Antifungal, antibacterial, or antiviral composition comprising fermented kidney bean product

Abstract

The present invention relates to an antifungal, antibacterial, or antiviral composition comprising a fermented kidney bean product and, specifically, to an antifungal, antibacterial, or antiviral composition exhibiting excellent inhibitory effects against the activity of fungi, viruses, or antibiotic-resistant bacteria, the composition comprising a fermented kidney bean product fermented with a Bacillus subtillus strain. Upon application, non-heat-treated fermented kidney bean products or fractions thereof exhibit inhibitory effects against the activity of fungi, viruses, or antibiotic-resistant bacteria and thus can be effectively utilized as antifungal, antibacterial, or antiviral compositions.

Description

Antifungal, antibacterial, or antiviral composition containing fermented kidney beans

[0001] This patent application claims priority to Korean Patent Application No. 10-2025-0023623, filed with the Korean Intellectual Property Office on February 24, 2025, the disclosures of said patent application are incorporated herein by reference.

[0002] In addition, this patent application claims priority to Korean Patent Application No. 10-2026-0022247, filed with the Korean Intellectual Property Office on February 4, 2026, and the disclosures of said patent application are incorporated herein by reference.

[0003] The present invention was carried out under the support of the Ministry of Education under project unique number 1345362651 and project number 2021R1I1A3059219, the project management agency for the above project is the National Research Foundation of Korea, the research project name is "Establishment of Academic Research Infrastructure in Science and Engineering," the research project name is "Development of Antiviral Lectin Protein Materials Derived from Regionally Specialized Biological Resources for Biological Disaster Response," the project implementing agency is Chonnam National University, and the research period is March 1, 2023 – February 29, 2024.

[0004] The present invention relates to an antifungal, antibacterial, or antiviral composition comprising a fermented kidney bean product. Specifically, the invention relates to an antifungal, antibacterial, or antiviral composition comprising a fermented kidney bean product fermented with lactic acid bacteria or a strain of the genus Bacillus sp., which exhibits excellent inhibitory effects on the activity of fungi, viruses, or antibiotic-resistant bacteria.

[0005] While hygiene standards are becoming stricter as income levels rise, food poisoning remains a major cause of death worldwide. Looking at trends in food poisoning, cases have recently been occurring year-round regardless of the season, and the number of patients has not decreased, particularly during the winter months. During the summer, various causative agents such as Salmonella, Staphylococcus aureus, and Vibrio parahaemolyticus are primarily detected, while during the winter months of October to December, numerous causative agents, including Norovirus, are also being detected. Consequently, the Ministry of Food and Drug Safety has recently been strengthening standards regarding harmful microorganisms in food, and the role of antimicrobial preservatives is becoming increasingly important.

[0006] Various synthetic preservatives have been used for a long time in the food industry due to their convenience and cost-effectiveness. While these synthetic antimicrobial preservatives are widely used in many foods and household products because they are easy to use and offer excellent antimicrobial and preservative effects, the recent revelation of various problems and side effects associated with synthetic preservatives has raised concerns regarding the risks associated with their overly widespread and excessive use. Consequently, active research is underway to introduce new types of antimicrobial and preservatives or to identify naturally occurring substances that possess antimicrobial or preservative properties.

[0007] Furthermore, while numerous types of antibiotics have been developed and used to treat bacterial infections, the recent emergence of antibiotic-resistant strains due to misuse and overuse, and furthermore, the appearance of multidrug-resistant bacteria (MDRs) that are resistant to various antibiotics, is considered a major global problem. The emergence of these MDRs limits the types of antibiotics available for use in bacterial infections, thereby posing significant challenges to disease treatment and causing burdens such as prolonged treatment durations and increased medical costs.

[0008] Meanwhile, fungi refer to a group of microorganisms including molds, yeasts, and mushrooms; most are characterized by their inability to synthesize nutrients on their own, leading them to live as parasites on other organisms. In humans, infections most frequently occur on the skin—specifically in the scalp, hair, face, arms, legs, fingernails, and toenails—where sloughed-off cells are abundant. However, infections can also affect the gastrointestinal or vaginal mucosa, and can lead to systemic infections by infecting internal organs. Furthermore, fungal infections are caused by factors such as immunodeficiency, advanced age, the use of immunosuppressants or steroids, nutritional deficiencies, poor hygiene, and contact with infected patients.

[0009] Although antifungal agents such as imidazoles or polyenes are widely used to prevent or treat infections caused by these fungi, they are chemically synthesized and may cause side effects when used in humans, and long-term use leads to issues such as resistance. Therefore, there is a need to develop a composition that is derived from natural products, is safe with fewer side effects, and possesses excellent antifungal efficacy. This composition is a mixture of various components that can reduce side effects such as resistance through the pharmacological interactions between the components.

[0010] Meanwhile, the influenza virus, one of the pathogens of viral diseases, poses a threat to human health due to its ability to spread easily through the air. Influenza A is a common respiratory infection affecting millions of people worldwide; it is contagious to both animals and humans and causes acute respiratory illness. Historically, this virus has had a significant impact on human society, causing large-scale infections and deaths on several occasions.

[0011] The Spanish flu pandemic of 1918–1919 was recorded as one of the worst influenza pandemics in history, causing approximately 20 to 50 million deaths worldwide, and influenza pandemics such as the Asian flu of 1957 and the Hong Kong flu of 1968 also caused many patients and deaths, respectively, and had social and economic impacts.

[0012] Although the development of vaccines and antiviral drugs to combat viruses is ongoing, the Influenza A virus continues to mutate and new subtypes emerge, posing a persistent threat to global health. Therefore, the development of effective and safe antiviral products is of paramount importance.

[0013] Avian influenza virus was first reported in Italy in 1878 as an acute infectious disease of chickens and has since been recorded as the "fowl plague." Later, in the mid-20th century, it was scientifically identified that the cause of the disease was the influenza A virus. In particular, since the highly pathogenic H5N1 subtype was first identified in Guangdong Province, China in 1996, the highly pathogenic avian influenza virus (HPAIV) has repeatedly emerged in various subtypes and continues to pose a persistent threat to the global poultry industry.

[0014] HPAIV is characterized by high transmissibility and pathogenicity, leading to rapid spread of infection in poultry populations, severe respiratory symptoms, internal organ damage and tissue necrosis, and high mortality rates. These pathological characteristics have been confirmed through numerous epidemiological and pathological studies, and the risk of infection persists to this day due to the continuous mutation of the virus and the emergence of subtypes. Furthermore, avian influenza virus is classified as a representative respiratory virus and a zoonotic disease; with reported cases of human infection involving certain subtypes such as H5N1 and H7N9, it is recognized as a significant threat to public health.

[0015] Meanwhile, the South Korean chicken market has shown a growth trend in recent years, with both production and consumption increasing; however, unlike this industrial expansion, fundamental prevention and control technologies against highly pathogenic avian influenza viruses have not yet been sufficiently established. The current disease control system operates primarily around reactive measures such as culling, movement restrictions, and disinfection, and vaccines also face limitations in the duration of their protective efficacy due to viral mutations and the emergence of new subtypes.

[0016] Therefore, there is an urgent need to develop new prevention and control technologies that can effectively block the continuously re-emerging infection of HPAIV (Highly Pathogenic Avian Influenza Virus) and simultaneously mitigate the stability of the poultry industry and the public health risks associated with zoonotic diseases.

[0017] Feline calicivirus (FCV) is a representative viral pathogen in cats, and since its first isolation and identification in the 1950s, cases of infection have been continuously reported worldwide. FCV primarily causes upper respiratory diseases and oral lesions, and is characterized by accompanying clinical symptoms such as sneezing, rhinorrhea, oral ulcers, and fever. In particular, in environments where contact between individuals is frequent, such as multi-cat households, shelters, and veterinary clinics, the virus spreads easily, leading to repeated cases of outbreaks.

[0018] FCV is an unenveloped single-stranded RNA virus characterized by high environmental stability and relatively strong resistance to disinfection and external environmental conditions. Due to these characteristics, the virus can easily spread through the secretions of infected individuals or contaminated environments, and by persisting in the environment for extended periods, it acts as a factor that sustains the risk of infection. Furthermore, FCV undergoes frequent genetic mutations, leading to the continuous emergence of various variant strains; it has been reported that these variations result in differences in infection patterns and pathogenicity.

