Treatment of genotyped diabetic patients with DPP-IV inhibitors such as linagliptin
By using DPP-4 inhibitors and other anti-diabetic drugs to personalize treatment for patients with the TCF7L2 genotype, we solve the existing problems of poor blood sugar control and cardiovascular disease risk in type II diabetes and achieve more effective metabolic disorders. management and cardiovascular protection.
Patent Information
- Application Number
- CN201710111166.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2010-06-21
- Filing Date
- 2010-11-26
- Publication Date
- 2017-09-01
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
It is difficult to effectively treat type II diabetes with existing technology, especially due to poor blood sugar control and increased risk of cardiovascular disease caused by genetic variants such as TCF7L2 risk genotypes. Existing anti-hyperglycemic drugs have insufficient tolerability and effectiveness for long-term use.
Use DPP-4 inhibitors, such as linagliptin, in combination with other anti-diabetic drugs to provide personalized treatment for patients carrying TCF7L2 risk genotypes or wild genotypes. The treatment plan can be determined by identifying the patient's genotype to improve blood sugar control. .
Significantly improves blood sugar control in patients with type II diabetes, delays or reverses metabolic disorders, reduces body weight, reduces pancreatic beta cell degeneration, reduces the risk of cardiovascular complications, and improves the tolerability and effectiveness of treatment.
Smart Images

Figure HDA0001234430770000011 
Figure HDA0001234430770000021 
Figure BDA0001234430760000231
Abstract
Description
[0001] This application is a divisional application of Chinese invention patent application filed on November 26, 2010, with application number "201080062603.4" and entitled "Treatment of patients with genotype diabetes using DPP-IV inhibitors such as liraristine".
[0002] Invention Field
[0003] This invention relates to DPP-4 inhibitors, pharmaceutical compositions or combinations including the DPP-4 inhibitors described herein and optionally one or more other active substances, for use in the treatment or prevention methods described herein, such as particularly one or more conditions selected from: type 1 diabetes, type 2 diabetes, impaired glucose tolerance, abnormal fasting blood glucose, and hyperglycemia.
[0004] In one specific embodiment, the treatment and / or prevention method of the present invention includes the step of identifying a patient sensitive to the treatment and / or prevention, the identification including testing whether the patient has a variant in one or more genes related to metabolic diseases (e.g., whether the patient has the TCF7L2 risk genotype described herein), or whether the patient has a respective wild-type genotype (e.g., whether the patient has the TCF7L2 wild-type genotype described herein), and other steps of administering the DPP-4 inhibitor, pharmaceutical composition, or combination to the identified sensitive patient.
[0005] Additionally, in one embodiment, the availability of the DPP-4 inhibitors, pharmaceutical compositions, combinations, or drugs described herein in the treatment and / or prevention methods or uses of the present invention in patients who have variants in one or more genes associated with metabolic diseases (e.g., patients with the TCF7L2 risk genotype described herein).
[0006] Patients with TCF7L2 risk genotypes according to the present invention include (but are not limited to) patients who carry risk variants in the TCF7L2 gene (especially patients with type II diabetes) and patients who frequently suffer from its pathological effects, particularly patients associated with the risk T-allele of TCF7L2rs7903146, such as patients carrying the heterozygous risk genotype of TCF7L2rs7903146CT or patients carrying the homozygous high-risk genotype of TCF7L2rs7903146TT.
[0007] Additionally, in another embodiment, the availability of the DPP-4 inhibitors, pharmaceutical compositions, combinations, or drugs described herein in patients carrying the wild-type TCF7L2, particularly the wild-type TCF7L2rs7903146CC, in the treatment and / or prevention methods or uses of the present invention is discussed.
[0008] Furthermore, the present invention provides a diagnostic method for identifying subjects (especially patients with type II diabetes) who are statistically more likely to have a favorable response to a therapeutically effective dose of a DPP-4 inhibitor (optionally in combination with one or more other active substances (e.g., antidiabetic drugs)) (e.g., in achieving glycemic control, such as changes in HbA1c), the method comprising determining whether the subject is a TCF7L2 risk genotype (especially the TCF7L2rs7903146CT or TT risk genotype) or a TCF7L2 wild-type genotype (especially the TCF7L2rs7903146CC wild-type genotype), wherein subjects with the TCF7L2rs7903146CC homozygous wild-type genotype (and to a lesser extent, the subjects with the TCF7L2rs7903146CT heterozygous risk genotype) are more likely to have a favorable response to administration of a DPP-4 inhibitor than subjects with the TCF7L2rs7903146TT homozygous risk genotype.
[0009] Furthermore, the present invention relates to methods for achieving the following objectives in patients in need:
[0010] -Prevent metabolic disorders, slow the progression of metabolic disorders, delay or treat metabolic disorders;
[0011] - Improve glycemic control and / or reduce fasting plasma glucose, postprandial plasma glucose and / or glycosylated hemoglobin HbA1c;
[0012] - To prevent, slow, delay or reverse the progression of type 2 diabetes from impaired glucose tolerance, abnormal fasting blood glucose, insulin resistance and / or metabolic syndrome;
[0013] -Preventing, slowing the progression of, delaying or treating conditions or obstacles selected from complications of diabetes;
[0014] - To reduce weight and / or body fat, or to prevent weight and / or body fat gain, or to promote weight and / or body fat reduction;
[0015] - To prevent or treat pancreatic β-cell degeneration, and / or improve and / or restore or protect the function of pancreatic β-cells, and / or restore pancreatic insulin secretion function;
[0016] - To prevent, alleviate, delay, or treat diseases or conditions caused by abnormal accumulation of fat or ectopic fat in the liver; or
[0017] - Used to maintain and / or improve insulin sensitivity and / or treat or prevent hyperinsulinemia and / or insulin resistance;
[0018] -Preventing new-onset diabetes mellitus (NODAT) and / or post-transplant metabolic syndrome (PTMS), slowing the progression of these conditions, delaying or treating these conditions;
[0019] - To prevent, delay, or reduce NODAT and / or PTMS-related complications, including microvascular and macrovascular disease and events, transplant rejection, infection, and death;
[0020] - Treatment of hyperuricemia and hyperuricemia-related conditions;
[0021] For example, in patients who have variants (e.g., the TCF7L2 risk genotype described herein) in one or more genes associated with metabolic diseases (especially those with type 2 diabetes), or those who have their respective wild-type genotypes (e.g., the TCF7L2 wild-type described herein), wherein the method includes:
[0022] The test determines whether the patient has variants in one or more genes associated with metabolic diseases (e.g., whether he / she has the TCF7L2 risk genotype described herein) or whether the patient has their respective wild-type genotype (e.g., whether the patient has the TCF7L2 wild-type genotype described herein).
[0023] Administer a DPP-4 inhibitor as defined below (preferably linagliptin), optionally in combination with one or more other active substances.
[0024] Furthermore, the present invention relates to the use of DPP-4 inhibitors in the preparation of medicaments for use in the methods described in the context.
[0025] Furthermore, the present invention relates to DPP-4 inhibitors for treating patients described in the context, particularly human patients with type 2 diabetes.
[0026] Furthermore, the present invention relates to DPP-4 inhibitors for the treatment or prevention of diseases, disorders or conditions (especially diabetes, particularly type 2 diabetes, and related conditions such as diabetic complications) described in the context (especially metabolic diseases).
[0027] This invention also relates to the use of the pharmaceutical compositions or combinations of the invention in the preparation of a medicament for use in the context of the method described herein.
[0028] The present invention also relates to a DPP-4 inhibitor as defined herein, used in the context of a method comprising administering the DPP-4 inhibitor to the patient, optionally in combination with one or more other active substances (e.g., those optionally described herein).
[0029] Background of the Invention
[0030] Type 2 diabetes is an increasingly prevalent disease that significantly shortens life expectancy due to its high frequency of complications. Because of diabetes-related microvascular complications, type 2 diabetes is currently the most common cause of blindness, kidney failure, and amputation in adults in the industrialized world. Furthermore, the presence of type 2 diabetes is associated with a 2 to 5 times increased risk of cardiovascular disease.
[0031] After a long period of disease progression, oral therapy eventually fails for most patients with type 2 diabetes, and they become insulin dependent, requiring daily insulin injections and multiple daily glucose measurements.
[0032] The United Kingdom Prospective Diabetes Study (UKPDS) demonstrated that intensive treatment with metformin, sulfonylureas, or insulin produced only limited improvements in glycemic control (HbA1c difference of approximately 0.9%). Furthermore, even in the intensive treatment group, glycemic control significantly worsened over time due to β-cell dysfunction. Importantly, intensive treatment was not associated with a significant reduction in macrovascular complications (i.e., cardiovascular events). Therefore, many patients with type 2 diabetes remain undertreated, partly due to limitations in the long-term effectiveness, tolerability, and ease of administration of existing antihyperglycemic therapies.
[0033] Oral and non-oral antidiabetic drugs routinely used for treatment (e.g., first-line or second-line, and / or single or (initial or add-on) combination therapy) include (but are not limited to) metformin, sulfonylureas, thiazolidinediones, glinides, alpha-glucosidase inhibitors, GLP-1 or GLP-1 analogs, and insulin or insulin analogs.
[0034] The high incidence of treatment failure is a major cause of complications or chronic damage associated with long-term hyperglycemia in patients with type 2 diabetes, including microvascular and macrovascular complications such as diabetic nephropathy, retinopathy or neuropathy, or cardiovascular complications.
[0035] Gene association studies have identified gene variants in several genes associated with an increased risk of type 2 diabetes. For example, variants in the genes TCF7L2, KCNJ11, and PPARG independently and mutually increase the risk of progressing from abnormal fasting glucose and impaired glucose tolerance (IGT) to overt diabetes. While variants in KCNJ11 may alter insulin secretion and variants in PPARG may alter insulin action, TCF7L2 (transcription factor 7 analog 2) is the leading susceptibility gene for type 2 diabetes identified to date in multiple human populations, such as European, Indian, and Japanese populations, Mexican Americans, and West Africans. Polymorphisms (single nucleotide polymorphisms, called SNPs) in TCF7L2 (e.g., rs12255372, especially rs7903146) are highly associated with diabetes. Compared to the homozygous wild-type CC genotype, carriers of a risk T-allele (CT heterozygote) of TCF7L2 rs7903146 have an approximately 45% increased risk of developing type 2 diabetes (odds ratio 1.45); and at least twice as high in the homozygous TT genotype (odds ratio 2.41) (Grant et al., Nature Genetics, Vol. 38, 2006, p320-323). The TCF7L2 risk genotype is associated with increased TCF7L2 expression in pancreatic β-cells, abnormal (glucose-stimulated) insulin secretion, glucagon activity, accelerated hepatic glucose production, and a predisposition to and prediction of future type 2 diabetes (see Lyssenko et al., The Journal of Clinical Investigation, Vol. 117, No. 8, 2007, p. 2155-2163). Evidence suggests that the TCF7L2rs7903146 risk variant is associated with reduced glucagon-induced insulin secretion, possibly based on (at least in part) abnormal β-cell sensitivity to glucagon.
[0036] Therefore, diabetic patients carrying TCF7L2 risk variants, especially those carrying the risk T-allelic gene of TCF7L2rs7903146, such as those carrying the TCF7L2rs7903146CT genotype, and especially those carrying the TCF7L2rs7903146TT genotype, are expected to have difficulty undergoing antidiabetic treatment.
[0037] Therefore, there is an unmet need for methods, medicines, and pharmaceutical compositions or combinations that demonstrate good efficacy related to glycemic control, disease improvement properties, and reduction of cardiovascular morbidity and mortality, while also showing improved safety profiles.
[0038] DPP-4 inhibitors represent another class of new drugs developed to treat or improve glycemic control in patients with type 2 diabetes.
[0039] For example, DPP-4 inhibitors and their uses are disclosed in WO 2002 / 068420, WO 2004 / 018467, WO 2004 / 018468, WO 2004 / 018469, WO 2004 / 041820, WO 2004 / 046148, WO 2005 / 051950, WO 2005 / 082906、WO 2005 / 063750、WO 2005 / 085246、WO 2006 / 027204、WO 2006 / 029769、WO2007 / 014886、WO 2004 / 050658、WO 2004 / 111051、WO 2005 / 058901、WO 2005 / 097798, WO 2006 / 068163, WO 2007 / 071738, WO 2008 / 017670, WO 2007 / 128721, WO 2007 / 128724, WO 2007 / 128761 or WO 2009 / 121945.
[0040] Purpose of the invention
[0041] The purpose of this invention is to provide medicaments and / or methods for preventing metabolic disorders (especially type II diabetes), slowing the progression of such metabolic disorders, delaying or treating such metabolic disorders.
[0042] Another object of the present invention is to provide a medicine and / or method for improving glycemic control in patients in need, particularly those with type 2 diabetes, such as those with variants in one or more genes associated with metabolic diseases (e.g., patients with the TCF7L2 risk genotype described herein) or those with their respective wild-type genotypes.
[0043] Another object of the present invention is to provide a medicine and / or method for improving glycemic control in patients who have inadequate glycemic control despite monotherapy with an antidiabetic drug (e.g., metformin) or combination therapy with two or three antidiabetic drugs, such as patients with variants in one or more genes associated with metabolic diseases (e.g., patients with the TCF7L2 risk genotype described herein) or those with their respective wild-type genotypes.
[0044] Another object of the present invention is to provide a medicine and / or method for preventing, slowing down or delaying the progression of type II diabetes from impaired glucose tolerance (IGT), abnormal fasting blood glucose (IFG), insulin resistance and / or metabolic syndrome.
[0045] Another object of the present invention is to provide a medicine and / or method for preventing, slowing the progression of, delaying or treating conditions or disorders selected from diabetic complications.
[0046] Another object of the present invention is to provide a medicine and / or method for reducing weight or preventing weight gain in patients who require it, such as patients who have variants in one or more genes associated with metabolic diseases (e.g., patients with the TCF7L2 risk genotype described herein) or those who have their respective wild-type genotypes.
[0047] Another object of the present invention is to provide a highly effective medicament for treating metabolic disorders, particularly diabetes, impaired glucose tolerance (IGT), abnormal fasting glucose (IFG), and / or hyperglycemia, wherein the medicament composition has good to excellent pharmacological and / or pharmacokinetic and / or physicochemical properties.
[0048] Other objects of the present invention will become apparent to those skilled in the art from the contextual description and embodiments.
[0049] Invention Overview
[0050] Within the scope of this invention, DPP-4 inhibitors (preferably liraristine), as well as pharmaceutical compositions or combinations comprising said DPP-4 inhibitor and optionally one or more other active substances (e.g., antidiabetic drugs), have been found to be effective in improving glycemic control and treating type II diabetes in patients with the TCF7L2rs7903146CT or TT risk genotype and in patients with the TCF7L2rs7903146CC wild-type genotype.
[0051] In particular, all patients with the TCF7L2 genotype in all studies (those with the TCF7L2rs7903146CT or TT risk genotype or those with the TCF7L2rs7903146CC wild-type genotype) have been found to have a clinically meaningful response to administration of DPP-4 inhibitors (especially liraristine).
[0052] Therefore, within the scope of this invention, certain subgroups of diabetic patients are suitable for the antidiabetic treatment of this invention (including preferably using liraristine, optionally in combination with one or more other active substances (e.g., other antidiabetic drugs described herein), said patients including, for example, (but not limited to) those carrying the TCF7L2rs7903146CC or CT or TT genotypes respectively.
[0053] Within the scope of this invention, it has also been found that DPP-4 inhibitors as defined herein, as well as pharmaceutical compositions or combinations including DPP-4 inhibitors as defined herein and optionally one or more other active substances, can be used to: prevent metabolic disorders, slow their progression, delay (e.g., delay their onset), or treat metabolic disorders (especially diabetes, particularly type II diabetes and related conditions, such as diabetic complications); and particularly for improving glycemic control in patients, for example, those with variants in one or more genes associated with metabolic diseases (e.g., patients with the TCF7L2 risk genotype described herein).
[0054] Within the scope of this invention, it has also been found that DPP-4 inhibitors as defined herein, as well as pharmaceutical compositions or combinations including DPP-4 inhibitors as defined herein and optionally one or more other active substances, can be used to: prevent metabolic disorders, slow their progression, delay (e.g., delay their onset), or treat metabolic disorders (especially diabetes, especially type II diabetes and related conditions); particularly for improving glycemic control in patients such as those with the TCF7L2 wild-type genotype, especially those with the TCF7L2rs7903146CC wild-type genotype.
[0055] In one embodiment, the method includes the steps of identifying a patient sensitive to the method used, such as testing whether the patient has a variant in one or more genes associated with metabolic diseases (e.g., whether the patient has the TCF7L2 risk genotype described herein) or whether the patient has the TCF7L2 wild-type described herein, and administering the DPP-4 inhibitor, pharmaceutical composition, or combination to the identified sensitive patient.
[0056] This opens up new therapeutic possibilities for the treatment and prevention of type 2 diabetes, overweight, obesity, diabetic complications and related disease states, including in patients with variants in one or more genes associated with metabolic diseases (e.g., patients with the TCF7L2 risk genotype described herein) and patients with their respective wild-type genotypes (e.g., patients with the TCF7L2 wild-type genotype described herein).
[0057] Furthermore, the present invention provides a method for determining the probability of a favorable response (e.g., in providing glycemic control) or the extent of a favorable change in HbA1c from an individual treated with a DPP-4 inhibitor (preferably liraristine) or said DPP-4 inhibitor in combination with one or more other active substances (e.g., antidiabetic drugs), the method comprising determining whether the subject has a TCF7L2 risk genotype (especially the TCF7L2rs7903146TT risk genotype) or a TCF7L2 wild-type genotype (especially the TCF7L2rs7903146CC wild-type genotype), wherein the probability of a favorable response or a significantly highly favorable change in HbA1c in response to administration of a DPP-4 inhibitor (preferably liraristine) or said DPP-4 inhibitor in combination with one or more other active substances (e.g., antidiabetic drugs) is as follows:
[0058] It is higher in individuals with the homozygous wild-type TCF7L2rs7903146CC, and
[0059] It is lower in individuals with the homozygous risk genotype TCF7L2rs7903146TT (e.g., but still clinically significant or meaningful).
[0060] Therefore, in one aspect, a pharmaceutical composition or combination comprising the following is provided:
[0061] (a) DPP-4 inhibitors, and, optionally,
[0062] (b) A second antidiabetic drug selected from group G3, said group G3 consisting of biguanide (especially metformin), thiazolidinedione, sulfonylurea, linenide, alpha-glucosidase inhibitor, GLP-1 or a GLP-1 analog and insulin or an insulin analog, and optionally,
[0063] (c) A third antidiabetic drug selected from group G3, distinct from (b), said group G3 consisting of biguanide (especially metformin), thiazolidinedione, sulfonylurea, linenide, alpha-glucosidase inhibitor, GLP-1 or a GLP-1 analog, and insulin or an insulin analog.
[0064] Or its pharmaceutically acceptable salt.
[0065] One aspect provides a pharmaceutical composition or combination comprising the following:
[0066] (a) DPP-4 inhibitors, and, optionally,
[0067] (b) A second antidiabetic drug selected from group G3, said group G3 consisting of biguanide (especially metformin), thiazolidinedione, sulfonylurea, linenide, alpha-glucosidase inhibitor, GLP-1 or a GLP-1 analog and insulin or an insulin analog, and optionally,
[0068] (c) A third antidiabetic drug, distinct from (b), selected from metformin, sulfonylureas, pioglitazone, rosiglitazone, repaglinide, nateglinide, acarbose, voglibose, miglitol, GLP-1 or a GLP-1 analogue, and insulin or an insulin analogue.
[0069] Or its pharmaceutically acceptable salt.
[0070] In another minor aspect, a pharmaceutical composition or combination comprising the following is provided:
[0071] (a) DPP-4 inhibitors, and, optionally,
[0072] (b) A second antidiabetic drug selected from metformin, sulfonylureas, pioglitazone, rosiglitazone, repaglinide, nateglinide, acarbose, voglibose, miglitol, GLP-1 or a GLP-1 analog and insulin or an insulin analog, and optionally,
[0073] (c) A third antidiabetic drug selected from group G3, distinct from (b), said group G3 consisting of biguanide (especially metformin), thiazolidinedione, sulfonylurea, linenide, alpha-glucosidase inhibitor, GLP-1 or a GLP-1 analog, and insulin or an insulin analog.
[0074] Or its pharmaceutically acceptable salt.
[0075] In another minor aspect, a pharmaceutical composition or combination comprising the following is provided:
[0076] (a) DPP-4 inhibitors, and, optionally,
[0077] (b) A second antidiabetic drug selected from metformin, sulfonylureas, and pioglitazone, and optionally,
[0078] (c) A third antidiabetic drug, distinct from (b), selected from metformin, sulfonylureas, pioglitazone, rosiglitazone, repaglinide, nateglinide, acarbose, voglibose, miglitol, GLP-1 or a GLP-1 analogue, and insulin or an insulin analogue.
[0079] Or its pharmaceutically acceptable salt.
[0080] In another minor aspect, a pharmaceutical composition or combination comprising the following is provided:
[0081] (a) DPP-4 inhibitors, and, optionally,
[0082] (b) A second antidiabetic drug selected from metformin, sulfonylureas, pioglitazone, rosiglitazone, repaglinide, nateglinide, acarbose, voglibose, miglitol, GLP-1 or a GLP-1 analog and insulin or an insulin analog, and optionally,
[0083] (c) A third antidiabetic drug, distinct from (b), selected from metformin, sulfonylureas, and pioglitazone.
[0084] Or its pharmaceutically acceptable salt.
[0085] In another minor aspect, a pharmaceutical composition or combination comprising the following is provided:
[0086] (a) DPP-4 inhibitors, and, optionally,
[0087] (b) A second antidiabetic drug selected from metformin and pioglitazone, and optionally,
[0088] (c) A third antidiabetic drug, distinct from (b), selected from metformin, sulfonylureas, and pioglitazone.
[0089] Or its pharmaceutically acceptable salt.
[0090] In another minor aspect, a pharmaceutical composition or combination comprising the following is provided:
[0091] (a) DPP-4 inhibitors, and, optionally,
[0092] (b) A second antidiabetic drug selected from metformin, sulfonylureas, and pioglitazone, and optionally,
[0093] (c) A third antidiabetic drug, different from (b), selected from metformin and pioglitazone.
[0094] Or its pharmaceutically acceptable salt.
[0095] When a third antidiabetic drug is selected (in addition to the second antidiabetic drug), the third antidiabetic drug is preferably selected from a different type than the second antidiabetic drug. Therefore, it should be understood that the second and third antidiabetic drugs are different, and preferably, they are selected from different types (e.g., if the second antidiabetic drug is selected from biguanides, then the third antidiabetic drug is preferably selected from other types). Types of antidiabetic drugs are as described above, such as biguanides, thiazolidinediones, sulfonylureas, linebenzenes, alpha-glucosidase inhibitors, GLP-1 analogs, insulin, etc.
[0096] One specific embodiment of the present invention relates to monotherapy using a DPP-4 inhibitor as defined herein and / or to pharmaceutical compositions comprising a DPP-4 inhibitor as a single active ingredient.
[0097] Within the scope of the combination and / or combination therapies of the present invention, one specific embodiment relates to dual combination and / or dual therapy; another embodiment relates to triple combination and / or triple therapy.
[0098] According to another aspect, a method is provided for preventing, slowing the progression of, delaying or treating metabolic disorders in patients in need, said metabolic disorders being selected from: type 1 diabetes, type 2 diabetes, impaired glucose tolerance (IGT), abnormal fasting glucose (IFG), hyperglycemia, postprandial hyperglycemia, overweight, obesity and metabolic syndrome, characterized in that a context-defined DPP-4 inhibitor and optionally a second and optionally a third antidiabetic drug are administered, for example, in combination to said patient.
[0099] According to another aspect, a method is provided for preventing, slowing the progression of, delaying or treating metabolic disorders in patients in need, said metabolic disorders being selected from insulin resistance, hyperlipidemia, hypercholesterolemia, dyslipidemia, hypertension, chronic systemic inflammation, retinopathy, neuropathy, nephropathy, atherosclerosis, endothelial dysfunction, non-alcoholic fatty liver disease (NAFLD) and osteoporosis, characterized in that a context-defined DPP-4 inhibitor and optionally a second and optionally a third antidiabetic drug are administered to said patient in combination.
[0100] According to another aspect of the invention, a method is provided for improving glycemic control and / or reducing fasting plasma glucose, postprandial plasma glucose and / or glycosylated hemoglobin HbA1c in patients in need, characterized in that a context-defined DPP-4 inhibitor and optionally a second and optionally a third antidiabetic drug are administered to the patient in combination.
[0101] The pharmaceutical compositions of the present invention may also have valuable disease-modifying properties for diseases or conditions associated with impaired glucose tolerance (IGT), abnormal fasting blood glucose (IFG), insulin resistance, and / or metabolic syndrome.
[0102] According to another aspect, a method is provided for preventing, slowing, delaying or reversing the progression of impaired glucose tolerance (IGT), abnormal fasting blood glucose (IFG), insulin resistance and / or metabolic syndrome to type 2 diabetes in patients in need, characterized by administering a context-defined DPP-4 inhibitor and optionally a second and optionally a third antidiabetic drug, for example, in combination to the patient.
[0103] By using the pharmaceutical compositions or combinations of the present invention, glycemic control can be improved in patients in need, and conditions and / or diseases related to or caused by increased glycemic levels can also be treated.
[0104] According to another aspect, methods are provided for preventing, slowing the progression of, delaying or treating, diabetic complications such as cataracts and microvascular and macrovascular diseases such as nephropathy, retinopathy, neuropathy, learning and memory impairment, neurodegeneration or cognitive impairment, cardiovascular or cerebrovascular disease, arteriosclerosis, hypertension, endothelial dysfunction, myocardial infarction, acute coronary syndrome, unstable angina, stable angina, cardiomyopathy, heart failure, arrhythmia, restenosis, peripheral artery occlusive disease, stroke, tissue ischemia, diabetic foot or ulcer, characterized by administering, in combination with, a context-defined DPP-4 inhibitor and optionally a second and optionally a third antidiabetic drug, to the patient. In one or more aspects, diabetic nephropathy (e.g., hyperperfusion, proteinuria and albuminuria (including microalbuminuria or macroalbuminuria)) can be treated, its progression slowed, or its onset delayed or prevented. The term "tissue ischemia" specifically includes diabetic macrovascular disease, diabetic microvascular disease, abnormal wound healing, and diabetic ulcers. The terms "microvascular and macrovascular disease" and "microvascular and macrovascular complications" are used interchangeably in this application.
[0105] In one embodiment, administration of the pharmaceutical composition or combination of the present invention does not increase or even decrease body weight.
[0106] According to another aspect, a method is provided for reducing weight and / or body fat, or preventing weight and / or body fat gain, or promoting weight and / or body fat reduction in patients in need, characterized in that a context-defined DPP-4 inhibitor and optionally a second and optionally a third antidiabetic drug are administered to the patient in combination.
[0107] In one embodiment, administration of the pharmaceutical composition or combination of the present invention can delay or prevent β-cell degeneration and decreased β-cell function, such as apoptosis or necrosis of pancreatic β-cells. Furthermore, it can improve or restore pancreatic cell function and increase the number and size of pancreatic β-cells. It has been shown that treatment with the pharmaceutical composition or combination of the present invention can normalize the differentiation state and proliferation of pancreatic β-cells disrupted by hyperglycemia.
[0108] According to another aspect, a method is provided for preventing, slowing, delaying, or treating pancreatic β-cell degeneration and / or decreased pancreatic β-cell function, and / or improving and / or restoring pancreatic β-cell function, and / or restoring pancreatic insulin secretion function in patients in need, characterized in that a context-defined DPP-4 inhibitor and optionally a second and optionally a third antidiabetic drug are administered, for example, in combination to the patient.
[0109] In one embodiment, by administering the pharmaceutical composition or combination of the present invention, the abnormal accumulation of (ectopic) fat (especially ectopic fat in the liver) can be reduced or inhibited.
[0110] According to another aspect, a method is provided for preventing, mitigating, delaying, or treating diseases or conditions caused by abnormal accumulation of hepatic fat or ectopic fat in patients in need, characterized by administering, for example, a context-defined DPP-4 inhibitor and optionally a second and optionally a third antidiabetic drug in combination to the patient. Diseases or conditions caused by abnormal accumulation of hepatic fat or ectopic fat are particularly selected from: general fatty liver, non-alcoholic fatty liver (NAFL), non-alcoholic steatohepatitis (NASH), overnutrition-induced fatty liver, diabetic fatty liver, alcohol-induced fatty liver, or toxic fatty liver, especially non-alcoholic fatty liver disease (NAFLD), which includes hepatic steatosis, non-alcoholic steatohepatitis (NASH), and / or liver fibrosis.
