48results about How to "Quantitatively accurate and reliable" patented technology

The embodiment of the invention provides a carbonate rock microstructure determination method and device. The method includes the steps of obtaining an electronic computer X-ray CT image of a carbonate rock sample and conducting binarization processing on the CT image, wherein the pixel number of holes of the carbonate rock sample in the image obtained after binarization processing is different from the pixel number of particles of the carbonate rock sample; calculating a total area of all holes according to the pixel number of the holes, and calculating the area of the CT image of the carbonate rock sample according to the pixel number of the holes and the pixel number of the particles; determining a specific value of the total area of the holes to the area of the CT image of the carbonate rock sample to be the porosity. The scheme is based on the CT image of the carbonate rock sample, the area of the holes and the area of the CT image of the carbonate rock sample can be calculated in a quantitative mode, the porosity of the carbonate rock sample can be further calculated accurately and reliability, and quantitative and reliable analysis on a microstructure of a carbonate rock reservoir is better achieved.

The invention discloses a single-scanning magnetic resonance quantitative T2 imaging reconstruction method based on a residual network and relates to magnetic resonance imaging methods. According to the method, four small-angle excitation pulses with the same deflection angle are utilized, and a period of evolution time is available after each excitation pulse, so that transverse relaxation time T2 of each echo signal is different; a shift gradient of a frequency coding dimension and a phase coding dimension is added after each excitation pulse, so that the positions of the signals generated by different excitation pulses in a k space are different; multiple echo signals with different transverse relaxation time are obtained in one time of sampling; then the sampling signals are input intothe trained residual network after being subjected to normalization, zero-setting and fast Fourier transformation for reconstruction to obtain a quantitative T2 image; training data of the residual network comes from simulation data; and a template is randomly generated first, then an input image of the network is obtained by simulating experiment environment sampling, the template is used as a tag, and a mapping relation between the input image and an output image is obtained through training.

The invention relates to a BCR / ABL fusion gene (P210bcr / abl) mRNA fluorescence quantitative PCR measurement detection reagent box which comprises lymphocyte segregating liquid, RNA extracting liquid A, RNA extracting liquid B, Oligo (dT) 12-18, RT reaction fluid, reverse transcriptase, quantitative PCR reaction fluid, standard sample, comparison sample, and DEPC water; wherein, a marked primer and a non-marked primer are contained in the quantitative PCR reaction fluid. The reagent box can accurately detect the BCR / ABL fusion gene (P210) mRNA level in the specimen to be detected by extracting the total RNA of medulla ossium or peripheral blood, obtaining cDNA through reverse transcriptase and being combined with a real-time fluorescence quantitative PCR measurement detection technology. The reagent box adopts the latest self-quenched probe technology, thereby having the advantages that the repetitiveness is good, the sensitivity is high, the cost is low, and the invention can be applied to the dynamic monitoring of chronic myelocytic leukemia diagnosis, curative effect observation, prognosis and micro residual leukemia (MRD).

The invention provides a method for analyzing influence of a mentholated cigarette processing process on a production environment, aiming at solving the problem in the prior art that the menthol content in a mentholated cigarette production environment can not be accurately measured. According to the invention, an atmosphere sample during the mentholated cigarette processing process is captured through an on-line capturing device, and the concentration of menthol in the mentholated cigarette production environment is measured by a thermal desorption-gas chromatography-mass spectrography technology. The method is simple to operate and reliable to quantify, an analysis result is accurate and effective, the linear relation of a standard curve is good, the correlation index r<2> equals to 0.9999, a detection limit of the method reaches 0.34 microgram / m <3>, the recovery rate of the menthol in the production environment is 97.92% to 102.38%, and the relative standard deviation (RSD) is 6.57%. The method ensures the reliability and objectivity of an environmental menthol quantifying result in the cigarette processing process, and is of great significance to alleviation of pollution to a production line and a production environment.