[0019] Currently, vaccination is utilized as the primary response to FCV infection, but limitations regarding the restricted protective effect caused by antigenic mutations have been pointed out. In fact, cases of infection have been reported even in vaccinated individuals, suggesting that the vaccine does not provide a complete barrier against all variant strains. Furthermore, as vaccination alone has limitations in fundamentally suppressing the persistence and transmission of the virus in the environment, the need for additional preventive strategies is being raised.

[0020] Meanwhile, research on antiviral substances designed to prevent FCV infection or inhibit viral infection and proliferation has primarily focused on synthetic antivirals or immunomodulators. However, these approaches have limitations, including safety concerns regarding long-term use, cost burdens, and difficulties in integrating them into pet food or routine care systems. Consequently, there is a growing interest in highly safe and long-term antiviral preventive materials based on naturally derived ingredients.

[0021] Therefore, to effectively prevent FCV infections that continuously re-emerge due to environmental stability and mutation characteristics, and to suppress the spread of infection in cat breeding environments, the development of new antiviral prevention technologies capable of complementing existing vaccine-centered response strategies is required. In particular, antiviral materials with high safety and applicability, such as fermented compositions based on plant-based raw materials, have the potential to be utilized as a new alternative for preventing FCV infections.

[0022] Accordingly, the inventors conducted research on novel antifungal, antibacterial, and antiviral compositions to combat harmful microorganisms and viruses, and confirmed that when a non-heat-treated fermented kidney bean product or a fraction thereof is applied, an excellent inhibitory effect against fungi, viruses, and antibiotic-resistant bacteria is observed.

[0023] Accordingly, the object of the present invention is to provide an antifungal composition comprising a fermented kidney bean product or a fraction thereof.

[0024] Another object of the present invention is to provide a method for inhibiting fungal growth comprising the following steps: a step of preparing an antifungal composition by fermenting kidney beans to produce a fermented kidney bean product; and a step of treating one or more surfaces selected from the group consisting of food, soil, skin, water, nutrient solution, container, packaging material, and equipment with said antifungal composition.

[0025] Another objective of the present invention is an antibacterial composition comprising a fermented kidney bean product or a fraction thereof,

[0026] The above antibacterial composition provides an antibacterial composition having antibacterial activity against antibiotic-resistant strains.

[0027] Another objective of the present invention is to provide an antiviral composition comprising a fermented kidney bean product or a fraction thereof.

[0028] The present invention relates to an antifungal, antibacterial, or antiviral composition comprising a fermented kidney bean product. Specifically, the invention relates to an antifungal, antibacterial, or antiviral composition comprising a fermented kidney bean product fermented with lactic acid bacteria or a strain of the genus Bacillus sp., which exhibits excellent inhibitory effects on the activity of fungi, viruses, or antibiotic-resistant bacteria.

[0029] To further explain the present invention in detail below, one aspect of the present invention relates to an antifungal composition comprising a fermented kidney bean product or a fraction thereof.

[0030] In the present invention, the kidney bean fermentation product may include a peptide represented by the amino acid sequence of SEQ ID NO. 1, but is not limited thereto.

[0031] In the present invention, the kidney bean fermentation product may be fermented by lactic acid bacteria or Bacillus sp. strains, but is not limited thereto.

[0032] In the present invention, the lactic acid bacteria may be one or more selected from the group consisting of Lactobacillus casei, Lactobacillus paracasei, Lactobacillus plantarum, Streptococcus thermophilus, and Leuconostoc mesenteroides, but are not limited thereto.

[0033] In the present invention, the strains of the genus Bacillus may be one or more selected from the group consisting of Bacillus subtilis, Bacillus licheniformis, Bacillus pumilus, and Bacillus sonorensis, but are not limited thereto.

[0034] In the present invention, the kidney bean fermentation product may be unheat-treated, but is not limited thereto.

[0035] The term “non-heat treatment” in this specification means not performing heat treatment on the subject, and specifically means selecting a room temperature condition of 15 to 25°C when performing the process. In one embodiment of the present invention, a temperature condition of 37°C was selected when performing non-heat treatment, but it is not limited thereto.

[0036] In addition, the term “heat treatment” in this specification, contrary to this, means applying a temperature condition of 80 to 120°C to the subject. In one embodiment of the present invention, a temperature condition of 100°C was selected for performing the heat treatment, but it is not limited thereto.

[0037] In the present invention, the fermented kidney bean product may be included at a concentration of 1 to 500 μg / ml relative to the total antifungal composition, preferably at a concentration of 1 to 400 μg / ml, 1 to 300 μg / ml, 1 to 200 μg / ml, 1 to 100 μg / ml, 5 to 500 μg / ml, 5 to 400 μg / ml, 5 to 300 μg / ml, 5 to 200 μg / ml, 5 to 100 μg / ml, 10 to 500 μg / ml, 10 to 400 μg / ml, 10 to 300 μg / ml, or 10 to 200 μg / ml, and may be included at a concentration of, for example, 10 to 100 μg / ml, but is not limited thereto.

[0038] In the present invention, the peptide may be included at a concentration of 1 to 500 μg / ml relative to the total antifungal composition, preferably at a concentration of 1 to 400 μg / ml, 1 to 300 μg / ml, 1 to 200 μg / ml, 1 to 100 μg / ml, 5 to 500 μg / ml, 5 to 400 μg / ml, 5 to 300 μg / ml, 5 to 200 μg / ml, 5 to 100 μg / ml, 10 to 500 μg / ml, 10 to 400 μg / ml, 10 to 300 μg / ml, or 10 to 200 μg / ml, and may be included at a concentration of, for example, 10 to 100 μg / ml, but is not limited thereto.

[0039] In the present invention, the antifungal composition may have antifungal activity against one or more selected from the group consisting of Aspergillus niger, Botryosphaeria dothidea, Colletotrichum fructicola, Fusarium fujikuroi, Fusarium oxysporum, and Trichophyton rubrum, but is not limited thereto.

[0040] Another aspect of the present invention relates to providing a method for inhibiting fungal growth comprising the following steps: a step of preparing an antifungal composition by fermenting kidney beans to produce a fermented kidney bean product; and a step of treating one or more surfaces selected from the group consisting of food, soil, skin, water, nutrient solution, container, packaging material, and equipment with said antifungal composition.

[0041] In the present invention, the fermented kidney bean product may additionally include a fractionation step of fractionating a peptide represented by the amino acid sequence of SEQ ID NO. 1, but is not limited thereto.

[0042] In the present invention, the kidney bean fermentation product may be fermented by lactic acid bacteria or Bacillus sp. strains, but is not limited thereto.

[0043] In the present invention, the lactic acid bacteria may be one or more selected from the group consisting of Lactobacillus casei, Lactobacillus paracasei, Lactobacillus plantarum, Streptococcus thermophilus, and Leuconostoc mesenteroides, but are not limited thereto.

[0044] In the present invention, the strains of the genus Bacillus may be one or more selected from the group consisting of Bacillus subtilis, Bacillus licheniformis, Bacillus pumilus, and Bacillus sonorensis, but are not limited thereto.

[0045] In the present invention, the fungus may be one or more selected from the group consisting of Aspergillus niger, Botryosphaeria dothidea, Colletotrichum fructicola, Fusarium fujikuroi, Fusarium oxysporum, and Trichophyton rubrum, but is not limited thereto.

[0046] In one embodiment of the present invention, the step of preparing the antifungal composition may be performed by fermenting kidney beans for 3 to 10 days, preferably by fermenting for 3 to 7 days, 5 to 10 days, or 5 to 7 days, and for example, by fermenting for 5 days, but is not limited thereto.

[0047] In one embodiment of the present invention, the step of preparing the antifungal composition may be performed at 25 to 50°C, preferably at 25 to 40°C, 35 to 50°C, or 35 to 40°C, and may be performed, for example, at 37°C, but is not limited thereto.

