nanoporous gold electrodes. Corrosion current for nanoporous gold electrodes fabricated from different methods. The electrochemical etching was performed at +0.5 V v.s. Ag / AgCl in phosphate buffered saline for 300 s. Error bars indicate S.D. (n = 3).
[0023] FIG. 15 illustrates a calibration curve for phenylalanine aptamer sensor. Response of phenylalanine aptamer sensor on RNB. Error bars indicate S.D. (n = 3). Insets show square wave voltammograms, with arrows indicating increasing concentration.Atty. Dkt. 102352-1171
[0024] FIG. 16 illustrates a graph of electrochemical surface area (ECSA) of electrode with homogenous adhesion only and RNB via ORR. CV patterns in 50 mM H2SO4 (scan rate: 50 mV / s) showing ORR (oxygen reduction reaction) and the peak current can be used for quantification of ECSA. After nanostructured, the ECSA was enlarged 77 times.
[0025] FIG. 17 is a calibration curve for vancomycin aptamer sensor on RNB and disc electrode. The enhancement of the sensitivity comes from the Knudsen diffusion behavior of the target analyte. Error bars indicate S.D. (n = 3).
[0026] FIG. 18 are calibration curves before and after fouling. Sensor response for vancomycin before and after continuous operation in undiluted FBS for 9 days. Error bars indicate S.D. (n = 3).
[0027] FIG. 19 illustrates fouling performance of nanodendritic sensors. Sensor response decay in FBS for vancomycin on nanoporous and nanoparticle-based electrodes. Shaded areas represent standard deviations (n = 3).
[0028] FIG. 20 illustrates Young’s modulus of artificial tissues (AT) with different agarose content. The result is derived from standard compression testing and linear fitting of the elastic region.
[0029] FIG. 21 illustrates sensor response for an irinotecan sensor using a wireless circuit of embodiments and a commercialized potentiostat.
[0030] FIG. 22 illustrates pharmacokinetic profiles of vancomycin in blood. Vancomycin concentrations measured by LC-MS over time in healthy rat administered with doses of 20 mg / kg, 40 mg / kg, and 60 mg / kg.
[0031] FIG. 23 illustrates AUC and fitting mean squared error over measurement time in a measurement. The AUC represents area under the curve calculated from Equation 3.
[0032] FIG. 24 illustrates correlation between drug clearance (CL) in interstitial fluid (ISF) and blood without one-point calibration. Clearance measured from ISF are plotted against those from blood, showing a correlation coefficient of R2= 0.74.DETAILED DESCRIPTION
[0033] The present embodiments relate to a microneedle biosensing platform for dual therapeutic drug monitoring (TDM) and metabolic organ function assessment.Atty. Dkt. 102352-1171
[0034] By way of background, wearable biomonitoring via microneedle biosensors that access and analyze interstitial fluid (ISF) offers a promising solution to address the above-described limitations of current clinical dosing practices (Friedel, M. et al. Opportunities and challenges in the diagnostic utility of dermal interstitial fluid. Nat. Biomed. Eng. 7, 1541-1555 (2023); Zheng, M., Sheng, T., Yu, J., Gu, Z. & Xu, C. Microneedle biomedical devices. Nat. Rev. Bioeng. 2, 324-342 (2024); Heikenfeld, J. et al. Accessing analytes in biofluids for peripheral biochemical monitoring. Nat. Biotechnol. 37, 407-419 (2019); Vora, L. K. et al. Microneedle-based biosensing. Nat. Rev. Bioeng. 2, 64- 81 (2024)). This approach facilitates continuous molecular measurements, enabling tracking of biochemical processes in a minimally invasive manner. However, despite this potential, the adoption of ISF-based monitoring for therapeutic drug management remains limited due to persistent device engineering challenges and the lack of clinical interpretability frameworks (Kim, G., Ahn, H., Chaj Ulloa, J. & Gao, W. Microneedle sensors for dermal interstitial fluid analysis. Med-X 2, 15 (2024)).
[0035] From a device engineering standpoint, the miniaturization of microneedle tips, essential for minimal invasiveness, fundamentally reduces signal intensity (Saha, K., Agasti, S. S., Kim, C., Li, X. & Rotello, V. M. Gold nanoparticles in chemical and biological sensing. Chem. Rev. 112, 2739-2779 (2012); Rosi, N. L. & Mirkin, C. A. Nanostructures in biodiagnostics. Chem. Rev. 105, 1547-1562 (2005); Tavallaie, R. et al. Nucleic acid hybridization on an electrically reconfigurable network of gold-coated magnetic nanoparticles enables microRNA detection in blood. Nat. Nanotechnol. 13, 1066- 1071 (2018)). The high-interference, low-volume ISF environment within friction-prone subcutaneous tissue further challenges measurement fidelity. While these challenges are generally manageable for high-concentration analytes like glucose and lactate (via enzymatic-amperometric sensing) (Wang, Y., Wu, Y. & Lei, Y. Microneedle-based glucose monitoring: a review from sampling methods to wearable biosensors. Biomater. Sci. 11, 5727-5757 (2023)), they become restrictive for low-concentration therapeutics such as antibiotics and chemotherapeutics (Gerson, J. et al. High-precision monitoring of and feedback control over drug concentrations in the brains of freely moving rats. Sci. Adv. 9, eadg3254 (2023); Li, S. et al. Implantable Hydrogel-Protective DNA Aptamer-Based Sensor Supports Accurate, Continuous Electrochemical Analysis of Drugs at Multiple Sites in Living Rats. ACS Nano 17, 18525-18538 (2023); Rasdal, A., Brauker, J. H., Neale, P. V.Atty. Dkt. 102352-1171& Simpson, P. C. Integrated receiver for continuous analyte sensor. (2009); Friedel, M. et al. Continuous molecular monitoring of human dermal interstitial fluid with microneedle- enabled electrochemical aptamer sensors. Lab. Chip 23, 3289-3299 (2023); Reynoso, M. et al. 3D-printed, aptamer-based microneedle sensor arrays using magnetic placement on live rats for pharmacokinetic measurements in interstitial fluid. Biosens. Bioelectron. 244, 115802 (2024); Ogata, G. et al. A microsensing system for the in vivo real-time detection of local drug kinetics. Nat. Biomed. Eng. 1, 654-666 (2017); Wu, Y. et al. Microneedle aptamer-based sensors for continuous, real-time therapeutic drug monitoring. Anal. Chem. 94, 8335-8345 (2022); Seo, J.-W. et al. Real-time monitoring of drug pharmacokinetics within tumor tissue in live animals. Sci. Adv. 8, eabk2901 (2022); Tehrani, F. et al. An integrated wearable microneedle array for the continuous monitoring of multiple biomarkers in interstitial fluid. Nat. Biomed. Eng. (2022) doi:10.1038 / s41551-022-00887-l; Downs, A. M. et al. Nanoporous Gold for the Miniaturization of In Vivo Electrochemical Aptamer- Based Sensors. ACS Sens. 6, 2299-2306 (2021)).Table 1 : In vivo microneedle and microprobe continuous electrochemical aptamer biosensorsAtty. Dkt. 102352-1171
[0036] Self-assembled receptor-transducer mechanisms, such as electrochemical aptamer biosensing (EAB), have proven effective for analyzing these drugs in in-vitro or invasive direct blood applications (Pellitero, M. A., Shaver, A. & Arroyo-Curras, N. Critical review — approaches for the electrochemical interrogation of DNA-based sensors: a critical review. J. Electrochem. Soc. 167, 037529 (2019); Dauphin-Ducharme, P. et al.Electrochemical aptamer-based sensors for improved therapeutic drug monitoring and high- precision, feedback-controlled drug delivery. ACS Sens. 4, 2832-2837 (2019)). However, for transdermal use within the interstitial space, these interfaces must be simultaneously coupled with signal enhancement and sensor protection mechanisms to ensure reliable performance (see Table 2).Table 2: Comparison of system requirements for continuous biomonitoring in the central(blood) and peripheral (ISF) compartments.Atty. Dkt. 102352-1171
[0037] Alternative approaches aiming to circumvent these requirements, including decoupling sampling and sensing, such as hydrogel-based microneedles for ISF sampling and analyte routing to epidermal EAB sensors, introduce significant diffusion delays (Keyvani, F. et al. A hydrogel microneedle assay combined with nucleic acid probes for onsite detection of small molecules and proteins. Angew. Chem. 135, e202301624 (2023)). For example, a 1 mm distance results in a 30-minute delay for vancomycin measurements. Nanostructuring microneedle electrodes could help with enhancing signal without adding delay (Chen, J. B. et al. Nanostructured architectures for biomolecular detection inside and outside the cell. Adv. Funct. Mater. 30, 1907701 (2020)), but it has been discovered that current interfaces, such as extruded nanodendritic or nanoporous implementations, have poor mechanical resilience. Extruded nanodendritic-based designs are prone to breakage due to tissue-induced stress at the base. Nanoporous electrode implementations, which theoretically offer sensor protection, are limited by stress-induced cracking and decohesion during fabrication when adapting conventional methods to create films on microneedle substrates (Seker, E., Reed, M. L. & Begley, M. R. Nanoporous gold: fabrication, characterization, and applications. Materials 2, 2188-2215 (2009); Mahr, C. et al. Quantitative determination of residual silver distribution in nanoporous gold and its influence on structure and catalytic performance. J. Catal. 352, 52-58 (2017)). These defects lead to pronounced electrochemical corrosion and eventual device failure.
[0038] From a clinical interpretability perspective, pharmacokinetic (PK) measurements with minute-level temporal resolution over the clearance period are crucial for characterizing ISF-blood molecular perfusion and diffusion processes during drug filtration and metabolism (Kiang, T. K. L., Hafeli, U. O. & Ensom, M. H. H. A comprehensive review on the pharmacokinetics of antibiotics in interstitial fluid spaces in humans: implications on dosing and clinical pharmacokinetic monitoring. Clin. Pharmacokinet. 53, 695-730 (2014)). However, the absence of bioanalytical tools has impeded the development of analytical frameworks to contextualize ISF readings amidst biological variability, such as blood-to-ISF analyte partitioning (Wu, J., Liu, H., Chen, W., Ma, B. & Ju, H. Device integration of electrochemical biosensors. Nat. Rev. Bioeng. 1,Atty. Dkt. 102352-1171346-360 (2023)). As a result, correlations between peripheral ISF and blood-based PK parameters remain largely phenomenological, with the relationship between ISF readings and metabolic organ clearance still unexplored (Vieira, P. A. et al. Ultra-high-precision, in- vivo pharmacokinetic measurements highlight the need for and a route toward more highly personalized medicine. Front. Mol. Biosci. 6, (2019); Arroyo-Curras, N. et al. Real-time measurement of small molecules directly in awake, ambulatory animals. Proc. Natl. Acad. Sci. 114, 645-650 (2017)).
[0039] To overcome these problems, among others, the present embodiments relate to a microneedle biosensing platform that integrates a resilient nanostructured bioelectrode (RNB) onto a microneedle for durable, high-SNR measurements of molecules in-skin. In these and other embodiments, the RNB’s readings are paired with a customized analytical framework to derive blood-equivalent PK parameters.
