A yeast-based high-throughput screen for identification of GPCR oligo- and polypeptide ligands

Abstract

The present invention relates to a method for identifying one or more oligo- or polypeptide agonists that can activate a GPCR; wherein the method comprises (a) expressing the GPCR in each yeast cell of a library of yeast cells such that the GPCR is presented at the surface of the yeast cells, (b) expressing a library of test oligo- or polypeptides in the library of yeast cells of (a) such that the test oligo- or polypeptides are directed into the secretion pathway of yeast cells of the library, wherein each yeast cell within the library expresses only one kind of test oligo- or polypeptide of the library of test oligo- or polypeptides, and (c) assessing the activity of cell-surface localized GPCR, wherein within the library of yeast cells a yeast cell expressing an oligo- or polypeptide agonist as the kind of test oligo- or polypeptide of the library of test oligo- or polypeptides is identified based on a lower cell-surface activity of the GPCR as compared to a yeast cell not expressing a test oligo- or polypeptide.

Description

[0001] New PCT-Patent Application

[0002] Max-Planck-Gesellschaft zur Fbrderung der Wissenschaften e. V.

[0003] Vossius Ref.: AJ2477 PCT

[0004] A yeast-based high-throughput screen for identification of GPCR oligo- and polypeptide ligands

[0005] The present invention relates to a method for identifying one or more oligo- or polypeptide agonists that can activate a GPCR, wherein the method comprises (a) expressing the GPCR in each yeast cell of a library of yeast cells such that the GPCR is presented at the surface of the yeast cells, (b) expressing a library of test oligo- or polypeptides in the library of yeast cells of (a) such that the test oligo- or polypeptides are directed into the secretion pathway of yeast cells of the library, wherein each yeast cell within the library expresses only one kind of test oligo- or polypeptide of the library of test oligo-or polypeptides, and (c) assessing the activity of cell-surface localized GPCR, wherein within the library of yeast cells a yeast cell expressing an oligo- or polypeptide agonist as the kind of test oligo- or polypeptide of the library of test oligo- or polypeptides is identified based on a lower cell-surface activity of the GPCR as compared to a yeast cell not expressing a test oligo- or polypeptide.

[0006] In this specification, a number of documents including patent applications and manufacturer's manuals are cited. The disclosure of these documents, while not considered relevant for the patentability of this invention, is herewith incorporated by reference in its entirety. More specifically, all documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.

[0007] Seven-transmembrane domain G protein-coupled receptors (GPCRs) comprise the largest family of proteins targeted by drug discovery. The breadth of GPCR distribution across nearly all of the body's organs and tissues and the cellular role GPCRs play as signal transducers make GPCRs key regulatory elements. GPCRs are crucial as molecular sensors for many vital physiological processes and they are involved in a broad range of normal and pathological processes (Salon et al. (2011), Pharmacol Rev.; 63(4):901-937).

[0008] GPCRs are involved in many diseases. GPCRs are an important drug target and approximately 34% of all Food and Drug Administration (FDA) approved drugs target 108 members of this family. The global sales volume for these drugs is estimated to be 180 billion US dollars as of 2018. It is estimated that GPCRs are targets for about 50% of drugs currently on the market, mainly due to their involvement in signaling pathways related to many diseases i.e. mental, metabolic including endocrinologicaldisorders, immunological including viral infections, cardiovascular, inflammatory, senses disorders, and cancer. Thus, GPCRs have been and will continue to be an important focus for drug discovery. Further agonists and antagonists for GPCRs are need in order to ultimately identify novel treatment options for diseases.

[0009] Hence, there is an ongoing need for methods that allow for fast and high-throughput screening to identify agonists and antagonists for a GPCRs.

[0010] Accordingly, the present invention relates in a first aspect to a method for identifying one or more oligo- or polypeptide agonists that can activate a GPCR, wherein the method comprises (a) expressing the GPCR in each yeast cell of a library of yeast cells such that the GPCR is presented at the surface of the yeast cells, (b) expressing a library of test oligo- or polypeptides in the library of yeast cells of (a) such that the test oligo- or polypeptides are directed into the secretion pathway of yeast cells of the library, wherein each yeast cell within the library expresses only one kind of test oligo- or polypeptide of the library of test oligo- or polypeptides, and (c) assessing the activity of cell-surface localized GPCR, wherein within the library of yeast cells a yeast cell expressing an oligo- or polypeptide agonist as the kind of test oligo- or polypeptide of the library of test oligo- or polypeptides is identified based on a lower cell-surface activity of the GPCR as compared to a yeast cell not expressing a test oligo- or polypeptide.

[0011] An agonist is a molecule that activates a receptor to produce a biological response while, on the other hand, an antagonist is a molecule that inhibits or blocks a receptor to produce a biological response. The antagonist will further be dealt with herein below in connection with the third aspect of the invention.

[0012] The agonist herein is an oligo- or polypeptide ("agonist"). The term "oligo- or polypeptide" as used herein describes a group of molecules preferably consisting of up to 250 amino acids, more preferably up to 150 amino acids and most preferably up to 100 amino acids. The term "oligo- or polypeptide" as used herein also describes a group of molecules preferably consisting of 5 or more amino acids, more preferably 8 or more amino acids and most preferably 10 or more amino acids. These upper and lower limits can be combined into the ranges and these ranges are also envisioned herein. Exemplary ranges are 5 to 250 amino acids, preferably 8 to 150 amino acids and most preferably 10 to 100 amino acids. The term oligopeptide generally comprises up to 10 amino acids while polypeptide generally comprises more than 10 amino acids. The oligo- or polypeptide may also be a naturally modified oligo- or polypeptide where the modification is effected, e.g., by glycosylation, acetylation, phosphorylationand similar modifications which are well known in the art.

[0013] Receptors are cellular proteins whose activation triggers specific responses within a cell. Herein the receptors are GPCRs. A GPCR (G protein-coupled receptor, also known as seven-(pass)-transmembrane domain receptors, 7-TM receptors, heptahelical receptors, serpentine receptors, and G protein-linked receptors (GPLR)) is a protein located in the cell membrane that binds extracellular substances and transmits signals from these substances to an intracellular protein complex called a G protein (guanine nucleotide-binding protein). GPCRs are a large family of cell surface receptors that respond to a variety of external signals. GPCRs are found in the cell membranes of a wide range of organisms, including mammals, plants, microorganisms, and invertebrates. Non-limiting examples of GPCRs are beta-adrenergic receptors, which bind epinephrine; prostaglandin E2 receptors, which bind inflammatory substances called prostaglandins, and rhodopsin, which contains a photoreactive chemical called retinal that responds to light signals received by rod cells in the eye.

[0014] A GPCR is generally made up of an extracellular N-terminus, an intracellular C-terminus, and a middle region containing seven alpha-helical transmembrane domains and their connecting loops. Beginning at the N-terminus, this long protein winds down and up through the cell membrane. The long middle segment traverses the membrane seven times in a serpentine pattern with the transmembrane domains being connected by either intra- or extracellular loops. The last of the seven transmembrane domains is connected to the C-terminus. When a GPCR with its extracellular surface (N-terminus and / or extracellular loops) binds an extracellular agonist (i.e. a molecule that possesses an affinity for the receptor and activates the GPCR upon binding), the ligand triggers a conformational change in the receptor. This activates the receptor, specifically its GEF (guanine nucleotide exchange factor) -activity, which facilitates the exchange of GDP for GTP of the G Protein alpha subunit associated with the GPCR and thus, activates the G protein. Activation of the G protein initiates a series of intracellular reactions that end ultimately in the generation of some effect, such as in the case of beta2-adrenergic receptor an increase in intracellular cAMP due to activation of adenylate cyclase and ultimately physiological responses like increased heart rate in response to adrenaline.

[0015] Hence, a GPCR agonist is a molecule that binds to a GPCR and thereby activates intracellular signaling through G proteins. Agonists lead to conformational changes in the GPCR which activate its intracellular GEF-activity which in turn facilitates the GDP for GTP exchange of the associated G protein. On the other hand, interaction of GPCR with an antagonist blocks binding of other ligands (including agonists) of the GPCR and fixes the GPCR in an inactive conformation, thus preventing any transmembrane signalling by this GPCR.According to step (a) of the first aspect a GPCR is expressed in each yeast cell of a library of yeast cells such that the GPCR is presented at the surface of the yeast cells. As explained above, GPCRs are cell surface expressed receptors and become integrated into a cell membrane by their 7-TM domain, so that it is a matter of routine to express them such that the GPCR is presented at the surface of the yeast cells. It is also to be understood that generally the same kind of GPCR is expressed in each yeast cell of the library of yeast cells.

[0016] Yeasts are eukaryotic, single-celled microorganisms classified as members of the fungus kingdom. The kind of yeast cells to be used in the method of the invention are not particularly limited. Several yeasts, in particular Saccharomyces cerevisiae (S. cerevisiae), Kluyveromyces lactis and Schizosaccharomyces pombe, have been widely used in genetics and cell biology, largely because they are genetically tractable simple eukaryotic cells, serving as a model for all eukaryotes, including humans, for the study of fundamental cellular processes such as the cell cycle, DNA replication, recombination, cell division, and metabolism. Moreover, various yeast species have been genetically engineered to efficiently produce various drugs, a technique called metabolic engineering. About 20% of biopharmaceuticals are produced in S. cerevisiae, including insulin, vaccines for hepatitis, and human serum albumin (Nielsen (2012), Bioengineered, 4 (4): 207-211.).

[0017] According to step (b) of the first aspect a library of test oligo- or polypeptides in the library of yeast cells of (a) is expressed such that the test oligo- or polypeptides are directed into the secretion pathway of yeast cells of the library, wherein each yeast cell within the library expresses only one kind of test oligo- or polypeptide of the library of test oligo- or polypeptides.

[0018] By the method of the present invention, it can be identified whether one or more of the test oligo- or polypeptides is an oligo- or polypeptide agonist that can activate a GPCR. Because each yeast cell within the library expresses only one kind of test oligo- or polypeptide of the library of test oligo- or polypeptides, the yeast cells that express an oligo- or polypeptide agonist as the type of a test oligo-or polypeptide can be separated from those cells that do not express an oligo- or polypeptide agonist as the type of a test oligo- or polypeptide. Upon separation of the cells also the kind of oligo- or polypeptide agonist can be identified. This will be further detailed herein below.

[0019] GPCR's traffic through the secretion (or secretory) pathway in order to reach the cell surface; during the trafficking, the soon-to-be extracellular parts of the GPCR are facing the lumen (inside) of the secretory compartments. Because the test oligo- or polypeptides must be enabled to come intocontact with the soon-to-be extracellular part of the GPCRs within a cell, the test oligo- or polypeptides are directed into the secretion pathway. The secretion pathway is a fundamental cellular process that entails synthesis, modification, sorting and trafficking through secretory compartments like the endoplasmic reticulum (ER) and the Golgi apparatus and the release of proteins and peptides to the cell surface or extracellular milieu. It can be ensured that the test oligo- or polypeptides are directed into the secretion pathway by fusing / cloning them downstream of a signal peptide sequence which later will be cleaved off within the secretory pathway.