[0048] Another aspect of the present invention is an antibacterial composition comprising a fermented kidney bean product or a fraction thereof,

[0049] The above antibacterial composition relates to an antibacterial composition having antibacterial activity against antibiotic-resistant strains.

[0050] In the present invention, the kidney bean fermentation product may include a peptide represented by the amino acid sequence of SEQ ID NO. 1, but is not limited thereto.

[0051] In the present invention, the kidney bean fermentation product may be fermented by lactic acid bacteria or Bacillus sp. strains, but is not limited thereto.

[0052] In the present invention, the lactic acid bacteria may be one or more selected from the group consisting of Lactobacillus casei, Lactobacillus paracasei, Lactobacillus plantarum, Streptococcus thermophilus, and Leuconostoc mesenteroides, but are not limited thereto.

[0053] In the present invention, the strains of the genus Bacillus may be one or more selected from the group consisting of Bacillus subtilis, Bacillus licheniformis, Bacillus pumilus, and Bacillus sonorensis, but are not limited thereto.

[0054] In the present invention, the kidney bean fermentation product may be unheat-treated, but is not limited thereto.

[0055] In the present invention, the antibiotic-resistant strain may be one or more selected from the group consisting of Escherichia coli, Staphylococcus sp., Salmonella sp., Vibrio parahaemolyticus, Campylobacter sp., and Bacillus cereus, but is not limited thereto.

[0056] In the present invention, the antibiotic may be one or more selected from ampicillin, penicillin, streptomycin, kanamycin, and neomycin, but is not limited thereto.

[0057] In the present invention, the antibacterial composition may be used in combination with an antibiotic, but is not limited thereto.

[0058] In the present invention, the antibacterial composition and the antibiotic may be used by mixing in a weight ratio of 1:10 to 1000, and preferably 1:10 to 800, 1:10 to 600, 1:10 to 400, 1:10 to 200, 1:50 to 1000, 1:50 to 800, 1:50 to 600, 1:50 to 400, 1:50 to 200, 1:100 to 1000, 1:100 to 800, 1:100 to 600, 1:100 to 400, 1:100 to 200, 1:150 to 1000, 1:150 to 800, 1:150 to 600, or 1:150 to 400. It may be used by mixing in a weight ratio, for example, by mixing in a weight ratio of 1:150 to 200, but is not limited thereto.

[0059] Another aspect of the present invention relates to an antiviral composition comprising a fermented kidney bean product or a fraction thereof.

[0060] In the present invention, the fermented product may include a peptide represented by the amino acid sequence of SEQ ID NO. 1, but is not limited thereto.

[0061] In the present invention, the kidney bean fermentation product may be fermented by lactic acid bacteria or Bacillus sp. strains, but is not limited thereto.

[0062] In the present invention, the lactic acid bacteria may be one or more selected from the group consisting of Lactobacillus casei, Lactobacillus paracasei, Lactobacillus plantarum, Streptococcus thermophilus, and Leuconostoc mesenteroides, but are not limited thereto.

[0063] In the present invention, the strains of the genus Bacillus may be one or more selected from the group consisting of Bacillus subtilis, Bacillus licheniformis, Bacillus pumilus, and Bacillus sonorensis, but are not limited thereto.

[0064] In the present invention, the kidney bean fermentation product may be unheat-treated, but is not limited thereto.

[0065] In the present invention, the fermented product may be included at a concentration of 5 to 100 μg / ml relative to the total antiviral composition, preferably at a concentration of 5 to 50 μg / ml, 5 to 25 μg / ml, 12.5 to 100 μg / ml, or 12.5 to 50 μg / ml, and for example, at a concentration of 12.5 to 25 μg / ml, but is not limited thereto.

[0066] In the present invention, the peptide may be included at a concentration of 5 to 100 μg / ml relative to the total antiviral composition, preferably at a concentration of 5 to 75 μg / ml, 5 to 50 μg / ml, or 5 to 25 μg / ml, and for example, at a concentration of 5 to 12.5 μg / ml, but is not limited thereto.

[0067] In the present invention, the antiviral composition may have antiviral activity against one or more selected from the group consisting of influenza A virus (H1N1), highly pathogenic avian influenza virus (H5N8), human infecting norovirus, feline calicivirus (FCV), coronavirus family (SARS0-CoV2, NL63, 229E, etc.), human immunodeficiency virus (HIV), and human respiratory syncytial virus (HRSV), and may have antiviral activity against, for example, influenza A virus, but is not limited thereto.

[0068] In particular, the above antiviral composition significantly reduces the viral replication rate when treated after viral infection with highly pathogenic avian influenza, and HA gene-based RT-qPCR analysis results show an inhibitory effect similar to that of the existing antiviral agent oseltamivir.

[0069] In addition, the above composition has a dual mechanism of action that stabilizes the host immune response excessively induced by viral infection by regulating the expression of antiviral-related genes such as IRF3, IRF7, IFN-α, IFN-β, and ISG15.

[0070] The present invention relates to a soybean extract composition having multiple antimicrobial activities, comprising a fermented kidney bean product fermented with lactic acid bacteria or Bacillus sp. strains, and to an antimicrobial composition having excellent inhibitory effects against fungi, viruses, or antibiotic-resistant bacteria. Since an inhibitory effect against fungi, viruses, and antibiotic-resistant bacteria is exhibited when the unheat-treated fermented kidney bean product or its fractions are treated, it can be effectively utilized as an antifungal, antibacterial, or antiviral composition.

[0071] In particular, the present invention provides an antiviral composition comprising a fermented kidney bean composition as an active ingredient, thereby exhibiting an excellent infection inhibitory effect against highly pathogenic avian influenza viruses and offering a technology of high industrial utility that can be expected to provide a stable preventive effect against viruses that frequently reappear.

[0072] Figure 1 is a graph showing the results of separating proteins in a fermented kidney bean product according to one embodiment of the present invention.

[0073] FIG. 2a shows the half-cytotoxicity concentration (CC) of a non-heat-treated fermented kidney bean product according to one embodiment of the present invention. 50 This is a graph representing ).

[0074] FIG. 2b shows the half-cytotoxicity concentration (CC) of a heat-treated fermented kidney bean product according to one embodiment of the present invention. 50 This is a graph representing ).

[0075] FIG. 2c shows the half-cytotoxicity concentration (CC) of an antifungal peptide according to one embodiment of the present invention. 50 This is a graph representing ).

[0076] Figure 3a is a graph showing the reduction rate of mycelium of Aspergillus niger strains according to the treatment concentration of an antifungal peptide according to one embodiment of the present invention.

[0077] Figure 3b is a photograph comparing the antifungal effect on Aspergillus niger strains according to the treatment concentration of an antifungal peptide according to one embodiment of the present invention.

[0078] Figure 4 is a photograph comparing the fungal growth inhibition effect on the surface of bread according to the concentration of unheat-treated fermented kidney beans according to one embodiment of the present invention.

[0079] Figure 5a is a photograph confirming the antifungal activity of a non-heat-treated fermented kidney bean product against the Aspergillus niger strain according to one embodiment of the present invention.

[0080] FIG. 5b is a photograph confirming the antifungal activity of unheat-treated fermented kidney beans against strains of Botryosphaeria dothidea (branch blight), Colletotrichum fructicola (anthracnose), Fusarium fujikuroi (rice blast), and Fusarium oxysporum (damping-off, root rot) according to one embodiment of the present invention.

[0081] FIG. 5c is a photograph confirming the antifungal activity of a non-heat-treated fermented kidney bean product against a Trichophyton rubrum strain according to one embodiment of the present invention.

[0082] FIG. 6a shows the half-inhibitory concentration (IC) for viral infection after H1N1 virus pretreatment of a non-heat-treated fermented kidney bean product according to one embodiment of the present invention. 50 This is a graph representing ).

[0083] FIG. 6b shows the half-inhibitory concentration (IC) for H1N1 virus infection after pretreatment of a heat-treated fermented kidney bean product according to one embodiment of the present invention. 50 This is a graph representing ).

[0084] FIG. 6c shows the half-inhibitory concentration (IC10) for H1N1 virus infection after pretreatment with an antifungal peptide according to one embodiment of the present invention. 50 This is a graph representing ).