[0040] The present embodiments will now be described in detail with reference to the drawings, which are provided as illustrative examples of the embodiments so as to enable those skilled in the art to practice the embodiments and alternatives apparent to those skilled in the art. Notably, the figures and examples below are not meant to limit the scope of the present embodiments to a single embodiment, but other embodiments are possible by way of interchange of some or all of the described or illustrated elements. Moreover, where certain elements of the present embodiments can be partially or fully implemented using known components, only those portions of such known components that are necessary for an understanding of the present embodiments will be described, and detailed descriptions of other portions of such known components will be omitted so as not to obscure the present embodiments. Embodiments described as being implemented in software should not be limited thereto, but can include embodiments implemented in hardware, or combinations of software and hardware, and vice-versa, as will be apparent to those skilled in the art, unless otherwise specified herein. In the present specification, an embodiment showing a singular component should not be considered limiting; rather, the present disclosure is intended to encompass other embodiments including a plurality of the same component, and vice-versa, unless explicitly stated otherwise herein. Moreover, applicants do not intend for any term in the specification or claims to be ascribed an uncommon or special meaning unless explicitly set forth as such. Further, the present embodiments encompass present and future known equivalents to the known components referred to herein by way of illustration.Atty. Dkt. 102352-1171
[0041] FIGs.1 A to ID illustrate aspects of a wearable therapeutic drug monitoring (TDM) and online organ function assessment via resilient nanostructured bioelectrode (RNB) according to embodiments. For example, FIG. 1 A is a schematic illustrating the RNB-enabled TDM and real-time liver / kidney function assessment. In the top of the figure, illustrated is global drug distribution post-administration, detailing the liver and kidney's respective metabolic and filtration mechanisms. The green dots in the figure represent the drug molecules. In the bottom of the figure, illustrated is an example bilayer RNB design for high-fidelity wearable TDM according to embodiments. FIG. IB further illustrates an example bilayer structure of the RNB. As shown in the top of the figure, an homogeneous inert gold adhesion layer ensures secure adhesion and minimizes surface cracking, leading to artifact-free electrochemical measurements. As shown in the bottom of FIG. IB, the concave nanoporous layer improves SNR by reducing local stress concentrations, offering intrinsic antifouling properties, and enhancing diffusion. FIG. 1C illustrates tissue pharmacokinetics modeled using a two-compartment system, where peripheral measurements can be calibrated with single-point blood samples under free diffusion conditions. FIG. ID illustrates direct organ function assessment via real-time pharmacokinetic measurements. In the top of the figure, illustrated are changes in pharmacokinetics, with reduced drug clearance indicating the onset of organ dysfunction. The bottom of FIG. ID illustrates quantified pharmacokinetic parameters (e.g., clearance rates) that facilitate early detection of organ dysfunction (e.g., kidney) and enable timely intervention.
[0042] With reference to the above described figures, as illustrated, an example design of the RNB, which hosts electrochemical receptor-based sensing interfaces such as EABs, follows a bilayer architecture (FIGs. 1 A and IB, FIG. 7): 1) a micrometer-thick homogeneous gold adhesion layer 102 that uniformly coats the conductive substrate 104 (e.g. microneedle), and 2) a high-quality nanoporous gold (npAu) layer 106 — fabricated through a stress-mitigated dealloying process — for effective receptor immobilization. The gold adhesion layer 102 provides a wide operational potential window, enhanced anticorrosion performance, and mechanical stability to withstand surface stresses during nanostructure fabrication. The concave nanostructured interface 106 minimizes stress concentration under tissue friction, effectively shielding the sensing monolayer and ensuring sensor durability in MPa-level stiffness tissue environments. Additionally, this interface 106Atty. Dkt. 102352-1171 enhances SNR by facilitating self-diffusion and enabling size-based exclusion of fouling agents.
[0043] Leveraging the RNB’s robust in-vivo performance, the analytical framework specifically taps into a previously unexplored ISF-blood equilibrium diffusion condition to directly quantify PK parameters (FIG. 1C). In small animal studies, the platform’s ability to accurately estimate total drug exposure was validated, guiding dosing adjustments for therapeutics such as vancomycin. More importantly, it can be demonstrated that the platform provides early, actionable insights into organ damage by capturing kinetic data on drug clearance by the kidney or liver — ahead of the point at which conventional surrogate biomarkers (e.g., creatinine) detect changes. By uncovering complex biochemical relationships between peripheral tissue dynamics and deep organ function, the present platform paves the way for future patient-centric strategies in precision dosing and organ health monitoring.
[0044] To assist in understanding aspects of the above described features, FIGs. 6A and 6B illustrate a comparison between conventional blood-based TDM and wearable ISF- based TDM for drug monitoring and organ function assessment that is enabled by embodiments. As shown in FIG. 6A, conventional TDM relies on blood-based methods to assess a patient’s hepatic and renal function using population-level data. Physiological blood tests, such as hepatic panels and renal panels, estimate hepatic metabolism ability and glomerular filtration, which are used to predict hepatic and renal clearance for drugs metabolized in the liver and kidneys, respectively. However, this approach often introduces errors due to the reliance on biased population data, which may not accurately reflect individual patient variations. Furthermore, there is no unified index for hepatic clearance due to its diversity in enzymatic metabolite pathway. After these physiological assessments, a dosing plan is formulated. However, the turnaround time for TDM is lengthy due to scattered TDM data points collected intermittently through blood draws and lab analyses. This delay in data collection and analysis results in a prolonged period before adjustments can be made to the dosing plan based on the patient’s actual metabolic response. The entire process is prone to potential error propagation from the use of populational data, which may result in inaccurate dosing decisions due to the diverse demographic and genetic backgrounds of patients, particularly for underrepresented groups.Atty. Dkt. 102352-1171
[0045] As shown in FIG. 6B, a wearable ISF -based TDM approach according to embodiments addresses these challenges by enabling continuous, high-resolution therapeutic drug monitoring in ISF. This ISF-based method provides a minimally invasive alternative that circumvents the need for frequent blood draws. It allows real-time pharmacokinetic measurements, including drug clearance, with high SNR. The bioelectrode used enables the assessment of key PK parameters, such as area under the curve (AUC), maximum concentration (Cmax), half-life, and drug clearance (CL) for improved personalized medication.
[0046] Development and characterizations of RNB
[0047] FIGs. 2 A to 2Q illustrate aspects of fabrication and functionalization of RNB for electrochemical sensors according to embodiments. In summary, FIG. 2A is a schematic illustrating the gold homogenous adhesion layer, which provides mechanical strength to support upper nanostructures. FIG. 2B provides cross-sectional optical microscopy images of RNB, showing the gold adhesion layer (202) and the metal needle substrate (204). FIG. 2C illustrates a potential window of the nanoporous electrode with different adhesion layers. The top shapes represent characteristic redox voltages for common electrochemical redox reporters: AQ: anthraquinone; NB: Nile blue; MB: methylene blue; Os(ii / iii): Os(ii / iii) organometallic complex; Fc: ferrocene. FIG. 2D illustrates electrochemical active surface area changes of different electrodes after etching at +0.5 V (vs. Ag / AgCl) in PBS over varying durations. Shaded areas represent standard deviations (n = 3). FIG. 2E provides microscopy images showing morphological changes after etching: The top of FIG. 2E illustrates an electrode with heterogeneous adhesion showing exacerbated delamination; in the bottom, illustrated is an electrode with homogenous adhesion showing minimal surface change. FIG. 2F is a schematic showing nanoporous structure formation by silver dealloying and dynamic monitoring via electrochemical quartz crystal microbalance (EQCM). The top left illustrates how SMD controls dealloying speed, minimizing surface tension and yielding high-quality nanopores; The top right of the figure illustrates how traditional rushed dealloying leads to surface cracking due to excess surface tension. In the bottom, illustrated is a continuous weight loss measurement by EQCM during dealloying. FIG. 2G provides dealloying profiles for different methods: SMD (stress-mitigated dealloy), EC-IT (constant voltage at 1.2 V vs. Ag / AgCl), EC-CV (cyclic voltammetry at 100 mV / s from 0.35 V to 1.35 V), andAtty. Dkt. 102352-1171HNO3@65°C (immersing electrode in 70% wt.% HNO3 at 65°C). FIG. 2H provides SEM images of nanoporous electrodes fabricated using different methods. FIG. 21 provides CV patterns in 50 mM H2SO4 (scan rate: 50 mV / s) for different nanoporous electrodes, showing ORR (oxygen reduction reaction). FIG. 2J illustrates quality factors calculated from the ORR peaks for various nanoporous electrodes. FIG. 2K illustrates an example sensing mechanism of an MB-aptamer monolayer. FIGs. 2L to 2N illustrate example sensor response to vancomycin (1), irinotecan (m), and doxorubicin (n) using RNB. Error bars indicate standard deviations (n = 3). Insets show square wave voltammograms (SWV), with arrows indicating increasing concentration. FIG. 20 illustrates an example relationship between CV peak current of MB and scan rate for RNB and disc electrodes in PBS containing 500 pM MB. Error bars, standard deviations (n = 3). The inset illustrates enhanced multiple electrode-analyte interactions (top) for RNB and single interaction (bottom) for disc electrodes. FIG. 2P provides B-values derived from FIG. 20. FIG. 2Q illustrates SWV signal decay in fetal bovine serum for vancomycin sensors on different electrodes. The inset illustrates selective protein blocking for RNB and fouling for disc electrodes. Shaded areas represent standard deviations (n = 3).
[0048] With reference to the above described figures, to develop an example RNB according to embodiments, a gold layer 202 (e.g. about 500 nm) was first electrochemically plated onto the needle substrate 204 (FIG. 2A), which unifies the materials of the adhesionpromoting layer 202 and the nanostructured function layer 206 (e.g., gold) for robust and inert connection. The electrochemical plating of layer 202 also creates passive nucleation, which improves gold coverage over surface irregularities, including lateral sites such as steps or defects. This uniform coverage effectively separates the underlying substrate materials from the electrolyte and suppresses the undesirable reaction from the adhesion material itself (Schenk, R. The corrosion properties of titanium and titanium alloys, in Titanium in medicine: material science, surface science, engineering, biological responses and medical applications (eds. Brunette, D. M., Tengvall, P., Textor, M. & Thomsen, P.) 145-170 (Springer, Berlin, Heidelberg, 2001). doi: 10.1007 / 978-3-642-56486-4_6). Additionally, the increased thickness of the adhesion layer 202 improves its mechanical strength for electrode modification (i.e., dealloy) compared with traditional nanometer layers which crack under high surface tension (FIG. 2B) (Windischmann, H. Intrinsic stress in sputter-deposited thin films. Crit. Rev. Solid State Mater. Sci. 17, 547-596 (1992);Atty. Dkt. 102352-1171Evans, A. G., Drory, M. D. & Hu, M. S. The cracking and decohesion of thin films. J. Mater. Res. 3, 1043-1049 (1988)).
[0049] To test the operation potential window, cyclic voltammetry (CV) characterizations in phosphate buffered saline (PBS) were compared. The electrodes with homogeneous adhesion remained inert up to +1 V (vs. Ag / AgCl), whereas electrodes with traditional heterogeneous adhesion (e.g. a layer of 50 nm Titanium via sputtering) remained stable only up to +0.3 V (FIG. 13). The inert potential window derived from CV profiles was overlaid with the signature redox potentials of commonly used redox reporters for biosensing (FIG. 2C) (Kang, D., Ricci, F., White, R. J. & Plaxco, K. W. Survey of redoxactive moieties for application in multiplexed electrochemical biosensors. Anal. Chem. 88, 10452-10458 (2016)). The RNB’s widening of potential window 212 is enabling for detecting various biomarkers through different sensing modalities (Li, H., Arroyo-Curras, N., Kang, D., Ricci, F. & Plaxco, K. W. Dual-reporter drift correction to enhance the performance of electrochemical aptamer-based sensors in whole blood. J. Am. Chem. Soc. 138, 15809-15812 (2016)).
[0050] To evaluate electrochemical long-term resilience, electrodes with different adhesion layers were interrogated under a high voltage of +0.5 V (vs. Ag / AgCl) for an extended time in PBS. Intermittently, the electrochemical surface area (ECSA) was quantified by CV at varying scan rates in low voltage (FIG. 2D) (Bard, A. J., Faulkner, L. R. & White, H. S. Electrochemical Methods: Fundamentals and Applications. (John Wiley & Sons, 2022)). The corrosion current measured at the beginning of the experiment also demonstrated the extent of exposed underlying materials and corresponding unwanted reactions (FIG. 14). Electrodes with heterogeneous adhesion exhibited rapid ECSA increases following the etching as shown in FIG. 2D, with optical images 214 also revealing the exacerbation of surface delamination post-etching (FIG. 2E, top). Those electrodes also dissolved completely after ~30 minutes of etching. Conversely, RNB with homogeneous adhesion showed minimal change in ECSA and surface morphology over 42 hours of continuous interrogation, indicating remarkable electrochemical robustness, as shown by images 216 in FIG. 2E, bottom.