[0020] Accordingly in step (c) the activity of cell-surface localized GPCR serves as the readout for determining whether a test oligo- or polypeptide is an oligo- or polypeptide agonist or not. When a GPCR with its extracellular surface binds an extracellular agonist this normally actives GPCR signalling. As explained above, GPCRs are cell surface receptors that relay extracellular signals to the inside of the cells. They act like an inbox for messages in the form of, for example, light energy, peptides, lipids, sugars, and proteins. As will be explained in more detail herein below, it was now found that test oligo- or polypeptides that when secreted can act as an agonist by binding to the extracellular part of the GPCR, display a second function on the intracellular side when co-expressed in the same cell as the GPCR, where they inactivate the GPCR. A strong correlation between these two functions was found. All tested peptides that were able to inactivate the GPCR inside the cells, upon the secretion acted as peptide agonists activating signalling by cell-surface localized GPCR (in the absence of the blocking activity inside the cells) (Figure 2). Hence and although this may appear counterintuitive at first glance, a yeast cell co-expressing a GPCR along with a test oligo- or polypeptide that can act as an agonist for the same GPCR, is characterized by lower activity of cell-surface localized GPCR as compared to a yeast cell only expressing the GPCR without expressing a test oligo- or polypeptide.

[0021] Accordingly in step (c) of the method of the first aspect the activity of cell-surface localized GPCR is determined and if within the library of yeast cells a yeast cell expresses an oligo- or polypeptide agonist as the kind of test oligo- or polypeptide of the library of test oligo- or polypeptides a lower cell-surface activity of the GPCR as compared to a yeast cell not expressing a test oligo- or polypeptide is determined. Hence, in step (c) such a determined lowered activity of a cell-surface localized GPCR in a yeast cell of the library indicates that the particular test oligo- or polypeptide expressed in this cell is an oligo- or polypeptide agonist for the GPCR.

[0022] The means and methods for determining the cell-surface activity of the GPCR are not particularly limited and a number of conceivable options are available. Non-limiting but preferred examples will be described herein below. In this connection it is already noted that the determination of the cell-surface activity of the GPCR does not necessarily require to directly determine the activity of the GPCR at the cell surface but that it is also possible, for example, to determine the cell-surface activity of the GPCR via the activity of the intracellular signalling cascade which is activated by the GPCR. As will be further explained below, a lower activity of the intracellular signalling cascade is a direct consequence of the co-expressed test oligo- or polypeptides that when secreted can act as an oligo- or polypeptide agonist by binding to the extracellular part of the GPCR because of their second function within the cell, where they inactivate the GPCR.

[0023] The alpha-factor (or also referred to herein as "a-factor") is a medium-sized peptide hormone (pheromone) that interacts with the yeast GPCR Ste2. Ste2 is a class DI GPCR. The alpha-factor is processed from a larger precursor and secreted from yeast cells via the standard secretory pathway. The secreted alpha-factor binds to the extracellular surface of the G protein-coupled receptor Ste2, thereby activating Ste2 signaling. Hence, alpha-factor is a known Ste2 agonist. The inventors recently found that the alpha-factor has a second, previously unrecognized function within the cell when coexpressed along with Ste2. Here, the alpha-factor inactivates Ste2 presumably by binding to Ste2 within the cell, more precisely, within the secretory compartments. The co-expression of the S. cerevisiae G-protein coupled receptor (GPCR) Ste2, together with its peptide ligand alpha-factor, results in intracellular inactivation of Ste2 and consequentially, the inability of the cell to respond to an externally applied or secreted alpha-factor. This phenomenon was termed "cell-internal autocrine receptor inactivation" by the inventors.

[0024] Based on this phenomenon of cell-internal GPCR-inactivation by ligand co-expression and co-secretion, the methods of the present invention were developed which allow for fast and high-throughput screening and identification of active oligo- or polypeptide ligands (agonists) for a given GPCR in S. cerevisiae. It can be taken from the appended examples that a method according to the first aspect of the invention can be readily used to screen for potential oligo- or polypeptide agonists of the GPCR Ste2. The method is based on the notion that within a population of cells expressing and secreting different test oligo- or polypeptides (i.e., a yeast library), cells producing an active oligo- or polypeptide agonist can be identified and isolated due to their reduced receptor activity mediated by the cellinternal autocrine receptor inactivation and, thus, impaired response to an extracellular agonist. On the other hand, cells expressing inactive oligo- or polypeptides as test oligo- or polypeptides retain their full capability to respond to an extracellular agonist. In the examples a cell internal fluorescent reporter gene was used as read-out for signalling pathway and thus receptor activity. The method was found to be very reliable, because all peptides capable to induce cell-internal receptor-inactivation indeed showed agonist activity (Fig. 2A), while all test peptides without agonist-activity were incapableto induce inactivation of the co-expressed receptor (Fig. 2B). Thus, there is a strong correlation between the extracellular trait (activation) and the intracellular trait (inactivation), so that the intracellular, inactivating trait can be used for the identification of oligo- or polypeptides that when being secreted or applied act as an agonist for cell-surface localized receptor. Neither the trait of intracellular inactivation, nor the strong correlation between the intracellular and extracellular traits, were foreseeable from the prior art.

[0025] While the newly discovered trait of agonist-induced cell-internal receptor inactivation and its strong correlation with the "classical" extracellular agonist activity are shown in the appended examples for S. cerevisiae Ste2 and alpha-factor derivatives, the inventors believe that agonist-induced cell-internal inactivation is a common trait for controlling the activity of GPCRs to suppress detrimental autocrine signalling. Likely, the molecular mechanisms for agonist-induced cell-internal inactivation are similar or identical to those governing the well-described phenomenon of agonist-induced inactivation of cellsurface localized receptors and agonist-induced inactivation or desensitization of cell-surface localized GPCR's appears to be conserved and has been described for a number of mammalian, including human, GPCRs (see, e.g., in Gurevich and Gurevich, 2019, Front Pharmacol, 19:10:125). Similar to yeast Ste2, mammalian cell-surface localized receptors upon activation by ligand binding are hyperphosphorylated at the C-terminus, which consequentially leads, through additional steps, to inactivation or desensitization of thus labeled receptor molecules. It therefore can be reasonably expected that the method as described herein can be used to identify oligo- or polypeptide agonists and oligo- or polypeptide antagonists for a plethora of GPCRs, including human GCPRs. It is known that non-yeast, including mammalian, GPCRs can be functionally expressed in yeast cells (Wang et al., Biochemical Pharmacology, 187, May 2021, 114370). Any GPCR displaying the trait of cell-internal agonist-induced receptor inactivation can be used for the method described herein to identify oligo-or polypeptide agonists and oligo- or polypeptide antagonists for this GPCR. Several Ste2 homologs from yeast species other than S. cerevisiae have been shown by the inventors to display this trait when co-expressed with their peptide agonists (Fig 4A). Furthermore, the Ste2 receptor from Candida albicans, which in its wild type form did not display this trait, could be converted to display this trait by creating a hybrid of this receptor in which its C-terminus was exchanged with the C-terminus of S. cerevisiae Ste2 (Fig 4B). Notably, the intracellular C-terminus of a GPCR is not directly involved in ligand binding and thus, its exchange is not expected to alter the receptor's specificity for ligands.

[0026] In summary, the principle underlying the method of the invention is the following: The agonist binds to the GPCR within the cell. During the transport of the GPCR to the cell surface through the secretion system, the soon-to be extracellular parts of the receptor are facing the lumen (inside) of the secretorycompartments. The oligo- or polypeptide agonist also travels through the secretion system and is thus present in the secretory compartments. Thus, within the lumen of secretory compartments, the agonist can bind to the (soon-to-be) extracellular surface of the GPCR and thus, activate the GPCR, i.e., trigger a conformational transition into its active state. One of the consequences of the activation of a GPCR molecule at the cell surface is its modification, e.g., by phosphorylation and ubiquitination of its C-terminus, which serves as a label for internalization (i.e., retraction from the cell membrane) and thus inactivation. This mechanism is well-known and -described for cell-surface localized GPCR molecules and ensures that an activated GPCR molecule can not signal indefinitely. It is believed that this process (or parts of it) of accelerated inactivation due to accelerated retraction from internal and / or cell membranes of activated GPCR molecules also takes place in the present case of activation of the GPCR within the secretory pathway. Whatever the exact mechanism, we see that cell-internal activation of the GPCR (within the secretory pathway) leads to an impairment of its activity at the cell surface. Thus, within the secretory pathway, binding of co-expressed agonist leads to conformational transition of the GPCR into its active state; this leads to its inactivation (and / or labelling for accelerated inactivation) before it even reaches the cell surface; this leads to less activity of the GPCR at the cell surface. By definition, an ANTAGONIST does not lead to transition of the GPCR into its active state. Thus, it can not trigger this process of cell-internal sequential activation and inactivation and thus, the amount of GPCR at the cell surface should not be diminished. On the contrary (and this is the theoretical basis for the third aspect of the invention as will be described herein below), a co-expressed antagonist should be able to "protect" the GPCR from inactivation by co-expressed agonist.

[0027] It is demonstrated in the appended examples that the co-expression (more precisely, co-secretion) of a peptide-agonist together with its receptor, has two consequences: (1) Intracellular (presumably within the secretion system) binding of the agonist to its receptor, leading to intracellular activation (i.e., transition into its active conformation) of the receptor, leading as a net consequence to accelerated retraction of receptor from internal secretory pathway and / or cellular membranes and thus, lower amount / activity of receptor at the cell-surface (= autocrine cell-internal inactivation). (2) Those receptor molecules reaching the cell surface and connecting to the signalling pathway (e.g., by connecting to a G-protein), will be stimulated by the self-secreted extracellular peptide-agonist (= autocrine extracellular stimulation). Function (1) was not known and is the newly observed negative effect on receptor amount / activity. Function (2) is the known ("classical") positive / stimulatory effect on receptor activity. Thus, it was surprisingly found that the co-expression of peptide-agonist and receptor has two counter-acting effects on the receptor: (a) inactivation due to cell-internal agonist binding and (b) increased activation of the cell-surface located receptor. However, while effect (a) onlyinfluences the cell actually producing the agonist, effect (b) also influences all surrounding cells sharing the extracellular environment with the agonist-producer.

[0028] Function (2), the known ("classical" function) is, for example, known from WO 00 / 31261. According to WO 00 / 31261 co-secretion of peptide-agonist leads to increased receptor activity (and, if coupled to a signalling pathway, increased pathway activity) compared to cells not expressing agonist and not sharing the same extracellular environment with the agonist-secreting cell. However, cells not expressing peptide-agonist but sharing the environment with an agonist-secreting cell, would likewise be stimulated by the secreted agonist and, thus, cannot be distinguished from an agonist-producing cell. As a consequence, in order to make the method as described in WO 00 / 31261 work, individual cells of the library expressing different peptides must be sufficiently spatially separated from each other (e.g., by plating them on a plate) in order to avoid cross-stimulation.

[0029] In contrast, in the newly discovered function (1) as described herein for the first time, the co-expressed agonist exerts its influence on the receptor cell-internally. Here, a cell expressing an agonist has reduced receptor amount / activity compared to a cell not expressing an agonist but sharing the same extracellular environment. Thus, given a population of individual cells producing different peptides but sharing the same extracellular environment (e.g., growing in the same flask), the method of the invention, in contrast to the method described in WO 00 / 31261, allows for isolation of those cells expressing an agonist of the co-expressed receptor. In summary, since the method of the invention relies on an activity within the cell (before the putative agonist is secreted into the extracellular medium), it can be employed, for example, for a population of cells producing different peptides but sharing the same extracellular environment, without any need for spatial separation of individual clones. Thus, it allows for true high-throughput screening to identify those cells within the population that produce an active agonist. This is not possible with the method as described in WO 00 / 31261.