[0111] According to another aspect of the invention, a method is provided for preventing, slowing the progression of, delaying, attenuating, treating or reversing hepatic steatosis, (liver) inflammation and / or abnormal accumulation of hepatic fat in patients in need, characterized in that a context-defined DPP-4 inhibitor and optionally a second and optionally a third antidiabetic drug are administered to the patient in combination, for example.
[0112] According to another aspect, a method is provided for maintaining and / or improving insulin sensitivity and / or treating or preventing hyperinsulinemia and / or insulin resistance in patients in need, characterized in that a context-defined DPP-4 inhibitor and optionally a second and optionally a third antidiabetic drug are administered, for example, in combination to the patient.
[0113] According to another aspect of the invention, a method is provided for preventing new-onset diabetes mellitus (NODAT) and / or post-transplant metabolic syndrome (PTMS), slowing the progression of these conditions, delaying or treating these conditions in patients in need, characterized in that a context-defined DPP-4 inhibitor and optionally a second and optionally a third antidiabetic drug are administered to the patient in combination, for example.
[0114] According to another aspect of the invention, a method is provided for preventing, delaying or reducing NODAT and / or PTMS-related complications (including microvascular and macrovascular diseases and events, transplant rejection, infection and death) in patients in need, characterized in that a context-defined DPP-4 inhibitor and optionally a second and optionally a third antidiabetic drug are administered, for example, in combination to the patient.
[0115] According to another aspect of the invention, a method is provided for treating hyperuricemia and hyperuricemia-related conditions (e.g., gout, hypertension, and renal failure) in patients in need, characterized in that a context-defined DPP-4 inhibitor and optionally a second and optionally a third antidiabetic drug are administered to the patient in combination.
[0116] According to another aspect, the use of DPP-4 inhibitors in the preparation of medicines for use in patients in need is provided:
[0117] -Prevention, slowing the progression of, delaying or treating of the following metabolic disorders: type 1 diabetes, type 2 diabetes, impaired glucose tolerance (IGT), abnormal fasting glucose (IFG), hyperglycemia, postprandial hyperglycemia, overweight, obesity and metabolic syndrome; or
[0118] - Improve glycemic control and / or reduce fasting plasma glucose, postprandial plasma glucose and / or glycosylated hemoglobin HbA1c; or
[0119] - To prevent, slow, delay, or reverse the progression of type 2 diabetes from impaired glucose tolerance (IGT), abnormal fasting glucose (IFG), insulin resistance, and / or metabolic syndrome; or
[0120] -Prevention, slowing the progression of, delaying or treating of conditions or disorders selected from the following: diabetic complications, such as cataracts, and microvascular and macrovascular diseases, such as nephropathy, retinopathy, neuropathy, tissue ischemia, arteriosclerosis, myocardial infarction, stroke, and peripheral artery occlusive disease; or
[0121] - To reduce weight and / or body fat, or to prevent weight and / or body fat gain, or to promote weight and / or body fat reduction; or
[0122] - To prevent, slow down, delay, or treat pancreatic β-cell degeneration and / or decreased pancreatic β-cell function, and / or improve and / or restore or protect pancreatic β-cell function and / or restore pancreatic insulin secretion function; or
[0123] - To prevent, alleviate, delay, or treat diseases or conditions caused by abnormal accumulation of fat or ectopic fat in the liver; or
[0124] - Maintain and / or improve insulin sensitivity and / or treat or prevent hyperinsulinemia and / or insulin resistance; or
[0125] - To prevent new-onset diabetes mellitus (NODAT) and / or post-transplant metabolic syndrome (PTMS), slow its progression, delay or treat these conditions; or
[0126] - To prevent, delay, or reduce NODAT and / or PTMS-related complications, including microvascular and macrovascular disease and events, transplant rejection, infection, and death; or
[0127] - Treatment of hyperuricemia and hyperuricemia-related conditions;
[0128] This includes patients who are given a DPP-4 inhibitor as defined in the context of single-dose administration or, optionally, in combination with a second and optionally a third antidiabetic drug.
[0129] According to another aspect, the use of a second type of antidiabetic drug, defined in context, in the preparation of a medicine intended for use in patients in need, is as follows:
[0130] -Prevention, slowing the progression of, delaying or treating of the following metabolic disorders: type 1 diabetes, type 2 diabetes, impaired glucose tolerance (IGT), abnormal fasting glucose (IFG), hyperglycemia, postprandial hyperglycemia, overweight, obesity and metabolic syndrome; or
[0131] - Improve glycemic control and / or reduce fasting plasma glucose, postprandial plasma glucose and / or glycosylated hemoglobin HbA1c; or
[0132] - To prevent, slow, delay, or reverse the progression of type 2 diabetes from impaired glucose tolerance (IGT), abnormal fasting glucose (IFG), insulin resistance, and / or metabolic syndrome; or
[0133] -Prevention, slowing the progression of, delaying or treating of conditions or disorders selected from the following: diabetic complications, such as cataracts, and microvascular and macrovascular diseases, such as nephropathy, retinopathy, neuropathy, tissue ischemia, arteriosclerosis, myocardial infarction, stroke, and peripheral artery occlusive disease; or
[0134] - To reduce weight and / or body fat, or to prevent weight and / or body fat gain, or to promote weight and / or body fat reduction; or
[0135] - To prevent, slow down, delay, or treat pancreatic β-cell degeneration and / or decreased pancreatic β-cell function, and / or improve and / or restore pancreatic β-cell function and / or restore pancreatic insulin secretion function; or
[0136] - To prevent, alleviate, delay, or treat diseases or conditions caused by the abnormal accumulation of fat or ectopic fat in the liver; or
[0137] - Maintain and / or improve insulin sensitivity and / or treat or prevent hyperinsulinemia and / or insulin resistance;
[0138] This includes a combination of a second antidiabetic drug with a DPP-4 inhibitor, as defined in the context of patient administration, and, optionally, a combination with a third antidiabetic drug.
[0139] According to another aspect, the use of the pharmaceutical compositions of the present invention in the preparation of medicaments for the treatment and prevention methods described in the context is provided.
[0140] Within the scope of this invention, patients with the TCF7L2 risk genotype (also referred to herein as TCF7L2 risk genotype patients) are those who have one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2 (especially the SNP selected from rs7903146, rs12255372, and rs10885406, especially the SNP of rs7903146); more specifically, those who carry at least one T allele SNP rs7903146 of TCF7L2, i.e., the CT genotype or TT genotype; and especially those who carry two T allele SNPs rs7903146 of TCF7L2, i.e., the TT genotype, who are at high risk and are expected to be difficult to treat (e.g., achieve adequate glycemic control).
[0141] This invention provides a DPP-4 inhibitor (preferably liraristine), pharmaceutical composition, combination, or medicament thereof, for use in one or more of the following patient groups for the treatment and / or prevention methods described in the context (e.g., treatment of type 2 diabetes):
[0142] - Patients carrying two T allele SNPs for TCF7L2, i.e., the TT genotype, are at high risk for TCF7L2 (and have demonstrated clinically meaningful responses, such as in glycemic control).
[0143] - Patients carrying a T allele SNP rs7903146 of TCF7L2, i.e., the CT genotype, are at risk for TCF7L2 (and have provided clinically favorable responses, such as in glycemic control).
[0144] - Patients carrying two CC allele SNPs of TCF7L2, i.e., wild-type TCF7L2 with CC genotype (which provides a more clinically favorable response, such as in glycemic control).
[0145] In a specific aspect of the invention, the present invention relates to DPP-4 inhibitors, pharmaceutical compositions, or combinations thereof, for use in the treatment and / or prevention methods or uses described in the context (e.g., for treating type II diabetes), said methods or uses including:
[0146] (i) Identifying patients sensitive to the treatment and / or preventive methods or uses, including testing whether the patient has any TCF7L2 risk genotype, particularly whether the patient has one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, especially SNPs selected from rs7903146, rs12255372, and rs10885406, for example whether the patient carries at least one T allele SNP rs7903146 of TCF7L2, for example whether the patient has the CT genotype (i.e., whether the patient carries one T allele SNP rs7903146 of TCF7L2) or, in particular, whether the patient has the TT genotype (i.e., whether the patient carries two T allele SNPs rs7903146 of TCF7L2), or testing whether the patient has the TCF7L2 wild-type genotype, especially whether the patient carries two C allele SNPs of TCF7L2. rs7903146 (i.e., whether the patient has the CC wild-type genotype), and
[0147] (ii) administer an effective amount of a DPP-4 inhibitor, pharmaceutical composition, or combination to the patient identified in step (i).
[0148] In another specific aspect of the invention, the invention relates to the DPP-4 inhibitor, pharmaceutical composition, combination, or medicament of the invention for use in the treatment and / or prevention methods or uses described in the context (e.g., for the treatment of type II diabetes) in patients with TCF7L2 risk genotypes, said patients, for example, having one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, particularly those selected from rs7903146, rs12255372, and rs10885406, especially those with the SNP rs7903146; more specifically, said patients are those carrying at least one T allele SNP rs7903146 of TCF7L2, i.e., those with the CT or TT genotypes.
[0149] In another specific aspect of the invention, the invention relates to the DPP-4 inhibitor, pharmaceutical composition, combination or medicament of the invention, for use in the treatment and / or prevention methods or uses described in the context (e.g., treatment of type II diabetes) in patients with wild-type TCF7L2, such as those carrying the two C allele SNPs rs7903146 of TCF7L2, i.e., those with the CC genotype.
[0150] In this context, the specific subgroup of patients (e.g., patients requiring the treatment or prevention methods described herein) refers to those patients who have one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, particularly at least one SNP selected from rs7903146, rs12255372, and rs10885406, especially rs7903146, and more specifically, those patients who carry at least one T allele SNP rs7903146 of TCF7L2, i.e., the CT genotype or TT genotype.
[0151] More specifically, patients carrying at least one T allele SNP rs7903146 of TCF7L2, i.e., the CT or TT genotype, especially those carrying two T allele SNPs rs7903146 of TCF7L2, i.e., the TT genotype, are more susceptible to increased TCF7L2 expression in pancreatic β-cells, abnormal insulin secretion, intestinal glucagon action, accelerated hepatic glucose production, and / or diabetes. The T allele rs7903146 of TCF7L2 is associated with abnormal insulinotropic effects of intestinal glucagon, decreased 24-hour plasma insulin and glucagon levels, and increased hepatic glucose production.
[0152] Another specific subgroup of patients mentioned in the context (e.g., patients who require the treatment or prevention methods described herein) refers to those patients with the TCF7L2 wild-type genotype, especially those with the TCF7L2 rs7903146CC wild-type genotype.
[0153] According to one embodiment of this aspect of the invention, a DPP-4 inhibitor, pharmaceutical composition, combination, or medicament according to the invention is provided for use in the treatment and / or prevention methods or uses described in the context (specifically for the treatment and / or prevention of type II diabetes and / or obesity) in patients who have reduced (glucose-stimulated) insulin secretion, increased hepatic gluconeogenesis, and / or reduced insulinotropic effects or effects of intestinal hypoglycemic hormones (e.g., GLP-1 and / or GIP), for example, patients with abnormal intestinal hypoglycemic sensitivity associated with the TCF7L2 risk genotype, especially those with the aforementioned TCF7L2 risk genotype.
[0154] According to another embodiment of this aspect of the invention, a method is provided for determining a patient’s therapeutic response to the DPP-4 inhibitor, pharmaceutical composition, combination or drug of the invention, the method comprising the steps of determining whether the patient has the TCF7L2 risk genotype described herein, for example testing whether the patient belongs to a specific subgroup of TCF7L2 risk genotype carriers, or determining whether the patient has the TCF7L2 wild-type genotype, for example testing whether the patient carries the wild-type CC allele in rs7903146 of TCF7L2.
[0155] According to another embodiment of this aspect of the invention, a DPP-4 inhibitor, pharmaceutical composition, combination or medicament of the invention is provided for use in patients in need of the treatment and / or prevention methods described in the context (specifically for the treatment and / or prevention of type II diabetes and / or obesity), said methods comprising testing said patient for any of the TCF7L2 risk genotypes described herein.
[0156] According to another embodiment of this aspect of the invention, a DPP-4 inhibitor, pharmaceutical composition, combination or medicament of the invention is provided for use in patients in need of the treatment and / or prevention methods described in the context (specifically for the treatment and / or prevention of type II diabetes and / or obesity), said methods comprising testing whether said patient has the TCF7L2 wild-type genotype described herein.
[0157] According to another aspect of the invention, testing for the TCF7L2 risk genotype can be used for patient triage, for example, to aggregate patient populations in clinical trials to test the effectiveness of the DPP-4 inhibitor.
[0158] According to another aspect of the invention, methods for determining an individual’s treatment sensitivity (e.g., including testing for TCF7L2 risk or wild-type as described herein) can be used to determine whether the patient is likely to respond to a lower dose or may require a higher dose of a DPP-4 inhibitor, optionally in combination with one or more other active substances.
[0159] According to another aspect of the invention, determining an individual's treatment sensitivity (including testing for TCF7L2 risk or wild-type as described herein) can be used to determine whether the patient can be treated with monotherapy or in combination therapy with one or more other antidiabetic drugs according to the invention to provide adequate glycemic control, for example. For instance, those patients with a reduced likelihood of a favorable response may require combination therapy to achieve adequate glycemic control, for example.
[0160] definition
[0161] The term "active ingredient" in the pharmaceutical compositions or combinations of the present invention refers to the DPP-4 inhibitor and / or the second antidiabetic drug (if present) and / or the third antidiabetic drug (if present).
[0162] In human patients, the term "body mass index" or "BMI" is defined as weight in kilograms divided by the square of height in meters, thus the unit of BMI is kg / m². 2 .
[0163] The term "overweight" is defined as an individual's BMI greater than 25 kg / m². 2 And less than 30kg / m 2 The condition. The terms "overweight" and "pre-obesity" are used interchangeably.
[0164] The term "obesity" is defined as an individual's BMI being greater than or equal to 30 kg / m². 2 The condition is obesity. According to the WHO definition, obesity can be classified as follows: The term "Grade I obesity" is defined as a BMI greater than or equal to 30 kg / m². 2 But less than 35kg / m 2 The condition; the term "Grade II obesity" is defined as a BMI greater than or equal to 35 kg / m². 2 But less than 40kg / m 2 The condition; the term "Grade III obesity" is defined as a BMI greater than or equal to 40 kg / m². 2 The illness.
[0165] The term "visceral obesity" is defined as a condition in which a waist-to-hip ratio of 1.0 or higher is measured in men and 0.8 or higher in women. It is used to assess the risk of insulin resistance and the development of prediabetes.
[0166] The term "abdominal obesity" is generally defined as a waist circumference >40 inches or 102 cm for men and >35 inches or 94 cm for women. For Japanese ethnicity or Japanese patients, abdominal obesity can be defined as a waist circumference ≥85 cm for men and ≥90 cm for women (see, for example, the Investigating Committee for the Diagnosis of Metabolic Syndrome in Japan).
[0167] The term "normal blood glucose" is defined as an individual's fasting blood glucose concentration being within the normal range, specifically greater than 70 mg / dL (3.89 mmol / L) and less than 110 mg / dL (6.11 mmol / L) or 100 mg / dL (5.6 mmol / L). The term "fasting" has its general medical meaning.
[0168] The term "hyperglycemia" is defined as an individual's fasting blood glucose concentration being higher than the normal range, specifically greater than 110 mg / dL (6.11 mmol / L) or 100 mg / dL (5.6 mmol / L). The term "fasting" has the general meaning in medical terminology.
[0169] The term "hypoglycemia" is defined as an individual's blood glucose concentration being below the normal range of 60 to 115 mg / dL (3.3 to 6.3 mmol / L), especially below 70 mg / dL (3.89 mmol / L).
[0170] The term "postprandial hyperglycemia" is defined as a condition in which an individual's blood glucose or serum glucose concentration 2 hours after a meal is greater than 200 mg / dL (11.11 mmol / L).
[0171] The term "abnormal fasting glucose" or "IFG" is defined as an individual's fasting blood glucose concentration or fasting serum glucose concentration in the range of 100 to 125 mg / dL (i.e., 5.6 to 6.9 mmol / L), especially greater than 110 mg / dL and less than 126 mg / dL (7.00 mmol / L). "Normal fasting glucose" refers to an individual's fasting glucose concentration of less than 100 mg / dL, i.e., less than 5.6 mmol / L.
[0172] The term "impaired glucose tolerance" or "IGT" is defined as a condition in which an individual's 2-hour postprandial blood glucose or serum glucose concentration is greater than 140 mg / dL (7.78 mmol / L) but less than 200 mg / dL (11.11 mmol / L). Abnormal glucose tolerance (i.e., 2-hour postprandial blood glucose or serum glucose concentration) can be measured by the number of milligrams of glucose per deciliter of plasma two hours after a fasting intake of 75 g of glucose. "Normal glucose tolerance" is defined as a 2-hour postprandial blood glucose or serum glucose concentration less than 140 mg / dL (7.78 mmol / L).
[0173] The term “hyperinsulinemia” is defined as a condition in which fasting or postprandial serum or plasma insulin concentrations are higher than those in normal lean individuals without insulin resistance and with a waist-to-hip ratio of <1.0 (male) or <0.8 (female).
[0174] The terms “insulin sensitivity,” “improved insulin resistance,” or “reduced insulin resistance” are synonymous and can be used interchangeably.
[0175] The term "insulin resistance" is defined as a condition in which circulating insulin levels exceed the normal response to glucose stimulation to maintain normal blood glucose levels (Ford ES et al., JAMA. (2002) 287:356-9). Insulin resistance is assessed using the normocytic-hyperinsulinemic clamp test. The ratio of insulin to glucose is measured within a combined insulin-glucose infusion technique. Insulin resistance is considered to be present if glucose uptake is less than 25% of that in the background population (WHO definition). A much simpler method than the clamp test is the so-called minimal model, in which blood insulin and glucose concentrations are measured at fixed time intervals during an intravenous glucose tolerance test, and insulin resistance is calculated accordingly. This method cannot distinguish between hepatic and peripheral insulin resistance.
[0176] In addition, insulin resistance (i.e., the response of patients with insulin resistance to therapy), insulin sensitivity, and hyperinsulinemia can be quantitatively measured by assessing the Homeostasis Model Assessment of Insulin Resistance (HOMA-IR) score (a reliable indicator of insulin resistance) (Katsuki A et al., Diabetes Care 2001; 24:362-5). Methods for measuring insulin sensitivity using the HOMA index (Matthews et al., Diabetologia 1985, 28:412-19), methods for measuring the ratio of intact proinsulin to insulin (Forst et al., Diabetes 2003, 52(Supplement 1):A459), and normal glucose clamp studies have also been referenced. Furthermore, plasma adiponectin levels can be monitored as a possible alternative to insulin sensitivity. The Homeostasis Model Assessment of Insulin Resistance (HOMA)-IR score is used to estimate insulin resistance using the following formula (Galvin P et al., Diabet Med 1992; 9:921-8):
[0177] HOMA-IR = [Fasting serum insulin (μU / mL)] × [Fasting plasma glucose (mmol / L) / 22.5]
[0178] Insulin resistance is typically assessed using other parameters in daily clinical practice. Preferably, for example, the patient's triglyceride concentration is used, as increased triglyceride levels are significantly correlated with the presence of insulin resistance.
[0179] Patients with a predisposition to developing IGT, IFG, or type 2 diabetes are those with hyperinsulinemia defined as insulin resistance and who have normal blood glucose levels. Typical patients with insulin resistance are overweight or obese. If insulin resistance is detectable, it is a strong indicator of prediabetes. Therefore, to maintain glucose homeostasis, this individual may require 2-3 times the insulin of a healthy individual, otherwise, any clinical symptoms will result.
[0180] The methods for studying pancreatic β-cell function are similar to those described above for insulin sensitivity, hyperinsulinemia, or insulin resistance: improvements in β-cell function can be measured, for example, by measuring the HOMA index of β-cell function (Matthews et al., Diabetologia 1985, 28:412-19), the ratio of intact proinsulin to insulin (Forst et al., Diabetes 2003, 52(Supplement 1):A459), insulin / C-peptide secretion after oral glucose tolerance test or dietary tolerance test, or by using a hyperglycemic clamp study and / or establishing a minimal model after a frequently sampled intravenous glucose tolerance test (Stumvoll et al., Eur J Clin Invest 2001, 31:380-81).
[0181] The term "prediabetes" refers to a condition in which an individual is predisposed to developing type 2 diabetes. Prediabetes expands the definition of impaired glucose tolerance to include individuals with fasting blood glucose levels in the high-normal range (≥100 mg / dL) (JBMeigs et al., diabetes 2003; 52:1475-1484) and fasting hyperinsulinemia (high plasma insulin concentration). The American Diabetes Association and the National Institute of Diabetes and Digestive and Kidney Diseases, in their joint status report entitled "The Prevention or Delay of Type 2 Diabetes," outline the scientific and medical basis for identifying prediabetes as a serious health threat (Diabetes Care 2002; 25:742-749).
[0182] Individuals who may have insulin resistance are those who possess two or more of the following characteristics: 1) overweight or obesity, 2) hypertension, 3) hyperlipidemia, and 4) one or more first-degree relatives diagnosed with IGT, IFG, or type II diabetes. Insulin resistance in these individuals can be determined by calculating the HOMA-IR score. For the purposes of this invention, insulin resistance is defined as a clinical condition in which an individual has a HOMA-IR score >4.0 or a HOMA-IR score higher than the upper limit of normal as defined by laboratory glucose and insulin analysis.
[0183] The term "type 2 diabetes" is defined as a condition in which an individual's fasting blood glucose or serum glucose concentration is greater than 125 mg / dL (6.94 mmol / L). Blood glucose measurement is a standard procedure in routine medical analysis. In a glucose tolerance test, a diabetic patient's plasma glucose level will exceed 200 mg / dL (11.1 mmol / L) two hours after fasting 75 g of glucose. In a glucose tolerance test, 75 g of glucose is orally administered to the patient after a fasting period of 10–12 hours, and blood glucose levels are recorded before glucose ingestion and at 1 and 2 hours after ingestion. In healthy individuals, the pre-ingestion blood glucose level will be 60 to 110 mg / dL, the 1-hour post-ingestion level will be less than 200 mg / dL, and the 2-hour post-ingestion level will be less than 140 mg / dL. If the 2-hour post-ingestion level is 140 to 200 mg / dL, this is considered abnormal glucose tolerance.
[0184] The term “advanced type 2 diabetes” includes patients with type 2 diabetes who have failed secondary antidiabetic medications, are eligible for insulin therapy, and have progressed to microvascular and macrovascular complications (such as diabetic nephropathy or coronary heart disease (CHD)).
[0185] The term "HbA1c" refers to the product of non-enzymatic glycation of the B chain of hemoglobin. Its measurement is well-known to those skilled in the art. HbA1c levels are particularly important in monitoring diabetes treatment. Because HbA1c production is largely dependent on blood glucose levels and red blood cell lifespan, HbA1c reflects the average blood glucose levels over the previous 4–6 weeks in the sense of "glucose memory." Diabetic patients with consistently well-regulated HbA1c levels (i.e., less than 6.5% of the sample's total hemoglobin) through intensive diabetes treatment are significantly better protected against diabetic microvascular complications. For example, metformin alone achieves an average improvement of approximately 1.0–1.5% in HbA1c levels in diabetic patients. This reduction in HbA1c is insufficient to enable all diabetic patients to reach the desired target range of HbA1c <6.5%, preferably <6%.
[0186] Within the scope of this invention, the term "inadequate glycemic control" or "insufficient glycemic control" refers to a patient showing an HbA1c value higher than 6.5%, especially higher than 7.0%, or even higher than 7.5%, especially higher than 8%.
[0187] Metabolic syndrome, also known as syndrome X (in cases of metabolic disorders) or metabolic disorder syndrome, is characterized by insulin resistance (Laaksonen DE et al., Am J Epidemiol 2002; 156:1070-7). According to the ATP III / NCEP guidelines (Executive Summary of the Third Report of the National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel III) JAMA: Journal of the American Medical Association (2001) 285:2486-2497), metabolic syndrome is diagnosed when three or fewer of the following risk factors are present:
[0188] 1. Abdominal obesity, defined as waist circumference >40 inches or 102 cm for men and >35 inches or 94 cm for women; or, for Japanese ethnicity or Japanese patients, defined as waist circumference ≥85 cm for men and ≥90 cm for women;
[0189] 2. Triglycerides: ≥150 mg / dL
[0190] 3. Men with HDL-cholesterol <40mg / dL
[0191] 4. Blood pressure ≥130 / 85 mm Hg (SBP ≥130 or DBP ≥85)
[0192] 5. Fasting blood glucose ≥110mg / dL or ≥100mg / dL.
[0193] The NCEP definition has been validated (Laaksonen DE et al., Am J Epidemiol. (2002) 156:1070-7). Triglycerides and HDL cholesterol in the blood can also be determined by medical analysis and standard pharmaceutical analysis methods, such as those described in Thomas L (ed.): “Labor und Diagnose”, TH-Books Verlagsgesellschaft mbH, Frankfurt / Main, 2000.
[0194] According to the commonly used definition, hypertension is diagnosed when systolic blood pressure (SBP) exceeds 140 mmHg and diastolic blood pressure (DBP) exceeds 90 mmHg. If the patient has manifest diabetes, the current recommendation is to lower systolic blood pressure to below 130 mmHg and diastolic blood pressure to below 80 mmHg.
[0195] The definitions of NODAT (new onset diabetes after transplantation) and PTMS (post-transplant metabolic syndrome) closely follow the American Diabetes Association's diagnostic criteria for type 2 diabetes and the International Diabetes Federation (IDF) and American Heart Association / National Heart, Lung, and Blood Institute's definitions of metabolic syndrome. NODAT and / or PTMS are associated with an increased risk of microvascular and macrovascular disease and events, transplant rejection, infection, and death. Predictors of several potential risk factors associated with NODAT and / or PTMS have been identified, including higher age at transplantation, male sex, pre-transplant body mass index, pre-transplant diabetes, and immunosuppression.
[0196] The term "hyperuricemia" refers to a condition characterized by elevated levels of total urate in the blood serum. In human blood, the American Medical Association considers a uric acid concentration of 3.6 mg / dL (approximately 214 μmol / L) to be normal. High serum total urate levels, or hyperuricemia, are commonly associated with a variety of conditions. For example, high serum total urate levels can cause a type of arthritis called gout in the joints. Gout is a condition caused by high concentrations of total urate in the bloodstream, resulting in the formation of monosodium urate or uric acid crystals in the articular cartilage, tendons, and surrounding tissues of the joints. The formation of urate or uric acid in these tissues triggers an inflammatory response. When uric acid or urate crystals crystallize in the kidneys, the saturated level of uric acid in the urine can lead to the formation of kidney stones. Furthermore, high serum total urate levels are often associated with so-called metabolic syndromes, including cardiovascular disease and hypertension.
[0197] The term "DPP-4 inhibitor" as used within the scope of this invention refers to a compound that exhibits inhibitory activity against dipeptidyl peptidase IV (DPP-4). This inhibitory activity can be determined by IC50. 50 Value characterization. The IC50 value exhibited by DPP-4 inhibitors. 50 The value is preferably below 10000 nM, and more preferably below 1000 nM. Some DPP-4 inhibitors have shown IC50 values... 50 Values below 100 nM, or even ≤50 nM. IC50 of DPP-4 inhibitors.50 Values are generally greater than 0.01 nM, or even greater than 0.1 nM. DPP-4 inhibitors can include biological and non-biological compounds, especially non-peptide compounds. Inhibition of DPP-4 can be determined by methods known in the literature, especially those described in applications WO 02 / 068420 or WO 2004 / 018468 (page 34) (the entire contents of which are incorporated herein by reference). The term "DPP-4 inhibitor" also includes any pharmaceutically acceptable salt, hydrate, and solvate thereof, including their respective crystalline forms.
[0198] The term "treatment" or similar terms specifically encompass therapeutic treatment of patients who have developed the condition (especially the overt form). Therapeutic treatment can be symptomatic treatment to alleviate symptoms of a specific indication, or etiological treatment to reverse or partially reverse the condition of an indication, or to stop or slow disease progression. Therefore, the compositions and methods of the present invention can be used, for example, as therapeutic treatments for a period of time as well as long-term therapies.