An embodiment of the invention provides a device and a method for determining multiscale porous characteristics of carbonatite. The method includes: acquiring a first scanning image by subjecting a carbonatite sample with the diameter larger than a full diameter to millimeter CT (computed tomography) scanning; taking a portion with micron-diameter voids or pores densely distributed from the carbonatite sample as a first plunger sample, and subjecting the first plunger sample to millimeter CT scanning to obtain a second scanning image; taking a portion with nano-diameter voids or pores densely distributed from the first plunger sample as a second plunger sample, and subjecting the second plunger sample to millimeter CT scanning to obtain a third scanning image; determining porosity of the carbonatite sample and distribution modes of the voids and pores in different diameters on the carbonatite sample according to the first scanning image, the second scanning image and the third scanning image after binaryzation. By adoption of the scheme, quantitative, precision and reliable analysis on the multiscale porous characteristics of the carbonatite can be realized.

The invention relates to a method for detecting content of fructooligosaccharide in infant formula milk rice flour. The method comprises the following steps: accurately weighting a sample; placing the sample into a volumetric flask; adding hot water for dissolving; mixing uniformly; ultrasonically shaking; cooling to room temperature; accurately adding a potassium ferrocyanide solution and a zinc acetate solution, shaking and uniformly mixing, adding water for achieving a constant volume, and uniformly shaking; standing; filtering by using filter paper; accurately transferring supernate to the volumetric flask until constant volume is achieved by using acetonitrile; shaking and uniformly mixing; filtering through a 0.45 micron organic filter film; performing HPLC (High Performance Liquid Chromatography) measuring and quantifying according to an external standard method, namely, firstly, preparing a standard working solution and respectively injecting the standard working solution into the HPLC, measuring a corresponding peak area and drawing a standard curve, then injecting the prepared sample solution into the HPLC, measuring the corresponding peak area and quantifying the sample on the basis of the standard curve, thereby obtaining the concentration of the sample solution; and calculating the percentage of the content of fructooligosaccharide according to a formula. The method has the advantages of convenience, high speed, accuracy and the like.

The invention relates to a method for separating and determining multiple phenolic substances in saliva, and belongs to the technical field of analytical chemistry. The method comprises the steps of collecting a saliva sample by adopting a saliva collection tube, carrying out high-speed centrifugation after collection and then taking a supernatant; carrying out acidification, adding an internal standard and carrying out vortex oscillation until mixing evenly in sequence; and filtering with a micropore filter membrane, separating and determining multiple phenolic substances in saliva from filtrate by adopting an ultra-high performance liquid chromatography-multiwavelength fluorescence method, fabricating a standard curve and quantifying through an internal standard method. The method can be effectively used for separating and determining the multiple phenolic substances in the saliva, and the method is good in separation effect, low in detection limit, good in precision, accurate and reliable, and has popularization and application values.

The invention relates to a method for detecting the residual quantities of glyphosate and phosphonic acid being a metabolite of glyphosate in food. The method comprises the following steps: preparation of a standard working solution, preparation of a food sample test solution, drawing of a standard working solution regression curve and calculation of the residual quantities of glyphosate and phosphonic acid in a food sample. The method has the advatnages that the residual quantities of glyphosate and phosphonic acid in food can be detected accurately, wherein the detection results are accurate, reliable, and high in reproducibility; a dialysis bag and a divinyl benzene solid phase extraction cartridge are adopted for purification to avoid blockage, ensure 80 percent or high recovery rate, and avoid use of expensive internal standard substances for recovery correction; as an NH2P-502D cartridge is adopted, and 5 mmol / L liquid ammonium acetate and acetonitrile are adopted as mobile phases, the method is excellent in response and peak shape.

A hydraulic weight device of buffer type consists of data collection system, cylinder body with air vent and air intake holes, piston rod with sink hole, disc spring set in said sink hole, damping baffle with a numbers of through holes, disc spring baffle with impact proof seal washer, oil cylinder guarding cover buckled on cylinder body, guide sleeve set between piston rod and cylinder body, and pressure transmitter connected to data collection system.

The invention discloses a Human respiratory syncytial virus (HRSV) fluorescent quantitative PCR reagent box and detecting method, the reagent box including RNA extract, reverse transcription enzyme, RNA enzyme inhibitor, reverse transcription reacting solution, standard positive template, Taq DNA polyase, fluorescent quantitative reacting solution and standard negative reference and control solution. Using the reagent box to firstly extract virus total RNA from the sample to be detected to make reverse transcription into cDNA, where cDNA and the standard positive template act as fluorescent quantitative PCR, and calculating the initial HRSV concentration by the software in fluorescent quantitative PCR apparatus. It has fast detection, convenience and safety of operation, time saving and high efficiency and can implement early diagnosis and effective prevention of HRSV.