[0085] Figure 7 is a graph showing the replication rate of FCV viruses within cells when a non-heat-treated fermented kidney bean product is pre-treated for virus infection according to one embodiment of the present invention.

[0086] FIG. 8a shows the half-inhibitory concentration (IC10) for H1N1 virus neutralization treatment of a non-heat-treated fermented kidney bean product according to one embodiment of the present invention. 50 This is a graph representing ).

[0087] FIG. 8b shows the half-inhibitory concentration (IC) for H1N1 virus neutralization treatment of heat-treated fermented kidney beans according to one embodiment of the present invention. 50 This is a graph representing ).

[0088] FIG. 8c shows the half-inhibitory concentration (IC10) for the H1N1 virus neutralization treatment of an antifungal peptide according to one embodiment of the present invention. 50 This is a graph representing ).

[0089] Figure 9 is a graph showing the replication rate of the virus for FCV virus neutralization treatment of a non-heat-treated fermented kidney bean product according to one embodiment of the present invention.

[0090] FIG. 10a shows the half-inhibitory concentration (IC) for post-treatment of unheat-treated fermented kidney beans after H1N1 virus infection according to one embodiment of the present invention. 50 This is a graph representing ).

[0091] FIG. 10b shows the half-inhibitory concentration (IC) for post-treatment of fermented kidney beans heat-treated after H1N1 virus infection according to one embodiment of the present invention. 50 This is a graph representing ).

[0092] FIG. 10c shows the half-inhibitory concentration (IC10) for post-treatment with an antifungal peptide after H1N1 virus infection according to one embodiment of the present invention. 50 This is a graph representing ).

[0093] Figure 11 is a graph showing the virus replication rate for post-treatment of unheat-treated fermented kidney beans after H5N8 virus infection according to one embodiment of the present invention.

[0094] Figure 12 is a graph showing the intracellular H5N8 HA mRNA replication rate for post-treatment of unheat-treated fermented kidney beans after H5N8 virus infection according to one embodiment of the present invention.

[0095] Figure 13 is a graph showing the intracellular antiviral-related gene expression levels for post-treatment of unheat-treated fermented kidney beans after H5N8 virus infection according to one embodiment of the present invention.

[0096] FIG. 10a is a graph showing the change in intracellular viral replication rate when a fermented kidney bean composition (FNBE) is pretreated with a virus infection according to one embodiment of the present invention.

[0097] FIG. 10b is a graph showing the change in the intracellular virus replication rate when a fermented kidney bean composition (FNBE) is mixed with a virus in advance and neutralized, then infected into a cell, according to one embodiment of the present invention.

[0098] FIG. 14a is a graph showing the growth curve of antibiotic-resistant bacteria according to treatment with non-heat-treated kidney bean fermented product (FNBE) according to one embodiment of the present invention.

[0099] FIG. 14b is a graph showing the efflux pump and curli protein gene expression results of antibiotic-resistant bacteria treated with non-heat-treated kidney bean fermentation product (FNBE) according to one embodiment of the present invention.

[0100] FIG. 14c is a schematic diagram showing the growth inhibition mechanism of antibiotic-resistant bacteria by non-heat-treated kidney bean fermentation product (FNBE) according to one embodiment of the present invention.

[0101] The present invention relates to an antifungal composition comprising a fermented kidney bean product or a fraction thereof.

[0102] The present invention will be explained in more detail below through the following examples. However, these examples are merely illustrative of the invention, and the scope of the invention is not limited by these examples.

[0103] Throughout this specification, “%” used to indicate the concentration of a particular substance is (weight / weight)% for solid / solid, (weight / volume)% for solid / liquid, and (volume / volume)% for liquid / liquid, unless otherwise noted.

[0104]

[0105] Example 1. Preparation of unheat-treated fermented kidney beans

[0106] Dried kidney beans were ground to produce 10 g of kidney bean powder, which was then placed in 500 mL of culture medium and fermented at 37°C for 5 days after inoculation with a Bacillus subtilis strain to produce fermented navy bean extract (FNBE).

[0107] FNBE was placed in a centrifuge tube and centrifuged at 10,000 rpm for 5 minutes, and the supernatant was transferred to a new tube. The filtrate obtained through a 0.20 μm syringe filter was collected. To confirm that the multiple antimicrobial components of the collected FNBE were proteins, heat-treated fermented navy bean extract (Heated Fermented Navy Bean Extract; HFNBE) was prepared by heating at 100°C for 10 minutes and used as a control.

[0108]

[0109] Example 2. Analysis of Non-Heat-Treated Kidney Bean Ferment (FNBE)

[0110] After quantifying the protein contained in the fermented kidney bean product (FNBE) using the supernatant of the unheat-treated fermented kidney bean product (FNBE) prepared according to Example 1, SDS-PAGE was performed using a 15% polyacrylamide gel. 30 μL of the sample, heated at 95°C for 5 minutes, was loaded and electrophoresis was performed at 100 V for 2 hours. Staining was performed using Coomassie brilliant blue R-250 solution. The stained gel was decolorized in a 30% methanol solution containing 10% acetic acid for 2 hours to confirm the distribution of the protein composition of the unheat-treated fermented kidney bean product (FNBE).

[0111] As shown in Figure 1, on SDS-PAGE, the unheat-treated kidney bean fermented product (FNBE) was confirmed to be a composition consisting of a single-size protein.

[0112] Subsequently, the unheat-treated fermented kidney bean product (FNBE) was gelled with polyacrylamide, the proteins were peptidated using trypsin enzyme, fractionated by HPLC, and identified using a mass spectrometer. For LC-MS analysis, the FNBE extract was dissolved in a solvent, filtered, and injected into an HPLC system for separation in a column. Elution was carried out using solvents in stages while maintaining a constant flow rate.

[0113] Peptide identification was performed using MS connected to an HPLC system. As a result of searching the UniprotPhaseolus vulgaris database, an antifungal peptide (AP) showing 100% coverage in the kidney bean fermentation composition was identified.

[0114] Afterwards, the amino acid sequence of the antifungal peptide contained in the fermented kidney bean product was analyzed and is shown in Table 1 below.

[0115] Sequence Number Sequence Name Amino Acid Sequence 1 Antifungal lectin PVAPSNDIYFNFQR

[0116]

[0117] Example 3. Evaluation of cytotoxicity of unheat-treated kidney bean fermented product, heat-treated kidney bean fermented product, and antifungal peptide

[0118] MDCK (Mardin-Dardy canine kidney) cells were used to evaluate the cytotoxicity of unheat-treated fermented kidney beans (FNBE), heat-treated fermented kidney beans (HFNBE), and antifungal peptides (AP). MDCK cells were cultured at 37°C in a 5% CO₂ incubator (Thermo Forma, USA) using DMEM (Dulbecco's Modified Eagle's Media: Gibco, USA) as the base medium supplemented with penicillin (5 unit / mL) / streptomysin (5 μg / mL) and fetal bovine serum (Thermo Fisher, USA).

[0119] 0.1 mL of MDCK cell suspension at a concentration of 2×10⁴ cells / mL was dispensed into each well of a 96-well plate and cultured at 37°C in a 5% CO₂ incubator for 24 hours. Cells were treated with FNBE, HFNBE, and AP diluted in DMEM medium at concentrations of 0, 25, 50, 100, 200, and 400 μg / mL and cultured for 48 hours.

[0120] After the end of culture, 10 μL of CCK Solution (Cell-counting kit-8, Dojindo molecular technololgise, USA) was added and the cells were cultured at 37°C in a 5% CO₂ incubator for 2 hours. Cell viability was evaluated by measuring the absorbance at 450 nm and is shown in Table 2.

[0121] Cell viability (%) Concentration (μg / mL) FNBEHFNBEAP 0 10 0 10 0 10 25 10 9 10 28 6 5 0 10 19 0 10 11 0 129 3 4.3 8 6.6 20 0 11.6 5.6 6 14 0 0 8 - 7.6

[0122]

[0123] Based on the cell viability values ​​at different concentrations as shown in Figures 2a to 2c, the half-cytotoxicity concentration (CC) at which cell viability becomes 50% 50 ) was calculated, and as a result, CC concentrations of 184.8 μg / mL in FNBE, 85.6 μg / mL in HFNBE, and 221.0 μg / mL in AP were obtained, respectively. 50 The value was checked.