[0199] The terms “preventive treatment,” “preventive therapy,” and “prevention,” or similar terms, are used interchangeably and include the treatment of patients at risk of developing the conditions described above, thereby reducing that risk. Attached Figure Description
[0200] Figure 1 The baseline HbA1c values of the entire patient population studied (full analysis set, FAS), the subgroups that underwent genetic analysis (full analysis set of pharmacogenetic analysis, FASG), and the subgroups defined by the SNP rs7903146 genotype (CC, CT, TT) in TCF7L2 of that subgroup.
[0201] Figure 2 The relationship between SNP rs7903146 in TCF7L2 and the response to liraristine.
[0202] Invention Details
[0203] In various aspects of the invention, particularly pharmaceutical compounds, compositions, combinations, methods, and uses, therein lies a DPP-4 inhibitor, a second and / or third antidiabetic drug as defined in the context.
[0204] In the first embodiment (Embodiment A), the DPP-4 inhibitor in the context of this invention is any one of the following DPP-4 inhibitors:
[0205] Formula (I)
[0206]
[0207] Or formula (II)
[0208]
[0209] Or formula (III)
[0210]
[0211] Or form (IV)
[0212]
[0213] Wherein R1 represents ([1,5]diazanaphth-2-yl)methyl, (quinazolin-2-yl)methyl, (quinoxalin-6-yl)methyl, (4-methyl-quinazolin-2-yl)methyl, 2-cyano-benzyl, (3-cyano-quinolin-2-yl)methyl, (3-cyano-pyridin-2-yl)methyl, (4-methyl-pyrimidin-2-yl)methyl or (4,6-dimethyl-pyrimidin-2-yl)methyl, and R2 represents 3-(R)-amino-piperidin-1-yl, (2-amino-2-methyl-propyl)-methylamino or (2-(S)-amino-propyl)-methylamino, or a pharmaceutically acceptable salt thereof.
[0214] In the second embodiment (Embodiment B), the DPP-4 inhibitor in the context of this invention is selected from the following DPP-4 inhibitors: sitagliptin, vildagliptin, saxagliptin, alogliptin, and gemigliptin.
[0215] (2S)-1-{[2-(5-methyl-2-phenyl- [[Azol-4-yl]-ethylamino]-acetyl}-pyrrolidine-2-carboxynitrile,
[0216] (2S)-1-{[1,1-dimethyl-3-(4-pyridin-3-yl-imidazol-1-yl)-propylamino]-acetyl}-pyrrolidine-2-carboxynitrile,
[0217] (S)-1-((2S,3S,11bS)-2-amino-9,10-dimethoxy-1,3,4,6,7,11b-hexahydro-2H-pyrido[2,1-a]isoquinoline-3-yl)-4-fluoromethyl-pyrrolidone,
[0218] (3,3-Difluoropyrrolidone-1-yl)-((2S,4S)-4-(4-(pyrimidin-2-yl)piperazin-1-yl)pyrrolidone-2-yl)methyl ketone,
[0219] (1((3S,4S)-4-amino-1-(4-(3,3-difluoropyrrolidin-1-yl)-1,3,5-triazin-2-yl)pyrrolidin-3-yl)-5,5-difluoropiperidin-2-one,
[0220] (2S,4S)-1-{2-[(3S,1R)-3-(1H-1,2,4-triazol-1-ylmethyl)cyclopentylamino]-acetyl}-4-fluoropyrrolidone-2-carboxynitrile,
[0221] (R)-2-[6-(3-amino-piperidin-1-yl)-3-methyl-2,4-dioxo-3,4-dihydro-2H-pyrimidin-1-ylmethyl]-4-fluorobenzylnitrile,
[0222] 5-{(S)-2-[2-((S)-2-cyano-pyrrolidine-1-yl)-2-oxo-ethylamino]-propyl}-5-(1H-tetrazol-5-yl)-10,11-dihydro-5H-dibenzo[a,d]cycloheptatrien-2,8-dicarboxylic acid bis-dicarboxamide,
[0223] 3-{(2S,4S)-4-[4-(3-methyl-1-phenyl-1H-pyrazol-5-yl)piperazin-1-yl]pyrrolidine-2-ylcarbonyl}thiazolidinyl
[0224] [(2R)-1-{[(3R)-pyrrolidine-3-ylamino]acetyl}pyrrolidine-2-yl]boronic acid,
[0225] (2S,4S)-1-[2-[(4-ethoxycarbonylbicyclo[2.2.2]oct-1-yl)amino]acetyl]-4-fluoropyrrolidone-2-carboxynitrile,
[0226] 2-({6-[(3R)-3-amino-3-methylpiperidin-1-yl]-1,3-dimethyl-2,4-dioxo-1,2,3,4-tetrahydro-5H-pyrrolo[3,2-d]pyrimidin-5-yl}methyl)-4-fluorobenzyl nitrile, and
[0227] 6-[(3R)-3-amino-piperidin-1-yl]-5-(2-chloro-5-fluoro-benzyl)-1,3-dimethyl-1,5-dihydro-pyrrolo[3,2-d]pyrimidine-2,4-dione, and
[0228] (S)-2-methylpyrazolo[1,5-a]pyrimidine-6-carboxylic acid {2-[(2-cyanopyrrolidone-1-yl)-2-oxoethylamino]-2-methylpropyl}amide
[0229] Or its pharmaceutically acceptable salt.
[0230] Regarding the first embodiment (Embodiment A), the preferred DPP-4 inhibitor is any one or all of the following compounds and their pharmaceutically acceptable salts:
[0231] ·1-[(4-methyl-quinazolin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-(3-(R)-amino-piperidin-1-yl)-xanthine (refer to WO 2004 / 018468, Example 2(142)):
[0232]
[0233] ·1-[([1,5]diazanaphth-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-((R)-3-amino-piperidin-1-yl)-xanthine (refer to WO 2004 / 018468, Example 2(252)):
[0234]
[0235] ·1-[(quinazolin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-((R)-3-amino-piperidin-1-yl)-xanthine (refer to WO 2004 / 018468, Example 2(80)):
[0236]
[0237] ·2-((R)-3-amino-piperidin-1-yl)-3-(but-2-ynyl)-5-(4-methyl-quinazolin-2-ylmethyl)-3,5-dihydro-imidazo[4,5-d]pyridazin-4-one (refer to WO 2004 / 050658, Example 136):
[0238]
[0239] ·1-[(4-methyl-quinazolin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-[(2-amino-2-methyl-propyl)-methylamino]-xanthine (refer to WO 2006 / 029769, Example 2(1)):
[0240]
[0241] ·1-[(3-cyano-quinoline-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-((R)-3-amino-piperidin-1-yl)-xanthine (refer to WO 2005 / 085246, Example 1(30)):
[0242]
[0243] ·1-(2-cyanobenzyl)-3-methyl-7-(2-butyn-1-yl)-8-((R)-3-amino-piperidin-1-yl)-xanthine (refer to WO 2005 / 085246, Example 1(39)):
[0244]
[0245] ·1-[(4-methyl-quinazolin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-[(S)-(2-amino-propyl)-methylamino]-xanthine (refer to WO 2006 / 029769, Example 2(4)):
[0246]
[0247] ·1-[(3-cyano-pyridin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-((R)-3-amino-piperidin-1-yl)-xanthine (refer to WO 2005 / 085246, Example 1(52)):
[0248]
[0249] ·1-[(4-methylpyrimidin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-((R)-3-amino-piperidin-1-yl)-xanthine (refer to WO 2005 / 085246, Example 1(81)):
[0250]
[0251] ·1-[(4,6-dimethyl-pyrimidin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-((R)-3-amino-piperidin-1-yl)-xanthine (refer to WO 2005 / 085246, Example 1(82)):
[0252]
[0253] ·1-[(quinoxalo-6-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-((R)-3-amino-piperidin-1-yl)-xanthine (refer to WO 2005 / 085246, Example 1(83)):
[0254]
[0255] In the DPP-4 inhibitor described in Embodiment A of the present invention, a more preferred DPP-4 inhibitor is 1-[(4-methyl-quinazolin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-(3-(R)-amino-piperidin-1-yl)-xanthine, especially its free base (also known as liraristine or BI 1356).
[0256] The following compounds can be mentioned as other DPP-4 inhibitors:
[0257] - Sitagliptin (MK-0431) has the following structural formula A, which is (3R)-3-amino-1-[3-(trifluoromethyl)-5,6,7,8-tetrahydro-5H-[1,2,4]triazolo[4,3-a]pyrazin-7-yl]-4-(2,4,5-trifluorophenyl)but-1-one, also known as (2R)-4-oxo-4-[3-(trifluoromethyl)-5,6-dihydro[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl]-1-(2,4,5-trifluorophenyl)but-2-amine.
[0258]
[0259] In one embodiment, sitagliptin is in the form of its dihydrogen phosphate salt, namely sitagliptin phosphate. In another embodiment, sitagliptin phosphate is in the form of crystalline anhydrous or monohydrate. One such embodiment is sitagliptin phosphate monohydrate. The free base of sitagliptin and its pharmaceutically acceptable salts are disclosed in U.S. Patent 6,699,871 and in Example 7 of WO 03 / 004498. Crystalline sitagliptin phosphate monohydrate is disclosed in WO 2005 / 003135 and WO 2007 / 050485.
[0260] Therefore, for example, details regarding the preparation, formulation, or use of the compound or its salts can be found in these documents.
[0261] Sitagliptin tablets can be marketed under various brand names. Purchased. Tablet formulations of sitagliptin / metformin combination are available under the brand name... Purchased.
[0262] -Vildagliptin (LAF-237) has the following structural formula B, which is (2S)-{[(3-hydroxy-adamantane-1-yl)amino]acetyl}pyrrolidine-2-carboxynitrile, also known as (S)-1-[(3-hydroxy-1-adamantane)amino]acetyl-2-cyano-pyrrolidine.
[0263]
[0264] Vildagliptin is specifically disclosed in U.S. Patent 6,166,063 and in Example 1 of WO 00 / 34241. Specific salts of vildagliptin are disclosed in WO 2007 / 019255. Crystalline forms of vildagliptin and vildagliptin tablet formulations are disclosed in WO 2006 / 078593. Vildagliptin can be formulated as described in WO 00 / 34241 or WO 2005 / 067976. Modified release vildagliptin formulations are disclosed in WO 2006 / 135723.
[0265] Therefore, for example, details regarding the preparation, formulation, or use of the compound or its salts can be found in these documents.
[0266] Vildagliptin tablets can be marketed under various brand names. Purchased. Vildagliptin / metformin combination tablet formulation, available under the brand name... Purchased.
[0267] - Saxagliptin (BMS-477118) has the following structural formula C, which is (1S,3S,5S)-2-{(2S)-2-amino-2-(3-hydroxyadamantane-1-yl)acetyl}-2-azabicyclo[3.1.0]hexane-3-carboxylonitrile, also known as (S)-3-hydroxyadamantane-glycine-L-cis-4,5-methylenepyrrolidine-2-carboxylonitrile.
[0268]
[0269] Saxagliptin is specifically disclosed in Example 60 of U.S. Patent 6,395,767 and WO 01 / 68603.
[0270] In one embodiment, saxagliptin is in the form of its HCl salt or its monobenzoate salt, as disclosed in WO 2004 / 052850. In another embodiment, saxagliptin is in the form of a free base. In yet another embodiment, saxagliptin is in the form of a monohydrate of the free base, as disclosed in WO 2004 / 052850. The crystalline forms of the HCl salt and the free base of saxagliptin are disclosed in WO 2008 / 131149. Methods for preparing saxagliptin are also disclosed in WO 2005 / 106011 and WO 2005 / 115982. Saxagliptin can be formulated in tablet form, as described in WO 2005 / 117841.
[0271] Therefore, for example, details regarding the preparation, formulation, or use of the compound or its salts can be found in these documents.
[0272] -Alogliptin (SYR-322) has the following structural formula E, which is 2-({6-[(3R)-3-aminopiperidin-1-yl]-3-methyl-2,4-dioxo-3,4-dihydro-2H-pyrimidin-1-yl}methyl)benzylnitrile
[0273]
[0274] Alogliptin is specifically disclosed in US 2005 / 261271, EP 1586571 and WO 2005 / 095381.
[0275] In one embodiment, alogliptin is in the form of its benzoate, its hydrochloride, or its toluenesulfonate, each as disclosed in WO 2007 / 035629. One such embodiment is alogliptin benzoate. Polymorphs of alogliptin benzoate are disclosed in WO 2007 / 035372. Methods for preparing alogliptin are disclosed in WO 2007 / 112368 and particularly in WO 2007 / 035629. Alogliptin (i.e., its benzoate) can be formulated and administered in tablet form as described in WO 2007 / 033266. Solid dosage forms of alogliptin / pioglitazone, their preparation, and uses are disclosed in WO 2008 / 093882. Solid dosage forms of alogliptin / metformin, their preparation, and uses are disclosed in WO 2009 / 011451.
[0276] Therefore, for example, details regarding the preparation, formulation, or use of the compound or its salts can be found in these documents.
[0277] -(2S)-1-{[2-(5-methyl-2-phenyl- [[4-yl]-ethylamino]-acetyl]-pyrrolidine-2-carboxynitrile or a pharmaceutically acceptable salt thereof, preferably a methanesulfonate, or
[0278] (2S)-1-{[1,1-dimethyl-3-(4-pyridin-3-yl-imidazol-1-yl)propylamino]acetyl}-pyrrolidine-2-carboxynitrile or a pharmaceutically acceptable salt thereof:
[0279] These compounds and their preparation methods are disclosed in WO 03 / 037327.
[0280] The mesylate salt of the former compound and its crystalline polymorph are disclosed in WO 2006 / 100181. The fumarate salt of the latter compound and its crystalline polymorph are disclosed in WO 2007 / 071576. These compounds can be formulated as pharmaceutical compositions, as described in WO 2007 / 017423.
[0281] Therefore, for details, such as on the preparation, formulation, or use of these compounds or their salts, please refer to these documents.
[0282] -(S)-1-((2S,3S,11bS)-2-amino-9,10-dimethoxy-1,3,4,6,7,11b-hexahydro-2H-pyrido[2,1-a]isoquinolin-3-yl)-4-fluoromethyl-pyrrolidone-2-one (also known as carmegliptin) or a pharmaceutically acceptable salt thereof:
[0283]
[0284] The compound and its preparation method are disclosed in WO 2005 / 000848. Methods for preparing this compound (especially its dihydrochloride salt) are also disclosed in WO 2008 / 031749, WO 2008 / 031750 and WO 2008 / 055814. This compound can be formulated as a pharmaceutical composition, as described in WO 2007 / 017423.
[0285] Therefore, for example, details regarding the preparation, formulation, or use of the compound or its salts can be found in these documents.
[0286] -(3,3-difluoropyrrolidone-1-yl)-((2S,4S)-4-(4-(pyrimidin-2-yl)piperazin-1-yl)pyrrolidone-2-yl)methyl ketone (also known as gosogliptin) or a pharmaceutically acceptable salt thereof:
[0287] The compound and its preparation method are disclosed in WO 2005 / 116014 and US 7291618.
[0288] Therefore, for example, details regarding the preparation, formulation, or use of the compound or its salts can be found in these documents.
[0289] -(1((3S,4S)-4-amino-1-(4-(3,3-difluoropyrrolidin-1-yl)-1,3,5-triazin-2-yl)pyrrolidin-3-yl)-5,5-difluoropiperidin-2-one or a pharmaceutically acceptable salt thereof:
[0290]
[0291] The compound and its preparation method are disclosed in WO 2007 / 148185 and US 20070299076. Therefore, for example, details regarding the preparation, formulation, or use of the compound or its salts can be found in these documents.
[0292] -(2S,4S)-1-{2-[(3S,1R)-3-(1H-1,2,4-triazol-1-ylmethyl)cyclopentylamino]-acetyl}-4-fluoropyrrolidine-2-carboxynitrile (also known as melogliptin) or a pharmaceutically acceptable salt thereof:
[0293]
[0294] The compound and its preparation method are disclosed in WO 2006 / 040625 and WO 2008 / 001195. Specifically claimed salts include methanesulfonates and p-toluenesulfonates. Therefore, details regarding the preparation, formulation, or use of the compound or its salts can be found in these documents.
[0295] -(R)-2-[6-(3-amino-piperidin-1-yl)-3-methyl-2,4-dioxo-3,4-dihydro-2H-pyrimidin-1-ylmethyl]-4-fluorobenzyl nitrile or a pharmaceutically acceptable salt thereof:
[0296]
[0297] The compound, its preparation methods, and uses are disclosed in WO 2005 / 095381, US 2007060530, WO 2007 / 033350, WO 2007 / 035629, WO 2007 / 074884, WO 2007 / 112368, WO 2008 / 033851, WO 2008 / 114800, and WO 2008 / 114807. Specifically claimed salts include succinate (WO 2008 / 067465), benzoate, benzenesulfonate, p-toluenesulfonate, (R)-mandelate, and hydrochloride. Therefore, details regarding the preparation, formulation, or use of the compound or its salts can be found in these documents.
[0298] -5-{(S)-2-[2-((S)-2-cyanopyrrolidin-1-yl)-2-oxo-ethylamino]-propyl}-5-(1H-tetrazol-5-yl)-10,11-dihydro-5H-dibenzo[a,d]cycloheptatrien-2,8-dicarboxylic acid bis-dicarboxamide or a pharmaceutically acceptable salt thereof:
[0299]
[0300] The compound and its preparation method are disclosed in WO 2006 / 116157 and US 2006 / 270701. Therefore, for example, details regarding the preparation, formulation, or use of the compound or its salts can be found in these documents.
[0301] -3-{(2S,4S)-4-[4-(3-methyl-1-phenyl-1H-pyrazol-5-yl)piperazin-1-yl]pyrrolidine-2-ylcarbonyl}thiazolidin (also known as tenegliptin) or a pharmaceutically acceptable salt thereof:
[0302] The compound and its preparation method are disclosed in WO 02 / 14271. Specific salts are disclosed in WO 2006 / 088129 and WO 2006 / 118127 (particularly including hydrochloride and hydrobromide). Combination therapies using this compound are disclosed in WO2006 / 129785. Therefore, details regarding the preparation, formulation, or use of the compound or its salts can be found in these documents.
[0303] -[(2R)-1-{[(3R)-pyrrolidine-3-ylamino]acetyl}pyrrolidine-2-yl]boronic acid (also known as dutogliptin) or a pharmaceutically acceptable salt thereof:
[0304] The compound and its preparation methods are disclosed in WO 2005 / 047297, WO 2008 / 109681, and WO 2009 / 009751. Specific salts are disclosed in WO 2008 / 027273 (including citrate and tartrate). Formulations of the compound are disclosed in WO 2008 / 144730. Formulations of dugliptin (as a tartrate) with metformin are disclosed in WO 2009 / 091663. Therefore, details regarding the preparation, formulation, or use of the compound or its salts can be found in these documents.
[0305] -(2S,4S)-1-[2-[(4-ethoxycarbonylbicyclo[2.2.2]oct-1-yl)amino]acetyl]-4-fluoropyrrolidine-2-carboxynitrile or a pharmaceutically acceptable salt thereof:
[0306] The compound and its preparation method are disclosed in WO 2005 / 075421, US 2008 / 146818 and WO 2008 / 114857. Therefore, for example, details regarding the preparation, formulation or use of the compound or its salts can be found in these documents.
[0307] -2-({6-[(3R)-3-amino-3-methylpiperidin-1-yl]-1,3-dimethyl-2,4-dioxo-1,2,3,4-tetrahydro-5H-pyrrolo[3,2-d]pyrimidin-5-yl}methyl)-4-fluorobenzyl nitrile or a pharmaceutically acceptable salt thereof, or 6-[(3R)-3-amino-piperidin-1-yl]-5-(2-chloro-5-fluoro-benzyl)-1,3-dimethyl-1,5-dihydro-pyrrolo[3,2-d]pyrimidin-2,4-dione or a pharmaceutically acceptable salt thereof:
[0308] These compounds and their preparation methods are disclosed in WO 2009 / 084497 and WO 2006 / 068163, respectively. Combination therapies using the latter compounds are disclosed in WO 2009 / 128360. Therefore, details regarding the preparation, formulation, or use of these compounds or their salts can be found in these documents, for example.
[0309] -(S)-2-methylpyrrolo[1,5-a]pyrimidine-6-carboxylic acid {2-[(2-cyanopyrrolidin-1-yl)-2-oxoethylamino]-2-methylpropyl}amide (also known as anagliptin) or a pharmaceutically acceptable salt thereof:
[0310] The compound and its preparation method are disclosed in WO 2004 / 067509. Combination therapies using the compound are disclosed in WO 2009 / 139362. Therefore, details regarding the preparation, formulation, or use of these compounds or their salts can be found in these documents, for example.
[0311] Preferably, the DPP-4 inhibitor is selected from group G2, which consists of liraliptin, sitagliptin, vildagliptin, alogliptin, saxagliptin, carmegliptin, gosegliptin, terliliptin, megliptin, and dugliptin, or a pharmaceutically acceptable salt of one of the above DPP-4 inhibitors, or a prodrug thereof.
[0312] More preferred DPP-4 inhibitors are selected from group G2, which consist of liraliptin, sitagliptin, vildagliptin, alogliptin, saxagliptin, terliliptin, and dugliptin, or a pharmaceutically acceptable salt of one of the above DPP-4 inhibitors, or a prodrug thereof.
[0313] The DPP-4 inhibitor particularly preferred by this invention is liraristine. As used herein, the term "liraristine" refers to liraristine and its pharmaceutically acceptable salts, including its hydrates and solvates, and its crystalline forms. Crystalline forms are described in WO 2007 / 128721. Methods for preparing liraristine are described, for example, in patent applications WO 2004 / 018468 and WO2006 / 048427. Liraristine differs from structurally equivalent DPP-4 inhibitors because, in monotherapy and / or when used in combination with the second and optionally third antidiabetic agents of this invention, it combines exceptional potency and long-lasting effects with favorable pharmacological properties, receptor selectivity, and favorable side effect properties, or produces unexpected therapeutic advantages or improvements.
[0314] To avoid any doubt, the published content of the aforementioned literature related to specific DPP-4 inhibitors cited above is incorporated herein by reference in its entirety.
[0315] In one aspect of the invention, the pharmaceutical compositions, methods and uses of the invention relate to those compositions comprising a DPP-4 inhibitor as a single active ingredient (i.e., without the presence of a second and a third antidiabetic drug), and / or to monotherapy using a DPP-4 inhibitor alone.
[0316] In another aspect of the invention, the pharmaceutical compositions, combinations, methods and uses of the invention relate to those compositions or combinations comprising a DPP-4 inhibitor and a second antidiabetic drug as a single active ingredient (i.e., without a third antidiabetic drug), and / or to dual combination therapy using a DPP-4 inhibitor and a second antidiabetic drug.
[0317] In another aspect of the invention, the pharmaceutical compositions, combinations, methods and uses of the invention relate to compositions or combinations comprising a DPP-4 inhibitor, a second and a third antidiabetic drug, and / or to triple combination therapy using a DPP-4 inhibitor, a second and a third antidiabetic drug.
[0318] Furthermore, the DPP-4 inhibitor of the present invention is further characterized in that: the DPP-4 inhibitor does not significantly impair the function of the glomeruli and / or renal tubules in type II diabetic patients with chronic renal insufficiency (e.g., mild, moderate or severe renal impairment or end-stage renal disease), and / or the DPP-4 inhibitor does not require dose adjustment in type II diabetic patients with renal impairment (e.g., mild, moderate or severe renal impairment or end-stage renal disease).
[0319] The second and (if present) third antidiabetic drugs are selected from group G3, comprising biguanide, thiazolidinedione, sulfonylurea, linenide, α-glucosidase inhibitor, GLP-1 or a GLP-1 analog and insulin or an insulin analog, or pharmaceutically acceptable salts thereof. Preferred embodiments of the second and / or third antidiabetic drugs are disclosed below.
[0320] Group G3 includes biguanides. Examples of biguanides are metformin, phenformin, and buprofen. Metformin is the preferred biguanide. Combining DPP-4 inhibitors with biguanides, especially metformin, can provide more effective glycemic control and / or can act with biguanides to (e.g.) reduce weight, and has, for example, an overall beneficial effect on metabolic syndrome commonly associated with type 2 diabetes.
[0321] As used herein, the term "metformin" refers to metformin or a pharmaceutically acceptable salt thereof, such as hydrochloride, metformin (2:1) fumarate, and metformin (2:1) succinate, hydrobromide, p-chlorophenoxyacetate, or embonate, and other known mono- or dicarboxylic acid salts of metformin. Metformin hydrochloride is preferred as used herein.
[0322] Group G3 includes thiazolidinediones. Examples of thiazolidinediones (TZDs) are pioglitazone and rosiglitazone. TZD therapy is associated with weight gain and fat redistribution. Furthermore, TZDs cause fluid retention and are contraindicated in patients with congestive heart failure. Long-term TZD treatment is also associated with an increased risk of fractures. Combining DPP-4 inhibitors with thiazolidinediones (especially pioglitazone) can provide more effective glycemic control and / or minimize the side effects of TZD therapy.
[0323] As used herein, the term "pioglitazone" refers to pioglitazone, including its enantiomers, mixtures thereof and racemic mixtures thereof, or pharmaceutically acceptable salts thereof, such as hydrochloride.
[0324] As used herein, the term "rosiglitazone" refers to rosiglitazone, including its enantiomers, mixtures thereof and racemic mixtures thereof, or pharmaceutically acceptable salts thereof, such as maleate salts.
[0325] Group G3 contains sulfonylureas. Examples of sulfonylureas include glibenclamide, tolbutamide, glimepiride, glipizide, glibenclamide, glibenclamide, gliclazide, and gliclazide. Preferred sulfonylureas are tolbutamide, glibenclamide, glibenclamide, and glimepiride, especially glibenclamide and glimepiride. Because the effectiveness of sulfonylureas is depleted over treatment, the combination of a DPP-4 inhibitor with a sulfonylurea can provide additional benefits to patients for better glycemic control. Furthermore, sulfonylurea treatment typically results in gradual weight gain over treatment, and DPP-4 inhibitors can minimize this side effect of sulfonylurea treatment and / or improve metabolic syndrome. Moreover, the combination of a DPP-4 inhibitor with a sulfonylurea can minimize hyperglycemia, another undesirable side effect of sulfonylureas. Sulfonylureas can also cause mild hypoglycemia, and this combination also allows for a reduction in the dosage of sulfonylureas.
[0326] As used in this article, the terms “glibenclamide,” “glimepiride,” “gliquidone,” “glibenclamide,” “gliclazide,” “gliclazide,” “glipide,” “tolbutamide,” and “glipizide” refer to the respective active pharmaceutical ingredient or its pharmaceutically acceptable salt.
[0327] Group G3 includes linene. Examples of linene include nateglinide, repaglinide, and miglitolide. Because its effectiveness diminishes with treatment, the combination of a DPP-4 inhibitor and meglitolide can provide additional benefits to patients in terms of better glycemic control. Furthermore, meglitol treatment typically results in gradual weight gain with treatment, and DPP-4 inhibitors can minimize this side effect of meglitol treatment and / or improve metabolic syndrome. Moreover, the combination of a DPP-4 inhibitor and meglitol minimizes hyperglycemia, another undesirable side effect of meglitol. Meglitol can also cause mild hypoglycemia, and this combination also allows for a reduction in the meglitol dosage.
[0328] As used herein, the term “nateglinide” refers to nateglinide, including its enantiomers, mixtures thereof and racemic mixtures thereof, or pharmaceutically acceptable salts and esters thereof.
[0329] As used herein, the term “repaglinide” refers to repaglinide, including its enantiomers, mixtures thereof and racemic mixtures thereof, or pharmaceutically acceptable salts and esters thereof.
[0330] Group G3 contains alpha-glucosidase inhibitors. Examples of alpha-glucosidase inhibitors are acarbose, voglibose, and miglitol. The additional benefits of combining a DPP-4 inhibitor with an alpha-glucosidase inhibitor may be associated with, for example, more effective glycemic control at lower doses of the individual drugs, and / or with reduced unwanted gastrointestinal side effects of the alpha-glucosidase inhibitor.
[0331] As used in this article, the terms “acarbose,” “voglibose,” and “miglitol” refer to the respective active pharmaceutical ingredient or its pharmaceutically acceptable salt.
[0332] Group G3 contains inhibitors of GLP-1 analogs. Examples of GLP-1 analogs include exenatide, liraglutide, taspoglutide, semaglutide, albiglutide, and lixisenatide. Combinations of DPP-4 inhibitors and GLP-1 analogs can achieve good glycemic control at, for example, lower doses of the individual drugs. Furthermore, the weight-reducing ability of GLP-1 analogs can synergistically work positively with the properties of DPP-4 inhibitors. On another front, combining low-dose GLP-1 analogs with DPP-4 inhibitors can reduce side effects (e.g., nausea, gastrointestinal side effects such as vomiting).