[0030] In accordance with a preferred embodiment of the first aspect in step (c) the activity of a cell-surface localized GPCR is assessed by contacting the library of yeast cells of (b) with a known agonist of the GPCR, wherein within the library of yeast cells a yeast cell expressing an oligo- or polypeptide agonist as the kind of test oligo- or polypeptide of the library of test oligo- or polypeptides is identified based on its lower response to the known agonist of the GPCR as compared to a yeast cell not expressing a test oligo- or polypeptide.

[0031] In the above preferred embodiment, a lower response to a known agonist of the GPCR as compared to a yeast cell not expressing a test oligo- or polypeptide indicates the lower cell-surface activity of the GPCR as compared to a yeast cell not expressing a test oligo- or polypeptide which indicates that theparticular test oligo- or polypeptide expressed within this cell is an oligo- or polypeptide agonist. Hence, the preferred embodiment relates to a method for identifying one or more oligo- or polypeptide agonists that can activate a GPCR, wherein the method comprises (a) expressing the GPCR in each yeast cell of a library of yeast cells such that the GPCR is presented at the surface of the yeast cells, (b) expressing a library of test oligo- or polypeptides in the library of yeast cells of (a) such that the test oligo- or polypeptides are directed into the secretion pathway of yeast cells of the library, wherein each yeast cell within the library expresses only one kind of test oligo- or polypeptide of the library of test oligo- or polypeptides, and (c) contacting the library of yeast cells of (b) with a known agonist of the GPCR, wherein within the library of yeast cells a yeast cell expressing an oligo- or polypeptide agonist as the kind of test oligo- or polypeptide of the library of test oligo- or polypeptides is identified based on its lower response to the known agonist of the GPCR as compared to a yeast cell not expressing a test oligo- or polypeptide. It is to be understood that if the GPCR is expressed such that it is presented at the surface of the yeast cells it is also coupled to the receptor-associated G protein, such that upon agonist binding it can activate the intrinsic yeast signalling pathway (mating pathway). It is also of note that the coupling of the G protein to the receptor is required only if the pathway activity is used as a read-out for receptor activity.

[0032] It is important to understand that the step of contacting the library of yeast cells of (b) with a known agonist excludes the expression of the known agonist in the yeast cells. Instead, the known agonist is to be added extracellularly to the yeast cells, so that the known agonist can bind to the extracellular part of the cell-surface localized GPCR but is not present within the yeast cells. This ensures that the known agonist cannot lead to cell-internal autocrine receptor inactivation.

[0033] The known agonists of GPCRs are preferably the known naturally occurring ligands that are known to bind to and to activate the respective GPCRs. A database on GPCRs and their ligands can, for example, be found in the IUPHAR / BPS Guide to PHARMACOLOGY (https: / / www.guidetopharmacology.org / GRAC / GPCRListForward?class=A) and the GLASS: a comprehensive database for experimentally validated GPCR-ligand associations (Chan et al. (2015); Bioinformatics; 31(18):3035-3042; https: / / zhanggroup.org / GLASS / ). Hence, the identification and use in the method of the invention of a known agonist of a particular GPCR is a matter of routine.

[0034] The test principle of this preferred embodiment is illustrated by the appended examples. If a test oligo-or polypeptide is a newly identified oligo- or polypeptide agonist, its expression in the cells inactivates the co-expressed GPCR by the discussed phenomenon of "cell-internal autocrine receptor inactivation". The consequence of this cell-internal inactivation is a reduced activity of cell-surfacelocalized GPCR and hence, the response to the known agonist of the GPCR as compared to a yeast cell not expressing a test oligo- or polypeptide is lower. The means and methods for the detection of the lower response to the known agonist are not particularly limited and preferred examples will be provided herein below.

[0035] In accordance with a more preferred embodiment of the first aspect the known agonist of the GPCR is an oligo- or polypeptide alpha-factor, preferably a fungal oligo- or polypeptide alpha-factor, and most preferably a yeast oligo- or polypeptide alpha-factor.

[0036] The S. cerevisiae alpha-factor is a medium-sized peptide pheromone that interacts with the GPCR Ste2. Ste2 is a class DI GPCR.

[0037] In accordance with a further more preferred embodiment of the first aspect the known agonist of the GPCR comprises or consists of the amino acid sequence of SEQ ID NO: 1 or 2, or an amino acid sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical to SEQ ID NO: 1 or 2.

[0038] The alpha-factor of Saccharomyces cerevisiae is a 13 aa peptide naturally occurring in the two variants of WHWLQLKPGQPMY (SEQ ID NO: 1) and WHWLNLRPGQPMY (SEQ ID NO: 2). SEQ ID NO: 1 is used as the known agonist in the appended examples and therefore preferred over SEQ ID NO: 2.

[0039] In accordance with the present invention, the term "percent (%) sequence identity" describes the number of matches ("hits") of identical nucleotides / amino acids of two or more aligned nucleic acid or amino acid sequences as compared to the number of nucleotides or amino acid residues making up the overall length of the template nucleic acid or amino acid sequences. In other terms, using an alignment, for two or more sequences or subsequences the percentage of amino acid residues or nucleotides that are the same (80%, 85%, 90% or 95% identity) may be determined, when the (sub)sequences are compared and aligned for maximum correspondence over a window of comparison, or over a designated region as measured using a sequence comparison algorithm as known in the art, or when manually aligned and visually inspected. This definition also applies to the complement of any sequence to be aligned.

[0040] Nucleotide and amino acid sequence analysis and alignment in connection with the present invention are preferably carried out using the NCBI BLAST algorithm (Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), NucleicAcids Res. 25:3389-3402). BLAST can be used for nucleotide sequences (nucleotide BLAST) and amino acid sequences (protein BLAST). The skilled person is aware of additional suitable programs to align nucleic acid sequences.

[0041] As defined herein, sequence identities of at least 80% identical, preferably at least 90% identical, and most preferred at least 95% are envisaged by the invention. However, also envisaged by the invention are with increasing preference sequence identities of at least 97.5%, at least 98.5%, at least 99%, at least 99.5%, at least 99.8%, and 100%.

[0042] In accordance with another preferred embodiment of the first aspect in step (c) the activity of a cellsurface localized GPCR is assessed by a fluorescently labelled GPCR, wherein in step (a) a GPCR-fluorescent protein fusion protein is expressed, wherein within the library of yeast cells a yeast cell expressing an oligo- or polypeptide agonist as the kind of test oligo- or polypeptide of the library of test oligo- or polypeptides is identified based on a reduced fluorescence of the cell-surface localized GPCR as compared to a yeast cell not expressing a test oligo- or polypeptide.

[0043] The test principle of this preferred embodiment is that the fluorescence of the fluorescent protein allows for directly observing / measuring the amount of a surface localized receptor and thereby the cell-surface activity of the GPCR. It is assumed that the phenomenon of "cell-internal autocrine receptor inactivation" leads to the inactivation of the GPCR by receptor retraction from internal and / or cellular membranes and subsequent degradation of the GPCR. Hence, the ultimate consequence of "cell-internal autocrine receptor inactivation" is that less GPCR is localized in the cell membrane of those yeast cells that express an oligo- or polypeptide agonist as a test oligo- or polypeptide. Hence, reduced fluorescence of the cell-surface localized GPCR as compared to a yeast cell not expressing a test oligo- or polypeptide indicates that the test oligo- or polypeptide produced by the respective cells is a GPCR agonist.

[0044] The fluorescent protein as the fusion partner of the GPCR is preferably encoded by one of the fluorescent reporter genes that will be described herein below.

[0045] The present invention relates in a second aspect to a method for identifying one or more oligo- or polypeptide agonists that can activate a GPCR; wherein the method comprises (a) expressing the GPCR in each yeast cell of a library of yeast cells, wherein the GPCR is fluorescently labelled (b) assessing the fluorescence localization pattern of the fluorescently labelled GPCR in each yeast cell of a library of yeast cells of (a),(c) expressing a library of test oligo- or polypeptides in the library of yeast cells of (a) such that the test oligo- or polypeptides are directed into the secretion pathway of yeast cells of the library, wherein each yeast cell within the library expresses only one kind of test oligo- or polypeptide of the library of test oligo- or polypeptides, (d) assessing the fluorescence localization pattern of the fluorescently labelled GPCR in each yeast cell of a library of the yeast cells of (c), wherein within the library of yeast cells a yeast cell expressing an oligo- or polypeptide agonist as the kind of test oligo- or polypeptide of the library of test oligo- or polypeptides is identified based on the change from a focal fluorescence localization pattern in (b) to a diffuse fluorescence localization pattern in (d), and / or from a fluorescence localization in the Golgi apparatus in (b) to a fluorescence localization in the cell vacuole in (d).

[0046] The definitions and preferred embodiments of the first aspect of the invention apply mutatis mutandis to the second aspect of the invention as far as being amenable therewith. For example and as discussed above, an antagonist is a molecule that inhibits or blocks a receptor to transition into its active conformation and thus, to produce a biological response. A fluorescently labelled GPCR has already been described in connection with a preferred embodiment of the first aspect. As mentioned, the fluorescent protein as the fusion partner of the GPCR is preferably encoded by one of the fluorescent reporter genes that will be described herein below.

[0047] In accordance with a preferred embodiment of the third aspect, the GPCR comprises a Golgi-retention sequence.

[0048] A Golgi-retention sequence ensures that the GPCR is retained within the endomembrane system without reaching the cell surface. This in turn ensures that all of the fluorescence of the fluorescently labelled GPCR is detected within the cell and that no fluorescence is present outside of the cell.

[0049] The Golgi-retention sequence is preferably derived from the cytoplasmic C-terminal tail of the Golgi-resident protein Kex2 and more preferably comprises or consists of the amino acids RRRIRRSR (SEQ. ID NO: 31) of a sequence being at least 80% identical thereto.

[0050] The Golgi-retention sequence is preferably inserted into the GPCR within the junction site that is present between the transmembrane domain and the cytoplasmic C-terminal tail of the GPCR.

[0051] It is shown in the appended examples that fluorescently labelled GPCR shows a distinct change in fluorescence localization upon the expression of a test oligo- or polypeptide in the yeast cell such thatthe test oligo- or polypeptide is directed into the secretion pathway of the yeast cell and the test oligo-or polypeptide is an oligo- or polypeptide agonist.

[0052] This distinct change in localization is the change from a focal fluorescence localization pattern to a diffuse fluorescence localization pattern, and / or from a fluorescence localization in the Golgi apparatus to a fluorescence localization in the cell vacuole. Figure 6C illustrates a change from a fluorescence localization in small clusters in the Golgi apparatus to a diffuse fluorescence localization in the vacuole.

[0053] The focal fluorescence localization pattern is preferably characterized by focal fluorescence clusters having a diameter of no more than 0.6 pm, preferably no more than 0.5 pm clusters and most preferably no more than 0.4 pm. The diffuse fluorescence localization is preferably characterized by fluorescence across an area within the cell having a diameter of more than 1.0 pm, preferably more than 1.5 pm.