[0051] To fabricate high-quality npAu film (e.g. 206) on top of the adhesion layer (e.g. 202), a precursor alloy was first deposited through co-sputtering of silver and gold, followed by a stress-mitigated dealloying (SMD) procedure (electrochemical etching at aAtty. Dkt. 102352-1171 low scan rate of 5 mV / s, FIG. 2F, left) to selectively remove silver and form a nanoporous gold layer. Unlike a traditional dealloying procedure using strong acid etching which results in abrupt volume contraction and cracks 222 in the adhesion layer (e.g. illustrated in FIG. 2F, left), the SMD technique enabled a more controlled dealloying process, evident from the reduced etching current than other electrochemical dealloying techniques (FIG. 2F, right, FIG. 9). The electrochemical quartz crystal microbalance (EQCM) 224 was utilized to confirm the reduced dealloying speed from SMD (FIG. 2G, left) (Tsai, W.-Y., Taberna, P - L. & Simon, P. Electrochemical quartz crystal microbalance (EQCM) study of ion dynamics in nanoporous carbons. J. Am. Chem. Soc. 136, 8722-8728 (2014)). The SMD provides gold atoms enough time to diffuse and reorganize to form a highly ordered structure with fewer defects (Dixon, M. C. et al. Preparation, structure, and optical properties of nanoporous gold thin films. Langmuir 23, 2414-2422 (2007)). SEM images cross-validated that the nanoporous gold formed by SMD has a more uniform surface, with smooth ligaments and a smaller feature size compared to other dealloying methods (FIG. 2H(i) vs. FIGs. 2H(ii) to 2H(iv)).
[0052] To assist in understanding aspects of the above described features, FIG. 7 further illustrates an example fabrication process comparison between the present embodiments and conventional methods for nanoporous functionalization, including a detailed fabrication flow chart for microneedle-shaped RNB for minimally invasive tissue access. The process begins with adhesion: the present embodiments use electrochemical plating to create a homogeneous gold adhesion layer, providing an electrochemically inert and stable interface with tissues. In contrast, conventional methods employ heterogeneous adhesion by depositing nanometer-thick layers of materials such as Ti or Cr, which often results in reduced mechanical strength and susceptibility to surface cracking. Next, both methods involve co-sputtering silver and gold atoms (Ag67Au33) to form an alloy precursor, setting up the electrode for dealloying process. For dealloying, the present embodiments leverage the SMD process, utilizing an electrochemical method that gradually increases voltage through linear sweep voltammetry (LSV) to achieve a controlled dealloying rate. This process creates a high-quality nanoporous gold structure with fewer defects. By minimizing surface stress and reducing unwanted reactions, the SMD method promotes long-term electrochemical stability and corrosion resistance. In contrast, conventional dealloying methods, such as nitric acid corrosion or rushed electrochemicalAtty. Dkt. 102352-1171 dealloying, often induce higher surface stress, cracks, and structural defects, which can ultimately compromise the sensor's long-term stability.
[0053] To evaluate the quality of the resulting npAu electrodes, analyzed was the surface gold oxygen reduction reaction (ORR) using CV in 0.05 M H2SO4 solution (FIG. 21), where the peak broadening 232 in FIG. 2J indicates increased unwanted reactions or gold heterogeneity, and peak height correlates with ECSA (Xiao, X., Si, P. & Magner, E. An overview of dealloyed nanoporous gold in bioelectrochemistry. Bioelectrochemistry 109, 117-126 (2016); Trasatti, S. & Petrii, O. A. Real surface area measurements in electrochemistry. Pure Appl. Chem. 63, 711-734 (1991); Veselinovic, J., AlMashtoub, S., Nagella, S. & Seker, E. Interplay of effective surface area, mass transport, and electrochemical features in nanoporous nucleic acid sensors. Anal. Chem. 92, 10751-10758 (2020)). Therefore, the sharpness of the CV peaks reflects the electrochemical quality of the npAu, quantified using the quality factor:Quality factor = Ipeak / F WHM ( 1 ) where the Ipeak is the ORR peak current in mA and FWHM is full width at half maximum in V. The present RNBs exhibited the highest peak height and narrowest peak width, indicating improved surface quality as shown by 234 in FIG. 2J.
[0054] Owning to widened potential windows and a high-quality gold surface, RNB supports a variety of electrochemical sensing mechanisms. In one study, three reagent-free sensor interfaces were fabricated: (1) an electroenzymatic lactate sensor, which operates at +0.5 V (vs. Ag / AgCl) using amperometry (FIGs. 9A and 9B); (2) an ion-selective pH sensor, functioning under open-circuit potential conditions (FIGs. 9C and 9D); and (3) monolayer-based methylene blue aptamer sensors designed for various pharmaceutical drugs. In these aptamer sensors, methylene blue was attached as a redox reporter to convert biomarker-induced aptamer conformational changes into measurable signals via square wave voltammetry (SWV), as shown in FIG. 2K (Lin, S. et al. Wearable microneedle-based electrochemical aptamer biosensing for precision dosing of drugs with narrow therapeutic windows. Sci. Adv. 8, eabq4539 (2022); Wu, Y. & Arroyo-Curras, N. Advances in nucleic acid architectures for electrochemical sensing. Curr. Opin. Electrochem. 27, 100695 (2021); Gerson, J. et al. High-precision monitoring of and feedback control over drugAtty. Dkt. 102352-1171 concentrations in the brains of freely moving rats. Sci. Adv. 9, eadg3254 (2023)). The sensor’s signal, corresponding to the reduction peak of methylene blue, was used to construct the calibration curve. To demonstrate the versatility of the aptamer-based sensor, four sensors for vancomycin, irinotecan, doxorubicin, and phenylalanine were developed on RNB (FIG. 2L to FIG. 2N and FIG. 15).
[0055] After fabricating the biosensors, the mechanisms of intrinsic sensor SNR enhancement for RNB were explored in three different aspects in terms of aptamer-based sensing specifically. Firstly, the ECSA was enlarged 77 times compared to the physical area of the needle indicated by the gold ORR peak height (FIG. 16), allowing more recognition molecules to be immobilized (Arroyo-Curras, N., Scida, K., Ploense, K. L., Kippin, T. E. & Plaxco, K. W. High surface area electrodes generated via electrochemical roughening improve the signaling of electrochemical aptamer-based biosensors. Anal. Chem. 89, 12185-12191 (2017)). This in situ signal amplification enables device miniaturization without compromising SNR, maintaining high spatial resolution and reducing physiological disturbances such as inflammation (Williams, D. F. On the mechanisms of biocompatibility. Biomaterials 29, 2941-2953 (2008)), a capability not achievable with electrode arrays.
[0056] Secondly, the concave structure of the RNB electrode endows the analyte with Knudsen diffusion behavior (Malek, K. & Coppens, M.-O. Effects of surface roughness on self- and transport diffusion in porous media in the knudsen regime. Phys. Rev. Lett. 87, 125505 (2001); Park, S., Kim, H. C. & Chung, T. D. Electrochemical analysis based on nanoporous structures. Analyst 137, 3891-3903 (2012); White, R. J. & White, H. S. Electrochemistry in nanometer-wide electrochemical cells. Langmuir 24, 2850-2855 (2008)). This was demonstrated using "b-value" analysis based on the voltammograms peak current of freely moving methylene blue molecules at both nanoporous 252 and standard planar 254 electrodes as shown in FIG. 20 (see example methods described below) (Choi, C. et al. Achieving high energy density and high power density with pseudocapacitive materials. Nat. Rev. Mater. 5, 5-19 (2020)). A b-value close to 1 suggests that electrode operation within the Knudsen regime — meaning that once the analyte enters the pore structure, it is likely to stay within the nanostructure with enhanced heterogeneous electron transfer probabilities. In contrast, a b-value close to 0.5 suggests a diffusion-dominated process and indicates minimal surface confinement (FIG. 2P). Thus, the enhanced selfdiffusion provided by the nanoporous structure improves the sensor's sensitivity toAtty. Dkt. 102352-1171 biomarkers, as shown in FIG. 17 for a vancomycin sensor, which is particularly important for detecting low-concentration biomarkers.
[0057] Thirdly, the antifouling capabilities and improved stability of the monolayer brought by the selective blocking of npAu were assessed by continuous operation of the vancomycin sensor in undiluted fetal bovine serum (FBS) for 9 days. The sensor 270 of embodiments experienced a modest 20% decline in signal, with negligible change in its sensitivity, as indicated by 262 in FIG. 2Q and FIG. 18. In contrast, sensors based on traditional disc electrodes or nanodendritic electrodes exhibited significant signal degradation as shown by 264 in FIG. 2Q and in FIG. 19. This enhancement in signal retention can be attributed to the concave geometry of the nanoporous structure of 270 limits interactions between the external biomatrix (such as large proteins and amphipathic molecules 266) and the monolayer itself (Daggumati, P., Matharu, Z., Wang, L. & Seker, E. Biofouling-resilient nanoporous gold electrodes for DNA sensing. Anal. Chem. 87, 8618— 8622 (2015)). These factors together confer superior SNR for RNB based sensors, enabling their continuous operation for an extended period with high fidelity measurement.
[0058] To assist in understanding aspects of the above described features, FIGs. 8A to 8F illustrate a comparison of electrochemical dealloying techniques for nanoporous gold (npAu) film fabrication. FIG. 8A provides voltage-time and FIG. 8B provides current-time profiles for stress mitigated dealloy (SMD) method. FIG. 8C provides voltage-time and FIG. 8D provides current-time profiles for electrochemistry cyclic voltammetry (EC-CV) method. FIG. 8E provides voltage-time and FIG. 8F provides current-time profiles for electrochemistry amperometry (EC-IT) method.
[0059] To further assist in understanding aspects of the above described features, FIGs. 9A to 9D illustrate a characterization of reagent-free electrochemical sensors on RNB. FIG. 9 A provides a potential -time profile showing the sensor response at different pH conditions. The sensor operates under open-circuit potential conditions, with potential increasing in a stepwise manner as the pH changes every 200 seconds. FIG. 9B provides a pH calibration curve for the sensor, showing a linear decrease in potential as the pH increases across a wide range (n=3). FIG. 9C provides a current-time profile of the sensor response to increasing lactate concentrations. The electroenzymatic lactate sensor operates at +0.5 V (vs. Ag / AgCl) using amperometry. The sensor current increases in a stepwise manner as lactate concentration is adjusted every 100 seconds for 0.5 mM. FIG. 9DAtty. Dkt. 102352-1171 provides a lactate calibration curve showing a linear increase in sensor response with increasing lactate concentration (n=3).
[0060] Surface mechanical characterization of RNB
[0061] FIGs. 3 A to 3H illustrate aspects of surface mechanical characterization of RNB according to embodiments. In summary FIG. 3 A(i) provides an illustration of the experimental setup used to test the nanostructured needles, with artificial tissue (AT) made from 2% wt. agarose hydrogel. FIG. 3 A(ii) illustrates a mass of gold debris left inside the AT after a single insertion for three needles. Insets show optical images of the insertion sites. Error bars represent standard deviations (SD) (n = 3). FIG. 3B provides simulation results showing surface stress distribution in 3D. FIG. 3B(i) and 2D along the center line FIG. 3B(ii). A, B, C, D indicate the labeled corners in FIG. 3B(i). FIG. 3C illustrates stress concentration ratios for different geometric factors. FIGs. 3D and 3F provides SEM images of the RNB (d) and nanodendritic (f) electrodes before (top row) and after (bottom row) insertion into the AT. FIG. 3E illustrates average electrochemical signal retention after repeated insertions into the AT (n = 3). FIG. 3G illustrates soft tissue stiffness for various organs / tissues. The arrow at the bottom indicates the stiffness range in which the sensor retains 80% of its electrochemical signals after insertion. FIG. 3H illustrates sensor response in different tissues with varying vancomycin concentrations. (***P < 0.001, **P < 0.01, *P < 0.05, and “n.s ” denotes statistical non-significance; two-sided, two-sample t- tests).