[0333] As used in this article, the terms “exenatide,” “liraglutide,” “tasglutide,” “semarglutide,” “albiglutide,” and “liximatide” refer to the respective active pharmaceutical ingredient or its pharmaceutically acceptable salt.
[0334] In one embodiment (Embodiment E1), the pharmaceutical compositions, combinations, methods and uses of the present invention relate to a combination of a DPP-4 inhibitor and a second antidiabetic drug, preferably selected from those combinations in Table 1.
[0335] Table 1
[0336]
[0337]
[0338]
[0339]
[0340]
[0341]
[0342]
[0343] In a specific embodiment (Embodiment E2), the pharmaceutical compositions, combinations, methods, and uses of the present invention relate to those combinations in which the DPP-4 inhibitor is liraristine. According to Embodiment E2, the second antidiabetic drug is preferably selected from Table 2.
[0344] Table 2
[0345]
[0346]
[0347] Compared to monotherapy using a DPP-4 inhibitor or a second or third antidiabetic drug (e.g., metformin monotherapy) or dual therapy using a second and third antidiabetic drug, combinations of DPP-4 inhibitors with a second and optionally a third antidiabetic drug improve glycemic control, particularly in the patients described herein. Furthermore, compared to combination therapy using a DPP-4 inhibitor and one or more of a second or third antidiabetic drugs, or a combination therapy using a second and third antidiabetic drug, triple combinations of the DPP-4 inhibitor and the second and third antidiabetic drugs of the present invention improve glycemic control, particularly in the patients described herein. Improved glycemic control is defined as an increase in the reduction of blood glucose and an increase in the reduction of HbA1c. For monotherapy in patients (particularly those described herein), administering a drug above a specific maximum dose does not further significantly improve glycemic control. Moreover, given the potential side effects, prolonged use of the maximum dose may not be desirable. Therefore, monotherapy using a DPP-4 inhibitor or one of a second or third antidiabetic drug does not achieve satisfactory glycemic control in all patients. Dual therapy may be necessary when complete glycemic control cannot be achieved with monotherapy. Even combination therapy using only two drugs selected from DPP-4 inhibitors and second and third antidiabetic drugs cannot produce complete glycemic control and / or long-term complete glycemic control in all patients. Triple therapy may be necessary when dual therapy fails to achieve complete glycemic control. In these patients with inadequate glycemic control, diabetes may continue to progress and diabetes-related complications, such as macrovascular complications, may occur. Compared to monotherapy or dual therapy using one or two combination partners, the pharmaceutical compositions or combinations of the present invention and the methods of the present invention reduce HbA1c levels to the desired target range, e.g., <7%, and preferably <6.5%, in more patients, and provide a longer duration of therapeutic treatment, e.g., in the case of dual or triple combination therapy.
[0348] Furthermore, the combination of the DPP-4 inhibitor and the second, and optionally the third, therapeutic agent of the present invention allows for a reduction in the dosage of the DPP-4 inhibitor, or the second or third antidiabetic drug, or even two or three active ingredients. This dosage reduction is beneficial to patients who may otherwise suffer from the side effects of therapy using higher doses of one or more active ingredients, particularly those caused by the second and / or third antidiabetic drug. Therefore, the pharmaceutical combinations and methods of the present invention exhibit fewer side effects, thus making the therapy more tolerable and improving patient compliance.
[0349] The DPP-4 inhibitors of the present invention can reduce glucagon secretion in patients (by increasing the level of active GLP-1). Therefore, this will limit hepatic glucose production. Furthermore, the increased activity of GLP-1 produced by the DPP-4 inhibitors will have a beneficial effect on β-cell regeneration and regeneration. All these characteristics of the DPP-4 inhibitors make the pharmaceutical compositions, combinations, or methods of the present invention highly useful and therapeutically relevant.
[0350] When this invention refers to patients requiring treatment or prevention, it primarily refers to treatment and prevention in humans, but the pharmaceutical compositions can also be used accordingly in veterinary medicine for mammals. Within the scope of this invention, adult patients are preferably persons aged 18 years or older. Also within the scope of this invention, patients are adolescents, i.e., persons aged 10 to under 18 years, preferably 13 to under 18 years.
[0351] In one implementation, patients who require the treatment or prevention described herein can be identified by determining whether they have variants (e.g., polymorphisms) in one or more genes associated with metabolic diseases and / or whether they have variants (e.g., polymorphisms) in one or more genes selected from TCF7L2, KCNJ11, PPARG, and GLP1R, and in particular whether they have the TCF7L2 risk genotype described herein.
[0352] In another implementation, patients who require the treatment or prevention described herein can determine whether they have their respective wild-type genotypes, and in particular whether they have the TCF7L2 wild-type genotype described herein.
[0353] The specific subgroup of patients requiring the treatment or prevention described herein refers to those who have one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, particularly those selected from rs7903146, rs12255372, and rs10885406, especially the SNP rs7903146, and more specifically, those who carry at least one T allele SNP rs7903146 of TCF7L2, i.e., the CT genotype or TT genotype.
[0354] Another specific subgroup of patients who require the treatment or prevention described in this article refers to those who carry the wild-type TCF7L2rs7903146CC.
[0355] Therefore, in one aspect of the invention, the treatment or prevention of the invention is suitable for patients who require such treatment or prevention, said patients being diagnosed with variants (e.g., polymorphisms) in one or more genes associated with metabolic diseases and / or variants (e.g., SNPs) in one or more genes selected from TCF7L2, KCNJ11, PPARG and GLP1R, particularly having the TCF7L2 risk genotype described herein.
[0356] In another aspect of the invention, the treatment or prevention of the invention is particularly suitable for those patients who require such treatment or prevention and who are diagnosed with the TCF7L2 wild-type genotype described herein.
[0357] In a relevant minor aspect of the invention, the treatment or prevention of the invention is suitable for patients who require such treatment or prevention, said patients being diagnosed with one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, such as at least one SNP selected from rs7903146, rs12255372 and rs10885406, for example, the SNP of rs7903146, specifically, carrying at least one T allele of rs7903146 (i.e., CT or TT genotype), wherein, more specifically, carrying one T allele of rs7903146 (i.e., CT risk genotype) or, secondly, carrying two T alleles of rs7903146 (i.e., TT high-risk genotype).
[0358] In another minor aspect of the invention, the treatment or prevention of the invention is particularly beneficial to patients who are diagnosed as carrying two wild-type TCF7L2 rs7903146 C alleles (i.e., CC genotype).
[0359] In one embodiment of the invention, the treatment or prevention of the invention is suitable for patients who require such treatment or prevention and are diagnosed with one or more conditions selected from the following: overweight and obesity, especially grade I obesity, grade II obesity, grade III obesity, visceral obesity, and abdominal obesity. Furthermore, the treatment or prevention of the invention is advantageously suitable for patients for whom weight gain is contraindicated. For example, any weight-gain effect of the therapy may be diminished or even eliminated due to administration of a second and / or third antidiabetic drug.
[0360] In another embodiment of the invention, the pharmaceutical compositions or combinations of the invention exhibit excellent glycemic control efficacy, particularly in reducing fasting plasma glucose, postprandial plasma glucose, and / or glycosylated hemoglobin (HbA1c). By administering the pharmaceutical compositions or combinations of the invention, an HbA1c reduction of greater than or equal to, preferably 1.0%, more preferably greater than or equal to, 2.0%, and even more preferably greater than or equal to, 3.0%, with the reduction particularly occurring in the range of 1.0% to 3.0%.
[0361] Furthermore, the methods and / or uses of the present invention can be used for patients exhibiting one, two, or more of the following conditions:
[0362] (a) Fasting blood glucose or serum glucose concentration greater than 110 mg / dL or greater than 100 mg / dL, especially greater than 125 mg / dL;
[0363] (b) Postprandial plasma glucose is greater than or equal to 140 mg / dL;
[0364] (c) HbA1c value greater than or equal to 6.5%, especially greater than or equal to 7.0%, especially greater than or equal to 7.5%, and even more especially greater than or equal to 8.0%.
[0365] This invention also discloses the use of pharmaceutical compositions or combinations for improving glycemic control in patients with type 2 diabetes or exhibiting the first signs of prediabetes. Therefore, this invention also includes diabetes prevention. Thus, if the pharmaceutical compositions or combinations of this invention are used immediately after the onset of any of the aforementioned prediabetes symptoms to improve glycemic control, the onset of overt type 2 diabetes can be delayed or prevented.
[0366] Furthermore, the pharmaceutical compositions or combinations of the present invention are particularly suitable for treating patients with insulin dependence, i.e., patients who are being or will be treated with insulin or insulin derivatives or insulin substitutes or preparations containing insulin or its derivatives or substitutes, or who require such treatment. These patients include patients with type II diabetes and patients with type I diabetes.
[0367] Therefore, according to one embodiment of the invention, a method is provided to improve glycemic control and / or reduce fasting plasma glucose, postprandial plasma glucose and / or glycosylated hemoglobin HbA1c in patients diagnosed with impaired glucose tolerance (IGT), abnormal fasting glucose (IFG), insulin resistance, metabolic syndrome and / or type II or type I diabetes, characterized in that a context-defined DPP-4 inhibitor and optionally a second and optionally a third antidiabetic drug are administered to the patient, for example, in combination.
[0368] According to another embodiment of the present invention, a method is provided to improve glycemic control in patients with type 2 diabetes, particularly adults, as an adjunct to diet and exercise.
[0369] Furthermore, in specific embodiments of the present invention, the treatment or prevention methods and / or uses of the present invention are suitable for patients who have variations (e.g., polymorphisms) in one or more genes related to metabolic diseases and / or patients who have variations (e.g., polymorphisms) in one or more genes selected from TCF7L2, KCNJ11, PPARG, and GLP1R.
[0370] In this context, the patient subgroup referred to refers to patients with TCF7L2 risk genotypes, such as those who possess one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, particularly at least one SNP selected from rs7903146, rs12255372, and rs10885406, especially rs7903146. More specifically, patients carrying at least one T allele SNP rs7903146 of TCF7L2, i.e., the CT or TT genotype, especially those carrying two T allele SNPs rs7903146 of TCF7L2, i.e., the TT genotype, are more susceptible to elevated TCF7L2 expression in pancreatic β cells, abnormal insulin secretion, incretin action, accelerated hepatic glucose production, and / or diabetes. The T allele of rs7903146TCF7L2 is associated with abnormal insulinotropic effects of intestinal glucagon, reduced 24-hour plasma insulin and glucagon levels, and increased hepatic glucose production.
[0371] Therefore, the present invention also includes the compounds, pharmaceutical compositions, or combinations thereof for treating and / or preventing the diseases, disorders, or conditions mentioned herein in patients who: have one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, particularly at least one SNP selected from rs7903146, rs12255372, and rs10885406, especially rs7903146; more specifically, patients carrying at least one T allele SNP rs7903146 of TCF7L2, i.e., those with the CT or TT genotypes, especially those carrying one T allele SNP rs7903146 of TCF7L2, i.e., those with the CT genotype, or those carrying two T allele SNPs rs7903146 of TCF7L2, i.e., those with the TT genotype.
[0372] Patients with the TCF7L2 risk genotype described in this article include (but are not limited to) Caucasians, Scandinavians, East Asians, Indians, and / or patients of African descent.
[0373] The invention also includes the application of the treatment and / or prevention methods or uses of the invention in patients in need, the methods or uses comprising determining whether the patient has a variant (e.g., polymorphism) in one or more genes selected from TCF7L2, KCNJ11, PPARG and GLP1R, and in particular determining whether the patient has the TCF7L2 risk genotype described herein.
[0374] Determining or diagnosing whether the patient has a variant (e.g., polymorphism) in one or more genes selected from TCF7L2, KCNJ11, PPARG, and GLP1R, particularly whether the patient has the TCF7L2 risk genotype described herein, or whether the patient has a wild-type genotype, particularly whether the patient has the TCF7L2 wild-type genotype described herein, can be used in the context of the treatment and / or prevention methods or uses (e.g., treating diabetes or improving glycemic control) to determine the likelihood (e.g., increased, decreased, or no likelihood) of a favorable treatment and / or prevention response to treatment with a DPP-4 inhibitor (or a combination of a DPP-4 inhibitor as defined herein with a second and / or third antidiabetic drug), thus identifying subjects sensitive to the treatment.
[0375] Therefore, further, in another embodiment of the invention, a method is provided to determine in a subject (especially a diabetic patient) the probability (e.g., increased, decreased, or no probability) of a favorable response to a pharmaceutically acceptable amount of a DPP-4 inhibitor (or a combination of the DPP-4 inhibitor described herein with a second and / or third antidiabetic drug), the method comprising determining whether the subject has a variant (e.g., polymorphism) in one or more genes selected from TCF7L2, KCNJ11, PPARG, and GLP1R, particularly whether the subject has the TCF7L2 risk genotype described herein, or determining whether the subject has the TCF7L2 wild-type genotype, particularly testing whether the subject has the TCF7L2rs7903146CC wild-type genotype.
[0376] According to another specific embodiment of the present invention, the present invention provides a DPP-4 inhibitor, pharmaceutical composition, or combination thereof for use in the treatment or prevention methods described in the context (particularly for treating or preventing type II diabetes and / or obesity), said method comprising:
[0377] (i) Identifying subjects sensitive to the treatment or prevention method, said identification comprising testing whether the subject has variants (e.g., polymorphisms) in one or more genes selected from TCF7L2, KCNJ11, PPARG, and GLP1R, particularly whether the subject has any of the TCF7L2 risk genotypes described herein, more specifically whether he / she has one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, particularly at least one SNP selected from rs7903146, rs12255372, and rs10885406, especially rs7903146, for example whether the subject carries at least one T allele SNP rs7903146 of TCF7L2, for example whether the subject has the CT genotype (i.e., whether the patient carries two T allele SNPs rs7903146 of TCF7L2) or whether the subject has the TT genotype (i.e., whether the patient carries two T allele SNPs of TCF7L2). rs7903146), or test whether the subject has the TCF7L2 wild-type genotype, especially whether the subject has the TCF7L2rs7903146CC wild-type genotype; and thus determine the probability of a favorable response (e.g., a favorable change in HbA1c) produced by therapeutic or prophylactic treatment of the subject with a DPP-4 inhibitor, pharmaceutical composition, or combination.
[0378] and
[0379] (ii) administering an effective amount of the DPP-4 inhibitor, pharmaceutical composition, or combination to the subject, wherein the subject is determined to have a high probability of having a favorable response (e.g., a favorable change in HbA1c) resulting from therapeutic or prophylactic treatment of the subject with the DPP-4 inhibitor, pharmaceutical composition, or combination.
[0380] The present invention also provides a method or use for treatment and / or prevention of the invention in patients in need, said method or use comprising the following steps:
[0381] - Obtain and analyze nucleic acid samples from individuals with type 2 diabetes.
[0382] - Determining the effectiveness and / or, optionally, the probability of a favorable response (e.g., in providing glycemic control, such as a favorable change in HbA1c) of treatment with a DPP-4 inhibitor (preferably liraristine), or a combination of said DPP-4 inhibitor with one or more other active substances (e.g., antidiabetic drugs), includes detecting any TT, CT, or CC allele genotype in rs7903146 of the TCF7L2 gene in a patient's sample.
[0383] The presence of the TT, CT, or CC genotype indicates the effectiveness of the treatment, and / or, optionally,
[0384] The presence of the TT genotype indicates a decreased likelihood of a favorable response to treatment, and / or the presence of the CC genotype indicates an increased likelihood of a favorable response to treatment.
[0385] -Administer a therapeutically effective amount of the DPP-4 inhibitor (preferably liraristine) to the individual, or a combination of the DPP-4 inhibitor with one or more other active substances (e.g., antidiabetic drugs).
[0386] It has also been found that improved glycemic control can be achieved by using the pharmaceutical compositions or combinations of the present invention, even in patients whose glycemic control remains inadequate despite the use of a second or third antidiabetic drug or a combination therapy of a second and a third antidiabetic drug, for example, those patients whose glycemic control remains inadequate despite oral monotherapy with the maximum tolerated dose of metformin, thiazolidinediones (e.g., pioglitazone), or sulfonylureas, or a combination of the maximum tolerated dose of metformin with thiazolidinediones (e.g., pioglitazone), metformin with sulfonylureas, or a combination of thiazolidinediones (e.g., pioglitazone) with sulfonylureas.
[0387] It has also been found that improved glycemic control can be achieved by using the combination of the present invention, especially in patients whose glycemic control remains inadequate despite the use of DPP-4 inhibitors or combination therapy with DPP-4 inhibitors and a second or third antidiabetic drug, such as those patients whose glycemic control remains inadequate despite oral monotherapy with the maximum tolerated dose of DPP-4 inhibitor, or dual combination therapy with the maximum tolerated dose of DPP-4 inhibitor and a second or third antidiabetic drug.
[0388] The maximum tolerated dose of metformin is, for example, 2000 mg / day, 1500 mg / day (e.g. in Asian countries), or 850 mg, three times daily, or any equivalent dose.
[0389] Therefore, the method and / or use of the present invention are applicable to patients exhibiting one, two, or more of the following conditions:
[0390] (a) Inadequate blood glucose control despite using diet and exercise therapy alone;
[0391] (b) Inadequate glycemic control despite the use of metformin, thiazolidinediones (e.g., pioglitazone), sulfonylureas, GLP-1 or GLP-1 analogs, or insulin or insulin analogs as monotherapy, especially despite oral monotherapy with the maximum tolerated dose of metformin, thiazolidinediones (e.g., pioglitazone) or sulfonylureas.
[0392] (c) Inadequate glycemic control despite the use of two medications selected from metformin, thiazolidinediones (e.g., pioglitazone), sulfonylureas, GLP-1 or GLP-1 analogs, and insulin or insulin analogs, for example, despite the use of combination therapy selected from metformin / pioglitazone, metformin / sulfonylureas, metformin / insulin, sulfonylureas / pioglitazone, sulfonylureas / insulin and pioglitazone / insulin;
[0393] The dual or triple combination method and / or application of the present invention are also used in patients who present with the following symptoms (d) or (e):
[0394] (d) Inadequate glycemic control despite oral monotherapy with a DPP-4 inhibitor, especially despite oral monotherapy with the maximum tolerated dose of a DPP-4 inhibitor;
[0395] (e) Inadequate glycemic control despite treatment with a DPP-4 inhibitor in combination with a second or third antidiabetic drug (oral), especially despite oral dual therapy at the maximum tolerated dose of at least one of the said concomitant combination drugs.
[0396] In one embodiment of the invention, the pharmaceutical composition or combination is suitable for treating a patient diagnosed with one or more of the following conditions:
[0397] -Insulin resistance
[0398] - Hyperinsulinemia,
[0399] -Prediabetes
[0400] Type 2 diabetes, especially advanced type 2 diabetes.
[0401] Type I diabetes.
[0402] Furthermore, the pharmaceutical compositions or combinations of the present invention are particularly suitable for treating patients diagnosed with one or more of the following conditions:
[0403] (a) Obesity (including Grade I, II and / or III obesity), visceral obesity and / or abdominal obesity,
[0404] (b) Blood triglyceride levels ≥150 mg / dL,
[0405] (c) Female patients with HDL-cholesterol blood levels <40 mg / dL and male patients with HDL-cholesterol levels <50 mg / dL
[0406] (d) Systolic blood pressure ≥130 mmHg and diastolic blood pressure ≥85 mmHg,
[0407] (e) Fasting blood glucose level ≥110 mg / dL or ≥100 mg / dL.
[0408] Patients diagnosed with impaired glucose tolerance (IGT), abnormal fasting glucose (IFG), insulin resistance, and / or metabolic syndrome are believed to have an increased risk of cardiovascular disease (e.g., myocardial infarction, coronary artery disease, heart failure, thromboembolic events). The glycemic control method of this invention can reduce cardiovascular risk.
[0409] Furthermore, the pharmaceutical compositions and methods of the present invention are particularly suitable for treating patients after organ transplantation, especially patients diagnosed with one or more of the following conditions:
[0410] (a) Older age, especially over 50 years old,
[0411] (b) Male sex,
[0412] (c) Overweight, obesity (including Grade I, II and / or III obesity), visceral obesity and / or abdominal obesity
[0413] (d) Pre-transplant diabetes
[0414] (e) Immunosuppressive therapy.
[0415] The pharmaceutical compositions or combinations of the present invention, particularly those attributed to the DPP-4 inhibitors therein, exhibit a favorable safety profile. Therefore, the treatment or prevention of the present invention may be used in patients who are contraindicated for monotherapy with another antidiabetic drug (e.g., metformin) and / or who are intolerant to therapeutic doses of these drugs. The treatment or prevention of the present invention may be particularly beneficial in patients exhibiting one or more of the following conditions or who have an increased risk: renal insufficiency or kidney disease, heart disease, heart failure, liver disease, lung disease, catabolic state with lactic acidosis and / or at risk, or pregnant or lactating women.
[0416] Furthermore, it has been found that administering the pharmaceutical compositions or combinations of the present invention carries no risk of hypoglycemia or a low risk of hypoglycemia. Therefore, the treatment or prevention of hypoglycemia according to the present invention is also beneficial to patients exhibiting hypoglycemia or at increased risk of developing hypoglycemia.
[0417] The pharmaceutical compositions or combinations of the present invention are particularly suitable for the long-term treatment or prevention of the disease and / or condition described in the context in patients with type II diabetes, and especially for their long-term glycemic control.
[0418] As used in the context, the term "long-term" means a period of treatment or administration to a patient that is longer than 12 weeks, preferably longer than 25 weeks, and even more preferably longer than 1 year.
[0419] Therefore, one specific embodiment of the present invention provides a treatment method (preferably oral therapy) for improving (especially for long-term improvement) glycemic control in patients with type 2 diabetes, especially those with advanced type 2 diabetes, and especially those also diagnosed with overweight, obesity (including grade I, II and / or III obesity), visceral obesity and / or abdominal obesity.
[0420] The above-mentioned effects were observed when DPP-4 inhibitors were administered together with a second and optionally a third antidiabetic drug (e.g., as a single formulation or as two or three separate formulations administered simultaneously) and / or when they were administered alternately (e.g., as two or three separate formulations administered sequentially).
[0421] Within this invention, it should be understood that the use of combination or combination is considered as administering the components separately, sequentially, simultaneously, concurrently, chronologically staggered, or alternately. It should be understood that the DPP-4 inhibitor and the other active substances may be administered in a single dosage form or separately in different dosage forms.
[0422] In this document, the term "combination" or "combined" as used in the sense of the present invention also includes (but is not limited to) fixed and non-fixed forms and uses.
[0423] It should be understood that the amount of the pharmaceutical composition of the present invention to be administered to a patient and used in the treatment or prevention of diabetes will vary depending on the route of administration, the nature and severity of the condition to be treated or prevented, the patient's age, weight and physical condition, and concomitant medications, and will ultimately be determined by the attending physician. However, in general, the amount of the DPP-4 inhibitor of the present invention and optionally a second and / or optional third antidiabetic agent included in the pharmaceutical composition, combination or dosage form is sufficient to improve glycemic control in the patient to be treated at the time of administration.
[0424] The following preferred ranges are disclosed for the amounts of the DPP-4 inhibitor, second and / or third antidiabetic drug to be used in the pharmaceutical compositions, methods and uses of the present invention. These ranges refer to the daily dosage for adult patients (especially, for example, those weighing about 70 kg) and can be adjusted accordingly based on whether the dosage is 2, 3, 4 or more times per day, other routes of administration, and the patient's age. The dosage and amount ranges are calculated for each individual active ingredient. The dosages of the individual DPP-4 inhibitor and / or the individual second and / or third antidiabetic drug used in the combination therapy of the present invention are preferably lower than those used in monotherapy or conventional therapy, thereby avoiding the possible toxicity and adverse side effects that may occur when those drugs are used as monotherapy.
[0425] Within the scope of this invention, the pharmaceutical composition or combination is preferably administered orally. Other forms of administration are also possible and are described below. Dosage forms comprising one or more DPP-4 inhibitors and / or a second and / or a third antidiabetic agent are preferably oral dosage forms or commonly known dosage forms.
[0426] Generally, the amount of DPP-4 inhibitor in the combination, combination method and combination use of the present invention is preferably in the range of 1 / 5 to 1 / 1 of the amount generally recommended for monotherapy using the DPP-4 inhibitor.
[0427] When administered orally, the preferred dosage range of liraristine is 0.5 mg to 10 mg daily, more preferably 2.5 mg to 10 mg daily, and most preferably 1 mg to 5 mg daily. The preferred amount in the pharmaceutical composition is 0.5 mg to 10 mg, particularly 1 mg to 5 mg. Examples of specific dosage strengths are 1, 2.5, 5, or 10 mg. The active ingredient can be administered up to three times daily, preferably once or twice daily. Suitable liraristine formulations may be those disclosed in application WO 2007 / 128724, the disclosure of which is incorporated herein by reference in its entirety.
[0428] Typical dosage strengths of liraristine / metformin IR (rapid release) dual fixed-dose combination (tablets) are 2.5 / 500 mg, 2.5 / 850 mg and 2.5 / 1000 mg, which can be administered 1-3 times daily, especially twice daily.
[0429] Typical dosage strengths of liraristine / metformin XR (extended release) dual fixed-dose combination tablets are 5 / 500mg, 5 / 1000mg, and 5 / 1500mg, which can be administered 1-2 times daily, especially once daily, preferably with a meal in the evening; or 2.5 / 500mg, 2.5 / 750mg, and 2.5 / 1000mg, which can be administered 1-2 times daily, preferably two tablets once daily, preferably with a meal in the evening.
[0430] When administered orally, the preferred dose range of sitagliptin is 10 to 200 mg daily, particularly 25 to 150 mg daily. The recommended dose of sitagliptin, calculated based on the active fraction (anhydrous free base), is 100 mg once daily or 50 mg twice daily. The preferred amount in the pharmaceutical composition is 10 to 150 mg, particularly 25 to 100 mg. Examples include 25, 50, 75, or 100 mg. The active ingredient can be administered up to three times daily, preferably once or twice daily. The equivalent amount of sitagliptin salts, especially phosphate monohydrate, can be calculated accordingly. For patients with renal failure, adjusted doses of sitagliptin, such as 25 and 50 mg, are preferred.
[0431] When administered orally, the preferred dosage range of vildagliptin is 10 to 150 mg daily, particularly 25 to 150 mg, 25 to 100 mg, or 25 to 50 mg, or 50 to 100 mg daily. For example, the daily dose of vildagliptin is 50 or 100 mg. The preferred amount in the pharmaceutical composition is 10 to 150 mg, particularly 25 to 100 mg. Examples are 25, 50, 75, or 100 mg. The active ingredient can be administered up to three times daily, preferably once or twice daily.
[0432] When administered orally, the preferred dosage range for alogliptin is 5 to 250 mg daily, particularly 10 to 150 mg daily. The preferred amount in the pharmaceutical composition is 5 to 150 mg, particularly 10 to 100 mg. Examples include 10, 12.5, 20, 25, 50, 75, and 100 mg. The active ingredient can be administered up to three times daily, preferably once or twice daily.
[0433] When administered orally, the preferred dosage range of saxagliptin is 2.5 to 100 mg daily, particularly 2.5 to 50 mg daily. The preferred amount in the pharmaceutical composition is 2.5 to 100 mg, particularly 2.5 to 50 mg. Examples include 2.5, 5, 10, 15, 20, 30, 40, 50, and 100 mg. The active ingredient can be administered up to three times daily, preferably once or twice daily.
[0434] When administered orally, the preferred dosage range for dugliptin is 50 to 400 mg daily, particularly 100 to 400 mg daily. The preferred amount in the pharmaceutical composition is 50 to 400 mg. Examples include 50, 100, 200, 300, and 400 mg. The active ingredient can be administered up to three times daily, preferably once or twice daily.
[0435] Specific embodiments of the DPP-4 inhibitors of the present invention relate to those DPP-4 inhibitors that are therapeutically effective at low dose levels, such as <100 mg or <70 mg per patient per day, preferably <50 mg, more preferably <30 mg or <20 mg, even more preferably 1 mg to 10 mg (divided into 1 to 4 single doses, preferably 1 or 2 single doses of the same size, if necessary), particularly at dose levels of 1 mg to 5 mg (more specifically 5 mg), preferably administered orally once daily, more preferably at any time of day, with or without food. Thus, for example, at any time of day, with or without food, a daily oral dose of 5 mg of BI 1356 can be administered as a once-daily regimen (i.e., 5 mg BI 1356 once daily) or as a twice-daily regimen (i.e., 2.5 mg BI 1356 twice daily).