[0054] Hence, while the first aspect of the invention identifies one or more oligo- or polypeptide agonists that can activate a GPCR from at the outside of the cell based on a lower cell-surface activity of the GPCR as compared to a yeast cell not expressing a test oligo- or polypeptide, the second aspect of the invention provides an alternative for identifying one or more oligo- or polypeptide agonists that can activate a GPCR. The alternative inspects the inside of the cell, namely the surprisingly found distinct change in GPCR localization.

[0055] The present invention relates in a third aspect to a method for identifying one or more oligo- or polypeptide antagonists that can inhibit a GPCR, wherein the method comprises (a) expressing the GPCR within each yeast cell of a library of yeast cells such that the GPCR is presented at the cell surface, (b) expressing an oligo- or polypeptide agonist of the GPCR in all cells of (a) such that the oligo- or polypeptide agonist is directed into the secretion pathway and such that the agonist induces cellinternal inactivation of the expressed GPCR of (a), and (c) expressing a library of test oligo- or polypeptides in the library of yeast cells of (b) such that the test oligo- or polypeptides are directed into the secretion pathway of the yeast cells of the library, wherein each yeast cell within the library expresses one kind of test oligo- or polypeptide of the library of test oligo- or polypeptides, wherein a yeast cell expressing an oligo- or polypeptide antagonist as the kind of test oligo- or polypeptide of the library of test oligo- or polypeptides can be identified based on its higher response to the expressed oligo- or polypeptide agonist of the GPCR as compared to a yeast cell not expressing a test oligo- or polypeptide but expressing the oligo- or polypeptide agonist of the GPCR.The definitions and preferred embodiments of the first and second aspect of the invention apply mutatis mutandis to the third aspect of the invention as far as being amenable therewith. For example and as discussed above, an antagonist is a molecule that inhibits or blocks a receptor to transition into its active conformation and thus, to produce a biological response.

[0056] The oligo- or polypeptide agonist of the third aspect is preferably the known oligo- or polypeptide agonist of the first aspect. Hence, also in connection with the third aspect the oligo- or polypeptide agonist is preferably an oligo- or polypeptide alpha-factor, more preferably a fungal oligo- or polypeptide alpha-factor, and most preferably a yeast oligo- or polypeptide alpha-factor. Also, the agonist of the GPCR comprises or consists of the amino acid sequence of SEQ ID NO: 1 or 2, or an amino acid sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical to SEQ ID NO: l or 2.

[0057] While the first aspect of the invention relates to a method for identifying one or more oligo- or polypeptide agonists that can activate a GPCR (agonists), the third aspect of the invention relates to a method for identifying one or more oligo- or polypeptide antagonists that can inhibit a GPCR (antagonists).

[0058] In this connection it is important to understand that in the context of the third aspect the (known) agonist is expressed inside the yeast cells and therefore leads to cell-internal autocrine receptor inactivation.

[0059] The test principle of the third aspect is that if a test oligo- or polypeptide is an antagonist it binds to the extracellular part of the test GPCR thereby blocking the co-expressed oligo- or polypeptide agonist to bind to the GPCR and thus "protecting" the GPCR from agonist-induced cell-internal inactivation. Hence, if a test oligo- or polypeptide is an antagonist it blocks cell-internal agonist-induced GPCR inactivation and results in higher activity of cell-surface localized GPCR compared to cells not expressing an antagonist as a kind of test oligo- or polypeptide.

[0060] The present invention relates in a forth aspect to a method for identifying one or more oligo- or polypeptide antagonists that can inhibit a GPCR; wherein the method comprises (a) expressing the GPCR within each yeast cell of a library of yeast cells, wherein the GPCR is fluorescently labelled, (b) assessing the fluorescence localization pattern of the fluorescently labelled GPCR in each yeast cell of a library of yeast cells of (a), (c) expressing an oligo- or polypeptide agonist of the GPCR in all cells of(a) such that the oligo- or polypeptide agonist is directed into the secretion pathway and such that the agonist induces a change in the localization of the fluorescently labeled GPCR in all cells of (a) from a focal fluorescence localization pattern to a diffuse fluorescence localization pattern, and / or from a fluorescence localization in the Golgi apparatus to a fluorescence localization in the cell vacuole, (d) expressing a library of test oligo- or polypeptides in the library of yeast cells of (c) such that the test oligo- or polypeptides are directed into the secretion pathway of the yeast cells of the library, wherein each yeast cell within the library expresses one kind of test oligo- or polypeptide of the library of test oligo- or polypeptides, and (e) assessing the fluorescence localization pattern of the fluorescently labelled GPCR in each yeast cell of a library of the yeast cells of (d), wherein a yeast cell expressing an oligo- or polypeptide antagonist as the kind of test oligo- or polypeptide of the library of test oligo- or polypeptides can be identified based on a change in localization of the fluorescently labeled GPCR from a diffuse fluorescence localization pattern to a focal fluorescence localization pattern and / or from a fluorescence localization in the cell vacuole to a fluorescence localization in the Golgi apparatus. In accordance with a preferred embodiment of all above aspects the method further comprises (i) isolating a yeast cell expressing an oligo- or polypeptide agonist or antagonist as the kind of test oligo-or polypeptide of the library of test oligo- or polypeptides, and / or (ii) isolating and sequencing the nucleic acid sequence of said oligo- or polypeptide agonist or antagonist from said yeast cell and / or (iii) isolating and identifying or sequencing the expressed oligo- or polypeptide agonist or antagonist from said yeast cells.

[0061] Because each yeast cell within the library expresses only one kind of test oligo- or polypeptide of the library of test oligo- or polypeptide, it is possible to isolate those yeast cells that were identified to express an oligo- or polypeptide agonist or antagonist as the kind of test oligo- or polypeptide of the library of test oligo- or polypeptides by the method of all above aspects, respectively. Means and methods for isolating single cells are known in the art and include, for example cell-sorting (FACS, MACS, etc.), single cell dilutions and single cell picking.

[0062] It is also possible to isolate the nucleic acid sequence encoding the identified oligo- or polypeptide agonists or antagonists from the yeast cells and to sequence said nucleic acid sequences to obtain the nucleotide and amino acid sequences of the identified oligo- or polypeptide agonists or antagonists.

[0063] Finally, it is possible to isolate the amino acid sequences of the identified oligo- or polypeptide agonists or antagonists from the yeast cells and to identify or sequence said amino acid sequences of the identified oligo- or polypeptide agonists or antagonists.In accordance with a preferred embodiment of above aspects the GPCR is a GPCR fungal pheromone mating factor receptor (Class D GPCR).

[0064] Fungal pheromone mating factor receptors form a distinct family of G-protein-coupled receptors and they are also known as Class D GPCRs. Mating factor receptors Ste2 and Ste3 are integral membrane proteins that are involved in the response to mating factors on the cell membrane. The amino acid sequences of both receptors contain high proportions of hydrophobic residues grouped into 7 domains, in a manner reminiscent of the rhodopsins and other receptors known to interact with G-proteins.

[0065] In accordance with a more preferred embodiment of all above aspects the GPCR fungal pheromone mating factor receptor is Ste2.

[0066] The Ste2 protein of Saccharomyces cerevisiae (Baker's yeast) is the cell-surface receptor that binds the 13-residue peptide alpha-factor of Saccharomyces cerevisiae.

[0067] In accordance with a further more preferred embodiment of all above aspects the GPCR fungal pheromone mating factor receptor is from a yeast species.

[0068] This yeast species is preferably S. cerevisiae as used in the appended examples.

[0069] In accordance with an even more preferred embodiment of all above aspects the Ste2 comprises or consists of the amino acid sequence of any one of SEQ ID NOs 3 to 9 or an amino acid sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical to any one of SEQ ID NOs 3 to 9.

[0070] SEQ ID NOs 3, 4, 5, 6, 7 and 8 are the amino acid sequences of the GPCR Ste2 of Saccharomyces cerevisiae, Kazachstania naganishii, Kluyveromyces lactis, Lachancea fermentati, Lachancea mirantina and Candida albicans, respectively. SEQ ID NO: 3 is used as GPCR in the appended examples and is therefore preferred. SEQ ID NO: 9 is the Ca-Ste2-Sc-Ste2 hybrid receptor as illustrated in the appended examples and is therefore also preferred.

[0071] In accordance with a preferred embodiment of all above aspects the yeast cell is a S. cerevisiae yeast cell.Saccharomyces cerevisiae (S. cerevisiae) yeast (brewer's yeast or baker's yeast) cells are used in the appended examples. While S. cerevisiae cells are preferred also other yeast cells, for example, Schizosaccharomyces pombe (S. pombe) can be used. Several yeasts, in particular S. cerevisiae and S. pombe, have been widely used in genetics and cell biology, largely because they are genetically tractable simple eukaryotic cells, serving as a model for all eukaryotes, including humans, for the study of fundamental cellular processes such as the cell cycle, DNA replication, recombination, cell division, and metabolism. Today several yeast species had their genomes sequenced and published and yeast genomes can be sequenced by yeast whole genome sequencing in one run only, including chromosomal DNA as well as mitochondrial DNA.

[0072] In accordance with a preferred embodiment of all above aspects the yeast cell comprises a fluorescent reporter gene, the fluorescence of which is changed in response to the applied agonist when the yeast cell expresses an active agonist / antagonist oligo- or polypeptide.

[0073] As explained above, in the appended examples the S. cerevisiae cells, Ste2 of S. cerevisiae (Figures 2 and 3) and alpha-factor of S. cerevisiae (and derivates of it; Figures 2 and 3) are used as yeast cells, GPCR and known agonist, respectively. The fluorescent reporter gene preferably comprises a FUS1 gene promoter fused to a gene encoding a fluorescent protein, which is preferably GFP.

[0074] As can be furthermore taken from the appended examples, the fluorescent reporter gene is used in order to identify the "cell-surface activity of the GPCR" and / or "a lower or higher response to the known agonist of the GPCR as compared to a yeast cell not expressing a test oligo- or polypeptide". In the appended examples the fluorescent reporter gene is a FUS1 gene promoter being fused to a gene encoding a fluorescent protein (GFP or Neongreen). Via this FUS1 -GFP (or FL / Sl-Neongreen) reporter gene Ste2 activity can be measured. This is because FUS1 transcription is dependent on Ste2 activation (Duran-Avelar (2001), EMS Microbiol Lett; 197(1):65-71.).

[0075] In order to separate the subpopulations of yeast cells expressing oligo- or polypeptides with and without agonist-activity as test oligo- or polypeptides, respectively, the yeast cells can be sorted based on the fluorescence of the FUSl-GFP reporter gene into non-responsive (GFP j and responsive (GFP+) cells. As can be taken from the appended examples that illustrate the first aspect of the invention for the identification of oligo- or polypeptide agonists, thus, likely, the population of GFP-cells was highly enriched for oligo- or polypeptides acting as agonists of Ste2.If pathway / reporter activity is used as the readout, one needs to make sure that the G(alpha) protein which couples to the GPCR has to be compatible with the GPCR. If needed, a screen for a suitable G(alpha) protein can be carried out; see, for example, Hus and Luo (2007), Am J Physiol Endocrinol Metab, 293(4): E1021-9 and Mashuho et al. (2023), Cell Reports, 42,(10):113173.

[0076] In accordance with a more preferred embodiment of all above aspects the fluorescent reporter gene is a GFP, EGFP, YFP, Neongreen, EBFP, Azurite, SBFP2, EBFP2, CFP, Cerulean, Citrine, Venus, Sapphire, Emerald, DsRed, DsRed2, mRFPl, mCherry, tdTomato, mPlum, Azami Green, Katushka, mKate or mKate2 reporter gene.