[0062] With reference to the above described figures, in advancing the biosensor towards in vivo biomonitoring, deploying the electrode at the target site without compromising the integrity of the sensing interface is especially important (Zhang, S., Geryak, R., Geldmeier, J., Kim, S. & Tsukruk, V. V. Synthesis, assembly, and applications of hybrid nanostructures for biosensing. Chem. Rev. 117, 12942-13038 (2017)). To evaluate the mechanical robustness of RNB, surface structure detachment, and function layer damage after tissue interaction were compared to electrodes with commonly used nanodendritic surfaces (Li, M. et al. Programming biosensing sensitivity by controlling the dimension of nanostructured electrode. Anal. Bioanal. Chem. 411, 4085-4092 (2019)), wherein all the electrodes provide a same level of surface area enhancement. To construct the tunable ex vivo testing platform, artificial tissue (AT) models made from the agarose hydrogel were fabricated to simulate epidermal tissue stiffness (2% wt., E = 180 KPa) andAtty. Dkt. 102352-1171 used to challenge the electrodes (FIG. 3A(i)). The optical microscopy images 302 of the AT post-application revealed substantial debris from the nanodendritic electrodes, indicating surface breakage (FIG.3 A(ii), inset). In contrast, the AT tissue underwent the challenge of nanoporous electrodes showing a clean, spotless hole (e.g. 304). The mass of gold debris left inside the gel was quantified by inductively coupled plasma mass spectrometry (ICP- MS) in FIG. 3 A(ii) (Thomas, R. Practical Guide to ICP-MS : A Tutorial for Beginners, Second Edition. (CRC Press, 2008). doi: 10.1201 / 9781420067873). The result of 306 shows that nanodendritic electrodes shed over 30 micrograms of gold into the AT with a single insertion, whereas the RNB in 308 showed no detectable gold signals comparable to the AT-only control group. These results highlight the superior mechanical resilience of the RNB.
[0063] A finite element analysis simulation was carried out to examine the mechanical behavior of two distinct morphologies under surface friction from tissue. The introverted and extroverted structures were modeled as cylindrical shapes with varying diameters (D) and lengths (L). A laminar viscous liquid flow passed through these geometries to simulate the tissue and nanostructures interaction (van Gerwen, D. J., Dankelman, J. & van den Dobbelsteen, J. J. Needle-tissue interaction forces - a survey of experimental data. Med. Eng. Phys. 34, 665-680 (2012)). The stress distribution for both cases was calculated in three dimensions, as depicted in FIG. 3B(i), and the stress along the centerline of each structure is presented in FIG. 3B(ii). In the extroverted case, critical stress points appeared at the base corners, whereas the introverted structure exhibited minimal stress concentration. The stress accumulation was quantitatively compared using the ratio q (maximum stress to average loading stress along the flow direction, as shown in FIG. 3C). As the extroverted structure elongated (increasing L / D ratio), q sharply increased as shown by 312, indicating that the enhanced surface area from longitudinal extension compromised mechanical robustness. In contrast, the introverted structure exhibited a negligible increase q as shown by 314, suggesting that it enlarged surface area without loss of mechanical strength, making it more suitable for in vivo sensing applications.
[0064] In addition, the RNB’s introverted structure can protect the sensor function layer from direct tissue abrasion and maintain unobstructed electron transfer chains. To assess the anti-abrasion performance, repeatedly inserting an RNB aptamer sensor into artificial tissues (AT) with different Young’s modulus (1 kPa to 1 MPa) that simulate theAtty. Dkt. 102352-1171 mechanical properties of soft biological tissues (FIG. 20) was performed. The RNB demonstrated exceptional mechanical resilience (FIGs. 3D and 3E), exhibiting only a 4.9 ± 2.6% signal reduction after a single insertion and a 14.1 ± 3.1% reduction after 10 insertions into AT with a modulus of 930 kPa as shown by 322. In contrast, the conventional nanodendritic electrodes experienced a drastic 62.8 ± 5.7% signal loss after repeated insertions as shown by 324 (FIG. 3E, right). Subsequent SEM analysis cross-validated the result by comparing the morphology change pre- and post- AT insertion. The RNB retained its micrometer-scale smoothness and displayed negligible change after the interrogation, attributed to its introverted structures with ligament sizes up to 100 nm (FIG. 3D). In contrast, nanodendritic surfaces feature fractal structures from nanometers to hundreds of micrometers, which showed significant deformation and breakage after tissue interaction as shown in FIG. 3F, underscoring the challenges of maintaining high signal-to-noise ratio (SNR) in tissues of moderate stiffness, such as skin or tumors as shown in FIG. 3G.
[0065] To demonstrate that the mechanical robustness of the RNB endows the sensor's capability to access and sense across various tissues, the vancomycin concentration variation in different soft tissues was probed as demonstrated in FIG. 3H (Guimaraes, C. F., Gasperini, L., Marques, A. P. & Reis, R. L. The stiffness of living tissues and its implications for tissue engineering. Nat. Rev. Mater. 5, 351-370 (2020); McKee, C. T., Last, J. A., Russell, P. & Murphy, C. J. Indentation versus tensile measurements of young’s modulus for soft biological tissues. Tissue Eng Part B Rev 17, 155-164 (2011); Liu, J., Zheng, H., Poh, P. S. P., Machens, H.-G. & Schilling, A. F. Hydrogels for engineering of perfusable vascular networks. Int. J. Mol. Sci. 16, 15997-16016 (2015)). By simply inserting a bundled electrode (including microneedle reference and counter electrodes in addition to a working electrode of embodiments) into the tissue, the increasing of vancomycin concentration in ex vivo tissue can be distinguished, including those with high Young’s modulus-like tendon. This demonstrates the RNB-based sensor's broad applicability for analyzing biomarker levels in tissues across the whole spectrum of stiffness.
[0066] Equivalence of Clearance Measured from Peripheral and Blood-Based Analysis
[0067] In the following study, utilized was a two-compartment model to interpret the in vivo pharmacokinetic (PK) data (FIG. 12). Previous research only studies the 1Atty. Dkt. 102352-1171 pharmacokinetic parameters correlation observationally under specific drug or measurement setups (Gerson, J. et al. A high-precision view of intercompartmental drug transport via simultaneous, seconds-resolved, in situ measurements in the vein and brain. Br. J.Pharmacol. 181, 3869-3885 (2024)). Here, it was proved that the high temporal resolution peripheral recording could provide a mathematical equilibrium result of certain PK parameter including drug clearance (CL) and area under curve (AUC) as traditional bloodbased TDM (Supplementary Note 1). In short, the sensor’s response signal (R) measured from peripheral compartment can be represented as:where Z, a, and P are PK parameters that can be calculated from the regression fitting; t is time after injection. After the fitting, the drug clearance can be calculated using the formula:CL = (eUmo aP) / (Z(a - P)) (3) where c is the isotropic diffusion coefficient depending on the drug’s property. U is the sensor’s calibration factor and mo is the total dosage of the drug. The expression contains only peripheral accessible parameters or constants, which means the determination of the drug clearance does not rely on any blood-based analysis result. The calibration factor can be either determined from the pre-calibration or blood-based calibration to remove the device-by-device variation.
[0068] Integrated wearable TDM device and hepatic clearance
[0069] FIGs.4A to 4K illustrates aspects of integrated wearable TDM device and hepatic clearance according to embodiments. FIG. 4A illustrates an example integrated wearable microneedle therapeutic drug monitoring (TDM) system for in vivo testing. FIG. 4A(i) is a photo of a rat carrying the device. FIG. 4 A(ii) illustrates a flexible printed circuit board acting as a wearable potentiostat. FIG. 4 A(iii) is a photo of the assembled microneedle bundle 402. As shown, in the example bundle 402 there are three electrodes: RE: reference electrode; CE: counter electrode; WE: working electrode. FIG. 4B illustrates morphology of HDFs cultured on the RNB with live (top, green) and dead (bottom, red) staining. NC: negative control (blank); PC: positive control (added 70 v / v % ethanol). FIG.Atty. Dkt. 102352-11714C illustrates fluorescence intensity of live HDFs cultured with medium exposed to electrodes for 7 days. NC: negative control (blank); PC: positive control (10 pg / mL AgNCh). The error bars indicate the SD of two biological and two technical replicates. (***P < 0.001; two-sided, two-sample t-tests). FIG. 4D and 4E illustrate an experimental design for acute liver damage induction (d) and the expected delay in drug clearance (e). FIG. 4F illustrates Hematoxylin and eosin (H&E)-stained images of rat liver with (top) and without (bottom) CCh injection. The top images demonstrate normal hepatic lobular structure, and the bottom images show fat vacuoles in centrilobular areas (round white space). FIG. 4G illustrates serum alanine transaminase (ALT) levels in rats with and without CCh injection. FIGs. 4H and 41 provide Pharmacokinetic (PK) curves of irinotecan in a healthy rat (h) and a rat with acute liver damage (i). FIGs. 4J and 4K illustrate sensor- derived pharmacokinetic parameters including half-life (j) and clearance (k) for healthy and acute liver-damaged rats, (n = 4) (***p < 0.001, **P < 0.01, *P < 0.05; two-sided, two- sample t-tests).
[0070] With reference to the above described figures, to enable minimally invasive wearable TDM, the RNB was further engineered into an integrated wearable device including 1) a three-electrode microneedle sensor (reference, counter and working electrodes, as can be appreciated by those skilled in the art) and 2) a flexible wireless electronic system serving as a wearable potentiostat (FIG. 4A(i) to 4A(iii), FIG. 10A to 10F and methods). Signal fidelity of the wireless system-acquired results was validated by comparing them with those from a commercial potentiostat (FIG. 21), which confirms the device's capability for high-quality in vivo signal acquisition.
[0071] Prior to in vivo application, the biocompatibility of RNB-based sensors was assessed. Human dermal fibroblasts (HDFs) cultured on the RNB exhibited normal spindle- shaped morphology and activity after 48 hours, indicating no cytotoxic effects (FIG. 4B). Long-term biocompatibility tests, involving a 7-day electrode incubation in medium followed by cell culture and staining at different time points, showed no significant differences in cell viability (FIG. 4C). These results confirm the suitability of RNB electrodes for extended contact with biological tissues.
[0072] In the first animal study shown in FIG. 4D, validated was the high-fidelity measurement of hepatic-metabolized drugs (specifically irinotecan) and the corresponding on-site analytic algorithm to monitor changes in rat liver metabolism (Chabot, G. G.Atty. Dkt. 102352-1171Clinical pharmacokinetics of irinotecan. Clin. Pharmacokinet. 33, 245-259 (1997)). Upon intravenous (IV) administration, irinotecan is transported to the liver and hydrolyzed to its active metabolite, 7-Ethyl-10-hydroxycamptothecin (SN-38), by carboxylesterases. The efficacy and toxicity of irinotecan-based chemotherapy depend significantly on liver metabolic function (Vanhoefer, U. et al. Irinotecan in the treatment of colorectal cancer: clinical overview. J. Clin. Oncol. 19, 1501-1518 (2001)). Impaired liver function can delay the conversion of irinotecan to SN-38, prolonging drug presence in the system, which is reflected in a delayed clearance phase in the interstitial fluid (ISF) concentration profiles (FIG. 4E).
[0073] To simulate acute liver damage in rats, carbon tetrachloride (CCh) was administered intraperitoneally (IP), inducing hepatocellular damage (Sun, F. et al. Evaluation of oxidative stress during apoptosis and necrosis caused by carbon tetrachloride in rat liver. Biochim. Biophys. Acta BBA - Mol. Basis Dis. 1535, 186-191 (2001)). Histopathological analysis using H&E staining post-administration confirmed the emergence of steatosis, as shown in FIG.4f. Biochemical assessment of liver function showed increased levels of alanine aminotransferase (ALT) in rats with CCh injection (FIG. 4G), confirming the hepatocellular damage. To demonstrate the liver function's impact on pharmacokinetic (PK) patterns, minimally invasive TDM was performed using the present device on both healthy and liver-damaged rats following a single dose of irinotecan. For in vivo sensing, signal drifting is a common phenomenon that depends on various mechanisms, including thermal desorption, electrochemically induced desorption, and bioinduced surface coverage and damage. To counteract the deviation, an internal driftcanceling technique based on tissue-specific kinetic differential measurement (TKDM) was adopted (FIGs. 11 A to 1 IF) (Ferguson, B. S. et al. Real-time, aptamer-based tracking of circulating therapeutic agents in living animals. Sci. Transl. Med. 5, 213ral65-213ral65 (2013)). As shown in FIGs. 4H and 41, the PK profile of the rats with liver damage demonstrated a significant delay in drug clearance, aligning with the observation from both histopathological and biochemical assessments. Further quantification of PK parameters, according to Equation (3), also revealed a significant increase in the drug’s half-life (FIG. 4 J) and a decrease in drug clearance (FIG. 4K). Collectively, these results demonstrate that the real-time pharmacokinetic recording with high SNR and temporal resolution is successfully achieved by the present RNB sensing device in minimally invasive fashion andAtty. Dkt. 102352-1171 can be effectively utilized to clinically diagnose abnormalities in the hepatic metabolism system.