[0436] Generally, the amount of the second and / or third antidiabetic drug in the combination, combination method, and combination use of the present invention is preferably in the range of 1 / 5 to 1 / 1 of the amount generally recommended for monotherapy using the antidiabetic drug. Using individual second and / or third antidiabetic drugs at doses lower than those of monotherapy can avoid or minimize the toxicity and adverse side effects that may occur when those drugs are used as monotherapy.
[0437] When administered orally, the preferred dosage range for metformin is 250 to 3000 mg daily, particularly 500 to 2000 mg daily. The preferred dosage range in the pharmaceutical composition is correspondingly 250 to 1000 mg, particularly 500 to 1000 mg or 250 to 850 mg. Examples are 500, 750, 850, or 1000 mg. These dosages are preferably administered once, twice, or three times daily. For example, dosages of 500, 750, and 850 mg are preferably administered once, twice, or three times daily, and a dosage of 1000 mg is preferably administered once or twice daily. Some controlled-release or sustained-release formulations allow for once-daily administration. Metformin may be presented, for example, under the trademark GLUCOPHAGE. TM GLUCOPHAGE-D TM Or GLUCOPHAGE-XR TM Administered in commercially available forms.
[0438] When administered orally, the preferred dose range of pioglitazone is 5 to 50 mg daily. The preferred dose ranges in the pharmaceutical composition are correspondingly 5 to 50 mg, 10 to 45 mg, and 15 to 45 mg. Examples are 15, 30, or 45 mg. These doses are preferably administered once or twice daily, particularly once daily. Pioglitazone may be presented, for example, under the trademark ACTOS. TM Administered in commercially available forms.
[0439] When administered orally, the preferred dosage range for rosiglitazone is 1 mg to 10 mg daily. Preferred amounts in the pharmaceutical composition range from 1 to 10 mg, 2 to 8 mg, 4 to 8 mg, and 1 to 4 mg. Examples include 1, 2, 4, or 8 mg. These amounts are preferably administered once or twice daily. The dosage should preferably not exceed 8 mg daily. Rosiglitazone may be presented, for example, under the trademark AVANDIA. TM Administered in commercially available forms.
[0440] When administered orally, the preferred dose range for thiazolidinediones (other than pioglitazone or rosiglitazone as described above) is 2 to 100 mg daily. The preferred dose ranges for once-daily, twice-daily, or three-daily administrations are 2 to 100 mg, 1 to 50 mg, and 1 to 33 mg, respectively.
[0441] When administered orally, the preferred dosage range of glibenclamide is 0.5 to 15 mg daily, particularly 1 to 10 mg daily. The preferred amount in the pharmaceutical composition is 0.5 to 5 mg, particularly 1 to 4 mg. Examples are 1.0, 1.75, and 3.5 mg. These amounts are preferably administered once, twice, or three times daily. Glibenclamide may be presented, for example, under the trademark EUGLUCON. TM Administered in commercially available forms.
[0442] When administered orally, the preferred dose range of glimepiride is 0.5 to 10 mg daily, particularly 1 to 6 mg daily. The preferred amount in the pharmaceutical composition is 0.5 to 10 mg, particularly 1 to 6 mg. Examples are 1, 2, 3, 4, and 6 mg. These amounts are preferably administered once daily, twice daily, or three times daily, preferably once daily. Glimepiride may be presented, for example, under the trademark AMARYL. TM Administered in commercially available forms.
[0443] When administered orally, the preferred dosage range for glibenclamide is 5 to 150 mg daily, particularly 15 to 120 mg daily. The preferred amount in the pharmaceutical composition is 5 to 120 mg, particularly 5 to 30 mg. Examples are 10, 20, and 30 mg. These dosages are preferably administered once, twice, three times, or four times daily. Glibenclamide may be presented, for example, under the trademark GLURENORM. TM Administered in commercially available forms.
[0444] When administered orally, the preferred dose range for glibenclamide is 5 to 75 mg daily. The preferred amount in the pharmaceutical composition is 5 to 75 mg, particularly 10 to 50 mg. These amounts are preferably administered once, twice, or three times daily.
[0445] When administered orally, the preferred dosage range for gliclazide is 20 to 300 mg daily, particularly 40 to 240 mg daily. The preferred amount in the pharmaceutical composition is 20 to 240 mg, particularly 20 to 80 mg. Examples are 20, 30, 40, and 50 mg. These dosages are preferably administered once, twice, or three times daily.
[0446] When administered orally, the preferred dosage range for glimepiride is 1 to 20 mg daily, particularly 1 to 16 mg daily. The preferred amount in the pharmaceutical composition is 1 to 8 mg, particularly 1 to 4 mg. These dosages are preferably administered once, twice, three times, or four times daily.
[0447] When administered orally, the preferred dosage range for tolbutamide is 100 to 3000 mg daily, more preferably 500 to 2000 mg daily. The preferred amount in the pharmaceutical composition is 100 to 1000 mg. These amounts are preferably administered once or twice daily.
[0448] When administered orally, the preferred dose range of glipizide is 1 to 50 mg daily, especially 2.5 to 40 mg daily. The preferred dose ranges for once, twice, or three times daily administration are 1 to 50 mg, 0.5 to 25 mg, and 0.3 to 17 mg, respectively.
[0449] When administered orally, the preferred dosage range for nateglinide is 30 to 500 mg daily, particularly 60 to 360 mg daily. The preferred amount in the pharmaceutical composition is 30 to 120 mg. Examples are 30, 60, and 120 mg. These dosages are preferably administered once, twice, or three times daily. Nateglinide can be presented, for example, under the trademark STARLIX. TM Administered in commercially available forms.
[0450] When administered orally, the preferred dosage range of repaglinide is 0.1 to 16 mg daily, particularly 0.5 to 6 mg daily. The preferred amount in the pharmaceutical composition is 0.5 to 4 mg. Examples include 0.5, 1, 2, or 4 mg. These dosages are preferably administered once, twice, three times, or four times daily. Repaglinide may be presented, for example, under the trademark NOVONORM. TM Administered in commercially available forms.
[0451] When administered orally, the preferred dosage range for acarbose is 50 to 1000 mg daily, particularly 50 to 600 mg daily. The preferred amount in the pharmaceutical composition is 50 to 150 mg. Examples are 50 and 100 mg. These dosages are preferably administered once, twice, three times, or four times daily. Acarbose may be presented, for example, under the trademark Glucobay. TM Administered in commercially available forms.
[0452] When administered orally, the preferred dosage range for voglibose is 100 to 1000 mg daily, particularly 200 to 600 mg daily. The preferred amount in the pharmaceutical composition is 50 to 300 mg. Examples include 50, 100, 150, 200, and 300 mg. These dosages are preferably administered once, twice, three times, or four times daily. Voglibose may be presented, for example, under the trademark Basen. TM Or Voglisan TM Administered in commercially available forms.
[0453] When administered orally, the preferred dosage range of miglitol is 25 to 500 mg daily, particularly 25 to 300 mg daily. The preferred amount in the pharmaceutical composition is 25 to 100 mg. Examples are 25, 50, and 100 mg. These dosages are preferably administered once, twice, three times, or four times daily. Miglitol may be presented, for example, under the trademark Glyset. TM Administered in commercially available forms.
[0454] The preferred dosage range for GLP-1 analogs (especially exenatide) is 5 to 30 μg daily, particularly 5 to 20 μg daily. The preferred amount in the pharmaceutical composition is 5 to 10 μg. Examples are 5 and 10 μg. These amounts are preferably administered subcutaneously once, twice, three times, or four times daily. Exenatide may be presented, for example, under the trademark Byetta. TM The exenatide is administered in commercially available forms. Long-acting formulations (preferably for once-weekly subcutaneous injection) contain 0.1 to 3.0 mg, preferably 0.5 to 2.0 mg, of exenatide. Examples include 0.8 mg and 2.0 mg. An example of a long-acting exenatide formulation is Byetta LAR. TM .
[0455] The preferred dosage range for liraglutide is 0.5 to 3 mg daily, particularly 0.5 to 2 mg daily. The preferred amount in the pharmaceutical composition is 0.5 to 2 mg. Examples include 0.6, 1.2, and 1.8 mg. These amounts are preferably administered subcutaneously once or twice daily.
[0456] The amounts of the DPP-4 inhibitor and the second and / or third therapeutic agent in the pharmaceutical compositions, methods, and uses of the present invention correspond to the respective dose ranges provided above. For example, the preferred dose range in the pharmaceutical compositions, combinations, methods, and uses of the present invention is 0.5 to 10 mg (especially 1 to 5 mg, especially 2.5 mg or 5 mg) of liraristine and / or, optionally, 250 to 1000 mg (especially 500 mg, 850 mg or 1000 mg) of metformin. It is preferred to administer orally once or twice daily.
[0457] In the combination method and use of the combination of the present invention, the DPP-4 inhibitor and the second and / or third therapeutic agent are administered in combination, including (but not limited to) simultaneous administration of the active ingredients, i.e., simultaneous or substantially simultaneous administration, or alternating administration of the active ingredients, i.e., administration of the first or two active ingredients followed by administration of the other two or one active ingredients after a period of time, i.e., at least two of the three active ingredients are administered sequentially. The period of time may be from 30 minutes to 12 hours. The combination or alternating administration may be once, twice, three or four times daily, preferably once or twice daily.
[0458] Regarding the administration of DPP-4 inhibitors and second and / or third antidiabetic drugs, all three active ingredients may be present in a single dosage form, such as a tablet or capsule, or one or two active ingredients may be present in separate dosage forms, such as two different or identical dosage forms.
[0459] Regarding alternating dosing, one or two active ingredients are present in independent dosage forms, such as two different or the same dosage forms.
[0460] Therefore, the pharmaceutical combination of the present invention can exist in a single dosage form, comprising a DPP-4 inhibitor and a second and optionally a third antidiabetic drug. Alternatively, the pharmaceutical combination of the present invention can exist in two separate dosage forms, one containing a DPP-4 inhibitor and the other containing a second plus optionally a third antidiabetic drug; or, in the case of a triplet combination, one dosage form contains a DPP-4 inhibitor plus either a second or a third antidiabetic drug, and the other dosage form contains either the third or the second antidiabetic drug. Alternatively, in the case of a triplet combination, the pharmaceutical combination of the present invention can exist in three separate dosage forms, one containing a DPP-4 inhibitor, the second containing a second antidiabetic drug, and the third containing a third antidiabetic drug. Alternatively, in the case of a dual combination, the pharmaceutical combination of the present invention can exist in two separate dosage forms, one containing a DPP-4 inhibitor and the second containing a second antidiabetic drug.
[0461] There may be situations where one active ingredient must be administered more frequently (e.g., twice daily) than another active ingredient (e.g., once daily). Therefore, "combination dosing" also includes dosing regimens in which all active ingredients are administered first, followed by a period of time in which only one active ingredient is administered, and vice versa.
[0462] Therefore, the present invention also includes drug combinations in separate dosage forms, one dosage form comprising a DPP-4 inhibitor and a second and / or optionally a third therapeutic agent, and another dosage form comprising only the second and / or optionally a third therapeutic agent.
[0463] Therefore, the present invention also includes pharmaceutical compositions or combinations for the separate, sequential, simultaneous, parallel, alternating, or chronologically cross-application of active ingredients or components.
[0464] Pharmaceutical compositions in individual or multiple dosage forms, preferably in kit form, are suitable for combination therapy to flexibly meet the individual treatment needs of patients.
[0465] According to the first embodiment, the kit comprises:
[0466] (a) A first container containing a dosage form comprising a DPP-4 inhibitor and at least one pharmaceutically acceptable carrier, and
[0467] (b) A second container containing a dosage form comprising a second antidiabetic drug and at least one pharmaceutically acceptable carrier, and optionally...
[0468] (c) A third container containing a dosage form comprising a third antidiabetic drug and at least one pharmaceutically acceptable carrier.
[0469] According to the second embodiment, the kit comprises:
[0470] (a) A first container containing a dosage form comprising a DPP-4 inhibitor and a second or third antidiabetic drug and at least one pharmaceutically acceptable carrier, and
[0471] (b) A second container containing a dosage form comprising a third or second antidiabetic drug and at least one pharmaceutically acceptable carrier.
[0472] According to the third embodiment, the kit comprises:
[0473] (a) A first container containing a dosage form comprising a DPP-4 inhibitor and at least one pharmaceutically acceptable carrier, and
[0474] (b) A second container containing a dosage form comprising a second and a third antidiabetic drug and at least one pharmaceutically acceptable carrier.
[0475] Another aspect of the invention is an article comprising the pharmaceutical combination of the invention in a separate dosage form and a label or instruction manual containing instructions for administration of the separate dosage forms in combination.
[0476] According to a first embodiment, the article comprises (a) a pharmaceutical composition comprising the DPP-4 inhibitor of the present invention; and (b) a label or product information leaflet comprising an instruction that the pharmaceutical product may or will be administered in combination, for example, in combination with a pharmaceutical product comprising a second antidiabetic drug of the present invention, or in combination with a fixed or free combination (e.g., pharmaceutical products) comprising a second and a third antidiabetic drug of the present invention.
[0477] According to a second embodiment, the article comprises (a) a second antidiabetic drug of the present invention and (b) a label or product information leaflet that includes instructions that the drug may or will be administered in combination, for example, in combination with a drug comprising a DPP-4 inhibitor of the present invention, or in combination with a fixed or free combination (e.g., a drug) comprising a DPP-4 inhibitor of the present invention and a third antidiabetic drug.
[0478] According to a third embodiment, the article comprises (a) a pharmaceutical composition comprising the DPP-4 inhibitor of the present invention and the second antidiabetic drug and (b) a label or instruction manual that includes instructions that the drug may or will be administered in combination, for example, in combination with a drug comprising the third antidiabetic drug of the present invention.
[0479] The desired dose of the pharmaceutical composition of the present invention is conveniently provided as once daily or as divided doses (e.g., twice, three or more times daily) at appropriate intervals.
[0480] Pharmaceutical compositions may be formulated for oral, rectal, nasal, topical (including sublingual and sublingual), transdermal, vaginal, or parenteral (including intramuscular, subcutaneous, and intravenous) administration in liquid or solid form or in a form suitable for administration by inhalation or blowing. Oral administration is preferred. Where appropriate, the formulation is preferably in discontinuous dose units and may be prepared by any method well known in the pharmaceutical field. All methods include the steps of conjugating the active ingredient with one or more pharmaceutically acceptable carriers (such as liquid carriers or subdivided solid carriers or both), and then shaping the product into the desired formulation when needed.
[0481] The pharmaceutical composition may be formulated in the following forms: tablets, granules, fine granules, powders, capsules, small capsules, soft capsules, pills, oral solutions, syrups, dry syrups, chewable tablets, sugar-coated tablets, effervescent tablets, drops, suspensions, instant tablets, oral fast-dispersible tablets, etc.
[0482] Pharmaceutical compositions and dosage forms preferably comprise one or more pharmaceutically acceptable carriers. The preferred carrier must be "acceptable," meaning it is compatible with other components of the formulation and harmless to the recipient. Examples of pharmaceutically acceptable carriers are known to those skilled in the art.
[0483] Pharmaceutical compositions suitable for oral administration are preferably in the form of discontinuous units, such as capsules, including soft gelatin capsules, flat capsules, or tablets, each containing a predetermined amount of the active ingredient; powders or granules; solutions, suspensions, or emulsions, such as syrups, elixirs, or self-emulsifying delivery systems (SEDDS). The active ingredient may also be in the form of bolus, electuary, or paste. Tablets and capsules for oral administration may contain conventional excipients, such as binders, fillers, lubricants, disintegrants, or wetting agents. Tablets may be coated according to methods well known in the art. Oral liquid formulations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups, or elixirs; or may be in the form of a dry product combined with water or other suitable medium before use. These liquid formulations may contain conventional additives, such as suspending agents, emulsifiers, non-aqueous mediums (which may include edible oils), or preservatives.
[0484] The pharmaceutical compositions of the present invention can also be formulated for parenteral administration (e.g., by injection, such as bolus or continuous infusion) and can be in unit dosage forms in ampoules with added preservatives, pre-filled syringes, small-volume infusions, or multi-dose containers. The compositions can be in the form of suspensions, solutions, or emulsions, for example, in oily or aqueous media and can contain formulations such as suspending agents, stabilizers, and / or dispersants. Alternatively, the active ingredient can be in the form of a powder obtained by aseptic separation of a sterile solid or by lyophilization from a solution, which is combined with a suitable medium (e.g., sterile, pyrogen-free water) before use.
[0485] The pharmaceutical composition suitable for rectal administration, wherein the carrier is solid, is most preferably in the form of a single-dose suppository. Suitable carriers include cocoa butter and other materials commonly used in the art, and the suppository is preferably formed by mixing the active compound with a softened or melted carrier, followed by cooling and molding in a mold.
[0486] For pharmaceutical applications in warm-blooded vertebrates (particularly humans), the compounds of the present invention are typically used at doses of 0.001-100 mg / kg body weight, preferably 0.1-15 mg / kg, once to four times daily in each case. For this purpose, compounds optionally combined with other active substances may be incorporated with one or more conventional inert carriers and / or diluents, such as corn starch, lactose, glucose, microcrystalline cellulose, magnesium stearate, polyvinylpyrrolidone, citric acid, tartaric acid, water, water / ethanol, water / glycerol, water / sorbitol, water / polyethylene glycol, propylene glycol, cetearyl stearyl alcohol, carboxymethyl cellulose, or fatty substances (e.g., stearate) or suitable mixtures thereof into conventional galen formulations (e.g., uncoated or coated tablets, capsules, powders, suspensions, or suppositories).
[0487] Therefore, the pharmaceutical compositions of the present invention comprising a DPP-4 inhibitor as defined herein are prepared by those skilled in the art using pharmaceutically acceptable formulation excipients as described in the art. Examples of such excipients include, but are not limited to, diluents, binders, carriers, fillers, lubricants, flow promoters, crystallization retardants, disintegrants, solubilizers, colorants, pH adjusters, surfactants, and emulsifiers.
[0488] Examples of suitable diluents for the compound in embodiment A include cellulose powder, dicalcium phosphate, erythritol, low-substituted hydroxypropyl cellulose, mannitol, pregelatinized starch, or xylitol. Among these diluents, mannitol, low-substituted hydroxypropyl cellulose, and pregelatinized starch are particularly preferred.
[0489] Examples of suitable lubricants for use with the compound in embodiment A include talc, polyethylene glycol, calcium behenate, calcium stearate, hydrogenated castor oil, or magnesium stearate. Among these lubricants, magnesium stearate is particularly preferred.
[0490] Examples of suitable adhesives for the compound in embodiment A include copovidone (a copolymer of vinylpyrrolidone and other vinyl derivatives), hydroxypropyl methylcellulose (HPMC), hydroxypropyl cellulose (HPC), polyvinylpyrrolidone (povidone), pregelatinized starch, or low-substituted hydroxypropyl cellulose (L-HPC). Among these adhesives, copovidone and pregelatinized starch are particularly preferred.
[0491] Examples of suitable disintegrants for the compound in embodiment A include corn starch or cropovidone. Among these disintegrants, corn starch is particularly preferred.
[0492] A suitable method for preparing the pharmaceutical formulation of the DPP-4 inhibitor of Embodiment A of the present invention is as follows:
[0493] ● Directly compress the active substance in powder form with a suitable tableting excipient into tablets;
[0494] ● Granulation with a suitable excipient, followed by mixing with a suitable excipient, then tableting and film coating; or
[0495] ● Package powder mixtures or granules into capsules.
[0496] The suitable granulation method is:
[0497] ●Wet granulation in a high-intensity mixer, followed by fluidized bed drying;
[0498] ●One-pot granulation;
[0499] ● Fluidized bed granulation; or
[0500] ●Dry granulation with suitable excipients (e.g., by roller pressing) and then tableting or packaging into capsules.
[0501] An exemplary composition of the DPP-4 inhibitor of Embodiment A of the present invention comprises a first diluent mannitol, a pregelatinized starch as a second diluent having additional binder properties, a binder copovidone, a disintegrant corn starch, and a lubricant magnesium stearate, wherein copovidone and / or corn starch are optional.
[0502] For details regarding the dosage form, formulation, and administration of the DPP-4 inhibitor of this invention, please refer to scientific literature and / or published patent documents, especially those cited herein.
[0503] These pharmaceutical compositions (or formulations) can be packaged in a variety of ways. Typically, the article for distribution includes a container that contains the pharmaceutical composition in an appropriate form. Tablets are typically packaged in suitable outer packaging that facilitates handling, dispensing, and storage, ensuring appropriate stability of the composition during prolonged exposure to the environment during storage. The outer packaging of tablets can be bottles or blister packs.
[0504] For example, suitable vials for pharmaceutical compositions or combinations comprising the DPP-4 inhibitor of Embodiment A of the present invention may be made of glass or polymer (preferably polypropylene (PP) or high-density polyethylene (HD-PE)) and sealed with a screw cap. The screw cap provides a child-resistant safety closure (e.g., a press-and-twist closure) to prevent or stop children from accessing the contents. If necessary (e.g., in high-humidity areas), the use of additional desiccants (e.g., bentonite, molecular sieves, or preferably silica gel) can extend the shelf life of the packaged composition.
[0505] For example, a suitable blister pack for a pharmaceutical composition or combination containing the DPP-4 inhibitor of Embodiment A of the present invention includes, or consists of, a top foil (which can be torn from the tablet) and a bottom (which includes a pocket for the tablet). The top foil includes a metal foil, particularly aluminum foil or aluminum alloy foil (e.g., having a thickness of 20 μm to 45 μm, preferably 20 μm to 25 μm), and is covered on its inner side (sealed side) by a heat-sealable polymer layer. The bottom may include a multilayer polymer foil (e.g., polyvinyl chloride (PVC)) coated with polyvinylidene chloride (PVDC); or a PVC foil laminated with polychlorotrifluoroethylene (PCTFE) or a multilayer polymer-metal-polymer foil (e.g., a cold-formable laminated PVC / aluminum-polyamide composition).
[0506] The object may also include a label or package insert, which is typically included in the package insert within the commercial packaging of the therapeutic product and may contain information such as indications, usage, dosage, administration, contraindications, and / or precautions for using the therapeutic product. In one embodiment, the label or package insert indicates that the composition can be used for any of the purposes described herein.
[0507] The pharmaceutical compositions and methods of the present invention have shown advantageous effects in the treatment and prevention of the aforementioned diseases and conditions. Dual combinations have shown advantageous effects compared to monotherapy with the active ingredient. Triple combinations have shown advantageous effects compared to dual therapy with one or two of the three active ingredients. These advantageous effects can be seen in, for example, efficacy, dosage strength, dosing frequency, pharmacodynamic properties, pharmacokinetic properties, fewer side effects, convenience, and compliance.
[0508] Regarding liraristine, synthetic methods are known to those skilled in the art and are described in the literature, particularly in WO 2002 / 068420, WO 2004 / 018468, or WO 2006 / 048427, the disclosures of which are incorporated herein by reference. Specific polymorphic crystal forms and formulations of DPP-4 inhibitors are disclosed in WO 2007 / 128721 and WO 2007 / 128724, the disclosures of which are incorporated herein by reference. Specific formulations of DPP-4 inhibitors in combination with metformin or other drugs are disclosed in WO 2009 / 121945, the disclosures of which are incorporated herein by reference.
[0509] Other methods for synthesizing DPP-4 inhibitors are described in scientific literature and / or published patent literature, especially the literature cited above.
[0510] Active ingredients, especially DPP-4 inhibitors and / or second and / or third antidiabetic drugs, may be in pharmaceutically acceptable salt forms. Pharmaceutically acceptable salts include (but are not limited to) salts of inorganic acids such as hydrochloric acid, sulfuric acid, and phosphoric acid; salts of organic carboxylic acids such as oxalic acid, acetic acid, citric acid, malic acid, benzoic acid, maleic acid, fumaric acid, tartaric acid, succinic acid, and glutamic acid; and salts of organic sulfonic acids such as methanesulfonic acid and p-toluenesulfonic acid. Salts can be formed by mixing appropriate amounts and proportions of the compound with an acid in a solvent and a decomposing agent. They can also be obtained through cation or anion exchange with other salt forms.
[0511] The active ingredient or its pharmaceutically acceptable salt may be in the form of a solvate, such as a hydrate or an alcohol adduct.
[0512] Because different metabolic disorders often occur simultaneously, it is frequently necessary to combine multiple different active ingredients. Therefore, depending on the diagnosed functional disorder, combining DPP-4 inhibitors with active substances conventionally used for each disorder can yield improved therapeutic outcomes. These active substances are, for example, one or more active substances selected from other antidiabetic substances, especially those that lower blood glucose or lipid concentrations, increase blood HDL concentrations, lower blood pressure, or are needed to treat atherosclerosis or obesity.
[0513] The aforementioned DPP-4 inhibitors, in addition to their use as monotherapy, can be used in combination with other active substances to achieve improved therapeutic outcomes. This combination therapy can be administered as a free combination of these substances or in a fixed combination (e.g., in tablets or capsules). The pharmaceutical formulations of the required combination drugs can be commercially available as pharmaceutical compositions or formulated by a technician using conventional methods. Active substances commercially available as pharmaceutical compositions are described in many places in the prior art, such as the Federal Association of the Pharmaceutical Industry's "Rote..." "In the annually published drug catalog, or in the annually updated compilation of manufacturers' information on prescription drugs (known as the Physician's Desk Reference)."
[0514] Examples of antidiabetic combination drugs include metformin; sulfonylureas such as glibenclamide, tolbutamide, glimepiride, glipizide, gliquidone, glibenclamide, and gliclazide; nateglinide; repaglinide; thiazolidinediones such as rosiglitazone and pioglitazone; PPARγ modulators such as metataglidase; PPAR-γ agonists such as rivoglitazone, mitoglitazone, INT-131, or balaglitazone; PPAR-γ antagonists; and PPAR-γ / α modulators such as tesaglitazar and muraglitazar. Alglitazar, indeglitazar, and KRP297; PPAR-γ / α / δ regulators, such as lobeglitazone; AMPK-activators, such as AICAR; acetyl-CoA carboxylase (ACC1 and ACC2) inhibitors; diacylglycerol-acetyltransferase (DGAT) inhibitors; pancreatic β-cell GCRP agonists, such as SMT3 receptor agonists and GPR119, such as GPR119 agonists 5-ethyl-2-{4-[4-(4-tetrazol-1-yl-phenoxymethyl)-thiazolyl-2-yl]piperidin-1-yl}-pyrimidine or 5-[1-(3-isopropyl-[1,2,4-] [diazol-5-yl]-piperidin-4-ylmethoxy]-2-(4-methanesulfonyl-phenyl)-pyridine; 11β-HSD inhibitors; FGF19 agonists or analogs; α-glucosidase inhibitors, such as acarbose, voglibose, and miglitol; α2-antagonists; insulin and insulin analogs, such as human insulin, lispro insulin, glutathione insulin, r-DNA-aspart insulin, NPH insulin, detemir insulin, degludec insulin, tregopil insulin, zinc insulin suspension, and glargine insulin. glargin; gastrointestinal inhibitory peptide (GIP); dextrin and dextrin analogs (e.g., pramlinide or davalintide); or GLP-1 and GLP-1 analogs, such as exendin-4, such as exenatide, exenatide LAR, liraglutide, taspoglutide, lixisenatide (AVE-0010), LY-2428757, dulaglutide (LY-2189265), semaglutide, or albiglutide; SGLT2 inhibitors, such as... Examples of inhibitors include dapagliflozin, seragliflozin (KGT-1251), aggliflozin, canagliflozin, iprigliflozin, and tofogliflozin; protein tyrosine phosphatase inhibitors (e.g., trodusquemine); glucose-6-phosphatase inhibitors; fructose-1,6-bisphosphatase regulators; glycogen phosphorylase regulators; glucagon receptor antagonists; phosphoenolpyruvate carboxykinase (PEPCK) inhibitors; pyruvate dehydrogenase kinase (PDK) inhibitors; and tyrosine kinase inhibitors (50 mg to 600 mg), such as PDGF receptor kinase (see EP-A-564409, WO). 98 / 35958, US 5093330, WO 2004 / 005281, and WO 2006 / 041976) or serine / threonine kinases; glucosamine / regulatory protein modulators, including glucosamine activators; glycogen synthase kinase inhibitors; inhibitors of inositol 5-phosphatase type 2 (SHIP2) containing an SH2 domain; IKK inhibitors, such as high-dose salicylates; JNK1 inhibitors; protein kinase C-θ inhibitors;β3 agonists, such as ritobegron, YM 178, solabegron, talibegron, N-5984, GRC-1087, rafabegron, and FMP825; aldose reductase inhibitors, such as AS 3201, zenasstat, findastat, epalrestat, ranirestat, NZ-314, CP-744809, and CT-112; SGLT-1 or SGLT-2 inhibitors, such as dapagliflozin, seragliflozin, aggliflozin, canagliflozin, or (1S)-1,5-dehydro-1-[3-(1-benzothiophene-2-ylmethyl)-4-fluorophenyl]-D-glucitol; KV 1.3 Channel inhibitors, such as [(3S)-6-({2',6'-dimethyl-4'-[3-(methanesulfonyl)propoxy]biphenyl-3-yl}methoxy)-2,3-dihydro-1-benzofuran-3-yl]acetic acid; SCD-1 inhibitors; CCR-2 antagonists; dopamine receptor agonists (bromocriptine mesylate [Cycloset]); 4-(3-(2,6-dimethylbenzyloxy)phenyl)-4-oxobutyric acid; deacetylase stimulators and other DPP-4 inhibitors.