[0077] GFP, EGFP, YFP, Neongreen, EBFP, Azurite, SBFP2, EBFP2, CFP, Cerulean, Citrine, Venus, Sapphire, Emerald, DsRed, DsRed2, mRFPl, mCherry, tdTomato, mPlum, Azami Green, Katushka, mKate and mKate2 are non-limiting but preferred examples of fluorescent proteins that were used as reporters, for example, in order to identify the expression of certain genes.

[0078] In accordance with a more preferred embodiment of all above aspects the intensity of the fluorescence is determined by Fluorescence Activated Cell Sorting (FACS), flow cytometry or fluorescence microscopy.

[0079] FACS is most preferred for cell sorting and is illustrated by the appended examples. The yeast cells were sorted into GFP+and GFP-cells.

[0080] In accordance with a more preferred embodiment of all above aspects the expressed test oligo- or polypeptides comprise at their N-terminus a signal sequence directing them towards the secretory pathway.

[0081] In accordance with all above aspects the test oligo- or polypeptides are directed into the secretion pathway of yeast cells of the library and in accordance with the third aspect only also the (known) oligo- or polypeptide agonist. This is preferably achieved by a signal sequence directing them towards the secretory pathway at the N-terminus.

[0082] A signal sequence (also referred to as signal peptide, targeting signal, localization signal, localization sequence, transit peptide, leader sequence or leader peptide) is a short peptide (usually 16-30 amino acids long) present at the N-terminus (or occasionally non-classically at the C-terminus or internally) of proteins and oligo- or polypeptides that are destined toward the secretory pathway. The signalpeptide carries the information for protein secretion. A comprehensive review of signal peptides can be found, for example, in Owji et al. (2018), European Journal of Cell Biology, 97(6):422-441. The signal peptide comprises a cleavage side (i.e. stretch of amino acids that is recognized and cleaved by signal peptidase), so that the signal peptide is typically cleaved-off within the secretory pathway before the test oligo- or polypeptide is secreted.

[0083] The test oligo- or polypeptides are preferably expressed from yeast expression vectors. Several yeast protein expression systems exist in organisms from the genera Saccharomyces, Pichia, Kluyveromyces, Hansenula and Yarrowia. Vectors that integrate into the host chromosome are most widely used because of their mitotic stability in the absence of a selection. However, episomal expression vectors exist for some yeast systems. Expression vectors typically contain a yeast promoter and terminator and a yeast selectable marker cassette. Most yeast vectors can be propagated and amplified in E. coli to facilitate cloning and as such, also contain an E. coli replication origin and antibiotic selectable marker. Finally, many yeast expression vectors include the ability to optionally clone a gene downstream of an efficient secretion leader (usually that of mating factor) that efficiently directs a heterologous protein to become secreted from the cell.

[0084] Episomal expression vectors are preferred because they allow for more efficient transformation into yeast cells and they allow to directly isolate them from the yeast cells in order to identify the oligo- or polypeptide agonist and antagonist nucleotide sequences.

[0085] Also the test oligo- or polypeptides are preferably expressed from an inducible promoter, preferably doxycycline or tetracycline-inducible promoter and most preferably pTetO7. Expression of the test oligo- or polypeptides from a doxycycline inducible promoter additionally requires expression of a doxycycline-responsive transcriptional activator. The doxycycline-responsive transcriptional activator is preferably rtTA-S2 as described in Urlinger et. al (2000), PNAS, 97(14):7963-7968. An inducible promoter is a regulatory promoter that is activated only when cells receive a specific stimulus. Upon activation, the promoter-specific stimulus-responsive activator recruits RNA polymerase and additional transcriptional factors to the promoter. Thus, the transcription process is initiated. For the doxycycline or tetracycline-inducible promoter this stimulus is doxycycline or tetracycline. Inducible promoter systems for yeast cells are, for example, reviewed in Kluge et al. (2018), Appl Microbiol Biotechnol., 102(15):6357-6372.In accordance with a more preferred embodiment of all above aspects the library of test oligo- or polypeptides comprises at least 100, preferably at least 1000 and most preferably at least 10000 different test oligo- or polypeptides.

[0086] As can also be taken from the appended examples based on SEQ. ID NO: 1 a library of test oligo- or polypeptides comprising about 24,500 distinct oligo- or polypeptides was designed (see Fig 3A). Hence, the number of different test oligo- or polypeptides to be employed in the method of the invention is with increasing preference at least 100, at least 1000, at least 5000, at least 10000, at least 15000 and at least 20000.

[0087] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skilled in the art to which this invention belongs. In case of conflict, the patent specification including definitions, will prevail.

[0088] Regarding the embodiments characterized in this specification, in particular in the claims, it is intended that each embodiment mentioned in a dependent claim is combined with each embodiment of each claim (independent or dependent) said dependent claim depends from. For example, in case of an independent claim 1 reciting 3 alternatives A, B and C, a dependent claim 2 reciting 3 alternatives D, E and F and a claim 3 depending from claims 1 and 2 and reciting 3 alternatives G, H and I, it is to be understood that the specification unambiguously discloses embodiments corresponding to combinations A, D, G; A, D, H; A, D, I; A, E, G; A, E, H; A, E, I; A, F, G; A, F, H; A, F, I; B, D, G; B, D, H; B, D, I; B, E, G; B, E, H; B, E, I; B, F, G; B, F, H; B, F, I; C, D, G; C, D, H; C, D, I; C, E, G; C, E, H; C, E, I; C, F, G; C, F, H; C, F, I, unless specifically mentioned otherwise.

[0089] Similarly, and also in those cases where independent and / or dependent claims do not recite alternatives, it is understood that if dependent claims refer back to a plurality of preceding claims, any combination of subject-matter covered thereby is considered to be explicitly disclosed. For example, in case of an independent claim 1, a dependent claim 2 referring back to claim 1, and a dependent claim 3 referring back to both claims 2 and 1, it follows that the combination of the subject-matter of claims 3 and 1 is clearly and unambiguously disclosed as is the combination of the subject-matter of claims 3, 2 and 1. In case a further dependent claim 4 is present which refers to any one of claims 1 to 3, it follows that the combination of the subject-matter of claims 4 and 1, of claims 4, 2 and 1, of claims 4, 3 and 1, as well as of claims 4, 3, 2 and 1 is clearly and unambiguously disclosed.

[0090] This also holds true for alternatives in different claims that depend from each other. Thus, if claim 1recites three alternatives of the same category and claim 2 recites three alternatives of a different category as recited in claim 1, and refers back to claim 1, all combinations of the alternatives as recited in claims 1 and 2 are explicitly disclosed herein.

[0091] The above considerations apply mutatis mutandis to all appended claims.

[0092] The figures show.

[0093] Figure 1 - Principle of the proposed screen for GPCR oligo- and polypeptide agonists. (A) Model representation for cell-internal agonist-induced receptor inactivation. (1) After translation, GPCR's (light blue), like all cell-membrane receptors, are transported within secretory compartments (endoplasmic reticulum, Golgi apparatus, secretory vesicles) to the cell surface, with their future extracellular regions facing towards the compartment lumen. Cell-surface localized GPCR molecules assemble into signalling-competent complexes, e.g., by association with G protein complexes (light magenta). Binding of extracellular agonist (orange circle) to a GPCR leads to conformational transition into its active state (dark blue) with one consequence being the activation of its associated G protein (dark magenta) and the resulting activation of the corresponding signalling cascade or enzyme activity (not shown). (2) Co-secreted oligo- or polypeptide agonist binds to the GPCR within secretory compartments, leading to conformational transition of the receptor into its active state. Activated GPCR is accessible to cell-internal inactivating and / or degrading activity, leading to its cell-internal inactivation and / or degradation and consequentially, lower GPCR activity at the cell surface. (B) Within a library of yeast cells in which each cell expresses the same GPCR but a different co-secreted oligo- or polypeptide, those cells expressing an agonist for the GPCR (circles in different colors) are characterized by lower cell-surface GPCR activity than those cells expressing no peptide or a nonagonist oligo- or polypeptide (squares and triangles) due to cell-internal agonist-induced receptor inactivation (A).

[0094] Figure 2 - Capability to induce cell-internal Ste2 receptor-inactivation and extracellular Ste2 activation (agonist-activity) for different alpha (a)-factor-derived active (A) and inactive (B) peptides. Strains (producer+receptor, PS, blue) carrying Ste2 receptor and different doxcycline (Dox)-inducible peptides (different peptides in different rows) were incubated either as mono-cultures (left columns in A and B) or in co-culture with a strain (sensor-only, S, red) carrying only Ste2 receptor (right columns in A and B; only the responses of the S strain are shown). Expression of peptides in PS strains was induced by 20 pg / ml Dox; mono-cultures of PS strains (left columns) were exposed to 20 nM synthetic alpha-factor (a-factor). Shown are fluorescence distributions for FUS1-sfGFP and FUS1-mNeongreen reporter genesin PS and S strains, respectively. Distributions with grey filling (Control) stem from control-cultures where PS did not contain a peptide and are displayed in each plot for comparison. Peptide pepscl (top row in A) is wild type alpha-factor; blue and red arrows exemplarily indicate shifts of responses due to cell-internal receptor inactivation and extracellular receptor activation, respectively.

[0095] Figure 3 - Proof-of-principle of a high-throughput screen for Ste2 peptide-agonists. (A) Sequence logo of the employed library of test peptides with the height of individual residues reflecting their theoretical probability to occur within the library. Residues occurring in the S. cerevisiae alpha-factor are highlighted with a yellow background. (B) Illustration of the performed experimental screening procedure. The constructed yeast library with different Dox-inducible test peptides was grown in the presence of Dox and alpha-factor (a-factor) and sorted by FACS based on the expression of the FUS1-GFP reporter into GFP⁻ and GFP⁺ factions, enriched for cells expressing active (agonist) and inactive (non-agonist) test peptides, respectively. (C) Flow-cytometry measurements showing the responses of the different sorted factions to synthetic a-factor in the absence (gray) or presence (orange) of Dox, i.e., test peptide expression). (D) Logos of the test peptide sequences isolated from the different factions (order as in C). The heights of residues reflect the frequency of occurrence amongst all sequences in a given pool. Yellow big and small triangles indicate positions with strongly and modestly enriched individual amino acids, respectively.

[0096] Figure 4 - Cell-internal inactivation of Ste2 homologs from other yeast species within S. cerevisiae. (A) Each co-culture was comprised of a strain (Sensor only, S, red) expressing a Ste2 homolog from another yeast species (top to bottom: Kazachstania naganishii, Kluyveromyces lactis, Lachancea fermentati, Lachancea mirantina) and another strain (Producer+Sensor, PS, blue) containing the receptor and the corresponding doxycycline (Dox)-inducible alpha-factor of the same species as the receptor. After growing separately overnight, PS and S strains were mixed in a 1:1 ratio in fresh medium and incubated for about five hours in the absence (left column) or presence (right column) of doxycycline (Dox). Shown are histograms of GFP-reporter fluorescence for both strains within the co-culture separately (in different colors). (B) S. cerevisiae (Sac.cer) strains containing a Dox-inducible Candida albicans (Can.alb) alpha-factor gene and expressing no Ste2 receptor (top), Can.alb-Stel (middle) or a hybrid receptor consisting of Can.alb-Stel excluding its C-terminus fused to the C-terminus of Sac.cer-Stel (bottom) were grown for five hours in the absence (gray) or presence (orange) of Dox and treated with synthetic Can.alb alpha-factor two hours before flow-cytometry measurements.