The invention discloses a method for measuring the transfer volume of epoxy chloropropane in a food contact material. The method comprises the following steps: 1, preparing a standard working solution, a food simulant test solution and a blank test solution; 2, performing gas chromatography-tandem mass spectrum test on the three solutions in the step 1 by a gas chromatography-tandem triple quadrupole mass spectrum combined instrument respectively; drawing a standard working solution regression curve by taking the concentration x of epoxy chloropropane in the standard working solution as a horizontal coordinate and the corresponding measured quantitative ion peak area y as a longitudinal coordinate, and calculating the slope a and the intercept b of the regression curve according to a linear equation y=a*x+b obtained by the curve; 3, calculating the concentration of epoxy chloropropane in the food simulant test solution according to a formula c=[(y(simulant)-y(blank)-b] / a. The method can be used for accurately measuring the transfer volume of epoxy chloropropane in the food contact material, and is accurate and reliable in quantification and good in repeatability.

The invention provides a fluorescence quantitative PCR (Polymerase Chain Reaction) kit with simple and convenient usage and high sensitivity and specificity, which can optimize and improve the amplification efficiency of the PCR, reduce the contamination rate of the PCR, exactly and fast detect the BDV nucleic acid of a sample. In the invention, the real-time fluorescence quantitative PCR detection kit for a BDV p24 segment comprises 10* reverse transcription reaction liquid, an AMV (Avian Myeloblastosis Virus) reverse transcriptase, 2* fluorescence quantitative PCR reaction liquid, a Taq polymerase, a standard substance and the negative control, wherein the fluorescence quantitative PCR reaction liquid is optimized reaction liquid. The invention can shorten the reaction time and reduce the possibility of the PCR contamination, and can also remarkably improve the quantitative accuracy and the amplification efficiency.

The invention provides a method for detecting the content of impurity aldol dimer through degradation in an oxycodone liquid preparation, and belongs to the technical field of pharmaceutical analysis. According to the method, high performance liquid chromatography is adopted for detection, detection conditions are accurately controlled, octadecylsilane chemically bonded silica is selected as a chromatographic column of a filling agent, the composition and proportion of a mobile phase are controlled, a gradient elution method is adopted, a gradient elution procedure is controlled, and the content of the impurity dimer generated by degradation in the oxycodone hydrochloride liquid preparation can be detected. The detection method is high in sensitivity and specificity, it can be ensured that the genotoxic impurity dimer in the oxycodone hydrochloride liquid preparation is effectively detected, a powerful control strategy is provided for product quality control of the medicine, and a guarantee is effectively provided for product quality and safety. Moreover, the detection method disclosed by the invention is accurate, stable, durable, scientific and reliable, and the content of oxycodone aldol dimer in the oxycodone liquid preparation can be well measured.

The invention discloses a method, primer, probe and kit for detecting cronobacter sakazakii. The primer and probe for fluorogenic quantitative PCR detection are designed according to a conserved sequence of a cronobacter sakazakii genome; fluorogenic quantitative PCR detection technique of cronobacter sakazakii is established; and whether cronobacter sakazakii exists can be determined according to an amplification curve after a reaction is over. The sequence of the primer comprises an upstream primer sequence of 5'GGGATACGCAGGAGGTGGCA' and a downstream primer sequence of 5'GATGCTGCCTGCCAGCAGG'. The sequence of the probe is 5'CATTTTAGCGCTTGATACTCCCCTGGGC'. According to the invention, the method for detecting cronobacter sakazakii is good in accuracy and high in sensitivity, and whether cronobacter sakazakii exists in a sample can be fast and simply determined.