[0515] Metformin is typically administered in doses ranging from about 500 mg to 2000 mg, and up to 2500 mg per day, using various dosing regimens of about 100 mg to 500 mg or 200 mg to 850 mg (once to three times daily), or about 300 mg to 1000 mg (once or twice daily), or as a sustained-release formulation of about 100 mg to 1000 mg, or preferably 500 mg to 1000 mg (once or twice daily) or about 500 mg to 2000 mg (once daily). Specific dosage strengths include 250, 500, 625, 750, 850, and 1000 mg metformin hydrochloride.
[0516] For children aged 10 to 16 years, the recommended starting dose of metformin is 500 mg once daily. If this dose does not produce adequate results, the dose can be increased to 500 mg twice daily. Further increases of 500 mg weekly can be made up to a maximum daily dose of 2000 mg, divided into several administrations (e.g., 2 or 3 doses). Metformin can be taken with food to reduce nausea.
[0517] The usual dosage of pioglitazone is about 1-10 mg, 15 mg, 30 mg or 45 mg once a day.
[0518] Rosiglitazone is usually administered in doses of 4 mg to 8 mg once daily (or divided into two doses) (typical dosage strengths are 2, 4, and 8 mg).
[0519] Glibenclamide is usually administered in doses of 2.5-5 to 20 mg once daily (or divided into two doses) (typical strengths are 1.25, 2.5, and 5 mg), or micronized glibenclamide is administered in doses of 0.75-3 to 12 mg once daily (or divided into two doses) (typical strengths are 1.5, 3, 4.5, and 6 mg).
[0520] Glipizide is usually administered once daily at a dose of 2.5 to 10-20 mg (or up to 40 mg in two divided doses) (typical strengths are 5 mg and 10 mg), or extended-release glipizide is administered once daily at a dose of 5-10 mg (up to 20 mg) (typical strengths are 2.5, 5 and 10 mg).
[0521] Glimepiride is usually administered in doses of 1–2 to 4 mg (up to 8 mg) once daily (typical strengths are 1, 2, and 4 mg).
[0522] Glibenclamide / metformin dual combination is usually administered in doses ranging from 1.25 / 250 mg (once daily) to 10 / 1000 mg (twice daily) (typical dosage strengths are 1.25 / 250, 2.5 / 500 and 5 / 500 mg).
[0523] The glipizide / metformin combination is usually administered in doses of 2.5 / 250 to 10 / 1000 mg twice daily (typical strengths are 2.5 / 250, 2.5 / 500, and 5 / 500 mg).
[0524] The glimepiride / metformin combination is usually administered at a dose of 1 / 250 to 4 / 1000 mg twice daily.
[0525] Rosiglitazone / glimepiride dual combination is usually administered at doses of 4 / 1 mg (once or twice daily) to 4 / 2 mg (twice daily) (typical dosage strengths are 4 / 1, 4 / 2, 4 / 4, 8 / 2 and 8 / 4 mg).
[0526] The pioglitazone / glimepiride dual combination is usually administered at a dose of 30 / 2 to 30 / 4 mg (once daily) (typical strengths are 30 / 4 and 45 / 4 mg).
[0527] Rosiglitazone / metformin dual combination is usually administered at doses of 1 / 500 to 4 / 1000 mg (twice daily) (typical dosage strengths are 1 / 500, 2 / 500, 4 / 500, 2 / 1000 and 4 / 1000 mg).
[0528] The pioglitazone / metformin dual combination is usually administered at doses of 15 / 500 mg (once or twice daily) to 15 / 850 mg (three times daily) (typical dosage strengths are 15 / 500 and 15 / 850 mg).
[0529] Non-sulfonylurea insulin secretagogues such as nateglinide are typically administered with food at doses of 60 to 120 mg (up to 360 mg / day, with typical strengths of 60 and 120 mg); repaglinide is typically administered with food at doses of 0.5 to 4 mg (up to 16 mg / day, with typical strengths of 0.5, 1, and 2 mg). Repaglinide / metformin dual-use combinations are available in 1 / 500 and 2 / 850 mg strengths.
[0530] Acarbose is usually administered with food in doses of 25 to 100 mg. Miglitol is usually administered with food in doses of 25 to 100 mg.
[0531] Examples of combination therapies that lower blood lipid concentrations include HMG-CoA-reductase inhibitors such as simvastatin, atorvastatin, lovastatin, fluvastatin, pravastatin, pitavastatin, and rosuvastatin; fibrates such as bezafibrate, fenofibrate, clofibrate, gemfibrozil, etofyllinclofibrate; niacin and its derivatives such as acilimus; PPAR-α agonists; PPAR-δ agonists; inhibitors of acetyl-CoA:cholesterol acyltransferase (ACAT; EC 2.3.1.26) such as avamidib; cholesterol reabsorption inhibitors such as ezetimib; substances that bind to bile acids such as cholestyramine, colestipol, and colesvelam; bile acid transport inhibitors; and HDL-regulating active substances such as D4F and reverse D4F. D4F), LXR-regulated active substances and FXR-regulated active substances; CETP inhibitors, such as torcetrapib, JTT-705 / dalcetrapib, or compound 12 (anacetrapib) from WO2007 / 005572; LDL receptor modulators; MTP inhibitors (e.g., lomitapide) and ApoB100 antisense RNA.
[0532] Atorvastatin is typically taken in doses of 1 mg to 40 mg or 10 mg to 80 mg once daily.
[0533] Examples of combination therapies used to lower blood pressure include: beta-blockers such as atenolol, bisoprolol, celilol, metoprolol, and carvedilol; diuretics such as hydrochlorothiazide, chlorthalidone, sipamide, furosemide, pyrrolidone, torasemide, spironolactone, eplerenone, amiloride, and triamterene; and calcium channel blockers such as amlodipine, nifedipine, nifedipine, nisoldipine, nicardipine, felodipine, lacidipine, and lercanipidine. Manidipine, isadipine, nivadipine, verapamil, golopamil, and diltiazem; ACE inhibitors, such as ramipril, lisinopril, cilazapril, quinapril, captopril, enalapril, benazepril, perindopril, fosinopril, and qundopril; and angiotensin II receptor blockers (ARBs), such as telmisartan, candesartan, valsartan, losartan, irbesartan, olmesartan, azilsartan, and eprosartan.
[0534] The usual dosage of telmisartan is 20 mg to 320 mg or 40 mg to 160 mg per day.
[0535] Examples of concomitant combination drugs that increase HDL concentration in the blood include cholesterol ester transporter (CETP) inhibitors; endothelial lipase inhibitors; ABC1 modulators; LXRα antagonists; LXRβ agonists; PPAR-δ agonists; LXRα / β modulators; and substances that increase the expression and / or plasma concentration of apolipoprotein AI.
[0536] Examples of concomitant combination drugs used to treat obesity include sibutramine; tetrahydrolipstatin (orlistat); alizyme (cetilistat); dexfenfluramine; axokine; cannabinoid receptor 1 antagonists, such as the CB1 antagonist rimonobant; MCH-1 receptor antagonists; MC4 receptor agonists; NPY5 and NPY2 antagonists (e.g., velneperitone); β3-AR agonists, such as SB-418790 and AD-9677; and 5HT2c receptor agonists, such as APD. 356 / lorcaserin; tubocurarine inhibitors; Acrp30 and adiponectin; stearoyl-CoA desaturase (SCD1) inhibitors; fatty acid synthase (FAS) inhibitors; CCK receptor agonists; ghrelin receptor modulators; PyY 3-36; arixin receptor antagonists; and tesofensine; as well as dual combinations of buprivin / naltrexone, buprivin / zonisamide, topiramate / phentermine, and pramlintide / metriptin.
[0537] Examples of concomitant combination therapies for the treatment of atherosclerosis include phospholipase A2 inhibitors; tyrosine kinase inhibitors (50 mg to 600 mg), such as PDGF receptor-kinase (see EP-A-564409, WO 98 / 35958, US 5093330, WO2004 / 005281 and WO 2006 / 041976); oxLDL antibodies and oxLDL vaccines; apoA-1 Milano; ASA; and VCAM-1 inhibitors.
[0538] The scope of this invention is not limited to the specific embodiments described herein. In addition to those described herein, various modifications of this invention will be apparent to those skilled in the art from the disclosure of this invention. These modifications are intended to be included within the scope of the appended claims.
[0539] All patent applications cited in this document are incorporated herein by reference in their entirety.
[0540] Other embodiments, features, and advantages of the present invention will become clear from the following examples. These examples are intended to illustrate the principles of the invention by way of example, and are not intended to limit it.
[0541] Example
[0542] Example 1: The potent and selective DPP-4 inhibitor BI 1356 is safe and effective in patients with type 2 diabetes whose glycemic control remains inadequate despite metformin treatment.
[0543] The efficacy and safety of the potent and selective dipeptidyl peptidase-4 (DPP-4) inhibitor BI 1356 (1 mg, 5 mg, or 10 mg once daily) was investigated in patients with type 2 diabetes mellitus (T2DM; baseline HbA1c 7.5% to 10.0%) who were poorly controlled with metformin (MET, ≥1 g daily). The effects of additional placebo (PBO) or open-label glimepiride (GLIM; 1 to 3 mg once daily) were compared in a 12-week randomized, double-blind trial. Patients who did not have metformin or other antidiabetic medications were required to discontinue use for 6 weeks (34.7% of patients).
[0544] The primary endpoint was the change in baseline HbA1c (adjusted for prior antidiabetic medication). 333 patients (mean baseline HbA1c 8.3%; fasting plasma glucose [FPG] 185 ml / dL) were randomized to BI 1356, PBO, or open-label GLIM. After 12 weeks, BI 1356 treatment resulted in a significantly lower mean placebo-adjusted HbA1c (BI 1356 1 mg, n = 65, -0.39%; 5 mg, n = 66, -0.75%; 10 mg, n = 66, -0.73%). Patients receiving GLIM showed a slightly larger mean PBO-adjusted HbA1c reduction at week 12 (n = 64, -0.90%). The decrease in FPG from baseline at week 12 after BI 1356 treatment was statistically significant (1 mg; -19 mg / dL; 5 mg, -35 mg / dL; 10 mg, -30 mg / dL). Therefore, dose-response relationships demonstrated that HbA1c and FPG reached an effect plateau at BI 1356 5 mg. At this dose, >80% of patients at the trough achieved >80% DPP-4 inhibition at week 12.
[0545] A total of 106 patients (43.1%) experienced adverse events (AEs), with similar incidence rates across all treatment groups. The most common symptoms were nasopharyngitis (7.5%), diarrhea (3.3%), and nausea (3.0%). No medication-related hypoglycemia occurred in the BI 1356 or PBO groups, but it did occur in 3 patients in the GLIM group. Ten patients (3.7%) experienced serious AEs but considered these reactions unrelated to the medication.
[0546] In patients with type 2 diabetes whose glycemic control remained inadequate despite metformin monotherapy, the addition of BI 1356 to metformin resulted in a clinically relevant and statistically significant reduction in HbA1c. Combination therapy with metformin at doses of 1 mg, 5 mg, and 10 mg was well-tolerated without hypoglycemia. The incidence of adverse events (AEs) was comparable to that of BI 1356 and PBO.
[0547] Example 2:
[0548] Clinical trials can be used to test the availability of the DPP-4 inhibitors or combinations of the present invention for the purposes of the present invention (e.g., beneficial effects on glycemic control).
[0549] For example, in a randomized, double-blind, placebo-controlled, parallel-group trial, the safety and efficacy of the DPP-4 inhibitor of the present invention (e.g., liraristine, 5 mg orally once daily) were tested in patients with type II diabetes whose glycemic control was inadequate (HbA1c 7.0% to 10%, 7.5% to 10%, or 7.5% to 11%) despite treatment with one or two conventional antihyperglycemic agents, such as metformin, thiazolidinediones (e.g., pioglitazone), sulfonylureas, linenide, alpha-glucosidase inhibitors, GLP-1 or GLP-1 analogs, and insulin or insulin analogs.
[0550] In studies using sulfonylureas, the efficacy and safety of adding the DPP-4 inhibitor of the present invention (compared to placebo) to the background treatment of sulfonylureas were investigated (2-week placebo induction period; 18-week double-blind treatment period, followed by a 1-week follow-up period after study drug termination; the background treatment of sulfonylureas was administered at a constant dose throughout the trial (including the placebo induction period)).
[0551] The success of the treatment was determined by measuring HbA1c values and comparing them with initial values and / or placebo values. A significant change in HbA1c values compared to initial and / or placebo values demonstrated the effectiveness of the DPP-4 inhibitor. The success of the treatment was also determined by measuring fasting plasma glucose values and comparing them with initial and / or placebo values. A significant decrease in fasting glucose concentration demonstrated the effectiveness of the treatment. Furthermore, the achievement of a target response (i.e., HbA1c <7%) demonstrated the effectiveness of the treatment.
[0552] The safety and tolerability of the treatment were studied by assessing the patient’s condition and relevant changes from baseline, such as the incidence and severity of adverse events (e.g., hypoglycemic episodes) or weight gain.
[0553] Example 3: Treatment of prediabetes
[0554] Clinical studies can be used to test the efficacy of the pharmaceutical compositions or combinations of the present invention in treating prediabetes characterized by pathological fasting glucose and / or impaired glucose tolerance. In shorter-term studies (e.g., 2-4 weeks), treatment success is assessed by measuring fasting glucose levels and / or postprandial or loading test (oral glucose tolerance test or food tolerance test after a predetermined meal) at the end of the treatment period and comparing them to these values before the start of the study and / or to these values in the placebo group. Additionally, fructosamine levels can be measured before and after treatment and compared to initial values and / or placebo values. A significant reduction in fasting or non-fasting glucose levels demonstrates treatment efficacy. In longer-term studies (12 weeks or more), treatment success is assessed by measuring HbA1c levels and comparing them to initial values and / or placebo values. A significant change in HbA1c values compared to initial values and / or placebo values demonstrates the efficacy of the DPP-4 inhibitors or combinations of the present invention for treating prediabetes.
[0555] Example 4: Prevention of overt type 2 diabetes
[0556] Treatment of patients with pathologically impaired fasting glucose and / or glucose tolerance (prediabetes) also aims to prevent the progression to overt type 2 diabetes. Treatment efficacy can be investigated in comparative clinical studies involving long-term (e.g., 1-5 years) treatment of prediabetic patients with the pharmaceutical compositions or combinations of the present invention, or placebo, or non-pharmacological or other medications. During and at the end of treatment, fasting glucose and / or a loading test (e.g., oGTT) are used to determine how many patients exhibit overt type 2 diabetes, defined as a fasting glucose level >125 mg / dL and / or a 2-hour oGTT value >199 mg / dL. The significant reduction in the number of patients exhibiting overt type 2 diabetes when treated with the DPP-4 inhibitors or combinations of the present invention compared to another form of treatment demonstrates effectiveness in preventing the progression from prediabetes to overt diabetes.
[0557] Example 5: Treatment of Type II Diabetes
[0558] Treatment of patients with type 2 diabetes using the pharmaceutical compositions or combinations of the present invention not only produces a rapid improvement in glucose metabolism but also provides long-term protection against metabolic deterioration. This result can be observed in patients treated with the pharmaceutical compositions or combinations of the present invention for extended periods (e.g., 3 months to 1 year or even 1 to 6 years) and in comparison with patients treated with other antidiabetic drugs. If no increase or only a slight increase in fasting glucose and / or HbA1c levels is observed, this indicates treatment success compared to patients treated with other antidiabetic drugs. Further evidence of treatment success is obtained if a significantly smaller percentage of patients treated with the pharmaceutical compositions or combinations of the present invention experience a deterioration in glucose metabolism (e.g., HbA1c levels increase to >6.5% or >7%) to the extent indicating the need for additional oral antidiabetic drugs or insulin or insulin analogues compared to patients treated with other drugs.
[0559] Example 6: Treatment of Insulin Resistance
[0560] Treatment success was assessed using hyperinsulinemia-euglycemia clamp studies in clinical studies of varying durations (e.g., 2 weeks to 12 months). Significantly increased glucose infusion rates at the end of the studies compared to initial values, placebo groups, or groups receiving different therapies demonstrated the effectiveness of the DPP-4 inhibitor, pharmaceutical composition, or combination therapy of the present invention in treating insulin resistance.
[0561] Example 7: Treatment of hyperglycemia
[0562] In clinical studies of varying durations (e.g., 1 day to 24 months), treatment success in patients with hyperglycemia was assessed by measuring fasting or non-fasting glucose (e.g., postprandial, after an oGTT load test, or after a restricted meal). Significant reductions in these glucose values during or at the end of the study compared to initial values, placebo groups, or groups receiving different therapies demonstrate the effectiveness of the DPP-4 inhibitor, pharmaceutical composition, or combination therapy of the present invention for treating hyperglycemia.
[0563] Example 8: Prevention of microvascular or macrovascular complications
[0564] Treatment of patients with type 2 diabetes or prediabetes using the DPP-4 inhibitors, pharmaceutical compositions, or combinations of the present invention prevents or reduces microvascular complications (e.g., diabetic neuropathy, diabetic retinopathy, diabetic nephropathy, diabetic foot, diabetic ulcers) or macrovascular complications (e.g., myocardial infarction, acute coronary syndrome, unstable angina, stable angina, stroke, peripheral artery occlusive disease, cardiomyopathy, heart failure, arrhythmia, restenosis) or reduces the risk of developing these complications. Long-term (e.g., 1-6 years) treatment of patients with type 2 diabetes or prediabetes using the pharmaceutical compositions or combinations of the present invention, compared with patients already treated with other antidiabetic drugs or placebo. A lower number of single or multiple complications compared to patients treated with other antidiabetic drugs or placebo indicates treatment success. In cases of macrovascular events, diabetic foot, and / or diabetic ulcers, the number is calculated through past medical history and multiple testing methods. In cases of diabetic retinopathy, treatment success is determined by computer-controlled illumination and assessment of the fundus or other ophthalmic methods. In cases of diabetic neuropathy, in addition to medical history and clinical examination, nerve conduction velocity can be measured using, for example, a calibrated tuning fork. Regarding diabetic nephropathy, the following parameters can be studied before, during, and at the end of the study: albumin secretion, creatinine clearance, serum creatinine levels, time to double serum creatinine levels, and time until dialysis is necessary.
[0565] Example 9: Treatment of Metabolic Syndrome
[0566] The efficacy of the DPP-4 inhibitor, pharmaceutical composition, or combination thereof can be tested in clinical studies of varying durations (e.g., 12 weeks to 6 years) by measuring fasting or non-fasting glucose (e.g., postprandial, after an oGTT load test, or after a restricted meal) or HbA1c values. Significant reductions in these glucose or HbA1c values during or at the end of the study, compared to initial values or a placebo group, or a group treated with different therapies, demonstrate the efficacy of the active substance or combination of active substances in treating metabolic syndrome. Examples include reductions in systolic and / or diastolic blood pressure, plasma triglycerides, total cholesterol or LDL cholesterol, elevated HDL cholesterol, or weight loss compared to initial values at the start of the study or in patient groups treated with placebo or different therapies.
[0567] Example 10: Treatment response to DPP-4 inhibitor therapy
[0568] Genomic DNA samples are obtained from individual patients recruited in clinical trials (e.g., the clinical studies described herein) of DPP-4 inhibitors (e.g., liraliptin, for example, at an oral dose of 5 mg daily, optionally in combination with one or more other antidiabetic drugs). Genotyping is performed on variants (e.g., polymorphisms) in one or more candidate genes selected from TCF7L2, KCNJ11, PPARG, and GLP1R, particularly the TCF7L2 risk genotype as described herein, and the response is assessed relative to each patient in the clinical trial (see, for example, Example 21). The correlation between the probability of a favorable DPP-4 inhibitor treatment response (e.g., a favorable change in HbA1c value) (e.g., increased probability, decreased probability, or no probability) and the gene variant (e.g., the TCF7L2 risk genotype) or a reference can be investigated by applying statistical analysis to the genotyping results.
[0569] The probability of a favorable response in an individual resulting from treatment with a DPP-4 inhibitor can therefore be determined by genotyping an individual’s nucleic acid sample, for example by detecting one or more single nucleotide polymorphisms in the TCF7L2 gene, such as SNPs selected from rs7903146, rs12255372 and rs10885406, or by detecting their respective wild-type genotypes (see, for example, Example 21).
[0570] Methods for genotyping, i.e., identifying genetic variants (e.g., polymorphisms, especially those described herein) in a patient's nucleic acid sample, are known in the art. For example, molecular genetic methods for detecting single nucleotide polymorphisms within the TCF7L2 gene can be based on gene sequencing, microarray, or PCR analysis.
[0571] Example 11: Liraristine monotherapy improves glycemic control and regulates β-cell function in type 2 diabetes.
[0572] This study compared the effects of liraristine (LI) monotherapy (5 mg once daily) versus placebo (PBO) in a multicenter, 24-week, randomized, double-blind, placebo-controlled, parallel-group study of patients with type 2 diabetes mellitus (T2DM) (baseline HbA1c 4.9–10.6%) who had not previously used medication or had been previously treated. Patients were randomized to either LI (n = 336) or PBO (n = 167) and then underwent a 2-week PBO induction (previously treated patients cleared the drug 4 weeks prior to induction). Mean baseline demographics (HbA1c, 8.0% [SD 0.87]; fasting plasma glucose (FPG), 166.0 mg / dL [41.1]; body mass index (BMI), 29.05 kg / m²) were as follows: 2[4.81]; age, 55.7 years [10.2]) was similar in both groups. The primary endpoint was the change in HbA1c from baseline after 24 weeks of treatment. LI showed a PBO-adjusted change in HbA1c from baseline of -0.69% (p<0.0001), with a continuous decrease in HbA1c over time (from -0.46% at 6 weeks to -0.69% at 24 weeks (p<0.0001 for both). LI patients were more than 4 times more likely to achieve a ≥0.5% reduction in HbA1c at 24 weeks than PBO patients (47.1% vs. 19.0%; p<0.0001). For patients with baseline HbA1c ≥ 7.0%, significantly more patients treated with LI achieved the target HbA1c reduction to < 7.0% at week 24 compared to those treated with PBO (25.2% vs. 11.6%; odds ratio 2.9, p = 0.0006). Patients with baseline HbA1c concentrations ≥ 9.0% showed the largest reduction in HbA1c from baseline (-0.86%). Compared to PBO, FPG improvement was -23.3 mg / dL (p < 0.0001). In the dietary tolerance trial, compared to PBO, LI patients showed a greater reduction in the adjusted mean change from baseline for 2-hour postprandial glucose (PPG) at week 24 (-58.4 mg / dL; p < 0.0001). Liraristine (LI) increased insulin secretion (p<0.05), as shown by changes in the HOMA-%B index (LI, 5.02 vs. PBO, -17.2 [(mU / L) / (mmol / L)]), proinsulin / insulin ratio (LI, -0.015 vs. PBO, 0.024), and disposition index (LI, 3.05 vs. PBO, -0.68). The proportion of patients reporting at least one adverse event (AE) was similar in both groups (LI, 52.4%; PBO, 58.7%). Hypoglycemia was rare, occurring in only one patient in each group. Serious AEs were reported in both groups (LI, 3.0%; PBO, 4.2%), but were considered unrelated to the drug. Liraristine trough concentrations in patients with mild to moderate renal impairment were similar to those in patients with normal renal function.
[0573] Conclusion: Liraristine monotherapy demonstrated significant, clinically meaningful, and sustained improvements in glycemic control (reflected in changes in FPG and HbA1c) accompanied by improvements in β-cell function. Liraristine is safe and well-tolerated, and there were no clinically significant changes in weight or waist circumference. The trough concentrations of liraristine in patients with mild to moderate renal impairment were similar to those in patients with normal renal function, supporting the assumption that dose adjustment is not necessary in patients with renal impairment.
[0574] Example 12: Efficacy and safety of liraliptin in type 2 diabetes that is not adequately controlled by metformin monotherapy
[0575] A multicenter, 24-week, randomized, placebo-controlled, double-blind, parallel-group study examined the efficacy and safety of liraristine (LI) as adjunctive therapy to metformin (MET) in patients with inadequate glycemic control (HbA1c ≥7 to ≤10.0% for patients previously treated with metformin; or ≥6.5 to ≤9.0% for patients previously treated with other oral antihyperglycemic agents) in patients with type 2 diabetes mellitus (T2DM) with hyperglycemia. Participants entering the screening period discontinued their previous antidiabetic medications other than MET (≥1500 mg / day) for 6 weeks (including a placebo (PBO) introduction period in the last 2 weeks) and were then randomized to LI (n=524) or PBO (n=177). Mean baseline characteristics and demographics (HbA1c, 8.1%; fasting plasma glucose [FPG], 168.8 mg / dL; age, 56.5 years; BMI, 29.9 kg / m²) were also considered. 2 Similarities were observed in both groups. The primary endpoint was the change in HbA1c from baseline after 24 weeks of treatment (adjusted for baseline HbA1c and previous antidiabetic medication), assessed using analysis of covariance (ANCOVA). After 24 weeks of treatment, the adjusted mean treatment difference between LI+MET and PBO+MET was -0.64% (p<0.0001), with LI+MET being more favorable for the change (%) in HbA1c. Patients receiving LI+MET with baseline HbA1c ≥7.0% were more likely to achieve HbA1c ≤7.0% compared to those receiving placebo+MET (26.2% vs. 9.2%, odds ratio 4.4; p = 0.0001). At week 24, LI+MET was superior to PBO+MET in reducing mean fasting plasma glucose (FPG) from baseline (-21.1 mg / dL; p<0.0001). At the end of the study, the LI+MET treatment group showed a significantly greater mean reduction in 2-hour postprandial glucose (PPG) analyzed in the dietary tolerance test compared to the PBO+MET group (-67.1 mg / dL, p<0.0001). The proportion of patients reporting at least one adverse event (AE) was similar in the LI+MET and PBO+MET groups (52.8% and 55.4%, respectively). Hypoglycemia was rare, occurring in 5 PBO+MET patients (2.8%) and 3 LI+MET patients (0.6%), all of which were mild. Changes in weight from baseline to 24 weeks were similar in both treatment groups (-0.5 kg PBO+MET; -0.4 kg LI+MET).
[0576] Conclusion: Liraristine 5 mg (once daily) as adjunctive therapy was well tolerated in patients with type 2 diabetes mellitus (T2DM) whose glycemic control was not adequately controlled by metformin, producing significant and clinically meaningful improvements in glycemic control (decreases in HbA1c, FPG, and 2h PPG, but without weight gain). Liraristine as adjunctive therapy was well tolerated in T2DM patients with inadequate glycemic control, and the incidence of adverse events was comparable to that of placebo.
[0577] Example 13: Liraristine improves glycemic control in patients with type 2 diabetes whose blood sugar is not adequately controlled by metformin and sulfonylureas without causing weight gain or hypoglycemia.