[0074] To assist in understanding aspects of the above described features, FIGs. 11 A to 1 IF illustrate example principles and performance of tissue specific kinetic differential measurement (TKDM) for drift canceling according to embodiments. FIG. 11 A provides a phase-frequency profile that shows an aptamer sensor’s response to increasing vancomycin concentrations, with a phase shift observed as electron transfer from the redox reporter accelerates upon binding. The inset depicts the sensor's electrochemical process: in the unbound state, the redox reporter is distant from the electrode, resulting in slower electron transfer and extended depletion time. Upon vancomycin binding, electron transfer and redox depletion accelerate, leading to increased high-frequency currents and decreased low- frequency currents. This change manifests as a "signal-off1decrease in phase shift at low frequencies and a "signal-on" increase at high frequencies, reflecting enhanced electron transfer with binding. FIG. 1 IB is an equivalent circuit model of the electrochemical behavior of the EAB sensor. The circuit is modeled as a combination of resistor and capacitor elements, consisting of the solution resistance (RSOL) in series with the doublelayer capacitance (CDL). Charge-transfer resistance (RCT) and pseudocapacitance (CAD) are added in parallel with the double-layer capacitance due to Faradaic charge transfer. FIG. 11C provides a relative value-concentration plot for different elements in the equivalent circuit. The plot shows the effect of increasing vancomycin concentration on various elements. As vancomycin binds to the sensor, RCT decreases, reducing the effective resistance at the interface and allowing for faster electron transfer from the redox reporter. This change in RCT is the primary driver of the phase shift observed in the system, leading to the sensor’s sensitivity to different vancomycin concentrations (n = 3). FIG. 1 ID illustrates a normalized sensor and TKDM response over time in PBS solution containing 10 mg / mL bovine serum albumin. The top panel displays the sensor’s stepwise response at two frequencies, 10 Hz and 60 Hz, aligning with “signal-off’ and “signal-on” states, respectively, as vancomycin concentration increases from 0 to 5 pM, then to 20 pM. The bottom panel illustrates the TKDM response, which enhances signal strength and mitigates drift by integrating both “signal-on” and “signal-off’ responses. FIG. 1 IE illustrates in vivo TKDM signal tracking over time post-injection of vancomycin (20 mg / kg) was performed using a microneedle device across various frequency combinations in a rat model. TheAtty. Dkt. 102352-1171TKDM signal initially rises following the injection, peaks, and subsequently diminishes gradually as vancomycin undergoes metabolism and elimination. Variations in frequency combinations result in distinct signal intensities as well as noise level. FIG. 1 IF illustrates in vivo signal-to-noise ratio (SNR) and peak signal comparison across various frequencies used in TKDM. As the signal-on frequency increases, the peak signal continues to rise, but the SNR peaks at the “150 Hz-25 Hz” combination, indicating the optimal frequency pairing for achieving the highest SNR.
[0075] Renal clearance quantification
[0076] FIGs. 5 A to 50 illustrate aspects of kidney clearance quantification and early prediction according to embodiments. FIG. 5A illustrates an example experimental design for chronic kidney damage induction and delay in vancomycin clearance. FIG. 5B illustrates an example experiment timeline for healthy subjects; bottom numbers represent the dosage. FIG. 5C provides pharmacokinetic (PK) curves for different dosages in a rat. FIG. 5D illustrates an example correlation between the area under the curve (AUC) from interstitial fluid (ISF) measurements using the device and blood quantification using liquid chromatography-mass spectrometry (LC-MS). FIG. 5E illustrates an example experiment timeline for subjects with progressive kidney damage. FIG. 5F provides ISF PK curves at pre-diet, week 2, week 4, and week 6. Insets show blood PK curves from LC-MS measurements. FIG. 5G illustrates changes in clearance and estimated glomerular filtration rate (GFR) over the eight-week experiment. A single-point calibration was applied for ISF clearance. FIG. 5H illustrates changes in blood urea nitrogen (BUN) and serum creatinine levels over the course of the experiment. FIG. 51, the top of the figure provides Photos of kidneys at pre-diet, week 2, week 4, and week 6; the bottom of the figure provides Hematoxylin and eosin (H&E)-stained kidney images showing white blood cell casts (yellow arrows), glomerular sac atrophy (black arrows), and inflammation (red arrow). FIG. 5 J illustrates an example experiment timeline for kidney impairment and intervention. FIG. 5K illustrates changes in clearance and eGFR over the five-week experiment. A single-point calibration was applied for ISF clearance. FIG. 5L is a PK curve for a rat in the experiment shown in FIG. 4J. Correlation between clearance (CL) from device ISF measurements and LC-MS blood quantification for all valid measurements. A single-point calibration was applied for ISF clearance (N = 35). FIG. 5M illustrates how serum creatinine levels show no statistically significant difference after one week of a high-adenine diet. FIG. 5NAtty. Dkt. 102352-1171 illustrates device-measured clearance without blood calibration shows promise in detecting kidney impairment after one week of the diet, (“n.s non-statistically significant; two- sided, paired t-tests).
[0077] With reference to the above described figures, in a second animal study, employed was the RNB sensing device to explore the renal clearance process. Unlike hepatic metabolism, which lacks a widely accepted quantitative evaluation index due to diversity in biochemical processes, the glomerular filtration rate (GFR) provides a quantitative measure of renal clearance, making it an excellent parameter for validating ISF- based measurements of pharmacokinetic parameters and metabolic organ function (FIG.5 A) (Inker, L. A. & Titan, S. Measurement and estimation of GFR for use in clinical practice: core curriculum 2021. Am. J. Kidney Dis. 78, 736-749 (2021); Stevens, L. A., Coresh, J., Greene, T. & Levey, A. S. Assessing kidney function — measured and estimated glomerular filtration rate. N. Engl. J. Med. 354, 2473-2483 (2006)). In addition, conducted were three in vivo vancomycin TDM experiments, complemented by blood-based TDM using liquid chromatography-mass spectrometry (LC-MS) as a clinical benchmark for comparison. Vancomycin was chosen here to demonstrate the utility of TDM in assessing renal function, considering it is a widely used antibiotic with a narrow therapeutic index and mostly cleared through kidney filtration.
[0078] In the first vancomycin TDM study, investigated was the correlation between pharmacokinetic parameters in ISF and blood. Vancomycin was administered to rats on a weekly basis, with dosages increasing from 20 to 40 mg / kg, and reaching 60 mg / kg in the third week (FIG. 5B). The PK profiles enlarged with increasing doses of vancomycin within the same rat, as reflected in both ISF-based and blood-based TDM (FIG. 5C and FIG. 22). The area under curve (AUC), indicating total drug exposure and a critical dosing target, was calculated from both the present device measurement and blood, which shows a strong linear correlation (coefficient of determination R2 = 0.94). Furthermore, all these analyses can be performed in real-time within twice the time-to-peak (tpeak) after the initial injection, as demonstrated in the convergency analysis in FIG. 23, reducing the response time for evaluation and medical intervention.
[0079] In the second vancomycin TDM study, further demonstrated was that the present device can directly measure drug clearance via pharmacokinetic analysis, offering valuable insights into kidney function. To do so, a rat chronic kidney disease (CKD) modelAtty. Dkt. 102352-1171 was established via a replaced high adenine diet. This model also replicates the progressive impairment in GFR observed in clinical scenarios (Walser, M. Assessing renal function from creatinine measurements in adults with chronic renal failure. Am. J. Kidney Dis. 32, 23-31 (1998)). During the experiment, vancomycin (20 mg / kg) was administered weekly (FIG. 5E). FIG. 5F presents the ISF PK profile of a rat before and after replacement of the high adenine diet. The result reveals a consistent decrease in drug clearance (CL) corroborated by both blood-based and ISF-based TDM. Specifically, CL measured from ISF dropped from 5.46 mL / min pre-diet change to 0.68 mL / min by week 7, indicating significant kidney function impairment across different stages (FIG. 5G). In addition, rat blood was collected and analyzed for renal biomarkers blood urea nitrogen (BUN) and creatinine and further used to calculate the estimated GFR based on reported regression model (Besseling, P. J. et al. A plasma creatinine- and urea-based equation to estimate glomerular filtration rate in rats. Am. J. Physiol. -Ren. Physiol. 320, F518-F524 (2021)), which showed significant changes indicative of progressive kidney dysfunction (FIGs. 5G and 5H). The optical image of the rat kidney reveals significant enlargement due to cystic expansion of the tubules (FIG. 5L, top) (Diwan, V., Mistry, A., Gobe, G. & Brown, L. Adenine-induced chronic kidney and cardiovascular damage in rats. J. Pharmacol. Toxicol. Methods 68, 197-207 (2013)), corroborated by H&E pathology in FIG. 5L, bottom showing progressive kidney damage, which confirmed a progressive decline in kidney function from healthy to failure stages and cross-validated the sensor readout.
[0080] In the third vancomycin TDM study, simulated was fluctuating kidney function by alternating a high adenine diet with a normal diet and administering daily allopurinol, aiming to mimic clinical scenarios like dialysis and assess the impact of timely interventions on reducing drug toxicity (Launay-Vacher, V., Izzedine, EL, Mercadal, L. & Deray, G. Clinical review: use of vancomycin in haemodialysis patients. Crit. Care 6, 313 (2002)). The vancomycin TDM at 20 mg / kg is performed weekly as well as blood renal panel (FIG. 5 J). During the experiment, two parallel measurements from both ISF and blood consistently showed that CL was decreasing and increasing post intervention (FIG. 5K), which can be probed from the raw ISF PK measurement as shown in FIG. 51. This demonstrates that timely intervention for treatment can affect the therapeutic outcomes.
[0081] The correlation study indicates that CL measured in ISF by the present wearable device strongly correlated with blood-based clearance (FIG. 24, R2 = 0.74),Atty. Dkt. 102352-1171 showing promising potential for direct organ assessment and aiding medical decisions during pharmacotherapy. Furthermore, incorporating a single-point calibration for each device mitigates variations between devices, confirming that clearance measurements from both peripheral and blood TDM are equivalent (FIG. 5M) with a coefficient of determination reaching R2 = 0.98. This validation enhances the clinical utility of wearable devices, which have previously been limited by the absence of accurate, high-resolution peripheral tools.
[0082] To illustrate the utility of device-derived blood-free PK parameters for early detection of kidney impairment, further compared was the result at week one of diet change. The data indicated that blood creatinine levels were not adequate for detecting the onset of kidney damage, showing no significant changes and remaining below diagnostic thresholds (FIG. 5N). In contrast, a remarkable reduction in drug clearance from the device-only readout underscores its effectiveness in identifying early signs of kidney impairment (FIG. 50), thereby supporting timely clinical interventions and decision-making.