[0124]

[0125] Example 4. Measurement of antifungal activity of antifungal peptides

[0126] To measure the antifungal activity of the antifungal peptide (AP) contained in the fermented kidney bean product, Aspergillus niger strains were treated.

[0127] Specifically, the A. niger strain was obtained from the Seed Bank of the National Institute of Agricultural Sciences, Rural Development Administration and used in the experiment. To promote the growth and expression of the strain, it was cultured on malt extract agar (MEA) medium. AP dissolved in DMSO was diluted with sterile distilled water to concentrations of 0, 1.25, 2.5, 5, and 10 μg / mL, respectively. 100 μL of the diluted AP was dispensed onto the surface of the medium, and 100 μL of the A. niger strain solution was inoculated and cultured at 25°C for 120 hours.

[0128] As shown in Figure 3a, the inhibition rate of mycelia increased with increasing AP treatment concentration, and as shown in Figure 3b, the amount of mycelia reduced with increasing concentration was image-analyzed using the GelQuantNET program. As a result, it was confirmed that at a concentration of 5 μg / mL, mycelial growth was inhibited by 10% compared to the negative control group, and at a concentration of 10 μg / mL, mycelial growth was inhibited by 60%.

[0129]

[0130] Example 5. Fungal growth inhibitory effect of unheat-treated fermented kidney beans

[0131] The fungal growth inhibitory activity of unheat-treated fermented kidney beans (FNBE) was evaluated by the following method. Commercially available bread was cut into 5 x 5 cm pieces using a sterilized knife and placed in a Petri dish. Samples were prepared by diluting FNBE with distilled water to concentrations of 0, 100, 200, 400, and 600 μg / mL. 2 mL of the diluted FNBE was dispensed onto the surface of the bread and left at 25°C for 120 hours to observe the degree of fungal growth.

[0132] As can be seen in Figure 4, there were differences in the degree of fungal growth depending on the treatment concentration of FNBE, and it was confirmed that at a concentration of 400 μg / mL, the growth of the fungal fruiting bodies was completely inhibited compared to the control group.

[0133]

[0134] Example 6. Antifungal activity of unheat-treated fermented kidney beans

[0135] The antifungal activity of unheat-treated fermented kidney beans (FNBE) against Aspergillus niger, Botryophaeria sp., Colletotrichum sp., and Fusarium sp. strains was performed by the following method.

[0136] A. niger strain was cultured on potato dextrose agar (PDA) medium, and penicillin was used as a positive control for antifungal activity. 10 μL of the strain was inoculated onto PDA medium, and 20 μL each of penicillin and FNBE at a concentration of 300 μg / mL were inoculated onto sterile paper discs (8 mm) and cultured at 25°C for 120 hours.

[0137] As can be seen in Figure 5a, the positive control group treated with penicillin showed negative results regarding strain growth, and the FNBE treatment group also showed inhibition of mycelial formation, confirming the antifungal activity of FNBE.

[0138] The strains of Botryosphaeria dothidea (branch blight), Colletotrichum fructicola (anthracnose), Fusarium fujikuroi (rice blast), and Fusarium oxysporum (damping-off, root rot) were cultured on potato dextrose agar medium and used. After making 5 mm diameter plugs, they were inoculated into the experimental group PDA medium and the control group PDA medium, respectively.

[0139] The experimental group PDA medium was prepared by mixing sterile PDA and FNBE in a 1:1 ratio to a final concentration of 300 ppm, and the control group PDA medium was sterile PDA medium without added FNBE. After culturing each of the four strains at 25°C for 7 days, mycelia were collected from the colony boundaries and observed under an optical microscope at 200x magnification.

[0140] As shown in Fig. 5b, mycelial growth in the FNBE-treated experimental groups was 100% inhibited for all species, including B. dothidea, C. fructicola, F. fujikuroi, and F. oxysporum. When the mycelial morphology of the four fungi was observed under a microscope, the hyphae of the control group were straight and normal in shape, whereas the hyphae of the FNBE-treated experimental groups exhibited abnormal morphology, such as the breakdown of cell walls and fragmentation of the hyphae.

[0141] In addition, the Trichophyton rubrum strain, known as athlete's foot fungus, was prepared by culturing it in potato dextrose liquid medium (TDB) for 24 hours. The test groups were each prepared by mixing the liquid-cultured T. rubrum strain solution with FNBE or antifungal peptide (AP) in a 1:1 ratio to a final concentration of 100 ppm. After incubation at 25°C for 24 hours, 1 mL of the mixture was dispensed into a Petri dish, followed by 9 mL of PDA medium kept warm at 45-50°C. The mixture was mixed evenly and allowed to solidify. An additional 4-5 mL of PDA medium was dispensed over the solidified medium to create a superimposed layer, and the mixture was incubated at 25°C for 72 hours. The formed colonies were counted in CFU / mL, and the antifungal activities of FNBE and AP were evaluated by comparison and are shown in Table 3.

[0142] FNBEAP(antifungal peptide)T. rubrum colony count (CFU / mL)1.95 x 10 3 2.7 x 10 3

[0143] As can be seen in Figure 5c, mycelial growth was inhibited in both groups treated with FNBE and AP. In particular, it was confirmed that the inhibitory effect on mycelial growth was superior in the FNBE-treated group compared to the group treated only with AP, and when the number of T. rubrum colonies formed was counted, it was confirmed that mycelial growth was inhibited by approximately 27.7% more in the FNBE group.

[0144]

[0145] Example 7. Quantification of viruses and intracellular genes via RT-qPCR analysis

[0146] To measure the antiviral activity and intracellular gene expression levels of unheat-treated fermented kidney beans, experiments were conducted using the following method.

[0147] 0.3 mL of virus culture supernatant was reacted with 0.7 mL of RNAiso Plus (Takara, Cat# 9109) solution. After the reaction was complete, 0.24 mL of chloroform was added to the sample solution, and it was shaken vigorously for 15 seconds. The mixture was reacted at room temperature for 15 minutes while shaking every 5 minutes, and then centrifuged at 12,000 rpm for 15 minutes in a centrifuge at 4°C. After centrifugation, only the supernatant was transferred to a new ep-tube, and isopropyl alcohol was added in a 1:1 ratio. The mixture was reacted at room temperature for 10 minutes, followed by centrifugation at 12,000 rpm for 10 minutes at 4°C. After centrifugation, the supernatant was removed, and the pellet remaining in the tube was washed with 75% ethanol. Then, the pellet was centrifuged at 12,000 rpm at 4°C for 10 minutes to remove the ethanol, dried at room temperature for 10 minutes, and the total RNA was dissolved in RNase-free water.

[0148] For cDNA synthesis, the extracted total RNA was used as a template and heat-denatured with 1 μL of random primer (100 pmol / μL) at 63°C for 10 minutes, then immediately rapidly cooled on ice and held for 5 minutes. Using PrimeScript™Reverse Transcriptase (TaKaRa, Cat.2680A), 4 μL of 5× PrimeScript Buffer (250 mM Tris-HCl (pH 8.3), 375 mM KCl, 5 mM MgCl2), 2 μL of 50 mM DTT, 2 μL of dNTPs, 0.5 μL of RNase inhibitor, and 0.5 μL of PSRT were added, and the total volume was adjusted to 20 μL. The mixture was then reacted at 37°C for 60 minutes, followed by inactivation of the reverse transcriptase reaction at 95°C for 5 minutes, after which it was used for the qPCR reaction.

[0149] 2 μL of synthesized H1N1 cDNA template, the H1N1 PA gene and H5N8 HA gene, a primer set of the sequences listed in Table 4 that specifically bind to IRF3, IRF7, IFN-α, IFN-β, and ISG15 in MDCK cells, and TB green ® Virus quantification of the sample was performed using the qPCR method with 18 μL of reaction solution containing Premix Ex Taq™ (Takara, Cat# RR420).