[0578] A multicenter, 24-week, randomized, double-blind, placebo-controlled, parallel-group study examined the efficacy and safety of the DPP-4 inhibitor liraristine (LI; 5 mg once daily) in patients with type 2 diabetes mellitus (T2DM) (HbA1c 7.0–10.0%) who still had inadequate glycemic control despite combination therapy with metformin (MET) plus sulfonylurea (SU). The role of LI as an adjunct therapy was compared with placebo (PBO). All patients had a 2-week PBO induction and were then randomized to either LI+MET+SU (n=793) or PBO+MET+SU (n=265). Mean baseline characteristics were: HbA1c, 8.14% (SD 0.8); fasting plasma glucose (FPG), 160.1 mg / dL (36.6); age, 58.1 years (9.8); BMI, 28.3 kg / m². 2(4.7). Most patients (73.3%) had T2DM for more than 5 years prior to enrollment. The primary endpoint was the change in HbA1c from baseline after 24 weeks of treatment (adjusted for baseline HbA1c). After 24 weeks of treatment, the mean HbA1c of LI+MET+SU was 0.62% lower than that of PBO+MET+SU (p<0.0001). The maximum mean HbA1c reduction (-0.84%) was observed with LI+MET+SU at week 12. At 24 weeks, patients with baseline HbA1c ≥7.0% treated with LI+MET+SU (29.2%) were more than 5 times more likely to achieve a target HbA1c of <7.0% than those treated with PBO+MET+SU (8.1%, odds ratio 5.5, p<0.0001). At week 24, a statistically significant (p<0.0001) adjusted mean difference of -12.7 mg / dL was observed between LI+MET+SU and BPBO+MET+SU in terms of changes in FPG from baseline. Significant (p≤0.05) improvements in regulation of β-cell function (fasting plasma insulin and HOMA-%B) and HOMA-IR were observed with LI+MET+SU compared to PBO+MET+SU. The proportion of patients reporting serious adverse events (AEs) was lower in both the LI+MET+SU and PBO+MET+SU groups (2.4% vs. 1.5%, respectively). The most frequent AE reported more often in the LI+MET+SU group than in the PBO+MET+SU group was hypoglycemia (22.7% vs. 14.8%, respectively). This was expected to be due to the combination with SU. No significant changes in body weight were observed in either treatment group.
[0579] Conclusion: Liraristine in combination with metformin and sulfonylureas is effective and safe in treating patients with type 2 diabetes mellitus (T2DM) to produce significant and clinically meaningful improvements in glycemic control. In many patients whose glycemic control is inadequate with metformin and sulfonylureas, liraristine can provide an additional option before insulin therapy. Liraristine has shown a favorable safety and tolerability profile. However, hypoglycemia may occur when liraristine is added to existing sulfonylurea therapy.
[0580] Example 14: Efficacy and safety of initial combination therapy with liraliptin and pioglitazone in patients with poorly controlled type 2 diabetes.
[0581] A multicenter, 24-week, randomized, double-blind, placebo-controlled, parallel-group study examined the efficacy and safety of initial combination therapy with the DPP-4 inhibitor liraristine (LI) and pioglitazone (PIO). Patients with type 2 diabetes mellitus (T2DM) whose glycemic control remained inadequate (HbA1c 7.5–11.0%) and had not previously received any medication or had been treated with any oral antihyperglycemic agent (OAD) were randomized to receive either 5 mg LI plus 30 mg PIO once daily (n=259) or 30 mg PIO plus placebo (PBO) once daily (n=130). Patients had not taken any OAD for at least 6 weeks prior to randomization. Mean baseline characteristics (HbA1c 8.6%; fasting plasma glucose [FPG] 190 mg / dL; age 57.5 years; BMI 29.0 kg / m²) were as follows: 2 Similarities were observed in both groups. The primary endpoint was the change in HbA1c from baseline after 24 weeks of treatment (adjusted for baseline HbA1c and previous antidiabetic medication). After 24 weeks of treatment, the adjusted mean change in HbA1c in the LI+PIO group (full analysis set, carry-over from last observation) was -1.06% (standard error (SE) ± 0.06). The difference in adjusted mean HbA1c between the LI+PIO group and PBO+PIO was -0.51% (p < 0.0001; 95% confidence interval (CI), -0.71, -0.30). At 24 weeks, the reduction in FPG was significantly greater in the LI+PIO group compared to PBO+PIO, with a treatment difference of -14.2 mg / dL (p < 0.0001; 95% confidence interval (CI), -21.1, -7.3). Patients in the LI+PIO group were more likely than those in the PBO+PIO group to achieve a target HbA1c reduction of <7% (42.9% vs. 30.5%, odds ratio 2.1; p = 0.0051) and a reduction of ≥0.5% in HbA1c (75% vs. 50.8%, odds ratio 3.8; p < 0.001). The proportion of patients experiencing at least one adverse event (AE) was similar in the LI+PIO and PBO+PIO groups (136%, 52.5% vs. 53.1%, respectively). Hypoglycemia was rare, observed in 3 patients (1.2%) in the LI+PIO group, but not in the PBO+PIO group. All hypoglycemic events were mild.
[0582] Conclusion: Compared with PIO monotherapy, initial combination therapy with liraristine and pioglitazone demonstrated significant and clinically meaningful improvements in FPG and HbA1c levels, as well as greater improvements in β-cell function. The co-administration of liraristine and pioglitazone was shown to be safe and well-tolerated. Combination therapy with liraristine and pioglitazone provides an important synergistic initial treatment option for patients with type 2 diabetes mellitus (T2DM) who have inadequate glycemic control or renal impairment and are contraindicated for metformin.
[0583] Example 15: Improved glycemic control in Japanese patients with type 2 diabetes after 12 weeks of liraristine monotherapy
[0584] A multicenter, 12-week, randomized, double-blind, placebo-controlled, parallel-group study examined the efficacy and safety of the DPP-4 inhibitor liraristine (LI). The effects of LI monotherapy (5 mg once daily and 10 mg once daily) versus placebo (PBO) were compared in drug-naïve or previously treated Japanese patients with type 2 diabetes mellitus (T2DM) (baseline HbA1c 7.0–10.0% if drug-naïve, 7.0–9.0% if previously treated). All patients underwent a 2-week PBO induction (patients receiving antihyperglycemic agents did not receive medication for 2 weeks prior to induction) and were then randomized to either LI 5 mg (n=159), LI 10 mg (n=160), or PBO (n=80). Mean [SD] baseline characteristics and demographics (HbA1c, 8.0% [0.68]; fasting plasma glucose (FPG), 163.5 mg / dL [32.4]; BMI, 24.97 kg / m²) 2[3.86]; Age (60.0 years [9.7]) was similar across all groups. The primary endpoint was the change in HbA1c from baseline after 12 weeks. At week 12, the difference in the adjusted mean change in HbA1c from baseline was -0.87% for LI 5 mg relative to PBO (p<0.0001) and -0.88% for LI 10 mg relative to PBO (p<0.0001). After 12 weeks, the proportion of patients reaching HbA1c <7.0% was 26.4% for LI 5 mg, 35.7% for LI 10 mg, and 10.0% for PBO. The proportion of patients with a decrease in HbA1c level of at least 0.5% was 57.2% for LI 5 mg, 59.9% for LI 10 mg, and 8.8% for PBO. Both the LI 5 mg and 10 mg groups showed statistically significant differences in PBO (p<0.0001). Compared with PBO, both LI 5 and 10 mg significantly improved FPG: the difference in adjusted mean change from baseline after 12 weeks was -19.7 mg / dL for LI 5 mg relative to PBO (p<0.0001) and -20.4 mg / dL for LI 10 mg relative to PBO (p<0.0001). LI also significantly improved insulin secretion, as indicated by changes in the proinsulin / insulin ratio (LI 5 mg, p = 0.0065; LI 10 mg, p = 0.0004). The proportion of patients experiencing at least one adverse event (AE) was similar across the three groups (56.0% LI 5 mg, 53.1% LI 10 mg, and 56.3% PBO). Of these, 9.4%, 8.8%, and 10.0%, respectively, were evaluated as drug-related. No investigator-defined hypoglycemic episodes were observed. There was no change in body weight in the LI 5mg and 10mg groups, which were -0.39 and -0.06 kg respectively, and there was no significant difference compared with PBO (-0.04 kg).
[0585] Conclusion: In Japanese patients with type 2 diabetes mellitus (T2DM), liraristine demonstrated significant and clinically meaningful improvements in glycemic control, reflected in changes in HbA1c and fasting plasma glucose (FPG). Both 5 mg and 10 mg doses of liraristine showed similar efficacy in lowering HbA1c and were well tolerated in this population. The 5 mg dose of liraristine was the treatment dose for Japanese patients, which is the same as the treatment dose for Caucasians.
[0586] Example 16: Liraristine provides better glycemic control in Japanese patients with type 2 diabetes compared to voglibose as monotherapy.
[0587] A multicenter, 26-week, randomized, double-blind, active-drug-controlled, parallel-group study compared the efficacy and safety of the DPP-4 inhibitor liraristine (LI) and the alpha-glucosidase inhibitor voglibose (VB) in Japanese patients with type 2 diabetes mellitus (T2DM) who had never used medication or had previously been treated (baseline HbA1c of 7.0–10.0% if medication-naïve, and 7.0–9.0% if previously treated with oral antihyperglycemic agents (OADs)).
[0588] Following a 2-week PBO induction, patients were randomly assigned to either the LI 5 (n=159) or 10 mg (n=160) group, administered once daily, or the VB group (0.2 mg, administered three times daily; n=162). Any prior OAD treatment was discontinued 2 weeks prior to induction. Mean baseline [SD] characteristics and demographics (HbA1c, 8.01% [0.68]; fasting plasma glucose (FPG), 163.5 mg / dL [32.4]; BMI, 24.97 kg / m²) were also considered. 2 [3.86]; Age (60.0 years [9.7]) was similar across groups. The primary endpoint was the change in HbA1c from baseline after 26 weeks. The difference in the adjusted mean change in HbA1c from baseline at week 26 was -0.32% for LI 5 mg compared to VB (p = 0.0003) and -0.39% for LI 10 mg compared to VB (p < 0.0001). The proportion of patients achieving HbA1c < 7.0% after 26 weeks was 30.2% for LI 5 mg, 34.4% for LI 10 mg, and 22.2% for VB. The proportion of patients with a ≥ 0.5% reduction in HbA1c levels was 57.2% for LI 5 mg and 53.5% for LI 10 mg, and 37.7% for VB. Compared with VB, both LI 5 mg and 10 mg significantly improved FPG: the difference in adjusted mean change from baseline was -6.9 mg / dL for LI 5 mg compared to VB (p = 0.02) and -9.8 mg / dL for LI 10 mg compared to VB (p = 0.0015). In patients previously treated with one OAD, both LI 5 mg and 10 mg showed significant reductions in HbA1c compared to VB (p = 0.003 and p = 0.0011, respectively). The incidence of ≥1 adverse event (AE) was similar across groups (LI 5 mg 72.3%, LI 10 mg 77.5%, VB 71.6%). Of the AEs, 11.3%, 10.6%, and 18.5% were evaluated as drug-related, respectively. Drug-related gastrointestinal disturbances were more common in the VB group (14.2%) than in the LI group (5 mg, 8.2%; 10 mg, 8.1%). One episode of hypoglycemia was reported in the VB group, while none occurred in the LI group.
[0589] Conclusion: In Japanese patients with type 2 diabetes mellitus (T2DM), liraristine monotherapy demonstrated greater efficacy than vitamin B (VB) in improving glycemic control. After 26 weeks, liraristine 5 mg and liraristine 10 mg showed comparable efficacy compared to VB, demonstrating statistically significant reductions in HbA1c and FPG from baseline. Compared to VB, liraristine was well tolerated in Japanese T2DM patients with fewer gastrointestinal adverse events (AEs) and offers a valuable available treatment option for this population. 5 mg of liraristine was the treatment dose for Japanese patients, consistent with the treatment dose for Caucasians.
[0590] Example 17: Liralitin restores β-cell function and survival in isolated human islets:
[0591] Studies in diabetic animal models have shown that dipeptidyl peptidase-4 (DPP-4) inhibitors reverse hyperglycemia and increase β-cell mass. Here, the effects of liraristine (a DPP-4 inhibitor) on human β-cell function were investigated: isolated human islets were exposed to escalating concentrations of glucose (5.5–33.3 mM), 0.5 mM palmitic acid, a mixture of 2 ng / mL IL-1β or 1,000 U / mL IFN-γ for 4 days, or to 50 μM H₂O₂ for 8 hours. Islets were pretreated for 1 hour with 500 ng / mL interleukin-1 receptor antagonist (IL-1Ra, which has been shown to restore β-cell function), 100 nM liraristine, or a solvent, followed by exposure to diabetic stimulation throughout the 4-day treatment period. Under control conditions, islets secreted 3.8 times more insulin at 16.7 mM glucose compared to 2.8 mM glucose. The difference was that when islets were exposed to 11.1 mM and 33.3 mM glucose, the stimulation index decreased by 1.9 and 2.4 times, respectively (P<0.05). Exposure of islets to palmitate, a mixture of cytokines, or H2O2 reduced glucose-stimulated insulin secretion (GSIS) by 2.1, 2.2, and 1.9 times, respectively (P<0.05). Liralitine significantly restored β-cell function under all conditions (GSIS increased by 1.9, 2.5, 3.3, 1.9, and 3.7 times, respectively, in 11.1 or 33.3 mM glucose, palmitate, cytokines, or H2O2, P<0.05). IL-1Ra was equally effective in restoring β-cell function under high glucose, palmitate, and cytokine conditions, but IL-1Ra could not restore β-cell function under H2O2-induced oxidative stress. Since the loss of function was mediated by oxidative stress, the concentration of nitrotyrosine in islet lysates was measured. In all diabetic conditions, the concentration of nitrotyrosine was significantly elevated in human islets (13, 14, 6, 14 and 8-fold increases in 11.1 or 33.3 mM glucose, palmitic acid, cytokines or H2O2, respectively, P<0.05), while no increase in nitrotyrosine production was observed in islets treated with liralistin.
[0592] In summary, the DPP-4 inhibitor liraristine has demonstrated protective effects against glucose toxicity, lipotoxicity, and cytokine toxicity comparable to IL-1Ra. Furthermore, it can improve β-cell function and inhibit (H2O2 treatment-induced) apoptosis under oxidative stress. This study provides evidence demonstrating the direct protective effect of liraristine on β-cell survival and insulin secretion.
[0593] Example 18: In rats, chronic kidney disease did not alter the pharmacokinetics of liraristine but increased exposure to sitagliptin and alogliptin.
[0594] Kidney injury is a common complication of type 2 diabetes mellitus (T2DM). The effects of dipeptidyl peptidase-4 inhibitors (liraliptin, sitagliptin, and alogliptin) on chronic kidney disease were investigated in a rat model of chronic renal insufficiency (5 / 6 nephrectomy, 5 / 6N). Eight weeks after surgery, rats were treated orally with the inhibitors for four days. 5 / 6N resulted in a significant (P<0.001) decrease in glomerular filtration rate (measured by creatinine clearance (sham-operated group: 2510±210 mL / 24 h; 5 / 6N: 1665±104.3 mL / 24 h)) and an increase in cystatin C concentration (sham-operated group: 700±35.7 ng / mL; 5 / 6N: 1434±77.6 ng / mL). Significantly impaired renal tubular function (P<0.001) was observed, as evidenced by plasma neutrophil gelatinase-associated lipotransferase (NGAL) levels (sham-operated group: 286±23 ng / ml; 5 / 6N: 680±56.3 ng / ml) and β2-microglobulin levels (sham-operated group: 20.4±2.4 μg / mL; 5 / 6N: 33.3±1.34 μg / mL). DPP-4 activity was similar across groups.
[0595] Administration of liraristine (0.5 and 7 μmol / kg) to 5 / 6N rats did not show significant changes in AUC (0–∞): sham-operated group: 316 ± 54.7 nmol*h / L; 5 / 6N: 257 ± 21.54 nmol*h / L; P = 0.771; sham-operated group: 1252 ± 372 nmol*h / L; 5 / 6N: 748 ± 74.5 nmol*h / L; P = 0.284. The difference was that both sitagliptin and alogliptin (7 μmol / kg) had significantly higher (41% and 28%) AUCs (0–∞) (P = 0.0001 and P = 0.039): sitagliptin sham-operated group: 3690 ± 103 nmol*h / L; 5 / 6N: 6238 ± 423 nmol*h / L; alogliptin sham-operated group: 1772 ± 225 nmol*h / L; 5 / 6N: 2445 ± 166 nmol*h / L. Furthermore, no correlation was observed between renal tubular and glomerular function markers and liraliptin AUC. The differences were that sitagliptin was significantly associated with creatinine clearance (r² = 0.374, P < 0.05), cystatin C (r² = 0.499, P < 0.01), NGAL (r² = 0.604, P < 0.01), and β2-microglobulin (r² = 0.543, P < 0.01). Alogliptin was not significantly associated with cystatin C (r² = 0.376, P < 0.05) and β2-microglobulin (r² = 0.391, P < 0.05), but not with creatinine clearance and NGAL.
[0596] These results demonstrate that renal impairment does not affect the pharmacokinetics of liraristine, but it increases exposure to sitagliptin and alogliptin. Therefore, unlike sitagliptin and alogliptin, liraristine does not require dose adjustment in patients with type 2 diabetes mellitus and renal impairment or diabetic nephropathy.
[0597] Furthermore, liraliptin significantly inhibited the mRNA expression of pro-fibrotic factors (such as TGF-β1, T1MP-1, and collagen (Col3α1)) in the hearts of uremic rats. These factors are tissue fibrosis markers of cardiac fibrosis and are increased in uremic hearts. Characteristic cardiomyopathy with intestinal expansion and fibrosis often develops in ureemia. Therefore, these anti-fibrotic properties of DPP-4 inhibitors could be used to treat uremic-related cardiac and renal damage, uremic heart, cardiac fibrosis, and / or cardiomyopathy with intestinal expansion and fibrosis in patients with type 2 diabetes. The anti-fibrotic effects of liraliptin could provide additional benefit to patients with chronic kidney disease and / or heart disease (which is often accompanied by type 2 diabetes).
[0598] Example 19: Liralidin improves hepatic steatosis in a rodent model:
[0599] Hepatic steatosis is a hallmark of type 2 diabetes mellitus and non-alcoholic fatty liver disease (NAFLD). Liraristine is a selective, non-renal excretionate dipeptidyl peptidase-4 (DPP-4) inhibitor.
[0600] The effects of liraristine (3 and 30 mg / kg / day, n=10) on 4 weeks of treatment were investigated in a diet-induced obesity model (DIO, 2 and 3 months of feeding). Hepatic lipid content was measured in vivo by nuclear magnetic resonance spectroscopy (MRS) and in vitro by analysis of liver triglycerides. Compared with control, liraristine significantly (P<0.001) inhibited DPP-4 activity by 67% to 80% and 79% to 89% (3 and 30 mg / kg / day, respectively). Blood glucose concentration (AUC) was significantly (P<0.01) reduced after OGTT, ranging from 16% to 20% (3 mg / kg / day) and 20% to 26% (30 mg / kg / day). Similarly, hepatic fat content (MRS measurement) was significantly reduced. Changes in hepatic fat content were observed as early as week 2 of treatment. The correlation between liver lipid content measured by MRS and liver triglyceride content measured in vitro was r² = 0.565 (p < 0.0001).
[0601] In addition, ob / ob mice were analyzed after 14 days of treatment with liraristine (3 mg / kg / day or control), and blinded histological scoring (severity and grade of fat content, inflammatory markers) was performed. DPP-4 activity was inhibited by 80% and blood glucose AUC decreased by 25% (P<0.05). Histological scoring revealed less hepatic steatosis and inflammation in the liraristine group (2.2±0.13, n=9, P<0.01) compared with the control group (3±0.18, n=10).
[0602] In summary, liraliptin significantly reduced hepatic steatosis and histological NAFLD in a high-fat diet model. Liraliptin reversed hepatic triglyceride levels and hepatic steatosis (with a greater therapeutic effect when hepatic steatosis was more pronounced). The reversal of hepatic steatosis supports the use of liraliptin in patients with type 2 diabetes and in patients with liver-related disease (NAFLD).
[0603] Example 20: Liraristin functionally eliminates the dysregulation of DPP-4 expression in damaged wounds of diabetic patients:
[0604] Impaired wound healing is a major complication of diabetes. The dipeptidyl peptidase-4 (DPP-4) inhibitor liraristine improves wound healing (as shown in ob / ob mice). The effects of liraristine on inflammatory markers were examined in injured skin, and a theoretical basis for the beneficial effects of liraristine on wound healing was provided.
[0605] The inflammatory markers COX-2 and MIP in wounds from liraristine (3 mg / kg / day) and mimic-treated ob / ob mice were investigated using a ribonuclease protection assay (these were not significantly different). Furthermore, liraristine did not increase the number of apoptotic infiltrating F4 / 80-positive macrophages. Therefore, DPP-4 expression in the skin of diabetic and non-diabetic animals was evaluated. Immunohistochemistry (IHC) and Western blotting revealed strong expression of DPP-4 in the skin of healthy and diabetic (ob / ob) mice, with keratinocytes as the primary cellular source of this enzyme. Similarly, after treatment with [3H]-labeled liraristine, the localization of DPP-4 protein in the skin was highly correlated with whole-body autoradiography. Analysis of DPP-4 expression in mice undergoing full-thickness excision wounds revealed that in healthy mice, DPP-4 protein expression decreased 3 days after injury, and the enzyme remained absent in the later stages of recovery. Interestingly, skin injury led to a high degree of downregulation of DPP-4 expression in regenerating keratinocytes at the wound margin (IHC). Unlike diabetic mice, no DPP-4 expression was observed in acute wounds. However, DPP-4 protein was expressed later in wound repair. This reversible regulation of DPP-4 protein in diabetic skin compared to non-diabetic skin provides a functional basis for the positive role of liraristine in wound healing. Therefore, the improvement of wound healing mediated by a suitable DPP-4 inhibitor (e.g., liraristine) depends on the compensation (inhibition) of dysregulated DPP-4 in diabetic wounds, rather than its role in glycemic or immunomodulatory effects. Therefore, a suitable DPP-4 inhibitor for improving wound healing is one that can effectively bind to DPP-4 in the skin, such as to dysregulated DPP-4 in diabetic wounds, preferably at a therapeutic dose concentration.
[0606] Furthermore, in this context, DPP-4 inhibitors suitable for improving wound healing (especially in patients with type II diabetes) are DPP-4 inhibitors that can be applied topically to wounds, for example, contained in wound dressings or patches, creams, or ointments. Therefore, the present invention also provides local devices for wounds, such as wound dressings or patches, comprising liraliptin and, optionally, one or more pharmaceutically acceptable carriers and / or excipients.
[0607] Example 21: Correlation Study (Genomic TCF7L2, Treatment Response)
[0608] The polymorphisms and variants of the TCF7L2 gene depicted in Table i can be analyzed as follows:
[0609] Table i: Genes, variant nucleotides, and rs numbers
[0610]
[0611] sample
[0612] The analytical method used was to employ patient samples (concentration: 50 ng / μl) in a 96-well plate.
[0613] Genotyping via direct Sanger sequencing
[0614] Using gDNA as a template, site-specific DNA fragments are amplified by polymerase chain reaction (PCR).
[0615] Using ABI PCR was performed using the Tetrad PCR system. The amount of PCR products was analyzed by agarose gel electrophoresis. The purified PCR products were used as templates in the sequencing reaction. Following the chain termination method of Sanger et al. (1977), DNA sequence analysis was based on terminated growing DNA strands due to the incorporation of dye-labeled 2',3'-dideoxynucleotide triphosphates (ddNTPs) by DNA polymerase. The purified sequencing products were analyzed using the 3730 gene analyzer.
[0616] Sequencing data were generated using the original ABI software. Subsequent KB-base identification and assembly were performed using the Staden software package. Utilizing the KB-base identification error probability, quality values were assigned to the identified bases across all automated sequencer traces. These quality values are used during the assembly of individual reads and are fundamental requirements for calculating sequence accuracy (Applied Biosystems, 3730 / 3730xl / DNA Analyzer Sequencing Analysis Software Training).
[0617] A quality value (q) of 20 corresponds to an error probability (ep) of 1 / 100, a value of 30 corresponds to an ep of 1 / 1000, and so on. During assembly, these values are set relative to each other. Generally, sequencing continues until each shared sequence base has a quality value (q) of 50 or greater. This corresponds to an error probability (ep) of 1 / 100,000. Because most shared sequence bases have quality scores even higher than the minimum quality score, the cumulative error probability of the final sequence calculation is significantly lower.
[0618] Sequencing data were uploaded and analyzed using software from jsi-medical systems (version Seq Pilot 3.3.2, JSImedical systems GmbH, Friedhofstr. 5, 77971 Kippenheim, Germany).
[0619] Only sequencing peaks that meet internal quality requirements will proceed to further genotyping analysis.
[0620] Genotyping was performed in the analysis of single polymorphisms, rather than in the analysis of the entire genome. Therefore, the genotyping results only pertain to the locations of the variants depicted in Table i.
[0621] Genotyping using TaqMan PCR
[0622] The technique involves amplifying PCR fragments while simultaneously detecting the degradation of labeled probes. The probes are labeled at both ends with an allele-specific dye and a quencher, respectively. During the amplification reaction, the specifically hybridized probes are replaced by DNA polymerase. This replacement occurs either by degradation via the 5' exonuclease activity of the polymerase when the probe is perfectly matched, or by no degradation when it is mismatched. Once degradation occurs, the quencher and dye are separated, and the fluorescence signal is enhanced. The enhancement of the fluorescence signal indicates the presence of the respective alleles. The fluorescence signal is recorded using an ABI PRISM 7700 system (Applied Biosystems).
[0623] In detail, prepare a Master Mix containing all PCR reaction components and aliquot it into the appropriate number of wells. Then, add DNA to each well according to the plate layout; do not add a template-free control (NTC).
[0624] AB analysis ID(rs7903146)C__29347861_10
[0625] SNP context sequence:
[0626] TAGAGAGCTAAGCACTTTTTAGATA[C / T]TATATAATTTAATTGCCGTATGAGG
[0627] The Mastermix presamples include:
[0628]
[0629] The loop condition is:
[0630]
[0631] AD Pre-reading and subsequent readings Performed on a 7900HT Fast Real system. Fluorescence measurements during plate readings were calculated using SDS software version 2.3, and Rn values were plotted against the signals from each well. The software was used to determine which SNP allele was present in each sample. NTCs should be given as undetermined.
[0632] Statistical analysis
[0633] To assess the homogeneity of treatment effects on the change from baseline in HbA1c after 24 weeks across genotype subtypes defined by the TCF7L2SNP rs7903146 genotype, an analysis of covariance (ANCOVA) model was applied to data from our four studies, incorporating the interaction between treatment and the covariate genotype. The statistical model included 'treatment', 'genotype', 'study', 'clearance period of previous oral antidiabetic medication (yes / no)', 'ethnicity', and the interaction term 'treatment * genotype' as a fixed effect and 'HbA1c baseline' as a linear covariate. The ANCOVA model provides an estimate of the mean change from baseline in HbA1c after 24 weeks of treatment for different genotypes, taking into account baseline clinical and demographic information.
[0634] Model-based paired comparisons were conducted between wild-type homozygous (genotype CC) and heterozygous (genotype CT) or rare homozygous (genotype TT) individuals receiving liraristine or combination therapy (liraristine + pioglitazone, liraristine + metformin, liraristine + metformin + sulfonylurea).
[0635] Furthermore, results from the corresponding ANCOVA models, excluding 'genotype' and 'treatment*genotype' fixed effects, were provided for the entire patient population studied (full analysis set, FAS) and the subgroups for which genetic analysis was performed (full analysis set of pharmacogenetic analysis, FASG) to demonstrate the comparability of the observed effects.
[0636] Using the software package SAS version 9.2 (SAS Institute Inc., Cary, North Carolina, USA) and S- 8.0 (Insightful Corp., Seattle, Washington, USA) was statistically evaluated.
[0637] Figure 1Mean baseline HbA1c values and 95% confidence intervals are shown for the following groups: the entire patient population studied (full analysis set, FAS), the subgroups for which genetic analysis was performed (full analysis set for pharmacogenetic analysis, FASG), and the subgroups defined by genotype (CC, CT, TT). The number of patients in placebo control and liraristine treatment is given in parentheses.
[0638] Figure 2 The study demonstrated a statistical correlation between carriers of the TCF7L2SNP rs7903146 genotype and the CC / CT genotype in terms of the likelihood of a favorable response to a therapeutically effective dose of liraliptin or a combination of liraliptin and other oral antidiabetic therapies.
[0639] Results are presented as point estimates and 95% confidence intervals for the mean change [%] in HbA1c from baseline after 24 weeks, estimated using an ANCOVA model. Results are given for the entire patient population studied (full analysis set, FAS), the subgroups that underwent genetic analysis (full analysis set of pharmacogenetic analysis, FASG), and subgroups defined by genotype (CC, CT, TT) within that subgroup. The number of patients in placebo control and liraristine treatment is given in parentheses.