The invention provides an ion chromatography method for simultaneously determining sorbic acid radicals, phosphate radicals and citric acid radicals in a reconstituted tobacco. The invention creates amethod for determining sorbic acid radicals, phosphate radicals and citric acid radicals in the reconstituted tobacco by taking a 4mmol L-1 KOH solution as a leacheate with initial concentration andAS11-HC column as a separation column under the column temperature of 24 DEG C. According to the method, the interference of bitrate radicals on sorbic acid radicals is solved; the sorbic acid in a sample is more accurately and reliably quantified; the relative standard deviation of the tested contents of all the to-be-tested components is 0.18%-0.74%; the adding standard recovery rate is within 97.1%-102.7%; the method is accurate, simple and reliable. The ion chromatography method is accurate, simple and reliable and is suitable for the simultaneous determination of the sorbic acid radicals,phosphate radicals and citric acid radicals in the reconstituted tobacco.

The invention discloses a method for measuring phthalic anhydride transfer volume in a food contact material and a product. The method comprises the following steps: step one, preparing a standard product, and preparing a standard working solution, to-be-measured test solution and blank test solution; step two, respectively performing liquid chromatography measurement on the standard working solution, the to-be-measured test solution and the blank test solution in the step one by adopting a high-performance liquid chromatography; and drawing a standard working solution calibration curve by taking phthalic anhydride concentration in the standard working solution of food simulant as a horizontal coordinate and taking the correspondingly measured peak area of the phthalic anhydride as the longitudinal coordinate; step three, computing the phthalic anhydride concentration in the to-be-measured test solution according to a curve formula, and converting into the transfer volume of the phthalic anhydride through appropriate computation. The method disclosed by the invention can accurately measure the transfer volume of the phthalic anhydride in the food contact material, the quantitationis accurate and reliable, and the reproducibility is good.

The invention belongs to the technical field of chemical detection methods and relates to a method for measuring the total amount of 2-phenyl-2-propanol in plastic and plastic products. The method includes the following steps that a 2-phenyl-2-propanol standard stock solution is prepared; a 2-phenyl-2-propanol standard work solution is prepared; a work curve of the 2-phenyl-2-propanol standard work solution is prepared; extraction is carried out, plastic or plastic products to be measured are frozen and smashed into powder, dissolved in a toluene-acetone solution and placed in a microwave extraction tank, extraction liquid is transferred into a volumetric flask after microwave extraction, the extraction tank is flushed through a toluene-acetone solution, the solutions are combined, and volume is measured through a toluene-acetone solution; measurement is carried out through a gas chromatography-mass spectrometer under the selected analysis condition; the total amount of the 2-phenyl-2-propanol in the plastic and the plastic products is precisely measured. Operation is easy, accuracy is high, reproducibility is good, and actual detection requirements can be met.

The invention discloses a method for detecting apoptosis of dinoflagellate cells. The method for detecting the apoptosis of the dinoflagellate cells comprises the following steps: carrying out apoptosis processing on the dinoflagellate cells; carrying out concentration processing on the dinoflagellate cells subjected to the apoptosis processing; carrying out AnnexinV and propidine iodide (PI) dyeing processing on a concentrated dinoflagellate cell solution; carrying out imaging flow detection processing on a dyed dinoflagellate cell solution; and calculating an apoptosis rate of the dinoflagellate cells according to an AnnexinV / PI scatter diagram. The method for detecting the apoptosis of the dinoflagellate cells disclosed by the invention has the advantages that AnnexinV fluorescence, PIfluorescence and chlorophyll autofluorescence can be effectively distinguished through an imaging flow cytometer, so that the number of the dinoflagellate cells experiencing the apoptosis, which are among the dinoflagellate cells to be detected, can be directly and quantitatively measured, and an early cell apoptosis rate can be further obtained; and the quantification is reliable, the analysis isaccurate, and high-precision results can be obtained.

The invention discloses a mononuclear, binuclear and mature maize pollen separation method and construction and an application of a pollen development stage judgment model. A compatible sample grinding-separation-purification buffer system is reasonably arranged in the pollen separation and purification method, so that the activity of pollen cells is effectively kept, and implementation of subsequent steps is facilitated; according to the method, the relevance among the corn plant leaf ring number, the tassel middle spikelet length, the pollen diameter and the pollen development stage is foundthrough research, a quantitative numeralization judgment model of the corn pollen development stage and a simple, convenient and rapid intuitive judgment method are established separately, wherein the model judgment method can accurately judge the development stage of the corn pollen; and the intuitive judgment method does not damage the corn tassels and the wrapped leaves (indexes such as leaf ring number and spikelet length are easy to inspect and obtain), is simple and visual to operate, and solves the technical problem that the corn tassels are damaged for sure (if the tassels wrapped bythe leaves need to be taken out, the leaves are damaged for sure) in the traditional judgment method.