[0097] Figure 5 - Cloning of the test peptide plasmid library. (1) The receiver plasmid contained two Bsal restriction sites for cloning of peptide-coding DNA sequences downstream of a doxycycline-induciblepromoter (pTetO7) and in between secretion signal and processing sites in order to achieve secretion of the mature peptide. (2) The single-stranded oligonucleotide contained several degenerated nucleotide positions (purple) within the peptide-coding sequence, thus coding for approximately 24,500 unique peptides. Double-stranded oligonucleotides were constructed by annealing a reverse primer to a constant region within the single-stranded oligonucleotide and performing a primer extension polymerase reaction. (3) The double-stranded oligonucleotides were cloned into the receiver plasmid by performing a " Golden-gate" reaction, resulting in in-frame fusion of mature-peptide sequences to the plasmid-encoded processing sites, with different individual plasmid molecules potentially encoding different peptide sequences.

[0098] Figure 6 - (A) Schematic representation of Ste2 (top) with its extracellular (Extra, grey), transmembrane (TMD, green) and intracellular (Intra, blue) domains. The junction between the last TMD and the cytoplasmic C-terminal tail are shown for the wild-type Ste2 (middle) and the Ste2-Kx variant (bottom). Ste2-Kx contains an 8-amino acid putative Golgi retention sequence derived from the Kex2 protein, inserted between amino acids 295 and 302. (B) PFUSl-mCherry reporter gene activity in cells expressing Ste2-mNeongreen (top) or Ste2-Kx-mNeongreen (bottom) in the absence (grey) or in the presence (blue) of synthetic a-factor. Results are from three to five independent experiments. (C) Fluorescence images of representative cells expressing C-terminally tagged Ste2-Kx-mNeongreen in the absence of external stimuli (left) or in the presence of either added synthetic a-factor (middle) or internal production of a-factor stimulated by Dox (right). Images were taken three hours after the addition of a-factor or Dox. Scale bar, 2 pm.

[0099] The examples illustrate the invention.

[0100] Example 1 - Results

[0101] Proof-of-principle screen for Ste2

[0102]

[0103] We have shown that co-expression of the S. cerevisiae G-protein coupled receptor (GPCR) Ste2, together with its peptide ligand (agonist) alpha-factor, results in cell-internal inactivation of Ste2 and consequently, the inability of the cell to respond to externally applied alpha-factor (see, e.g., Fig. 2A, upper row). Likely, cell-internal GPCR inactivation is a consequence of binding of agonist to the "soon-to-be" extracellular surface of the receptor within secretory compartments, leading to conformational transition of the GPCR into its active state and its consequential accessibility for GPCR-inactivating activity within the cell (Fig. 1A).Based on this phenomenon of cell-internal GPCR-inactivation by peptide-agonist co-expression and cosecretion, we aimed to develop a procedure which would allow for fast and high-throughput screening and identification of active peptide ligands (agonists) for a given GPCR in S. cerevisiae. The method is based on the concept that within a population of cells expressing and secreting different peptides (i.e., a yeast library), cells producing an active peptide agonist can be identified and isolated due to their reduced receptor activity and thus impaired response to extracellular agonist, while cells expressing inactive peptides (or no peptide at all) retain their cell-surface localized receptor activity and thus their full capability to respond to extracellular agonist (Fig. IB).

[0104] To test this concept, we examined different peptides related to but different from alpha-factor for their capabilities to (i) induce cell-internal deactivation of Ste2 when co-expressed with the receptor and to (ii) function as an agonist (activator) for Ste2 when secreted and acting extra-cellularly on a sensor-strain expressing only the receptor (Fig. 2). We found a strong positive correlation between these two traits: all peptides capable to induce cell-internal receptor-inactivation indeed showed agonist activity (Fig. 2A) while all peptides without agonist-activity were incapable to induce cellinternal inactivation of co-expressed receptor (Fig. 2B).

[0105] Next, in order to test and proof the principle of the proposed method, we performed a screen for peptide agonists of S. cerevisiae Ste2 with a library of strains expressing different peptides.

[0106] For construction of the peptide library, we used an oligonucleotide with several degenerate nucleotide positions coding for roughly 24,500 distinct peptides (Fig. 3A) derived from S. cerevisiae alpha-factor (Fig. 3A, amino-acid residues with yellow background) and cloned it into a "receiver" plasmid inbetween flanking secretion and processing sites and downstream of a doxycycline (Dox)-inducible promoter. Thus, peptides cloned into this vector will be secreted and processed to result in the desired mature peptide and their expression can be induced by Dox. Construction of the peptide-encoding plasmid library is detailed in the Material and Methods section.

[0107] The constructed plasmid library was transformed into an S. cerevisiae strain (yLK004, see table 1) expressing S. cerevisiae Ste2 and containing a GFP-reporter gene (FUS1-sfGFP) for measuring mating pathway and thus, indirectly, Ste2 activity, resulting in a yeast library containing cells with different peptides. In order to separate the subpopulations expressing peptides with and without agonistactivity, the yeast library cells were grown in the presence of Dox (to induce expression of the peptide) and synthetic alpha-factor (to extracellularly stimulate the receptors) and sorted based on the GFP-reporter fluorescence by fluorescence-assisted cell-sorting (FACS) into non-responsive (GFPj and responsive (GFP+) populations (Fig. 3B, see Material and Methods). Cells sorted independent of theirGFP fluorescence ("mock"-sorted, termed "unsorted" in the following) served as a control representing the total library population.

[0108] The sorted cell populations were grown and tested for their responses to extracellular alpha-factor while expressing their peptides. These measurements confirmed successful sorting: upon induction of peptide expression by Dox, the unsorted population showed a mixed response to synthetic alphafactor indicating the presence of large fractions of both responsive and non-responsive cells in the population, while the GFP+population was mostly responsive and the GFP-population was largely non-responsive (Fig. 3C). In the absence of Dox, i.e., in the absence of peptide expression, all populations uniformly displayed responsiveness to synthetic alpha-factor (Fig. 3C, grey). Thus, likely, the GFP' population was highly enriched for peptides acting as agonists of Ste2 and thus being capable of inducing cell-internal Ste2 inactivation.

[0109] Extraction of the peptide-encoding plasmids from the different populations and analysis of the peptide-coding regions by deep sequencing supported this conclusion. The peptide sequences found in the unsorted and GFP+populations did not show significant biases towards specific amino acids in any position, with the frequencies of individual amino acids in all positions closely mirroring the theoretical likelihood (Fig. 3D, compared to Fig. 3A). However, sequences in the GFP' population did show strong biases towards specific amino acids in several positions (esp. positions 2 and 6, and, to a lesser extent positions 12 and 13; see Fig. 3D bottom). Notably, the strongly enriched amino acids in positions 2 and 6 are those occurring in the S. cerevisiae wild type alpha-factor.

[0110] Suitability of other GPCR's for the peptide agonist screen

[0111] The basis for the above-described screening procedure lies in the phenomenon of cell-internal receptor inactivation by co-expressed peptide agonist. We tested if other GPCR's different from S. cerevisiae Ste2 (Sc-Ste2) displayed this phenomenon and, by implication, would be suitable to screen for oligo- or polypeptide agonists targeting those receptors. For this purpose, we expressed homologs of Ste2 from other yeast species along with their corresponding alpha-factor homologs within S. cerevisiae. We used co-cultures each consisting of a strain expressing only the receptor (Sensor-only S, red in Fig. 4A) and another strain (Producer+Sensor PS, blue in Fig. 4A) containing the receptor along with the corresponding Dox-inducible alpha-factor gene. Indeed, induction of alpha-factor expression by Dox within the PS strains led to clearly different reporter gene expressions in S and PS strains with PS strains displaying lower reporter activity due cell-internal receptor inactivation (Fig. 4A, right column).Out of the tested receptors, Ste2 from Candida albicans (Ca-Ste2) did not display intracellular inactivation within S. cerevisiae as shown by the unchanged reporter activity upon Dox-induced alphafactor expression (Fig. 4B, middle). We have shown that the C-terminal intracellular tail plays an essential role in the cell-internal inactivation of Sc-Ste2 (data not shown herein). Thus, in order to achieve its cell-internal inactivation, we exchanged the C-terminal tail of Ca-Ste2 with the C-terminal tail of Sc-Ste2. Indeed, this hybrid receptor displayed cell-internal inactivation upon co-expression of C. albicans alpha-factor (Fig. 4B, bottom). It is important to note that the intracellular C-terminus of GPCR's is not directly involved in extracellular ligand recognition and thus, its exchange should not alter the receptor specificity for extracellular ligands. Consequently, the Ca-Ste2-Sc-Ste2 hybrid receptor recognizes the same ligand(s) as Ca-Ste2 and thus, can be inactivated by C. albicans alphafactor.

[0112] Finally, to provide direct evidence that cell-internal Ste2-a-factor interaction can induce retraction of the receptor from the endomembrane system, we constructed a Ste2-Kx variant which is retained within the endomembrane system without reaching the cell surface. For that, an 8-amino acid putative Golgi-retention sequence, derived from the cytoplasmic C-terminal tail of the Golgi-resident protein Kex2 (35), was inserted within the junction site between the transmembrane domain and the cytoplasmic C-terminal tail of Ste2 (Fig. 6A). In contrast to Ste2-mNeongreen, cells expressing Ste2-Kx-mNeongreen did not activate the PFUSl-reporter in response to extracellular synthetic a-factor (Fig.

[0113] 6B). Furthermore, unlike Ste2-mNeongreen, Ste2-Kx-mNeongreen did not appear to form a ring of small clusters at the cell surface and it did not change localization upon stimulation with the synthetic a-factor (Fig. 6C). However, this hybrid exhibited a distinct change in localization, apparently being targeted to the vacuole, upon the induction of intracellular a-factor production (Fig. 6C). Thus, even cell-internal interaction between Ste2 and a-factor is sufficient to induce the retraction of the fluorescently labelled receptor from intracellular membranes, without the necessity to reach the cell membrane, and its localization into the vacuole.

[0114] In summary, we have shown here that some Ste2 homologs from other yeast species could be readily used to screen for potential peptide agonists using the above-described procedure. Moreover, we could show that one receptor not displaying the required property of cell-internal inactivation in S. cerevisiae could be "converted" to such functionality by transplanting to it the Sc-Ste2 C-terminus and thus, such "converted" receptor could be used in the screen.Example 2 - Material and Methods

[0115] Strains

[0116] All strains used in this study are derivatives of Saccharomyces cerevisiae strain SEY6210 (MATa leu2-3,112 ura3-52 his3 200 trplA901 Iys2 -801 suc2A9) or SEY6210a (MATa, otherwise identical to SEY6210) (Robinson et al., 1988) and are listed in Table 1.

[0117] Table 1. Strains used in this study.