[0083] Discussion
[0084] The present embodiments provide a minimally-invasive wearable platform featuring a microneedle-based resilient nanostructured bioelectrode (RNB) for monitoring therapeutic drugs and assessing metabolic organ function. The pRNB achieves a high SNR in the interstitial space through a bilayered electrode fabrication process that incorporates a high-quality nanoporous gold interface on top of an electrochemically inert adhesion layer. By contextualizing measurements within an analytical framework based on equilibrium diffusion dynamics, the platform directly infers PK parameters of drugs cleared by the liver or kidney through peripheral measurements — an unprecedented capability with significant implications for managing therapeutic drugs with narrow therapeutic indices. By supplementing existing TDM workflows (e.g., eGFR tests), this platform can enhance therapeutic effectiveness while reducing the risk of damage to clearance organs. In this way, the pRNB sensors can address critical clinical challenges, such as vancomycin-induced acute kidney injury, which affects approximately 35% of patients undergoing combination antibiotic therapy (Hodoshima, N., Masuda, S. & Inui, K. Decreased renal accumulation and toxicity of a new VCM formulation in rats with chronic renal failure. Drug Metab. Pharmacokinet. 22, 419-427 (2007); Elyasi, S., Khalili, H., Dashti-Khavidaki, S. & Mohammadpour, A. Vancomycin-induced nephrotoxicity: mechanism, incidence, riskAtty. Dkt. 102352-1171 factors and special populations, a literature review. Eur. J. Clin. Pharmacol. 68, 1243-1255 (2012)), or chemotherapy-induced neutropenia, a dose-limiting toxicity observed in about 30% of patients receiving irinotecan (Lyman, G. H. Impact of chemotherapy dose intensity on cancer patient outcomes. J. Natl. Compr. Cane. Netw. 7, 99-108 (2009); Ba, Y. et al. Current management of chemotherapy-induced neutropenia in adults: key points and new challenges: Committee of Neoplastic Supportive-Care (CONS), China Anti-Cancer Association Committee of Clinical Chemotherapy, China Anti-Cancer Association. Cancer Biol. Med. 17, 896-909 (2020)).
[0085] The RNB’s signal enhancement and sensor protection capabilities can be leveraged to lower the translational barrier of the rich library of EABs and other biosensors into in-vivo applications, thereby maximizing their potential (Labib, M., Sargent, E. H. & Kelley, S. O. Electrochemical methods for the analysis of clinically relevant biomolecules. Chem. Rev. 116, 9001-9090 (2016)). For instance, the vancomycin aptamer sequence used in the present disclosure has been shown to have poor in-vivo performance (Shaver, A. et al. Optimization of vancomycin aptamer sequence length increases the sensitivity of electrochemical, aptamer-based sensors in vivo. ACS Sens. 7, 3895-3905 (2022)), a limitation that was rectified through its integration within the RNB. Furthermore, the pRNB’s expanded potential window, covering both negative and positive excitation voltage regimes, particularly enhances adaptability to a variety of electrochemical / receptor-based sensing mechanisms. For example, molecular pendulum sensors, which are effective in quantifying large protein biomarkers (Das, J. et al. Reagentless biomolecular analysis using a molecular pendulum. Nat. Chem. 13, 428-434 (2021); Mahmud, A. et al. Monitoring cardiac biomarkers with aptamer-based molecular pendulum sensors. Angew. Chem. n / a, e202213567 (2023); Zargartalebi, H. et al. Capillary-assisted molecular pendulum bioanalysis. J. Am. Chem. Soc. 144, 18338-18349 (2022)), utilize positive voltage redox reporters like ferrocene (-0.35 V vs. Ag / AgCl), aligning with the operational range of the pRNB.
[0086] This adaptability, combined with RNB’s ability to seamlessly generate high SNR measurements from a single needle (unlike traditional microneedle arrays that rely on cumulative measurements from multiple needles for a single target), enables its extension into a relatively large array of needles within a compact footprint for multiplexed drug and biomarker analysis. RNB’s mechanical robustness across a wide range of tissue stiffnessAtty. Dkt. 102352-1171 also allows reliable sensing of dynamic processes at diverse locations, including internal organs and lesions (Brasi er, N. et al. A three-level model for therapeutic drug monitoring of antimicrobials at the site of infection. Lancet Infect. Dis. 0, (2023); Zhou, L. et al. Spatiotemporal dissection of tumor microenvironment via in situ sensing and monitoring in tumor-on-a-chip. Biosens. Bioelectron. 225, 115064 (2023)). In this context, the use of the presented tissue-specific kinetic data modeling (tKDM) can further enhance the accuracy of the readings. The equilibrium diffusion boundary conditions, exploitable through real-time peak ISF measurements, can also be applied to other drug or molecular administration processes (e.g., infusion, oral administration). This adaptability extends the presented analytical framework to interpret peripheral measurements within more generalized kinetic models, such as three-compartment pharmacokinetics.
[0087] Together, such demonstrated capabilities and opportunities position the platform as a powerful tool for generating molecular insights into both localized and systemic dynamic processes. This will empower studies that unravel complex systems, drive therapeutic and diagnostic developments, and ultimately enable personalized medicine.
[0088] Example Methods and Materials
[0089] All reagents including the aptamers were purchased from Sigma- Aldrich (MO, USA) unless stated. Tris(2-carboxyethyl)phosphine hydrochloride (TCEP) was purchased from TCI America Inc. (OR, USA). Tobramycin (900 pg / mg), phosphate- buffered saline (PBS; 1 *, pH 7.2; Gibco), PrestoBlue cell viability reagent, calcein-AM, ethidium homodimer-1 (EthD-1), Dulbecco's modified eagle medium, fetal bovine serum, acetone, ethanol, nitric acid (68-70% solution in water) and HPLC water were purchased from Thermo Fisher Scientific (MA, USA). Gold plating solution Elevate Gold 7990 was purchased from Technic Inc. (CA, USA). PDMS (Sylgard 184 Silicone Elastomer) was purchased from Dow Corning (MI, USA). Gold-plated acupuncture needles were purchased from Suzhou Acupuncture and Moxibustion Appliance Co. Ltd. (Suzhou, China). The lancets (30 gauge) were from LotFancy Inc. (CA, USA). Ag / AgCl ink was purchased from Ercon Incorporated (MA, USA).
[0090] Example Electrode fabrication
[0091] An example resilient nanostructured bioelectrode (RNB) was fabricated based on gold-plated acupuncture needles. All the electrochemistry experiments wereAtty. Dkt. 102352-1171 performed using a CHI660E or CHH040C electrochemical workstation (CH Instrument Inc., TX, USA). The needles were first cleaned by sonication in absolute acetone, ethanol, and HPLC water for 5 minutes each. Then, to construct homogenous adhesion, a layer of gold was plated onto the surface applying a constant voltage of -0.45 V (versus Ag / AgCl) in Elevate Gold 7990 solution at 65°C for 20 minutes. After being rinsed with HPLC water, a layer consisting of 30 nm Au and 300 nm Ag: Au alloy film was formed by sputtering in a vacuum deposition system (Denton Discovery 550 sputtering System), with a ratio of 2: 1 for the Ag: Au alloy film. The conventional coating was done by coating a series layer of 50 nm Ti, 30 nm Au and 300 nm 2: 1 Ag: Au alloy film via the same vacuum deposition system as comparison. To form gold nanoporous structures, the silver was dealloyed from the film through different etching processes. The stress-mitigated dealloy (SMD) process was achieved through linear sweep voltammetry in a 50 mM sulfuric acid solution, with a potential increase from 0.3 to 1.2 V at a scanning rate of 5 mV / s. Subsequently, cyclic voltammetry was performed in the same beaker, with a potential window of 0.2-1.35 V (versus Ag / AgCl) for 5 cycles at a scanning rate of 100 mV / s. To form the nanoporous structures via the conventional rushed dealloy method, the dealloying is achieved by one of the following procedures: 1) performing 5 cycles of cyclic voltammetry in 50 mM sulfuric acid solution with a potential window of 0.2-1.35 V (versus Ag / AgCl) at a scan rate of 0.1 V / s; 2) performing a 300 s of amperometry at a voltage of 1.25 V (versus Ag / AgCl); 3) or direct dealloy in nitric acid at 60°C for 4 minutes without electrochemical treatment. The electrodes were then rinsed with DI water before surface chemistry characterization or functionalization.
[0092] The fabrication of nanodendritic electrodes is based on the needle electrodes with homogenous gold adhesion mentioned above. To form the nanodendritic layer, the electrode was immersed in a solution containing 1.2 mg / mL chloroauric acid, 0.1 M sodium chloride and 1.5% wt. hydrochloride acid. A pulsed waveform cycle between 0 and -0.4 V was applied to the electrode for 240 cycles with a holding time of 1 s at each potential. The standard planar electrode was purchased (diameter: 2 mm, CH Instrument) and processed following previously reported procedures (Xiao, Y., Lai, R. Y. & Plaxco, K. W. Preparation of electrode-immobilized, redox-modified oligonucleotides for electrochemical DNA and aptamer-based sensing. Nat. Protoc. 2, 2875-2880 (2007)). The exposed length of theAtty. Dkt. 102352-1171 needle is defined by applying a PTFE heat-shrink tube (diameter 0.018 inches, Zeus Industrial Products, SC, USA) or PDMS before the dealloying process.
[0093] Electrode electrochemistry characterization
[0094] To measure the potential window, nanoporous gold electrodes with different fabrication methods were placed in an electrochemical cell (reference: Ag / AgCl; counter electrode: platinum) containing 30 mL PBS. The cyclic voltammetry (CV) was performed with a potential range from -1.2 V to 1.35 V at a scan rate of 50 mV / s. The potential window range is defined by a threshold current density of 3 mA / cm2, the area here refers to the physical dimension.
[0095] The corrosion and corresponding electrochemistry surface area monitoring were performed in the same electrochemical cell as described above for potential window measurement. The gold electrodes were held under a constant +0.5 V. To measure the electrochemical surface area, a series of CV were performed during certain time point intervals (from 0 to 42 hours) with different scan rates (-50 to 0 mV; 15, 60, 100, 200 mV / s). For each time point, a linear fitting for current at -25 mV versus different scan rates was done and the slope was taken as electrochemical surface area. The whole process was programmed using homemade code.
[0096] To assess the quality of various nanoporous electrodes, voltammetry tests were conducted in a 50 mM H2SO4 solution to facilitate the oxygen reduction reaction. The testing parameters were set from 0.2 to 1.35 V at a scan rate of 100 mV / s using the aforementioned three-electrode setup.
[0097] To investigate the impact of Knudsen diffusion on the electron transfer dynamics of nanoporous electrodes, cyclic voltammetry (CV) experiments were conducted at various scan rates (0.02, 0.05, 0.1, 0.2, 0.4, 0.8 V / s) using an electrochemical cell with PBS containing 500 pM methylene blue. Analysis of the "b-value" was performed by examining the corresponding voltammograms. The peak current (I_peak) follows a powerlaw relationship with the scan rate (v), represented by the equation:Ipeak=a * v'1where a and b are constants. The dimensionless b-value is determined by performing linear regression on the logarithmic values of Ipeak versus v and calculating the slope.Atty. Dkt. 102352-1171
[0098] To monitor the dealloying progress, an electrochemical quartz crystal microbalance (EQCM, Model 10M, Gamry) was used to record the electrode mass change. Au-coated AT-cut quartz crystals were used as the substrate, which were initially calibrated with a frequency constant of 56.6 MHz. The working electrode was then sputtered with 10 nm Ti and 60 nm Au / Ag (ratio 1:2) with an exposed area of 1.1 cm2. The electrode setup included a platinum counter electrode and an Ag / AgCl reference electrode and was dealloyed by different methods. The mass change was calculated by converting the frequency change using the Sauerbrey equation:Am = -CfxAf where Am is the mass change, Cf is the calibration constant, and Af is the frequency change. The corresponding dealloy progress is defined as:Dealloy Progress (%) = (1-Am / Mo)x100
[0099] Example Sensor fabrication
[0100] To construct the aptamer sensor, a 5 pL of 100 pM aptamer (thiolated methylene blue-DNA) was reduced to the disulfide bond of the aptamers with 10 pL of Tris(2-carboxyethyl) phosphine hydrochloride (TCEP) for 1 hour under dark space. The concentration of TCEP depends on the types of aptamers to achieve the optimized probe density of aptamers. The higher concentration of TCEP results in a higher probe density of aptamers grown on the golden-based electrode. For tobramycin and irinotecan aptamer, 10 mM TCEP solution was used to reduce lower probe density on electrodes. For vancomycin aptamer, the concentration is optimized to 100 mM TCEP. The buffer solution for TCEP solution contains 100 mM tris hydrochloride, 140 mM NaCl, and 20 mM magnesium chloride, 20 mM potassium chloride and adjusts the pH level to 7.4. The aptamer solution was further diluted with 500 pL PBS. After the reduction, the nanoporous microneedles were incubated inside the aptamer solution for 2 hours at room temperature under the dark. After the DNA immobilization, the sensors were further incubated in 20 mM 6-mercapto-l- hexanol (MCH; prepared in PBS) overnight at room temperature. Finally, the sensors wereAtty. Dkt. 102352-1171 rinsed with a few droplets of water and ready for test. The DNA sequence used for the construction of the sensor is listed as follows:Tobramycin:5 '- / 5ThioMC6-D / GGGACTTGGTTT AGGTA ATGAGTCCC73 MeBl N / -3Phenylalanine:5'- / 5ThioMC6-D / CG ACC GCG TTT CCC AAG AAA GCA AGT ATT GGT TGG TCG / 3MeBlN / -3',Vancomycin:5'- / 5ThioMC6-D / CGAGGGTACCGCAATAGTACTTATTGTTCGCCTATTGTGGGTCGG / 3MeBlN / -3',Doxorubicin:5 '- / 5ThioMC6-D / ACCATCTGTGTAAGGGGTAAGGGGTGGT / 3MeBlN / -3 and Irinotecan:5 '- / 5ThioMC6-D / TCCGGACTTGGGTGGGTGGGTTGGGGTACGGT / 3MeBlN / - 3'.