The invention relates to the technical field of powder feeding device, in particular to a simple powder quantitative material feeder. The simple powder quantitative material feeder is provided with a valve body, wherein the valve body comprises a material inlet, a valve chamber and a material outlet; a first end cover and a second end cover are respectively fixed on two sides of the valve body; a main shaft valve core is supported on the first end cover and the second end cover in a rotatable manner; the cross section of a working section, which is located in the valve chamber, of the main shaft valve core is regularly prismatic, and a transitional arc section is formed between every two adjacent edges; each transitional arc section is in tiny clearance fit with the inner wall of the valve chamber; a material accommodating cavity is formed between each edge and the inner wall of the valve chamber; a material clearing device and a sweeping device are arranged at the material outlet; and when the main shaft valve core rotates, the material clearing device and the sweeping device clear away powder attached on all the edge surfaces of the working section of the main shaft valve core. The material feeder is simple in structure, quantitative and accurate, can clear away the powder attached on the walls of the material accommodating cavities and the main shaft valve core, and difficultly damages the surface of the main shaft valve core.

The invention discloses a talcum powder feeding device and talcum powder feeding method for a powdery emulsion explosive. The talcum powder feeding device comprises a vacuum pump, a feeding bin, a spiral quantitative conveyor, a buffering bin, a vacuum feeder, a cyclone separator and hoses. Talcum powder in the feeding bin is vacuum-pumped into the vacuum feeder, is discharged into the buffering bin regularly through a pneumatic valve, then is precisely quantificationally discharged into a transparent hose by the aid of the spiral quantitative conveyor, and finally is fed into the powdery emulsion explosive. According to the technical scheme, the talcum powder feeding device and the talcum powder feeding method have the advantages that good convenience, safety and reliability in operation are realized, potential safety hazards caused by friction of the talcum powder on metal tube walls and equipment during talcum powder feeding are avoided effectively, and safety production of the powdery emulsion explosive is guaranteed.

The invention discloses a mononuclear, binuclear and mature maize pollen separation method and construction and an application of a pollen development stage judgment model. A compatible sample grinding-separation-purification buffer system is reasonably arranged in the pollen separation and purification method, so that the activity of pollen cells is effectively kept, and implementation of subsequent steps is facilitated; according to the method, the relevance among the corn plant leaf ring number, the tassel middle spikelet length, the pollen diameter and the pollen development stage is foundthrough research, a quantitative numeralization judgment model of the corn pollen development stage and a simple, convenient and rapid intuitive judgment method are established separately, wherein the model judgment method can accurately judge the development stage of the corn pollen; and the intuitive judgment method does not damage the corn tassels and the wrapped leaves (indexes such as leaf ring number and spikelet length are easy to inspect and obtain), is simple and visual to operate, and solves the technical problem that the corn tassels are damaged for sure (if the tassels wrapped bythe leaves need to be taken out, the leaves are damaged for sure) in the traditional judgment method.

The invention relates to the technical field of valves, and provides a one-way valve structure and a quantitative pump. The one-way valve structure comprises a valve plate and a valve plate support, the valve plate comprises a mounting portion and a sealing portion, and the sealing portion covers the side wall of the valve plate support; the edge of the sealing portion is attached to the side wallof the valve plate support; compared with a conventional valve, the valve plate and the valve plate support form a coating type sealing, so that the valve plate can be better attached to the valve plate support, and reliability and stability of sealing can be improved. The one-way valve structure is arranged in the quantitative pump so as to control the liquid to flow directionally, so that the sealing is more reliable and more stable, the liquid can be effectively prevented from flowing reversely, and therefore the quantitative precision is achieved; and the valve structure and the quantitative pump solve the problems that in the prior art, the quantitative precision fluctuation is large and the liquid discharge liquid is insufficient are solved.