[0118] Name Relative genotype* Description Figure [SEY6210] hot\::[PSAc6-STE2- Pheromone pathway GFP reporter; TENOI: HIS3] lys2bC::[LYS2: PADHi- chromosomally integrated doxycyclinertTAS2-T / iDHi] mfalb:: LEU2 responsive transcriptional activator rtTA- yLKOOl mfd2A::hph ste2A::[Prm- S2; Deletion of a-factor receptor gene STE3 mRuby2-T / (DHi: KanMx] and alpha-factor genes MFal and MFa2; steS&'MTRPl ura3::[PFusi- constitutively expressed STE2; constitutive Ubi(l)-sfGFP-TfUSi:t / / ? A3] expression of mRuby

[0119]

[0120] Deletion of HISS within STE2-expression fvLKOOl] hoA:: IP^rs-STE2- construct (which is integrated in ho locus) yLK004 -

[0121]

[0122] TfWoi: / i / s3A::nat] to release HISS marker; background strain for yeast peptide library

[0123]

[0124] A series of strains, each expressing a [yLK004] ste2A::[P LeL07“ pepXXX- yLK004-pepXXX different peptide under control of 2 TDHI'-HISS]

[0125] doxycycline-inducible promoter

[0126]

[0127]

[0128] [yLKOOl] hoA::[Ps C6- Constitutive expression of Candida [Can.alb]STF2-TfWM:nat] albicans STE2 and doxycycline-inducible

[0129]

[0130] ste2A::[Pteto7-[Can.alb] / WFcr- expression of Candida albicans alpha- TTDHI-HIS3] factor

[0131] yLKOll (yLKOlOl hoA:: kan No STE2 receptor 4B [yLKOllI hoA::[Ps^6-N- Constitutive expression of Candida yAA458 [Can.alb]STE2-C-STE2- 4B albicans + S. cerevisiae hybrid STE2 Ta / m:nat] [yLKOOl] hoA::[Ps / (C6- Constitutive expression of Kazachstania yLK033

[0132] [Kaz.nag]STE2-Tss / u:nat] naganishii STE2; no alpha-factor

[0133]

[0134] Constitutive expression of Kazachstania [yLK033] ste2A::[Pteto7- naganishii STE2 and doxycycline-inducible yLK043

[0135]

[0136] [Kaz.nag]MFa-TpG / «: CgH / S3] expression of Kazachstania naganishii alpha-factor

[0137] [yLKOOl]

[0138]

[0139] hoA::[Ps(C6- Constitutive expression of Kluyveromyces yLK034

[0140] [Klu.lac]STF2-Tssu:nat] lactis STE2; no alpha-factor

[0141]

[0142] Name Relative genotype* Description Figure Constitutive expression of Kluyveromyces [vLK034] ste2A:: FPtPto7- lactis STE2 and doxvcvcline-inducible yLK044 - 4A [Klu.lac]MFa-TpG / «: CgH / S3] expression of Kluyveromyces lactis alphafactor

[0143] IvLKOOl] f)oA::[Rs / (C6- Constitutive expression of Lachancea [Lac.fer]S7’F2-Tss / (i:nat] fermentati STE2; no alpha-factor Constitutive expression of Lachancea LKQ45 lvLK035] ste2A::[Pteto7- fermentati STE2 and doxycycline-inducible [Lac.ter]MFa-TpGKi'CgHIS3] expression of Lachancea fermentati alphafactor h / LKOOl] hoA::[Ps / (C6- Constitutive expression of Lachancea [Lac.mir]S7’F2-Tss / (i:nat] mirantina STE2; no alpha-factor Constitutive expression of Lachancea [yLK036] ste2A::[Pteto7- mirantina STE2 and doxycycline-inducible yLK046 4A [Lac.mir] / W Fa-~[PGKr. CgHIS3] expression of Lachancea mirantina alphafactor [SEY6210a] aga21\::k\TRPl MATa with aga2k with Pfusi-mNeongreen AA407 h / s3A::[PTOH2-mCherry- reporter and constitutive mCherry TTDHZ'HISS] ura3::[PFusr expression; used as sensor strain to sense mNeongreen-TpusFDRAS] peptides secreted by co-cultured strain.

[0144]

[0145]

[0146] (SEY62101 / ?oA::[Pfusi-mCherry- TEN0i: CaURA3] lys2^C-.-.[LYS2-.pADH1- Pheromone pathway P^-mCherry rtTAS2-TADH2] mfalb::[PsAC6-STE2- reporter, Dox-controlled a-factor peptide yAA54b 6D Kx-mNeongreen-Tflvoi:nat] expression, constitutive expression of Ste2 m / a2A::hph ste2A::[Ptcto7-pepscl- tagged with mNeongreen FTDHI: HIS3] ste3k: MTRPl [SEY6210] / ?oA::[Pfusi-mCherry- TENOI: CaURA3] lys2& C:: [LYS2: PADHI- I1TAS2-TADHI] mfalA::[PsAc6-STE2- Like yAA545, but constitutive expression yAA546 6B, C Kx-mNeongreen-Tflvoi:nat] of Ste2-Kx tagged with mNeongreen m / a2A::hph ste2A::[Pteto7-pepscl- FTDHI: HIS3] ste3b: MTRPl

[0147]

[0148] ’Genotypes are given relative to the predecessor shown underlined in square brackets.

[0149] Plasmids

[0150] Generally, plasmids containing yeast integrative cassettes were constructed by " Golden-Gate" assembly based on the standards and parts provided by the " Yeast toolkit" (ACS Synth. Biol. 2015, 4, 975-986, DOI: 10.1021 / sb500366v), extended by parts constructed in our laboratory.The relevant features of episomal plasmid pLK015, which served as the receiver plasmid for constructing the peptide-coding plasmid library, are listed in Table 2.

[0151] Table 2. Features of the receiver plasmid pLK015.

[0152] Feature Comment / Description

[0153] Promoter with bacterial tet-operator sites which are bound by doxycycline- Ptet07

[0154] activated transcriptional activator rtTA-S2.

[0155]

[0156]

[0157] N-terminal part (pre / pro-sequences) of MFal with the secretion signal and N-MFal processing sites. Directs the peptide into the secretion pathway and is cleaved off during transport within the Golgi.

[0158] Bacterial GFP expression cassette with flanking outwardly directed Bsa\ restriction sites. Allows " Golden-gate" cloning of peptide sequences in-frame GFP- in between the N- and C-terminal MFal sequences to allow secretion of the dropout resulting peptide. Successful cloning can be monitored by dropout of the GFP cassette and thus, white (i.e., non-green) color of the transformed E.coli colony.

[0159]

[0160]

[0161] C MF 1 C-terminal part of MFal with a processing site. Cleaved off during transport within the Golgi.

[0162] TTDHI Transcription terminator of the TDH1 gene.

[0163]

[0164]

[0165] Selection marker for prototrophic selection of transformed 5. cerevisiae cells CgHIS3 otherwise defective for the HIS3 gene and thus, not able to grow on media lacking histidine.

[0166] CEN6 / ARS4 Centromere sequence and ARS (autonomously replicating sequence) conferring low-copy number and replication of the plasmid in 5. cerevisiae.

[0167]

[0168] AmpR- ColEl origin of replication and ampicillin-resistance gene for plasmid ColEl replication and selection within E. coli cells.

[0169] Construction of the peptide-coding plasmid library

[0170] Construction of the plasmid library is schematically shown in Figure 4. Oligonucleotides are listed in Table 3. To create double-strand (ds) oligonucleotide from single-strand (ss) oligonucleotide AA900, the following components were mixed: 10.5 µl ddH₂O; 2 µl 10x buffer NEB r2.1; 2 µl 2 µM oligo AA900; 2.5 µl 2 µM oligo AA895; 2 µl 0.2 mM dNTP-mix. The mixture was incubated for 1 min at 95°C and then slowly cooled down to 8°C with a rate of 0.2°C per second. After adding 1 µl 3 mU / µl T4 DNA polymerase (NEB), the mixture was incubated for 15 min at 12°C and for another 20 min at 75°C. 4 µl of the resulting mixture containing ds oligonucleotide were mixed together with the following components: 24 µl ddH₂O; 4µl 100 ng / µl plasmid pLK015; 4µl T4 DNA ligase buffer (NEB); 2µl 20 mU / µlBsal-HFv2 (NEB); 2 pl 400 m U / p.1 T4 DNA ligase (NEB). The resulting mixture was incubated for 30 cycles of alternating steps of 1 min at 37°C and 1 min at 16°C and then incubated for another 5 min at 60°C.

[0171] The totality of the resulting mixture was transformed into chemically competent E.coli DH5a cells and the cell suspension was transferred into 50 ml liquid LB+Amp medium directly after transformation. A small fraction of the suspension was plated on LB+Amp agar plates to estimate the total amount of transformants (approx. 40,000); the remaining suspension was incubated at 200 rpm and 37°C overnight. Preparation of the plasmid library was performed by using a plasmid purification kit (Thermo Scientific).

[0172] Table 3. Oligonucleotides used in this study.

[0173] Name Sequence Description

[0174] Oligo encoding the peptide library. Region encoding the actual mature peptide (bold) contains degenerated nucleotides. The ACTGGGTCTCAAGCTTGGSRTTGGMTTA AA90 - == flanking constant regions contain Bsa\ RWTTSSRTCSTGGTSAACCAWTSKDTAA

[0175] 0 restriction sites (underlined); resulting GAGT A AC ACGTCGGCTATCAA

[0176] overhangs (double underlined) are compatible for ligation into the receiver plasmid.

[0177] Set of oligo nucleotides encoding different AA92 peptides to be cloned into a receiver ACTG G GTCT C A AG CT xxxxxxxxxxxxxxxx

[0178] 2- plasmid. Labelling as described for AA900.

[0179] xxxxxxxxxxxxxxxxxxxxxxxAAGAGTGAG

[0180] AA94 "x" represents different non-degenerated ACCACGTCGGCTATCAA

[0181] 3 sequences for different mature peptides and thus any nucleotide.

[0182] Anneals to oligo AA900; used as reverse AA89

[0183] TTGATAGCCGACGTGGTCTCACTC primer for creation of double-strand AA900 oligonucleotide

[0184] AX03 TGCATGCCTATCCTTGCCAGCATTGCTGC

[0185] 0 TAAAG Forward primers for amplification peptide- coding sequences for deep sequencing; AX03 TGCATGGGCTCTGATGCCAGCATTGCTG

[0186] primers are identical except for a barcode 1 CTAAAG

[0187] sequence (underlined) used to distinguish AX03 TGCATGAGGCGAAGTGCCAGCATTGCTG PCR products amplified from different pools 2 CTAAAGAX03 TGCATGTAATCTTATGCCAGCATTGCTGC

[0188] 3 TAAAG

[0189] AX03 ACAGTGCGAGTAATTCAAGATTGCTTTAT

[0190] 4 CTCGAGTTAGG

[0191] AX03 ACAGTGTCTCCGGATCAAGATTGCTTTAT Reverse primers for amplification peptide- 5 CTCGAGTTAGG coding sequences for deep sequencing;

[0192] primers are identical except for a barcode AX03 ACAGTGAATGAGCGTCAAGATTGCTTTA sequence (underlined) used to distinguish 6 TCTCGAGTTAGG PCR products amplified from different pools AX03 AC AGTG G G AATCTCTC AAG ATTG CTTTAT

[0193] 7 CTCGAGTTAGG

[0194] Construction of the

[0195]

[0196] 200 pl of the plasmid library (~260 ng / pl) were transformed into yLK004 cells according to a slightly modified published protocol (Rinji Akada, Miho Kawahata and Yoshinori Nishizawa, BioTechniques 28: 854-856 (2000)). Briefly, cells were grown overnight in liquid YPD medium, inoculated in 50 ml fresh YPD medium and grown at 30°C and 200 rpm on a rotary shaker to an OD600 of 1. The cells were pelleted and the pellet was re-suspended in 2 ml PLAG solution (40 % PEG4000; 0.1M LiAc; 10 mM TRIS / HCI pH7.5; 1 M EDTA; 15% w / v glycerol) and 250 pl 2 mg / ml single-stranded DNA (high molecular weight DNA from Salmon testes (Sigma D1626) dissolved in TE buffer (10 M Tris-HCI pH 8.0, 1.0 M EDTA), incubated for 5 min at 100 °C and quickly cooled in ice water). 10 x 200-pl aliquots of the resulting suspension were transferred into 1.5-ml tubes and 20 pl plasmid solution were added to each aliquot. The tubes were incubated for 90 min at 32°C and 800 rpm in a thermomixer and for another 15 min at 42°C without shaking.