[0150] SEQ ID NO Sequence Name Base sequence (5'-3')2H1N1_PA_ForGAGCCTATGTGGATGGATTC3H1N1_PA_RevCCCATTCGGAAAGTCTAAGTG4H5N8_HA_ForTGACTACCCGCAGTATTCAG5H5N8_HA_RevAGACCAGCTAYCATGATTGC 6Canis_IRF3_ForGTCAGCGGTGCCTACACTC7Canis_IRF3_RevCAAACTCATAGACCTTGTGTGG8Canis_IRF7_ForTTAACCATGGGGAGAAGGCG9Canis_IRF7_RevGGAAGACAGGGCCAGCATAA 10Canis_IFN-α_ForCTGGATGACCTGGATGCCTG11Canis_IFN-α_RevCCGATTTCTGCTCGGACCAT12Canis_IFN-βGCAACGACTTGCTTCGATCC13Canis_IFN-βCCTTCTGGAACTGGCGTGAT1 4Canis_ISG15_ForAGACRGTGGCTGAGCTCAAG15Canis_ISG15_RevGCAGGCGTAAAATTCATGAAC16FCV_ORF1_ForGCCAATCAGCATGTGGTAACC17FCV_ORF1_RevGCACATCATATGCGGGCTCTG

[0151] The PCR reaction conditions were 95°C for 10 minutes (1 cycle), 95°C for 5 seconds, 55°C for 10 seconds, and 72°C for 20 seconds (45 cycles), and the Thermal Cycler Dice ® Amplification curves of target genes were constructed using Real Time System III (Takara, TP950) and used for virus quantification.

[0152]

[0153] Example 8. Antiviral effects of unheat-treated kidney bean fermented product, heat-treated kidney bean fermented product, and antifungal peptide on viral infection after pretreatment

[0154] The antiviral activity of unheat-treated kidney bean ferment (FNBE), heat-treated kidney bean ferment (HFNBE), and antifungal peptide (AP) after pretreatment was measured by the following method.

[0155] First, MDCK (Mardin-Dardy canine kidney) cells were treated with the three substances at concentrations of 0, 12.5, 25, 50, and 100 μg / mL, respectively, for 12 hours, then inoculated with the influenza A virus (H1N1) for 2 hours, and cultured for 72 hours in DMEM (Dulbecco's Modified Eagle's Media: Gibco, USA) supplemented with TPCK (2 μg / mL). Afterward, the culture supernatant was collected, and the degree of antiviral activity through the inhibition of viral replication was analyzed by RT-qPCR.

[0156] Antiviral activity (%) Concentration (μg / mL) FNBEHFNBEAP 00001 2.57 326.6 27.9 258 9.2 08 5.75 097.2 4097.4 10099.4 79.2 398.8

[0157] Based on the antiviral activity values ​​at different concentrations as shown in FIGS. 6a to 6c, the median inhibition concentration (IC) at which the viral infection inhibition rate becomes 50% 50 ) was calculated, and the half-cytotoxicity concentration (CC) obtained in Example 2 was 50 The effectiveness of each composition was evaluated by calculating the selectivity index (SI) value for the influenza A virus using ) and the following formula 1.

[0158] [Formula 1]

[0159] SI = CC 50 / IC 50

[0160] (SI = Selection Index, CC 50 = Half-cytotoxicity concentration, IC 50 = Half-inhibitory concentration)

[0161] As a result, antiviral activity against the influenza A virus was observed in the order of FNBE (SI = 25), AP (SI = 19), and HFNBE (SI = 1.7). Therefore, it was confirmed that FNBE exhibited superior antiviral activity compared to HFNBE even at lower concentrations, and that heating FNBE inhibited its antiviral activity.

[0162] This presented results indicating that the antiviral active component of FNBE originates from a protein, confirmed that the protein isolated from FNBE via SDS-PAGE was AP, and confirmed that both FNBE and AP had antiviral activity as a result of virus pretreatment.

[0163]

[0164] Additionally, to confirm the inhibitory effect of fermented kidney beans (FNBE) on feline calicivirus (FCV), antiviral activity was evaluated under conditions where the composition was treated prior to viral infection.

[0165] First, CRFK (Crandell-Rees Feline Kidney) cells were cultured and treated with FNBE at concentrations of 0, 25, 50, and 100 μg / ml for 12 hours, followed by inoculation with FCV for 2 hours and culture for 48 hours. The culture supernatant was collected, and the degree of antiviral activity through the inhibition of viral replication was analyzed by RT-qPCR and is shown in Table 6.

[0166] Concentration (μg / mL) FNBE Antiviral Activity (%) 0 0 25 85.15 0 97 10 0 97.9

[0167] As can be seen in Figure 7, FNBE showed a concentration-dependent inhibitory effect on viral replication, specifically a 1.67 log reduction in the 100 µg / mL treatment group and a 1.51 log reduction in the 50 µg / mL treatment group.

[0168] Therefore, it was confirmed that the kidney bean fermentation product of the present invention exhibits an inhibitory effect on viral infection by pre-treating cells.

[0169]

[0170] Example 9. Antiviral effects of non-heat-treated fermented kidney beans, heat-treated fermented kidney beans, and antifungal peptides following virus neutralization treatment

[0171] The antiviral activity of unheat-treated kidney bean ferment (FNBE), heat-treated kidney bean ferment (HFNBE), and antifungal peptide (AP) was measured after neutralization treatment with a virus using the following method.

[0172] First, MDCK (Mardin-Dardy canine kidney) cells were reacted with influenza A virus (IAV) at concentrations of 0, 12.5, 25, 50, and 100 μg / mL, respectively, at 32°C for 2 hours. After inoculating the cells for 2 hours, they were cultured for 72 hours in DMEM (Dulbecco's Modified Eagle's Media: Gibco, USA) supplemented with TPCK (2 μg / mL). The culture supernatant was collected, and the degree of antiviral activity through the inhibition of viral replication was analyzed by RT-qPCR and is shown in Table 7.

[0173] Antiviral activity (%) Concentration (μg / mL) FNBEHFNBEAP 00001 2.5884 1.326.7259 4.63 7.334509 6.55 2.76 2.71009 8.583 378.7

[0174] Based on the antiviral activity values ​​at different concentrations as shown in FIGS. 8a to 8c, the median inhibition concentration (IC) at which the viral infection inhibition rate becomes 50% 50 ) was calculated, and the half-cytotoxicity concentration (CC) obtained in Example 2 was 50 The effectiveness of each composition was evaluated by calculating the selectivity index (SI) value for the influenza A virus using ) and Formula 1.

[0175] As a result, antiviral activity was observed in the order of FNBE (SI = 34.3), AP (SI = 9.1), and HFNBE (SI = 4.4).

[0176]

[0177] Additionally, to confirm the inhibitory effect of FNBE on the neutralization treatment of FCV (Feline calicivirus), an experiment was conducted using the following method.

[0178] CRFK (Crandell-Rees Feline Kidney) cells were treated with FNBE simultaneously with FCV and cultured in DMEM (Dulbecco's Modified Eagle's Media: Gibco, USA) for 48 hours. Afterward, the culture supernatant was collected, and the degree of antiviral activity through the inhibition of viral replication was analyzed by RT-qPCR and is shown in Table 8.

[0179] Concentration (μg / mL) FNBE Antiviral Activity (%) 00 2599.95 5099.99 10099.97

[0180] As can be seen in Figure 9, FNBE showed excellent viral replication inhibition effects even when treated simultaneously with FCV, and specifically showed a viral inhibition effect of 3.87 log reduction in the 50 µg / mL treatment group and 3.64 log reduction in the 100 µg / mL treatment group.

[0181] Therefore, it was confirmed that the kidney bean fermentation product of the present invention exhibits an inhibitory effect against virus infection by simultaneously neutralizing it with the virus.