[0101] To fabricate RNB-based lactate sensors, platinum (Pt) was electrochemically deposited onto the electrode by chronoamperometry at -0.1V (vs. Ag / AgCl) for 10 min in a fresh Pt solution containing 2.5 mM PBPtCle and 1.5 mM formic acid. Then lactate oxidase was electrochemically deposited on the needle by applying a +0.6 V (vs. Ag / AgCl) for 5 min in a solution containing 2.5 mg / mL enzyme and 1 mM o-Phenylenediamine. Finally, 2 pL of 0.3 % wt. PVC was coated 3 times as diffusion-limiting layer.
[0102] The pH sensor was fabricated through the electrochemical deposition of Pt and iridium oxide on RNB. Initially, Pt was deposited onto the electrodes using chronoamperometry at -0.1V (vs. Ag / AgCl) for 10 minutes in a solution containing 2.5 mM H2PtCle and 1.5 mM formic acid. For the iridium oxide deposition, the precursor solution was prepared by dissolving 45 mg of iridium (IV) chloride hydrate in 30 mL of DI water, followed by the addition of 300 microliters of H2O2 and 150 mg of oxalic acid dihydrate.Atty. Dkt. 102352-1171The pH was then adjusted to approximately 10.5 using a 1 M sodium hydroxide solution. This iridium oxide precursor solution was left to stabilize for two days. Iridium oxide (IrOx) was then deposited onto the electrodes using cyclic voltammetry, conducted over 200 segments with a potential range from 0 to 0.6 V (vs. Ag / AgCl) at a scan rate of 0.05 V / s; the solution was prepared following previously reported procedure. Following deposition, the electrodes were thoroughly rinsed with HPLC water to remove any residual chemicals and were then prepared for further testing or integration.
[0103] Sensor characterization
[0104] The aptamer sensors were interrogated using square wave voltammetry (SWV, -0.1 to -0.45 V vs. Ag / AgCl; increment: 1 mV, pulse amplitude: 25 mV) with varied frequency. The voltammograms were processed using Python code to extract peak current information after the series addition of the target analyte.
[0105] To characterize the fouling performance of the sensor, different vancomycin sensing electrodes (RNB, disc, and nanodendritic) were placed in UV-sterilized electrochemical cells containing fetal bovine serum and enclosed with parafilm and aluminum foil. Continuous SWV measurements were carried out every 10 minutes for up to 9 days.
[0106] For electrochemical impedance spectroscopy (EIS), first, a 10 Hz SWV was performed to capture the peak current position for standard electrode potential (E0) in the respective teat solution. Then EIS was performed at the E0 with AC waveform of 10 mV amplitude and frequency ranging from 1 Hz to 100000 Hz. The resulting Bode plot was fitted with corrected Randles circuit model using constant phase elements as shown in FIGs. 11B and 11C.
[0107] Artificial tissue fabrication and insertion experiment
[0108] To mimic the different stiffness of tissues, 10, 5, 2, 1, 0.5, and 0.2 wt.% of agarose hydrogel gel were made for the insertion test by mixing with HPLC water and heated to 80 °C for 20 minutes before being cured in predefined 3D printed mold. The as- fabricated vancomycin microneedle-based sensors with different nanostructures (i.e., nanoporous and nanodendritic) were inserted inside the gel. After each time of insertion, the sensors were scanned with the SWV technique to determine the remaining percentage of the signal. More specifically, 1, 3, 5, and 10 accumulated times insertion were performed in order and scanned with SWV for each step.Atty. Dkt. 102352-1171
[0109] To quantify the modulus of artificial tissue, the sample underwent a standard compression test, and Young’s modulus was quantified according to the stress-strain data obtained during testing, utilizing the slope of the linear elastic region of the stress-strain curve.
[0110] ICP-MS for agarose insertion Au quantification
[0111] To quantify the Au residue of nanodendritic and nanoporous electrodes after the artificial tissue insertion test, we used inductively coupled plasma mass spectrometry (ICP-MS) to determine the trace of Au left inside the artificial tissue. First, each group of artificial tissue was digested inside the 1 mL aqua regia solution under 30°C and further diluted 500 times with 2% nitric acid solution. For the calibration sample, the standard 1 pg / ml Au in hydrochloric acid was diluted into 1, 10, 50, and 100 ng / ml with 2% nitric acid, respectively.
[0112] An 8800 ICP-MS Triple Quad system (Agilent Technologies, CA, USA) coupled with an SPS 4 Autosampler was used for the experiment. MassHunter Workstation 4.1 software served as the interface to control the whole system. The samples were analyzed under the no-gas mode with the element Y as the internal standard (IS). The important parameters for setting the instrument include RF power of 1550 W, RF matching of 1.8 V, sample depth of 8 mm, carrier gas flow rate of 0.9 L / min, nebulizer pump rate of 0.1 rps, and S / C temperature of 2°C. The gas switch was configured with a dilution gas flow rate of 0.2 L / min.
[0113] Mechanical finite element analysis
[0114] The Fluid-Solid Interaction (FSI) module in COMSOL Multiphysics 6.0 was employed to simulate the impact of lateral flow on nanostructures. This three-dimensional model comprises two distinct domains: a solid and a fluid domain. The solid domain includes a cuboidal base and an extruded cylinder representing an extroverted nanodendritic structure or alternatively, a cylindrical hole representing an introverted nanoporous structure. Gold is modeled as a linear elastic material, characterized by Young's modulus of E = 76 GPa, a density of p = 19.3 g / cm3, and a Poisson's ratio of v = 0.442. The fluid domain, which surrounds the structure, has a density of p = 1 g / cm3, and a dynamic viscosity ranging from 1 to 100 mPa s, simulating fully developed laminar flow with average velocities between 0.01 and 0.0001 m / s. The solid domain’s base has a fixed constraint at the bottom side, while the left and right sides feature roller conditions, and theAtty. Dkt. 102352-1171 front and back sides have symmetry conditions. In the fluid domain, fully developed flow enters through the left inlet at a specified average velocity, while the right outlet is defined by a pressure boundary condition. The front and back sides of the fluid domain are symmetric, and the top side has an open boundary condition. The laminar flow of the fluid and the structure's solid mechanics are fully coupled within the FSI module. The surface stress was quantified by calculating the equivalent stress according to von Mises yield criterion. The stress accumulation was quantitatively compared using the ratio q T| Gmax / CJaverage
[0115] Multi-organs vancomycin test
[0116] The brain, lung, kidney, liver, and biceps femoris tissues were collected from freshly euthanized, healthy Sprague-Dawley rats. Fresh bovine tendon was sourced from a local grocery store in Los Angeles, California. Tumor tissue culture procedures were conducted under protocols approved by the Institutional Animal Care and Use Committee at the University of California, Los Angeles (Protocol R-17-072). Female C57BL / 6J mice (The Jackson Laboratory, Strain #000664), aged 8 weeks, were each injected subcutaneously on both dorsal flanks with 0.5 million murine colon adenocarcinoma cells (ATCC, MC-38). Fourteen days post-injection, the mice were euthanized, and tumor tissues were collected. Each type of organ (brain, kidney, liver, tumor, lung, biceps femoris, and bovine tendon) was soaked under 0, 10, 20, and 40 pM of vancomycin solution overnight. Then the packed microneedle sensors were inserted on the surface of each organ. To ensure the needle-organ contact area is dry, the surface of each organ was gently wiped prior to the test.
[0117] Wireless TDM device integration
[0118] FIGs. 10A to 10F illustrate an example customized wireless potentiostat (TDM) device of embodiments. FIG. 10A provides a circuit diagram of a square wave voltammetry circuit, FIG. 10B illustrates a schematic of an example MCU and a Bluetooth module, and FIG. 10C illustrates a schematic of an example voltage regulator. FIGs. 10D to 10F are optical images of the flexible circuit, battery, and the assembled device with 3D printed case, respectively, next to a standard US quarter coin.
[0119] FIG. 11G is a block diagram of an example TDM device according to embodiments. As shown, the wireless TDM device consists of three parts: a microneedle three-electrode sensing interface patch 1102. The patch consists of a bundle threeAtty. Dkt. 102352-1171 electrodes: counter, reference, and working, which are fixed in a PDMS substrate. The working electrode can be fabricated as described in the example methods above. The counter electrode can be prepared by coating the needle electrode with a layer of homogenous adhesion as previously described. The needle-based reference electrode can be adapted from a lancet needle and dip-coated with Ag / AgCl ink (50% diluted with toluene). The three electrodes can be planted into the PDMS that is reverse molded into the PLA 3D- printed case.
[0120] Sensor electronics 1004 is further included in the device. The wireless miniaturized electrochemical potentiostat can be realized based on a custom printed circuit board (PCB). A microcontroller unit (MCU) (Atmega328 U-TH) is programmed to generate the square waveform and read the sensor’s current at the appropriate interval. In particular, the MCU controls a dual-channel digital-analog converter (DAC) (DAC8552; Texas Instruments) with SPI commands to modulate the voltage difference across the reference and working electrode. The working electrode can be connected at the negative terminal of a transimpedance amplifier (TIA), which translates the current across the sensor into a voltage difference measured by an analog-digital converter (ADS 1256; Texas Instruments). As the experiment occurs, the raw difference current for each cathodic electrical pulse (the y-axis, of a voltammogram) is streamed over the serial connection to an onboard Bluetooth module (Proteus-III; Wurth Eletronik). On the connected client, the raw difference current can be processed with a Butterworth and moving average filter to produce a smooth voltammogram. It should be noted that a conversion to ISF readings to blood readings can be performed either in the device itself, or in another device communicating with the wireless device,
[0121] As further shown, the device includes auxiliary components 1006 such as a lithium battery (110 mAh) for powering and a 3D printed case for packaging, along with a biocompatible adhesion layer (Tegaderm film or double-sided tape, 3M Science, MN, USA) to provide robust attachment to the skin.
[0122] Biocompatibility test
[0123] To evaluate the cytotoxicity of the RNB, human dermal fibroblasts (HDFs) were seeded and cultured directly on the electrode surface using Dulbecco's modified eagle medium (Gibco) supplemented with 10% fetal bovine serum for 48 hours. Subsequently, theAtty. Dkt. 102352-1171 cells were stained with live (calcein-AM) or dead (ethidium homodimer-1) reagent, allowing the evaluation of cell viability through fluorescence microscopy.
[0124] For the long-term biocompatibility study of the RNB, the electrodes were incubated in Dulbecco's modified eagle medium (Gibco) at 37°C in a 5% CO2 incubator for 7 days. A positive control was established by incorporating AgNCh into the medium to achieve a final concentration of 10 pg / mL. HDFs were then cultured in this conditioned medium with 10% fetal bovine serum for 72 hours. Cell viability was assessed at 24 hours and 72 hours using PrestoBlue cell viability staining reagent, followed by fluorescence quantification (excitation wavelength 560 nm, emission wavelength 590 nm).