[0640] Point estimates and 95% confidence intervals were also provided for comparisons of the differences [%] in HbA1c changes from baseline with liraristine treatment or combination therapy (liraristine + pioglitazone, liraristine + metformin, liraristine + metformin + sulfonylureas) between wild-type homozygous (genotype CC) and heterozygous (genotype CT) or rare homozygous (genotype TT) individuals. They produced statistically significant differences between TT and CC (p = 0.0192). (Other paired comparisons: CT vs. CC: p = 0.4359; CT vs. TT: p = 0.0712).
[0641] This indicates a significant association between wild-type homozygous genotype and treatment-induced reduction of HbA1c.
[0642] Formulation Examples
[0643] Examples of formulations obtained by methods known in the art are provided to illustrate the invention in more detail, rather than limiting the invention to the content of these examples. The term "active substance" means one or more compounds of the invention, i.e., a DPP-4 inhibitor or a second or third antidiabetic compound or a combination of two or three of these active ingredients, for example selected from the combinations listed in Tables 1 or 2. Other suitable formulations of the DPP-4 inhibitor liraristine may be those disclosed in application WO2007 / 128724, the disclosure of which is incorporated herein by reference. Other suitable formulations of other DPP-4 inhibitors are commercially available formulations, or formulations described in the patent applications cited in the "Prior Art" paragraph above, or those described in the literature, such as the current publication "Rote..." The formulation disclosed in "(Germany)" or "Physician's Desk Reference".
[0644] Example 1: Dry ampoules containing 75 mg of active substance per 10 ml
[0645] composition:
[0646] 75.0 mg of active ingredient
[0647] Mannitol 50.0mg
[0648] Add water for injection to a final volume of 10.0 ml.
[0649] preparation:
[0650] The active ingredient and mannitol were dissolved in water. After encapsulation, the solution was freeze-dried. To prepare a ready-to-use solution, the product was dissolved in water for injection.
[0651] Example 2: Dry ampoules containing 35 mg of active substance per 2 ml
[0652] composition:
[0653] 35.0 mg of active ingredient
[0654] Mannitol 100.0mg
[0655] Add water for injection to a final volume of 2.0 ml.
[0656] preparation:
[0657] The active ingredient and mannitol were dissolved in water. After encapsulation, the solution was freeze-dried.
[0658] To prepare a ready-to-use solution, the product was dissolved in water for injection.
[0659] Example 3: Tablets containing 50 mg of active ingredient
[0660] composition:
[0661]
[0662] preparation:
[0663] Mix (1), (2), and (3) with the aqueous solution of (4) and granulate. Add (5) to the dried granulated material. Compress the mixture into tablets that are biplanar, faceted on both sides, and have a slit indentation on one side.
[0664] Tablet diameter: 9mm.
[0665] Example 4: Tablets containing 350 mg of active ingredient
[0666] preparation:
[0667]
[0668] Mix (1), (2), and (3) with the aqueous solution of (4) and granulate. Add (5) to the dried granulated material. Compress the mixture into tablets that are biplanar, faceted on both sides, and have a slit indentation on one side.
[0669] Tablet diameter: 12mm.
[0670] Example 5: Capsules containing 50mg of active substance
[0671] composition:
[0672]
[0673] preparation:
[0674] Grind (1) with (3). Add this ground material to the mixture of (2) and (4) under vigorous mixing. Encapsulate this powder mixture into No. 3 hard gelatin capsules in a capsule filling machine.
[0675] Example 6: Capsules containing 350mg of active substance
[0676] composition:
[0677]
[0678] preparation:
[0679] Grind (1) with (3). Add this ground material to the mixture of (2) and (4) under vigorous mixing. Encapsulate this powder mixture into No. 0 hard gelatin capsules in a capsule filling machine.
Examples
Embodiment 2
[0231] 1-[(4-methyl-quinazolin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-(3-(R)-amino -piperidin-1-yl)-xanthine (cf. WO 2004 / 018468, Example 2(142)):
[0232]
[0233] 1-[([1,5]naphthyridine-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-((R)-3- Amino-piperidin-1-yl)-xanthine (cf. WO 2004 / 018468, Example 2(252)):
[0234]
[0235] 1-[(quinazolin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-((R)-3-amino-piperidine-1 -yl)-xanthine (refer to WO 2004 / 018468, Example 2(80)):
[0236]
Embodiment 136
[0238]
[0239] 1-[(4-methyl-quinazolin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-[(2-amino-2- Methyl-propyl)-methylamino]-xanthine (refer to WO 2006 / 029769, Example 2(1)):
[0240]
[0241] 1-[(3-cyano-quinolin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-((R)-3-amino- Piperidin-1-yl)-xanthine (refer to WO 2005 / 085246, Example 1(30)):
[0242]
[0243] 1-(2-cyano-benzyl)-3-methyl-7-(2-butyn-1-yl)-8-((R)-3-amino-piperidin-1-yl)- Xanthine (refer to WO 2005 / 085246, Example 1 (39)):
[0244]
[0245] 1-[(4-methyl-quinazolin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-[(S)-(2- Amino-propyl)-methylamino]-xanthine (refer to WO 2006 / 029769, Example 2(4)):
[0246]
[0247] 1-[(3-cyano-pyridin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-((R)-3-amino-piper Pyridin-1-yl)-xanthine (refer to WO 2005 / 085246, Example 1 (52)):
[0248]
[0249] 1-[(4-methyl-pyrimidin-2-yl)methyl]-3-methyl-7-(2-butyn-1-yl)-8-((R)-3-amino-piper Pyridin-1-yl)-xanthine (refer to WO 2005 / 085246, Exa...
Embodiment approach
[0469] According to a second embodiment, the kit comprises:
[0470] (a) a first container containing a dosage form comprising a DPP-4 inhibitor and a second or third antidiabetic agent and at least one pharmaceutically acceptable carrier, and
[0471] (b) a second container containing a dosage form comprising the third or second antidiabetic drug and at least one pharmaceutically acceptable carrier.
[0472] According to a third embodiment, the kit comprises:
[0473] (a) a first container containing a dosage form comprising a DPP-4 inhibitor and at least one pharmaceutically acceptable carrier, and
[0474] (b) a second container containing a dosage form comprising the second and third antidiabetic agents and at least one pharmaceutically acceptable carrier.
[0475] Another aspect of the invention is an article of manufacture comprising a pharmaceutical combination of the invention in separate dosage form and a label or insert comprising instructions for the separate dosa...
Claims
1. A pharmaceutical compound, composition, or combination thereof, comprising: (a) DPP-4 inhibitors, And, optional, (b) A second antidiabetic drug selected from group G3, said group G3 consisting of biguanide, thiazolidinedione, sulfonylurea, linene, α-glucosidase inhibitor, GLP-1 or a GLP-1 analog and insulin or an insulin analog, and optionally, (c) A third antidiabetic drug selected from group G3, different from (b), said group G3 consisting of biguanide, thiazolidinedione, sulfonylurea, linenide, α-glucosidase inhibitor, GLP-1 or a GLP-1 analog and insulin or an insulin analog. Or its pharmaceutically acceptable salt; Especially for treatment or prevention methods, such as treating type 2 diabetes, said methods include: The test determines whether the patient has variants in one or more genes associated with metabolic diseases, such as whether the patient has one or more variants (e.g., polymorphisms) in one or more genes selected from TCF7L2 and GLP1R, especially whether he / she has one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, such as SNPs selected from rs7903146, rs12255372, and rs10885406, or whether the patient has their respective wild-type genotypes, such as whether the patient has the TCF7L2 wild-type genotype, especially whether he / she has the TCF7L2 rs7903146 wild-type genotype. and The drug compound, composition, or combination is administered to the patient.
2. The pharmaceutical composition or combination of claim 1, comprising: (a) DPP-4 inhibitors, And, optional, (b) A second antidiabetic drug selected from group G3, said group G3 consisting of biguanide (especially metformin), thiazolidinedione, sulfonylurea, linenide, alpha-glucosidase inhibitor, GLP-1 or a GLP-1 analog and insulin or an insulin analog, and optionally, (c) A third antidiabetic drug, distinct from (b), selected from metformin, sulfonylureas, pioglitazone, rosiglitazone, repaglinide, nateglinide, acarbose, voglibose, miglitol, GLP-1 or a GLP-1 analogue, and insulin or an insulin analogue. Or its pharmaceutically acceptable salt.
3. The pharmaceutical composition or combination of claim 1, comprising: (a) DPP-4 inhibitors, And, optional, (b) A second antidiabetic drug selected from metformin, sulfonylureas, pioglitazone, rosiglitazone, repaglinide, nateglinide, acarbose, voglibose, miglitol, GLP-1 or a GLP-1 analog and insulin or an insulin analog, and optionally, (c) A third antidiabetic drug selected from group G3, distinct from (b), said group G3 consisting of biguanide (especially metformin), thiazolidinedione, sulfonylurea, linenide, alpha-glucosidase inhibitor, GLP-1 or a GLP-1 analog, and insulin or an insulin analog. Or its pharmaceutically acceptable salt.
4. The pharmaceutical composition or combination of claims 1, 2, or 3, comprising... (a) DPP-4 inhibitors, And, optional, (b) A second antidiabetic drug selected from metformin, sulfonylureas, and pioglitazone, and optionally, (c) A third antidiabetic drug, distinct from (b), selected from metformin, sulfonylureas, pioglitazone, rosiglitazone, repaglinide, nateglinide, acarbose, voglibose, miglitol, GLP-1 or a GLP-1 analogue, and insulin or an insulin analogue. Or its pharmaceutically acceptable salt.
5. The pharmaceutical composition or combination according to any one of claims 1-4, comprising: (a) DPP-4 inhibitors, And, optional, (b) A second antidiabetic drug selected from metformin and pioglitazone, and optionally, (c) A third antidiabetic drug, distinct from (b), selected from metformin, sulfonylureas, and pioglitazone. Or its pharmaceutically acceptable salt.
6. The pharmaceutical composition or combination of claims 1, 2 or 3, wherein the second and / or third antidiabetic agent is independently selected from metformin, pioglitazone, rosiglitazone, troglitazone, cycloglitazone, glibenclamide, tolbutamide, glimepiride, glipizide, glimepiride, mesylate, glibenclamide, gliclazide, gliclazide, nateglinide, repaglinide, miglitol, acarbose, voglibose, miglitol, exenatide and liraglutide, or a pharmaceutically acceptable salt of one of the above therapeutic agents.
7. The pharmaceutical composition or combination of any one of claims 1-6, wherein the DPP-4 inhibitor is selected from group G2, said group G2 comprising the following substances: Liralipin, sitagliptin, vildagliptin, alogliptin, saxagliptin, terliliptin, and dugliptin, or a pharmaceutically acceptable salt of one of the above DPP-4 inhibitors, or a prodrug thereof.
8. The pharmaceutical composition of any of the preceding claims further comprises one or more pharmaceutically acceptable carriers.
9. The pharmaceutical composition or combination according to any one of claims 1-8, characterized in that... Components (a) and (b) are present, and component (c) is absent.
10. The pharmaceutical composition according to any one of claims 1-8, characterized in that... Component (a) is present, while components (b) and (c) are absent.
11. The pharmaceutical composition or combination according to any one of claims 1-9, characterized in that... It is suitable for use of the active ingredients simultaneously or sequentially.
12. The pharmaceutical composition or combination according to any one of claims 1-9, characterized in that... The active ingredient is present in a single dosage form or in separate dosage forms.
13. The pharmaceutical composition or combination according to any one of claims 1-8, characterized in that... The DPP-4 inhibitor and the second antidiabetic drug are present in a single dosage form, and the third antidiabetic drug is present in a separate dosage form.
14. A method for preventing, slowing the progression of, delaying or treating a metabolic disorder in patients in need, said metabolic disorder being selected from type 1 diabetes, type 2 diabetes, impaired glucose tolerance, abnormal fasting glucose, hyperglycemia, postprandial hyperglycemia, overweight, obesity and metabolic syndrome, for example in patients who: have one or more variants (e.g., SNPs) in one or more genes selected from TCF7L2 and GLP1R, or patients who have their respective wild-type genotypes. The method includes: The test determines whether the patient has one or more variants (e.g., polymorphisms) in one or more genes selected from TCF7L2 and GLP1R, particularly whether he / she has one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, such as SNPs selected from rs7903146, rs12255372, and rs10885406, or whether the patient has their respective wild-type genotype, such as whether the patient has the TCF7L2 wild-type genotype, particularly whether he / she has the TCF7L2 rs7903146 wild-type genotype. and The patient is given the DPP-4 inhibitor of claim 7, and optionally the second antidiabetic drug of any one of claims 1-6, and optionally the third antidiabetic drug of any one of claims 1-6, wherein the administration is optionally in combination, including alternating.
15. Methods for improving glycemic control and / or reducing fasting plasma glucose, postprandial plasma glucose, and / or glycosylated hemoglobin HbA1c in patients who require them, for example, in patients who: have one or more variants (e.g., SNPs) in one or more genes selected from TCF7L2 and GLP1R, or patients who have their respective wild-types. The method includes: The test determines whether the patient has one or more variants (e.g., polymorphisms) in one or more genes selected from TCF7L2 and GLP1R, particularly whether he / she has one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, such as SNPs selected from rs7903146, rs12255372, and rs10885406, or whether the patient has their respective wild-type genotype, such as whether the patient has the TCF7L2 wild-type genotype, particularly whether he / she has the TCF7L2 rs7903146 wild-type genotype. and The patient is given the DPP-4 inhibitor of claim 7, and optionally the second antidiabetic drug of any one of claims 1-6, and optionally the third antidiabetic drug of any one of claims 1-6, wherein the administration is optionally in combination, including alternating.
16. Methods for preventing, slowing, delaying, or reversing the progression of type 2 diabetes to impaired glucose tolerance, abnormal fasting blood glucose, insulin resistance, and / or metabolic syndrome in patients in need, for example, in patients who: have one or more variants (e.g., SNPs) in one or more genes selected from TCF7L2 and GLP1R, or patients who have their respective wild-type genotypes. The method includes: The test determines whether the patient has one or more variants (e.g., polymorphisms) in one or more genes selected from TCF7L2 and GLP1R, particularly whether he / she has one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, such as SNPs selected from rs7903146, rs12255372, and rs10885406, or whether the patient has their respective wild-type genotype, such as whether the patient has the TCF7L2 wild-type genotype, particularly whether he / she has the TCF7L2 rs7903146 wild-type genotype. and The method is characterized by administering to the patient the DPP-4 inhibitor of claim 7, and optionally administering the second antidiabetic drug of any one of claims 1-6, and optionally administering the third antidiabetic drug of any one of claims 1-6, wherein the administration is optionally in combination, including in alternation.
17. Methods for preventing, slowing the progression of, delaying or treating conditions or disorders selected from the following in patients in need: diabetic complications, such as cataracts, and microvascular and macrovascular diseases, such as nephropathy, retinopathy, neuropathy, tissue ischemia, diabetic foot, arteriosclerosis, myocardial infarction, acute coronary syndrome, unstable angina, stable angina, stroke, peripheral artery occlusive disease, cardiomyopathy, heart failure, arrhythmia and restenosis, for example, in patients who: have one or more variants (e.g., SNPs) in one or more genes selected from TCF7L2 and GLP1R, or have their respective wild-types. The method includes: The test determines whether the patient has one or more variants (e.g., polymorphisms) in one or more genes selected from TCF7L2 and GLP1R, particularly whether he / she has one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, such as SNPs selected from rs7903146, rs12255372, and rs10885406, or whether the patient has their respective wild-type genotype, such as whether the patient has the TCF7L2 wild-type genotype, particularly whether he / she has the TCF7L2 rs7903146 wild-type genotype. and The patient is given the DPP-4 inhibitor of claim 7, and optionally the second antidiabetic drug of any one of claims 1-6, and optionally the third antidiabetic drug of any one of claims 1-6, wherein the administration is optionally in combination, including alternating.
18. Methods for reducing or preventing weight gain or promoting weight loss in patients who require them, for example, in patients who have one or more variants (e.g., SNPs) in one or more genes selected from TCF7L2 and GLP1R, or patients who have their respective wild-type genotypes. The method includes: The test determines whether the patient has one or more variants (e.g., polymorphisms) in one or more genes selected from TCF7L2 and GLP1R, particularly whether he / she has one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, such as SNPs selected from rs7903146, rs12255372, and rs10885406, or whether the patient has their respective wild-type genotype, such as whether the patient has the TCF7L2 wild-type genotype, particularly whether he / she has the TCF7L2 rs7903146 wild-type genotype. and The patient is given the DPP-4 inhibitor of claim 7, and optionally the second antidiabetic drug of any one of claims 1-6, and optionally the third antidiabetic drug of any one of claims 1-6, wherein the administration is optionally in combination, including alternating.
19. Methods for preventing, slowing, delaying, or treating pancreatic β-cell degeneration and / or decreased pancreatic β-cell function, and / or improving and / or restoring pancreatic β-cell function, and / or restoring pancreatic insulin secretion function in patients in need, for example, in patients who: have one or more variants (e.g., SNPs) in one or more genes selected from TCF7L2 and GLP1R, or patients who have their respective wild-type genotypes. The method includes: The test determines whether the patient has one or more variants (e.g., polymorphisms) in one or more genes selected from TCF7L2 and GLP1R, particularly whether he / she has one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, such as SNPs selected from rs7903146, rs12255372, and rs10885406, or whether the patient has their respective wild-type genotype, such as whether the patient has the TCF7L2 wild-type genotype, particularly whether he / she has the TCF7L2 rs7903146 wild-type genotype. and The patient is given the DPP-4 inhibitor of claim 7, and optionally the second antidiabetic drug of any one of claims 1-6, and optionally the third antidiabetic drug of any one of claims 1-6, wherein the administration is optionally in combination, including alternating.
20. Methods for preventing, mitigating, delaying, or treating diseases or conditions caused by abnormal accumulation of fat in the liver in patients who require such treatment, for example, those who have one or more variants (e.g., SNPs) in one or more genes selected from TCF7L2 and GLP1R, or those who have their respective wild-type genotypes. The method includes: The test determines whether the patient has one or more variants (e.g., polymorphisms) in one or more genes selected from TCF7L2 and GLP1R, particularly whether he / she has one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, such as SNPs selected from rs7903146, rs12255372, and rs10885406, or whether the patient has their respective wild-type genotype, such as whether the patient has the TCF7L2 wild-type genotype, particularly whether he / she has the TCF7L2 rs7903146 wild-type genotype. and The patient is given the DPP-4 inhibitor of claim 7, and optionally the second antidiabetic drug of any one of claims 1-6, and optionally the third antidiabetic drug of any one of claims 1-6, wherein the administration is optionally in combination, including alternating.
21. Methods for maintaining and / or improving insulin sensitivity and / or treating or preventing hyperinsulinemia and / or insulin resistance in patients who require them, for example, in patients who: have one or more variants (e.g., SNPs) in one or more genes selected from TCF7L2 and GLP1R, or patients who have their respective wild-type genotypes. The method includes: The test determines whether the patient has one or more variants (e.g., polymorphisms) in one or more genes selected from TCF7L2 and GLP1R, particularly whether he / she has one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, such as SNPs selected from rs7903146, rs12255372, and rs10885406, or whether the patient has their respective wild-type genotype, such as whether the patient has the TCF7L2 wild-type genotype, particularly whether he / she has the TCF7L2 rs7903146 wild-type genotype. and The patient is given the DPP-4 inhibitor of claim 7, and optionally the second antidiabetic drug of any one of claims 1-6, and optionally the third antidiabetic drug of any one of claims 1-6, wherein the administration is optionally in combination, including alternating.
22. Use of the pharmaceutical composition of any one of claims 1-13 in the preparation of a medicament for use in a patient in need by the following methods: -Prevent, slow the progression of, delay or treat the following metabolic disorders: type 1 diabetes, type 2 diabetes, impaired glucose tolerance, abnormal fasting glucose, hyperglycemia, postprandial hyperglycemia, overweight, obesity, metabolic syndrome, insulin resistance, hyperlipidemia, hypercholesterolemia, dyslipidemia, hypertension, chronic systemic inflammation, retinopathy, neuropathy, nephropathy, atherosclerosis, endothelial dysfunction, non-alcoholic fatty liver disease (NAFLD), and osteoporosis; or - Improve glycemic control and / or reduce fasting plasma glucose, postprandial plasma glucose and / or glycosylated hemoglobin HbA1c; or - To prevent, slow, delay, or reverse the progression of type 2 diabetes from impaired glucose tolerance, insulin resistance, and / or metabolic syndrome; or -Prevention, slowing of the progression of, delay of or treatment of any of the following conditions or disorders: diabetic complications, such as cataracts, and microvascular and macrovascular diseases, such as nephropathy, retinopathy, neuropathy, tissue ischemia, diabetic foot, arteriosclerosis, myocardial infarction, acute coronary syndrome, unstable angina, stable angina, stroke, peripheral artery occlusive disease, cardiomyopathy, heart failure, arrhythmia and restenosis; or - To reduce weight or prevent weight gain or promote weight loss; or - To prevent, slow down, delay, or treat pancreatic β-cell degeneration and / or decreased pancreatic β-cell function, and / or improve and / or restore or protect pancreatic β-cell function and / or restore pancreatic insulin secretion function; or - To prevent, alleviate, delay, or treat diseases or conditions caused by abnormal accumulation of fat in the liver; or - Maintain and / or improve insulin sensitivity and / or treat or prevent hyperinsulinemia and / or insulin resistance; Especially In patients with variants in one or more genes associated with metabolic diseases Especially in patients with one or more variants (e.g., polymorphisms) in one or more genes selected from TCF7L2 and GLP1R, This is especially true in patients who have one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, such as those with SNPs selected from rs7903146, rs12255372, and rs10885406. or Among patients with their respective wild-type genotypes Especially in patients with the TCF7L2 wild-type genotype, This is especially true in patients whose TCF7L2 rs7903146 is wild-type.
23. The method of any one of claims 14-21 or the use of claim 22, wherein the patient is an individual diagnosed with one or more conditions selected from overweight, obesity, visceral obesity and abdominal obesity.
24. The method of any one of claims 14-21 or the use of claim 22, wherein the patient is an individual exhibiting one, two, or more of the following conditions: (a) Fasting blood glucose or serum glucose concentration greater than 110 mg / dL, especially greater than 125 mg / dL; (b) Postprandial plasma glucose is greater than or equal to 140 mg / dL; (c) HbA1c value greater than or equal to 6.5%, especially greater than or equal to 7.0%.
25. The method of any one of claims 14-21 or the use of claim 22, wherein the patient is an individual having one, two, three or more of the following conditions: (a) Obesity, visceral obesity, and / or abdominal obesity (b) Blood triglyceride levels ≥150 mg / dL, (c) Female patients with HDL-cholesterol blood levels <40 mg / dL and male patients with HDL-cholesterol levels <50 mg / dL (d) Systolic blood pressure ≥130 mmHg and diastolic blood pressure ≥85 mmHg, (e) Fasting blood glucose level ≥110mg / dL.
26. The method of any one of claims 14-21 or the use of claim 22, wherein the patient has inadequate glycemic control despite diet and exercise therapy or despite monotherapy with the second or third antidiabetic drug.
27. The method of any one of claims 14-21 or the use of claim 22, wherein the patient has inadequate glycemic control despite diet and exercise therapy or despite dual therapy with the second and third antidiabetic drugs.
28. The use of the dual combination method of any one of claims 14-21 or the dual combination of claim 22, wherein the patient has inadequate glycemic control despite diet and exercise therapy or despite monotherapy with the DPP-4 inhibitor or any one of the second or third antidiabetic drugs or despite dual therapy with the second and third antidiabetic drugs.
29. The use of the triple combination method of any one of claims 14-21 or the triple combination of claim 22, wherein the patient has inadequate glycemic control despite diet and exercise therapy or despite monotherapy with any one of the DPP-4 inhibitors or a second or third antidiabetic drug or despite combination therapy with two drugs selected from the DPP-4 inhibitors, the second and third antidiabetic drugs.
30. The pharmaceutical compound, composition, combination, method, or use of any of the preceding claims, wherein the patient has one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, particularly at least one SNP selected from rs7903146, rs12255372, and rs10885406, especially rs7903146.
31. The pharmaceutical compound, composition, combination, method, or use of any of the preceding claims, wherein the patient is diagnosed, has been diagnosed, or carries at least one T allele SNP rs7903146 of TCF7L2, i.e., the CT genotype or TT genotype.
32. The pharmaceutical compound, composition, combination, method, or use according to any one of claims 1-31, wherein the patient is diagnosed, has been diagnosed, or carries two T allele SNPs rs7903146 of TCF7L2, i.e., the TT genotype.
33. The pharmaceutical compound, composition, combination, method, or use according to any one of claims 1-31, wherein the patient is diagnosed, has been diagnosed, or carries a T allele SNP rs7903146 of TCF7L2, i.e., the CT genotype.
34. The pharmaceutical compound, composition, combination, method, or use of any one of claims 1-29, wherein the patient is diagnosed, has been diagnosed, or carries the wild-type TCF7L2, particularly the wild-type rs7903146 of TCF7L2.
35. The pharmaceutical compound, composition, combination, method, or use of any one of claims 1-29, wherein the patient is diagnosed, has been diagnosed, or carries a wild-type genotype, particularly a patient diagnosed or carrying the two C alleles of TCF7L2, SNPrs7903146, i.e., the CC genotype.
36. The pharmaceutical composition of any one of claims 1-13, used in a patient in need of it by the following methods: -Prevention, slowing the progression of, delaying or treating of the following metabolic disorders: type 1 diabetes, type 2 diabetes, impaired glucose tolerance, abnormal fasting glucose, hyperglycemia, postprandial hyperglycemia, overweight, obesity and metabolic syndrome; or - Improve glycemic control and / or reduce fasting plasma glucose, postprandial plasma glucose and / or glycosylated hemoglobin HbA1c; or - To prevent, slow, delay, or reverse the progression of type 2 diabetes from impaired glucose tolerance, insulin resistance, and / or metabolic syndrome; or -Prevention, slowing of the progression of, delay of or treatment of any of the following conditions or disorders: diabetic complications, such as cataracts, and microvascular and macrovascular diseases, such as nephropathy, retinopathy, neuropathy, tissue ischemia, diabetic foot, arteriosclerosis, myocardial infarction, acute coronary syndrome, unstable angina, stable angina, stroke, peripheral artery occlusive disease, cardiomyopathy, heart failure, arrhythmia and restenosis; or - To reduce weight or prevent weight gain or promote weight loss; or - To prevent, slow down, delay, or treat pancreatic β-cell degeneration and / or decreased pancreatic β-cell function, and / or improve and / or restore pancreatic β-cell function and / or restore pancreatic insulin secretion function; or - To prevent, alleviate, delay, or treat diseases or conditions caused by abnormal fat accumulation in the liver; and / or - Maintain and / or improve insulin sensitivity and / or treat or prevent hyperinsulinemia and / or insulin resistance; In patients who require it, the method includes (i) Test whether the patient has any TCF7L2 risk genotype, particularly whether the patient has one or more single nucleotide polymorphisms (SNPs) in the gene encoding TCF7L2, especially at least one SNP selected from rs7903146, rs12255372, and rs10885406, for example, whether the patient carries at least one T allele SNP rs7903146 of TCF7L2, for example, whether the patient has the CT genotype (i.e., whether the patient carries one T allele SNP rs7903146 of TCF7L2) or whether the patient has the TT genotype (i.e., whether the patient carries two T allele SNPs rs7903146 of TCF7L2). Alternatively, the patient may be tested to determine if they possess the TCF7L2 wild-type genotype, particularly whether they possess the TCF7L2 rs7903146 wild-type genotype, or, for example, whether they have the CC genotype (i.e., whether they carry the two C allele SNPs rs7903146 of TCF7L2). And, optional, (ii) administering to the patient the DPP-4 inhibitor of claim 7, and optionally administering the second antidiabetic drug of any one of claims 1-6, and optionally administering the third antidiabetic drug of any one of claims 1-6, wherein the administration is optionally in combination, including in alternation.
37. The pharmaceutical compound, composition, combination, method, or use of any of the preceding claims, wherein the DPP-4 inhibitor is liralistin.
38. The pharmaceutical compound, composition, combination, method or use of any of the preceding claims, wherein the DPP-4 inhibitor is liralistin, and the second antidiabetic drug is metformin or pioglitazone.
39. The pharmaceutical compound, composition, combination, method, or use of any of the preceding claims, wherein the patient suffers from or has been diagnosed with type 2 diabetes.
Citation Information
Patent Citations
Pyrimidin derivatives and process for their preparation
EP0564409A1
Dipeptidyl peptidase inhibitors
EP1586571A1
Dipeptidyl peptidase inhibitors
US20050261271A1
Dipeptidyl peptidase-IV inhibitors
US20060270701A1
Administration of dipeptidyl peptidase inhibitors
US20070060530A1