[0182]

[0183] Example 10. Antiviral activity through post-treatment with non-heat-treated kidney bean ferment, heat-treated kidney bean ferment, and antifungal peptide after viral infection of cells

[0184] To investigate the antiviral activity of unheat-treated fermented kidney beans, heat-treated fermented kidney beans, and antifungal peptides in virus-infected cells, MDCK (Mardin-Dardy canine kidney) cells were inoculated with IAV for 2 hours, treated with the three substances at concentrations of 0, 12.5, 25, 50, and 100 μg / mL for 12 hours, and cultured for 72 hours in DMEM (Dulbecco's Modified Eagle's Media: Gibco, USA) supplemented with TPCK (2 μg / mL). The culture supernatant was collected, and the degree of antiviral activity through the inhibition of viral replication was analyzed by RT-qPCR and is shown in Table 9.

[0185] Antiviral activity (%) Concentration (μg / mL) FNBEHFNBEAP 00001 2.53 2.44 1.90 255 5.40 508 2.42 77 5.71 008 5.13 198.6

[0186] Based on the antiviral activity values ​​at different concentrations as shown in FIGS. 10a to 10c, the median inhibition concentration (IC) at which the viral infection inhibition rate becomes 50% 50 ) was calculated, and the half-cytotoxicity concentration (CC) obtained in Example 2 was 50 The effectiveness of each composition was evaluated by calculating the selectivity index (SI) value for the influenza A virus using ) and Formula 1.

[0187] As a result, non-heat-treated FNBE (SI = 11.3), AP (SI = 5.7), and HFNBE (SI = 1.5) showed antiviral activity in that order.

[0188]

[0189] Additionally, to confirm the antiviral effect of fermented kidney beans on cells infected with the highly pathogenic avian influenza virus (H5N8), MDCK (Madin-Darby Canine Kidney) cells were cultured, and then the H5N8 virus was inoculated into the cells and infected for 10 minutes. After the H5N8 virus was adsorbed onto the cells, unheat-treated fermented kidney beans were treated at concentrations of 12.5, 25, 50, and 100 μg / mL, respectively. Oseltamivir 1 μM was used as the positive control (PC).

[0190] After the above treatment, the culture was incubated for 72 hours, and after the culture was finished, the supernatant was collected and the amount of virus replication was analyzed by RT-qPCR and is shown in Table 10.

[0191] Concentration (μg / mL) FNBE Antiviral Activity (%) 0 0 1 2.5 9.9 5 25 6 6.9 25 0 9 2.2 3 10 0 9 3.4 5

[0192] As can be seen in Figure 11, the unheat-treated fermented kidney beans exhibited a concentration-dependent inhibitory effect on the replication of the H5N8 virus, specifically showing a viral inhibitory effect of 1.11 log reduction in the 50 μg / mL treatment group and 1.26 log reduction in the 100 μg / mL treatment group. This is similar to the 1.27 log reduction effect observed in the positive control (PC), the oseltamivir 1 μM treatment group, suggesting that the fermented kidney beans of the present invention exhibit antiviral activity with efficacy similar to existing antiviral agents.

[0193]

[0194] Example 11: Inhibitory effect of fermented kidney bean composition (FNBE) on intracellular viral replication following treatment after viral infection

[0195] In this example, the inhibitory effect on H5N8 virus gene replication within cells was evaluated when unheat-treated fermented kidney beans were treated after H5N8 virus infection.

[0196] After culturing MDCK (Madin-Darby Canine Kidney) cells, H5N8 virus was inoculated into the cells and infected for 10 minutes. After virus adsorption occurred following infection, the cells were treated with a non-heat-treated fermented kidney bean product at a concentration of 100 μg / mL. After culturing the treated cells for 72 hours, the cells were harvested, intracellular RNA was extracted, and the intracellular viral replication level was evaluated by quantifying the expression of the viral gene (HA) through RT-qPCR analysis.

[0197] As a result, as shown in Figure 12, the intracellular HA gene expression level in the virus-alone infected group (NC) was approximately 40.17 times higher than that of the mock infected group (Mock), and in the positive control group (PC), the oseltamivir 1 μM treatment group, it was approximately 30.78 times higher on average. In the group treated with 100 μg / mL of unheat-treated fermented kidney beans, it was 27.02 times higher.

[0198] This means that treatment with 100 μg / mL of unheat-treated fermented kidney beans induced a reduction in H5N8 HA gene expression of approximately 32.7% compared to the virus-alone infection group, which showed a superior inhibitory effect on intracellular viral replication compared to the positive control group treated with oseltamivir (a reduction of approximately 23.4%).

[0199]

[0200] Example 12: Analysis of intracellular antiviral gene expression following treatment with fermented kidney bean composition (FNBE) after viral infection

[0201] In this example, to evaluate the effect of unheat-treated fermented kidney beans on the antiviral immune response of host cells to treatment following H5N8 virus infection, changes in the expression of major antiviral-related genes (IRF3, IRF7, IFN-α, IFN-β, ISG15) were analyzed.

[0202] After culturing MDCK (Madin-Darby Canine Kidney) cells, the cells were inoculated with the H5N8 virus and infected for 10 minutes. After virus adsorption was completed following infection, the unheat-treated fermented kidney bean product of the present invention was treated at concentrations of 50 μg / mL and 100 μg / mL, respectively. Subsequently, the cells were cultured for 72 hours.

[0203] After the culture was completed, cells were harvested, total RNA was extracted, and cDNA was synthesized. Subsequently, the expression levels of IRF3, IRF7, IFN-α, IFN-β, and ISG15 genes were quantitatively analyzed using RT-qPCR.

[0204] As a result, as shown in Figure 13, in the virus-alone infected group, IFN-α increased by about 43 times, IFN-β by about 14 times, and ISG15 by about 19 times compared to the mock infected group, confirming that the host cell rapidly induces the expression of antiviral-related genes for intracellular defense as the number of viral copies increases.

[0205] On the other hand, the group treated with non-heat-treated fermented kidney beans showed a tendency toward stabilization as the expression of these antiviral genes was effectively regulated, along with a significant reduction in the number of viral copies. In particular, in the group treated with 100 μg / mL of non-heat-treated fermented kidney beans, IFN-α decreased by approximately 28%, IFN-β by approximately 41%, and ISG15 by approximately 49% compared to the virus-alone infection group, and a similar regulatory effect was observed in the 50 μg / mL treatment group.

[0206] This means that the unheat-treated fermented kidney bean extract possesses a dual mechanism of action that directly inhibits viral replication while simultaneously stabilizing the host antiviral immune response excessively induced by viral infection, thereby maintaining cellular homeostasis.

[0207]

[0208] Example 13. Growth inhibitory activity of unheat-treated fermented kidney beans (FNBE) against antibiotic-resistant bacteria

[0209] To confirm the growth inhibitory activity of unheat-treated fermented kidney beans (FNBE) against antibiotic-resistant bacteria, the growth of the strains was observed after treating antibiotic-resistant bacteria with FNBE and antibiotics.

[0210] Specifically, multidrug-resistant Escherichia coli strains were cultured in tryptic soy broth (TSB), and growth curves were prepared over 24 hours using unheat-treated fermented kidney beans (FNBE, 200 ppm), an antibiotic (Ampicillin 0.1 μg / mL), and a combination of FNBE and antibiotics. 600 The values ​​were measured and shown in Table 11.

[0211] OD 600 0h2h4h6h8h10h12h14h16h18h20h22h24hControl0.000.100.430.600.790.920 .970.991.001.000.990.990.98AMP0.000.050.240.270.290.320.360.430.59 0.690.740.780.80FNBE0.000.070.150.290.450.510.550.650.820.931.011. 051.08AMP+FNBE0.000.030.110.160.180.210.230.250.280.300.320.330.34

[0212] As shown in Figure 14a, the growth of the strains in the FNBE-alone treatment group and the antibiotic-alone treatment group was delayed compared to the control group that was not treated with FNBE or antibiotics at the 12-hour mark of culture, but no significant difference in growth was observed at the end of the culture at the 24-hour mark.

[0213] In contrast, the group treated with FNBE and antibiotics in combination showed the most significant growth inhibitory effect. OD of the combination treatment group 600The value was found to be approximately 0.3 after 24 hours, which is significantly lower than the control group (0.9). This suggests that FNBE enhances the antibiotic effect and effectively inhibits the growth of resistant bacteria.