[0197] The transformed cells were transferred into 100 ml liquid SD-His medium; a small fraction of the suspension was plated on SD-His agar plates to estimate the total amount of yeast transformants (approx. 100,000); the remaining suspension was incubated at 30°C without shaking for approx. 50 hours. The yeast library cell suspension was stored at 4°C until further experiments.

[0198] Sorting of cells

[0199] For sorting experiments, cells of the yeast library were grown in liquid LD-His medium supplemented with 20 pg / ml doxycycline at 30°C and 200 rpm on a rotary shaker. Following overnight-growth, cells were diluted 1:5 in 20 ml fresh medium. After reaching an OD600 of approx. 0.5, 20 nM alpha-factor was added and the cells were grown for another 2 hours. Sorting of the cells according to their GFP fluorescence was carried out on a BD FACSAria Fusion (BD biosciences) cell sorter with a 488 nm laserfor GFP excitation. For each of the three sorted pools, i.e., cells showing low GFP expression (GFP-cells), cells showing high GFP expression (GFP+ cells) and cells independent of their GFP expression (control representing the total library), 100,000 cells were collected, inoculated in LD-His medium and grown overnight at 30°C without shaking. The cultures of the sorted populations were used to confirm success of the sorting procedure (see Fig. 3C) and to isolate the plasmids containing the sequences of the expressed peptides.

[0200] Plasmid extraction from yeast cells

[0201] 4 ml of saturated yeast culture grown overnight in SD-His medium were pelleted and washed once with 500 pl ddH2O. Plasmid isolation was based on buffers and components of the GeneJET Plasmid Miniprep kit (Thermo Scientific). The washed yeast cell pellet was resuspended in 250 pl RNase-A containing Resuspension Solution, supplemented with 5 pl Zymolyase solution (10 mg / ml Zymolyase in 0.1 M sorbitol) and 5 pl 1 M DTT and incubated for 30 min at 37°C. After addition of 250 pl Lysis Solution and 250 pl glass beads (0.5 mm diameter), the suspension was vortexed for 2 min and incubated on ice for 5 min. The suspension was mixed with 350 pl of ice-cold Neutralization Solution by inverting the tube several times, incubated for another 5 min on ice and centrifuged for 10 min at highest speed. The supernatant was transferred to a GenJET spin column and subsequent steps were carried out according to the manufacturer's protocol.

[0202]

[0203] Peptide-coding sequences were amplified from purified plasmid DNA derived from the different sorted yeast cell pools with unique combinations of forward (AX030-AX033) and reverse (AX034-AX037) primers. The individual PCR products were purified and mixed in equimolar ratios. Deep sequencing (NovaSeq paired ends 150 bp reads, 1 G raw data per sample) of the pooled PCR products was performed by Novogene (UK) Company Limited. The received raw data was analysed by us by depooling the sequences, extracting the sequences of the mature peptides in between the flanking processing sites and filtering for sequences of length 39 (i.e., resulting peptides of 13 amino acid length). The resulting sequences were used without further processing to create the sequence logos shown in Fig. 3D.

Claims

CLAIMS1. A method for identifying one or more oligo- or polypeptide agonists that can activate a GPCR;wherein the method comprises(a) expressing the GPCR in each yeast cell of a library of yeast cells such that the GPCR is presented at the surface of the yeast cells,(b) expressing a library of test oligo- or polypeptides in the library of yeast cells of (a) such that the test oligo- or polypeptides are directed into the secretion pathway of yeast cells of the library, wherein each yeast cell within the library expresses only one kind of test oligo- or polypeptide of the library of test oligo- or polypeptides, and(c) assessing the activity of cell-surface localized GPCR, wherein within the library of yeast cells a yeast cell expressing an oligo- or polypeptide agonist as the kind of test oligo- or polypeptide of the library of test oligo- or polypeptides is identified based on a lower cell-surface activity of the GPCR as compared to a yeast cell not expressing a test oligo- or polypeptide.

2. The method of claim 1, wherein in step (c) the activity of cell-surface localized GPCR is assessed by contacting the library of yeast cells of (b) with a known agonist of the GPCR,wherein within the library of yeast cells a yeast cell expressing an oligo- or polypeptide agonist as the kind of test oligo- or polypeptide of the library of test oligo- or polypeptides is identified based on its lower response to the known agonist of the GPCR as compared to a yeast cell not expressing a test oligo- or polypeptide.

3. The method of claim 2, wherein the known agonist of the GPCR is an oligo- or polypeptide alphafactor, preferably a fungal oligo- or polypeptide alpha-factor, and most preferably a yeast oligo- or polypeptide alpha-factor.

4. The method of claim 2 or 3, wherein the known agonist of the GPCR comprises or consists of the amino acid sequence of SEQ ID NO: 1 or 2, or an amino acid sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical to SEQ ID NO: 1 or 2.

5. The method of claim 1, wherein in step (c) the activity of cell-surface localized GPCR is assessed by fluorescently labelled GPCR, wherein in step (a) preferably a GPCR-fluorescent protein fusion protein is expressed, wherein within the library of yeast cells a yeast cell expressing an oligo- or polypeptide agonist as the kind of test oligo- or polypeptide of the library of test oligo- orpolypeptides is identified based on a reduced fluorescence of the cell-surface localized GPCR as compared to a yeast cell not expressing a test oligo- or polypeptide.

6. A method for identifying one or more oligo- or polypeptide agonists that can activate a GPCR;wherein the method comprises(a) expressing the GPCR in each yeast cell of a library of yeast cells, wherein the GPCR is fluorescently labelled,(b) assessing the fluorescence localization pattern of the fluorescently labelled GPCR in each yeast cell of a library of yeast cells of (a),(c) expressing a library of test oligo- or polypeptides in the library of yeast cells of (a) such that the test oligo- or polypeptides are directed into the secretion pathway of yeast cells of the library, wherein each yeast cell within the library expresses only one kind of test oligo- or polypeptide of the library of test oligo- or polypeptides, and(d) assessing the fluorescence localization pattern of the fluorescently labelled GPCR in each yeast cell of a library of the yeast cells of (c),wherein within the library of yeast cells a yeast cell expressing an oligo- or polypeptide agonist as the kind of test oligo- or polypeptide of the library of test oligo- or polypeptides is identified based on the change from a focal fluorescence localization pattern in (b) to a diffuse fluorescence localization pattern in (d), and / or from a fluorescence localization in the Golgi apparatus in (b) to a fluorescence localization in the cell vacuole in (d).

7. A method for identifying one or more oligo- or polypeptide antagonists that can inhibit a GPCR;wherein the method comprises(a) expressing the GPCR within each yeast cell of a library of yeast cells such that the GPCR is presented at the cell surface,(b) expressing an oligo- or polypeptide agonist of the GPCR in all cells of (a) such that the oligo- or polypeptide agonist is directed into the secretion pathway and such that the agonist induces cell-internal inactivation of the expressed GPCR of (a), and(c) expressing a library of test oligo- or polypeptides in the library of yeast cells of (b) such that the test oligo- or polypeptides are directed into the secretion pathway of the yeast cells of the library, wherein each yeast cell within the library expresses one kind of test oligo- or polypeptide of the library of test oligo- or polypeptides,wherein a yeast cell expressing an oligo- or polypeptide antagonist as the kind of test oligo- or polypeptide of the library of test oligo- or polypeptides can be identified based on its higher response to the expressed oligo- or polypeptide agonist of the GPCR as compared to a yeast cellnot expressing a test oligo- or polypeptide but expressing the oligo- or polypeptide agonist of the GPCR.

8. A method for identifying one or more oligo- or polypeptide antagonists that can inhibit a GPCR;wherein the method comprises(a) expressing the GPCR within each yeast cell of a library of yeast cells, wherein the GPCR is fluorescently labelled,(b) assessing the fluorescence localization pattern of the fluorescently labelled GPCR in each yeast cell of a library of yeast cells of (a),(c) expressing an oligo- or polypeptide agonist of the GPCR in all cells of (a) such that the oligo- or polypeptide agonist is directed into the secretion pathway and such that the agonist induces a change of the localization of the fluorescently labeled GPCR in all cells of (a) from a focal fluorescence localization pattern to a diffuse fluorescence localization pattern, and / or from a fluorescence localization in the Golgi apparatus to a fluorescence localization in the cell vacuole, (d) expressing a library of test oligo- or polypeptides in the library of yeast cells of (c) such that the test oligo- or polypeptides are directed into the secretion pathway of the yeast cells of the library, wherein each yeast cell within the library expresses one kind of test oligo- or polypeptide of the library of test oligo- or polypeptides, and(e) assessing the fluorescence localization pattern of the fluorescently labelled GPCR in each yeast cell of a library of the yeast cells of (d),wherein a yeast cell expressing an oligo- or polypeptide antagonist as the kind of test oligo- or polypeptide of the library of test oligo- or polypeptides can be identified based on a change of the localization of the fluorescently labeled GPCR from a diffuse fluorescence localization pattern to a focal fluorescence localization pattern and / or from a fluorescence localization in the cell vacuole to a fluorescence localization in the Golgi apparatus.

9. The method of any one of claims 1 to 8, further comprising(i) isolating a yeast cell expressing an oligo- or polypeptide agonist or antagonist as the kind of test oligo- or polypeptide of the library of test oligo- or polypeptides, and / or(ii) isolating and sequencing the nucleic acid sequence of said oligo- or polypeptide agonist or antagonist from said yeast cell and / or(iii) isolating and identifying or sequencing the expressed oligo- or polypeptide agonist or antagonist from said yeast cells.

10. The method of any one of claims 1 to 9, wherein the GPCR is a GPCR fungal pheromone mating factor receptor (Class D GPCR).

11. The method of claim 10, wherein the GPCR fungal pheromone mating factor receptor is Ste2.

12. The method of claim 10 or 11, wherein the GPCR fungal pheromone mating factor receptor is from a yeast species.

13. The method of claim 10 or 11, wherein the Ste2 comprises or consists of the amino acid sequence of any one of SEQ ID NOs 3 to 9 or an amino acid sequence being at least 80%, preferably at least 90% and most preferably at least 95% identical to any one of SEQ ID NOs: 3 to 9.

14. The method of any one of claims 1 to 13, wherein the yeast cell comprises a fluorescent reporter gene the fluorescence of which is changed in response to the applied agonist when the yeast cell expresses an active agonist / antagonist oligo- or polypeptide.

15. The method of any one of claims 1 to 14, wherein the expressed test oligo- or polypeptides comprise at their N-terminus a signal sequence towards the secretory pathway.

Images