[0125] In vivo test
[0126] All animal TDM studies were performed according to the protocols approved by the Institutional Animal Care and Use Committee at the University of California, Los Angeles under the protocols ARC -2021-011 and ARC-2023-114. Sprague-Dawley rats of mixed gender, ranging in body weight from 200 to 670 g, were procured from Charles River Laboratories International Inc. (MA, USA). The rats were accommodated in climate- controlled facilities, adhering to a 12-hour dark / light cycle, with food and water available ad libitum throughout the studies. A requisite acclimation period of at least seven days was observed before the commencement of any experimental procedures.
[0127] The continuous irinotecan TDM experiment in rats: Rats were initially anesthetized through inhalation of isoflurane (3-5% for induction and 1.5-2.5% for maintenance, Somni Inc., USA). Subsequently, the anesthetized rats were positioned on a circulating water-heated pad to maintain temperature. After shaving, a device was placed on the rat’s lower back. The sensor was interrogated under SWV with preoptimized sensor parameters to generate real-time TKDM signals (here 10 Hz and 150 Hz). Once sensor TKDM readout is no longer drifting, it is ready for the drug injection. A tube of blood was collected before the injection of the drug via tail prick. The fresh-collected blood sample was placed inside the centrifuge for 15 min at rest and centrifuged for 10 min at 10000 rpm. The upper layer of serum was gathered and stored at -20°C before analysis. A dose of 50 mg / kg irinotecan was then injected intravenously through a peripheral venous catheter attached to the tail vein. Another group of rats was injected with carbon tetrachloride to induce acute liver damage and the same TDM was performed, and the blood was collected before the administration of drug.Atty. Dkt. 102352-1171
[0128] The experiment to measure vancomycin TDM is similar to the irinotecan for healthy subjects, except the TKDM frequency pair was set to 25 Hz and 150 Hz. Besides the same pre-administration blood collection, the blood samples were intermittently collected through the femoral vein during sensor monitoring for LCMS quantification. For vancomycin TDM experiment in rats with compromised kidney function: this experiment replaces the general daily diet with a high adenine diet. The adenine diet was prepared by mixing powdered adenine with rat food pellets (Teklad 7013), resulting in a concentration of 0.75% by weight. One group of rats (n = 3) were fed with the high adenine diet for up to 7 weeks. The blood work was done every 7 days and if they showed symptoms of pain or distress, the analgesics (meloxicam or ibuprofen) would be administrated orally daily. During the 7 weeks of diet, the continuous vancomycin TDM experiment was performed every 7 days for each rat with a fixed dosage of 20 mg / kg unless they were diagnosed unsuitable for the procedure according to the US NIH guidelines. Another group of rats (n = 3) were fed with the high adenine diet for two weeks, followed by a switch to a regular nonadenine diet and daily oral administration of allopurinol (25 mg / kg) for another two weeks. During the 4-week dietary regimen, the continuous vancomycin TDM experiment was performed every 7 days for each rat, utilizing the same fixed dosage of 20 mg / kg.
[0129] Pathological analysis
[0130] To perform the histopathology analysis on the rat with CC14 injection, the rat’s liver was harvested 24 hours post-injection and fixed in 10% formalin solution for 72 hours. The fixed kidney was paraffin-embedded and sectioned. Section (4 pm in thickness) was collected every 20 pm throughout the sample and stained with H&E and optical photos were taken under the microscope.
[0131] To perform the histopathology analysis on the rat with a high adenine diet, three rats were fed with a high adenine diet for 2, 4, and 6 weeks, and one control healthy rat, respectively, and the kidney kidneys were harvested and fixed in 10% formalin solution for 72 hours. The fixed kidney was paraffin-embedded and sectioned. Section (4 pm in thickness) was collected every 20 pm throughout the sample and stained with H&E and optical photos were taken under the microscope.
[0132] LC-MS / MS serum vancomycin analysis
[0133] Rat serum samples were analyzed using LC-MS / MS in multiple reaction monitoring (MRM) modes for vancomycin quantification, using Tobramycin as the internalAtty. Dkt. 102352-1171 standard. Calibration samples were prepared by diluting vancomycin into concentrations of 2, 4, 12, and 20 pg / ml with HPLC water. To each tube containing 50 pL of these solutions, 3.2 pL of blank serum and 1.059 pL of tobramycin (1.02 mg / ml) were added. Then, 212 pL of acetonitrile was added for protein precipitation. After vertexing for 20 seconds and centrifuging at 8000 ref for 10 minutes, 10 pL of the supernatant was transferred into 70 pL of 0.1% formic acid, mixed gently, and prepared for LC-MS / MS analysis. For serum sample analysis, 3 pL of each serum sample was mixed with 47 pL of DI water and 1 pL of tobramycin (1.02 mg / ml). This was followed by adding 200 pL of acetonitrile, and the samples underwent the same preparation steps as the calibration samples.
[0134] For LC analysis, used was an Agilent 1200 series HPLC system (Agilent Technologies, CA, USA) with an HTS PAL autosampler (CTC Analytics, MN, USA) connected to an API 4000 triple quadrupole mass spectrometer (Sciex, ON, Canada). The mobile phases, A (water with 0.1% formic acid) and B (acetonitrile with 0.1% formic acid) were pumped at a flow rate of 350 pL / min, with a 4-minute equilibration before sample injection. The gradient began with 5% B for 0.5 minutes, ramped up to 90% B over 3 minutes, held at 90% for 1 minute, then dropped back to 5% over 0.5 minutes and maintained at 5% for an additional 2 minutes.
[0135] A 20 pL sample was loaded into the chamber using an autosampler tray. The mass spectrometer operated in MRM mode to measure specific mass-to-charge transitions: 725.5 to 144.1 for vancomycin and 468.3 to 163.2 for tobramycin. The optimized settings for vancomycin were a declustering potential of 56 V, entrance potential of 10 V, collision energy of 23 V, and collision cell exit potential of 10 V. For tobramycin, settings were a declustering potential of 76 V, entrance potential of 10 V, collision energy of 33 V, and collision cell exit potential of 10 V.
[0136] The herein described subject matter sometimes illustrates different components contained within, or connected with, different other components. It is to be understood that such depicted architectures are illustrative, and that in fact many other architectures can be implemented which achieve the same functionality. In a conceptual sense, any arrangement of components to achieve the same functionality is effectively "associated" such that the desired functionality is achieved. Hence, any two components herein combined to achieve a particular functionality can be seen as "associated with" each other such that the desired functionality is achieved, irrespective of architectures orAtty. Dkt. 102352-1171 intermedial components. Likewise, any two components so associated can also be viewed as being "operably connected," or "operably coupled," to each other to achieve the desired functionality, and any two components capable of being so associated can also be viewed as being "operably coupleable," to each other to achieve the desired functionality. Specific examples of operably coupleable include but are not limited to physically mateable and / or physically interacting components and / or wirelessly interactable and / or wirelessly interacting components and / or logically interacting and / or logically interactable components.
[0137] With respect to the use of plural and / or singular terms herein, those having skill in the art can translate from the plural to the singular and / or from the singular to the plural as is appropriate to the context and / or application. The various singular / plural permutations may be expressly set forth herein for sake of clarity.
[0138] It will be understood by those within the art that, in general, terms used herein, and especially in the appended claims (e.g., bodies of the appended claims) are generally intended as "open" terms (e.g., the term "including" should be interpreted as "including but not limited to," the term "having" should be interpreted as "having at least," the term "includes" should be interpreted as "includes but is not limited to," etc.).
[0139] Although the figures and description may illustrate a specific order of method steps, the order of such steps may differ from what is depicted and described, unless specified differently above. Also, two or more steps may be performed concurrently or with partial concurrence, unless specified differently above. Such variation may depend, for example, on the software and hardware systems chosen and on designer choice. All such variations are within the scope of the disclosure. Likewise, software implementations of the described methods could be accomplished with standard programming techniques with rulebased logic and other logic to accomplish the various connection steps, processing steps, comparison steps, and decision steps.
[0140] It will be further understood by those within the art that if a specific number of an introduced claim recitation is intended, such an intent will be explicitly recited in the claim, and in the absence of such recitation, no such intent is present. For example, as an aid to understanding, the following appended claims may contain usage of the introductory phrases "at least one" and "one or more" to introduce claim recitations. However, the use of such phrases should not be construed to imply that the introduction of a claim recitation byAtty. Dkt. 102352-1171 the indefinite articles "a" or "an" limits any particular claim containing such introduced claim recitation to inventions containing only one such recitation, even when the same claim includes the introductory phrases "one or more" or "at least one" and indefinite articles such as "a" or "an" (e.g., "a" and / or "an" should typically be interpreted to mean "at least one" or "one or more"); the same holds true for the use of definite articles used to introduce claim recitations. In addition, even if a specific number of an introduced claim recitation is explicitly recited, those skilled in the art will recognize that such recitation should typically be interpreted to mean at least the recited number (e.g., the bare recitation of "two recitations," without other modifiers, typically means at least two recitations, or two or more recitations).
[0141] Furthermore, in those instances where a convention analogous to "at least one of A, B, and C, etc." is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (e.g., "a system having at least one of A, B, and C" would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). In those instances where a convention analogous to "at least one of A, B, or C, etc." is used, in general, such a construction is intended in the sense one having skill in the art would understand the convention (e.g., "a system having at least one of A, B, or C" would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). It will be further understood by those within the art that virtually any disjunctive word and / or phrase presenting two or more alternative terms, whether in the description, claims, or drawings, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase "A or B" will be understood to include the possibilities of "A" or "B" or "A and B."
[0142] Further, unless otherwise noted, the use of the words “approximate,” “about,” “around,” “substantially,” etc., mean plus or minus ten percent.
[0143] Although the present embodiments have been particularly described with reference to preferred examples thereof, it should be readily apparent to those of ordinary skill in the art that changes and modifications in the form and details may be made without departing from the spirit and scope of the present disclosure. It is intended that the appended claims encompass such changes and modifications.
Claims
Atty. Dkt. 102352-1171WHAT IS CLAIMED IS:
1. An apparatus comprising: a microneedle biosensing platform including a resilient nanostructured bioelectrode (RNB) integrated onto a microneedle and configured for durable, high-SNR measurements of molecules in interstitial fluids.
2. The apparatus of claim 1, wherein the RNB comprises an adhesion layer plated onto the microneedle, and an nanostructured interfacial layer fabricated on the adhesion layer.
3. The apparatus of claim 1, wherein the nanostructured interfacial layer is formed using a stress mitigated dealloy (SMD) process.
4. The apparatus of any of claims 1-3, wherein the adhesion layer comprises gold.
5. The apparatus of claim 4, wherein the adhesion layer is less than a micrometer thick.
6. The apparatus of any of claims 1-5, wherein the nanostructured interfacial layer comprises a gold-silver alloy.
7. The apparatus of claim 6, wherein the nanostructured interfacial layer has a concave structure.
8. The apparatus of claim 1, wherein signals from the RNB responsive to interstitial fluids are paired with a framework to derive blood-equivalent parameters.
9. The apparatus of claim 1, wherein the biosensing platform is configured for dual therapeutic drug monitoring (TDM) and metabolic organ function assessment.
10. A method for fabricating a microneedle biosensing platform including a resilient nanostructured bioelectrode (RNB) integrated onto a microneedle, comprising: plating an adhesion layer onto the microneedle, andAtty. Dkt. 102352-1171 fabricating a nanostructured interfacial layer on the adhesion layer.
11. The method of claim 10, wherein the nanostructured interfacial layer is formed using a stress mitigated dealloy (SMD) process.
12. The method of claims 10 or 11, wherein the adhesion layer comprises gold.
13. The method of claim 12, wherein the adhesion layer is less than a micrometer thick.
14. The method of any of claims 10 to 13, wherein the nanostructured interfacial layer comprises a gold-silver alloy.
15. The method of claim 14, wherein the nanostructured interfacial layer has a concave structure.