[0214]

[0215] Example 14. Inhibitory activity of unheat-treated fermented kidney beans (FNBE) on gene expression of antibiotic-resistant bacteria

[0216] The effect of unheat-treated fermented kidney beans (FNBE) on the expression of the efflux pump regulatory gene MarA and the CsgD gene, which constitutes the adhesion protein curli, in antibiotic-resistant bacteria was analyzed by qPCR.

[0217] Antibiotic-resistant E. coli strains were treated with unheat-treated fermented kidney beans (FNBE, 200 ppm), antibiotics (Ampicillin 0.1 μg / mL), and a combination of FNBE and antibiotics. After treatment, mRNA was extracted from each sample, cDNA was synthesized, and qPCR was performed. The expression of the MarA and CsgD genes was calculated as relative expression (fold change) values ​​based on 16S rRNA and is shown in Table 12.

[0218] fold changeMarACsgDControl11AMP2.102.16FNBE1.041.53AMP+FNBE0.310.32

[0219] As shown in Figure 14b, there was no significant difference in MarA gene expression between the control group and the FNBE-alone group, but MarA gene expression increased twofold in the antibiotic-alone group. On the other hand, the test group treated with FNBE and antibiotics showed a 0.5-fold decrease in MarA gene expression compared to the control group.

[0220] In addition, the expression of the CsgD gene, which codes for the constituent protein of the adhesion protein Curly protein, increased 2.2-fold in the antibiotic-alone treatment group, while the expression in the test group treated with FNBE and antibiotics was suppressed 0.3-fold compared to the control group.

[0221] This suggests that, as shown in Fig. 14c, when antibiotics are applied to resistant bacteria, the efflux pump for releasing the antibiotic is activated; however, by treating in combination with FNBE, the expression of MarA required for efflux pump activation is suppressed, thereby preventing the release of antibiotics to the outside and inhibiting the growth of resistant bacteria.

[0222] In addition, it suggests that FNBE inhibits CsgD, thereby inhibiting bacterial biofilm formation, which can enhance antibiotic efficacy and effectively suppress the growth of resistant bacteria.

[0223] The present invention relates to a soybean extract composition having multiple antimicrobial activities, comprising a fermented kidney bean product fermented with lactic acid bacteria or Bacillus sp. strains, and to an antimicrobial composition having excellent inhibitory effects against fungi, viruses, or antibiotic-resistant bacteria. Since an inhibitory effect against fungi, viruses, and antibiotic-resistant bacteria is exhibited when the unheat-treated fermented kidney bean product or its fractions are treated, it can be effectively utilized as an antifungal, antibacterial, or antiviral composition.

Claims

1. An antifungal composition comprising a fermented kidney bean product or a fraction thereof.

2. An antifungal composition according to claim 1, wherein the kidney bean fermentation product comprises a peptide represented by the amino acid sequence of SEQ ID NO.

1.

3. An antifungal composition according to claim 1, wherein the kidney bean fermentation product is fermented by lactic acid bacteria or a strain of the genus Bacillus sp.

4. In paragraph 3, the lactic acid bacteria are one or more selected from the group consisting of Lactobacillus casei, Lactobacillus paracasei, Lactobacillus plantarum, Streptococcus thermophilus, and Leuconostoc mesenteroides, and An antifungal composition wherein the above-mentioned Bacillus strain is one or more selected from the group consisting of Bacillus subtilis, Bacillus licheniformis, Bacillus pumilus, and Bacillus sonorensis.

5. An antifungal composition according to claim 1, wherein the kidney bean fermentation product is non-heat-treated.

6. An antifungal composition according to claim 1, wherein the fermented kidney bean product is included at a concentration of 1 to 500 μg / ml relative to the total antifungal composition.

7. An antifungal composition according to claim 1, wherein the antifungal composition has antifungal activity against one or more selected from the group consisting of Aspergillus niger, Botryosphaeria dothidea, Colletotrichum fructicola, Fusarium fujikuroi, Fusarium oxysporum, and Trichophyton rubrum.

8. A method for inhibiting fungal growth comprising the following steps: Step of preparing an antifungal composition by fermenting kidney beans to produce a fermented kidney bean product; A treatment step of applying the above antifungal composition to one or more surfaces selected from the group consisting of food, soil, skin, water, nutrient solution, containers, packaging materials, and equipment.

9. A method for inhibiting fungal growth according to claim 8, wherein the step of preparing the antifungal composition further comprises a fractionation step of fractionating a peptide represented by the amino acid sequence of SEQ ID NO. 1 from the fermented kidney bean product.

10. A method for inhibiting fungal growth according to claim 8, wherein the fermented kidney bean product is fermented by lactic acid bacteria or a strain of the genus Bacillus sp.

11. In paragraph 10, the above lactic acid bacteria are one or more selected from the group consisting of Lactobacillus casei, Lactobacillus paracasei, Lactobacillus plantarum, Streptococcus thermophilus, and Leuconostoc mesenteroides, and A method for inhibiting fungal growth, wherein the above-mentioned Bacillus strain is one or more selected from the group consisting of Bacillus subtilis, Bacillus licheniformis, Bacillus pumilus, and Bacillus sonorensis.

12. A method for inhibiting fungal growth according to claim 8, wherein the fungus is one or more selected from the group consisting of Aspergillus niger, Botryosphaeria dothidea, Colletotrichum fructicola, Fusarium fujikuroi, Fusarium oxysporum, and Trichophyton rubrum.

13. An antibacterial composition comprising a fermented kidney bean product or a fraction thereof, The above antibacterial composition is an antibacterial composition having antibacterial activity against antibiotic-resistant strains.

14. An antibacterial composition according to claim 13, wherein the kidney bean fermentation product comprises a peptide represented by the amino acid sequence of SEQ ID NO.

1.

15. An antibacterial composition according to claim 13, wherein the kidney bean fermentation product is fermented by lactic acid bacteria or a strain of the genus Bacillus sp.

16. In paragraph 15, the lactic acid bacteria are one or more selected from the group consisting of Lactobacillus casei, Lactobacillus paracasei, Lactobacillus plantarum, Streptococcus thermophilus, and Leuconostoc mesenteroides, and An antibacterial composition wherein the above-mentioned Bacillus strain is one or more selected from the group consisting of Bacillus subtilis, Bacillus licheniformis, Bacillus pumilus, and Bacillus sonorensis.

17. An antibacterial composition according to claim 13, wherein the kidney bean fermentation product is non-heat-treated.

18. An antibacterial composition according to claim 13, wherein the antibiotic-resistant strain is one or more selected from the group consisting of Escherichia coli, Staphylococcus sp., Salmonella sp., Vibrio parahaemolyticus, Campylobacter sp., and Bacillus cereus.

19. An antibacterial composition according to claim 13, wherein the antibiotic is one or more selected from ampicillin, penicillin, streptomycin, kanamycin, and neomycin.

20. An antiviral composition comprising a fermented kidney bean product or a fraction thereof.

21. An antiviral composition according to claim 20, wherein the kidney bean fermented product comprises a peptide represented by the amino acid sequence of SEQ ID NO.

1.

22. An antiviral composition according to claim 20, wherein the kidney bean fermentation product is fermented by lactic acid bacteria or a strain of the genus Bacillus sp.

23. In paragraph 22, the lactic acid bacteria are one or more selected from the group consisting of Lactobacillus casei, Lactobacillus paracasei, Lactobacillus plantarum, Streptococcus thermophilus, and Leuconostoc mesenteroides, and An antiviral composition wherein the above-mentioned Bacillus strain is one or more selected from the group consisting of Bacillus subtilis, Bacillus licheniformis, Bacillus pumilus, and Bacillus sonorensis.

24. An antiviral composition according to claim 20, wherein the kidney bean fermentation product is non-heat treated.

25. The antiviral composition according to claim 20, wherein the antiviral composition has antiviral activity against one or more selected from the group consisting of influenza A virus (H1N1), highly pathogenic avian influenza virus (H5N8), human infecting norovirus, feline calicivirus, coronavirus family (SARS0-CoV2, NL63, 229E, etc.), human immunodeficiency virus (HIV), and human respiratory syncytial virus (HRSV).

Images