Methylation biomarkers or combinations and applications thereof for detecting breast cancer
By detecting the combination of methylation biomarkers in plasma cfDNA and combining it with the LASSO and Random Forest algorithms, the problems of insufficient sensitivity and specificity of existing breast cancer detection methods were solved, non-invasive early diagnosis was achieved, and the early screening and diagnosis of breast cancer were improved.
Patent Information
- Application Number
- CN202010426496.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2020-05-19
- Publication Date
- 2025-09-05
- Estimated Expiration
- 2040-05-19
AI Technical Summary
Existing breast cancer detection methods lack sensitivity and specificity, making it difficult to achieve early screening and early diagnosis. Traditional imaging methods are insensitive to the diagnosis of dense breast lesions, and traditional tissue biopsies are highly invasive and cannot meet clinical testing needs.
A methylation biomarker combination, including specific sequences of cg23035715, cg26371731, cg13973436, etc., was used to detect the methylation pattern in plasma cfDNA, combined with LASSO and Random Forest algorithms to screen out an efficient diagnostic marker combination for the preparation of a kit for detecting breast cancer.
It improves the sensitivity and specificity of early diagnosis of breast cancer, reduces the false positive and false negative rates, realizes non-invasive early screening and diagnosis, and meets the needs of clinical testing.
Smart Images

Figure GDA0005544456470000071 
Figure GDA0005544456470000072 
Figure GDA0005544456470000081
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and in particular relates to methylation biomarkers for detecting breast cancer, and combinations and applications thereof. Background Art
[0002] According to the China Cancer Registry Annual Report, the incidence of breast cancer in women is low in the 0-24 age group, gradually increases after age 25, peaks in the 50-54 age group, and gradually declines after age 55. Extensive research has been conducted in Europe and the United States on breast cancer susceptibility genes, including BRCA-1, BRCA-2, p53, and PTEN. Breast cancer associated with mutations in these genes is known as hereditary breast cancer, accounting for 5% to 10% of all breast cancers. The "21-Gene Breast Cancer Test" not only provides a 1-5 year and 5-year recurrence risk prediction, but is also the only multi-gene test to predict the benefit of chemotherapy and endocrine therapy for patients with estrogen receptor-positive invasive breast cancer. The "70-Gene Breast Cancer Test" also plays a key role in early breast cancer diagnosis. Recent research has identified 72 new common gene mutations that increase the risk of breast cancer in women, bringing the number of known breast cancer-associated gene mutations to 177. Many people may carry common gene mutations, and the risk of a single gene mutation is relatively small, but the more related gene mutations a woman has, the greater her risk of breast cancer. Current breast cancer genetic testing is non-invasive but based on tissue removed during the original surgery (lumpectomy, mastectomy, or core biopsy).
[0003] Early screening and diagnosis of tumors can increase the probability of detecting early-stage cancer, thereby improving the five-year survival rate and reducing mortality. The current status of breast cancer screening in China: The five-year survival rate for breast cancer is: 100% for carcinoma in situ, 84-100% for stage I, 76-87% for stage II, and 38-77% for stage III. A multicenter study in China showed that at the time of initial breast cancer diagnosis, 15.7% were stage I, 44.9% were stage II, 18.7% were stage III, and 2.4% were stage IV. Breast cancer imaging screening methods: 1. Mammography: Chinese women develop breast cancer at a younger age (45-55 years old) and have denser breast tissue than Western women, making mammary glandular abnormalities (MG) easily missed. The sensitivity of MG for diagnosing dense breast lesions is only 30%. 2. Ultrasound: The positive predictive value of MG alone is 55.5%, while the positive predictive value of MG combined with ultrasound is 43.3%. 3. Magnetic resonance imaging (MRI): MRI is insensitive to microcalcifications and has clear contraindications. Therefore, early cancer screening, diagnosis, and treatment are crucial for improving five-year survival rates. The key to early cancer screening and diagnosis lies in establishing effective detection models and identifying molecular markers for screening and diagnosis. cfDNA (cell-free DNA) is small fragments of DNA circulating in peripheral blood. They originate from the metabolism and apoptosis of normal or tumor cells and contain genetic information such as somatic mutations and DNA methylation. Liquid biopsy, a technique that uses disease-specific cfDNA fragments to understand the onset and progression of a disease, offers numerous advantages over traditional tissue biopsies, including speed, convenience, and minimal invasiveness. In 2014, a study of 640 patients with various tumors by Bert Vogelstein and Kenneth Kinzler's team found that ctDNA was detected in over 75% of patients with advanced pancreatic, ovarian, colorectal, bladder, gastroesophageal, melanoma, hepatocellular carcinoma, and head and neck cancers. Therefore, ctDNA is a broadly applicable, sensitive, and specific biomarker suitable for clinical and research use across a wide range of cancer types. In 2015, Professor Dennis Lo demonstrated the technical and theoretical feasibility of liquid biopsy as an alternative to tissue biopsy through whole-genome methylation sequencing of cfDNA. In 2017, Professor Zhang Kun's team used ctDNA methylation to quantitatively describe tumor burden and the profile of tumor-derived ctDNA. Turner's team used high-throughput sequencing to identify breast cancer-specific somatic mutation sites and monitor their dynamic changes, demonstrating that ctDNA testing can detect tumor recurrence and metastasis earlier than CT. Recent research has found that combining ctDNA mutations in blood with other analytes can enable earlier and more accurate diagnosis of eight common and resectable cancers: ovarian cancer, liver cancer, gastric cancer, breast cancer, prostate cancer, esophageal cancer, and colorectal cancer. A growing number of clinical studies indicate that plasma ctDNA can be used as a biomarker for early cancer diagnosis and screening, prognosis, treatment response, and monitoring of tumor size and recurrence.At present, the international research direction is to integrate multi-omics / multiple molecular markers, multiple genes / multiple sites to improve the sensitivity and specificity of detection technology to meet clinical needs for detection products. Summary of the Invention
[0004] One of the objectives of the present invention is to provide a methylation biomarker or a combination thereof that can be used for breast cancer detection.
[0005] The technical solutions for achieving the above-mentioned objectives include the following.
[0006] A methylation biomarker or a combination thereof for breast cancer detection, selected from any at least one of the following methylation biomarkers:
[0007] cg23035715, cg26371731, cg04541368, cg13973436, cg16304215, cg20072171, cg08402365, cg21501525, cg 22778178, cg08599259, cg25566568, cg15634980, cg07458308, cg01348584, cg14140881, cg25756435, cg005 94560, cg08279008, cg09760908, cg18087672, cg14868703, cg17632299, cg18786873, cg20631750, cg259240 96, cg24615528, cg22889755, cg23524195, cg20861607, cg22435300, cg25504443, cg14351528, cg25824543, cg23413809, cg24797187, cg26877715, cg01167274, cg12361223, cg04430835, cg27111970, cg22851944, cg2 3228540, cg26225694, cg07790615, cg14825633, cg11901043, cg24504927, cg21962423, cg14135814, cg0107 0209, cg14841828, cg04947764, cg01397141, cg00436496, cg01832036, cg27125093, cg21319323, cg06916239, cg11667451, cg03355998, cg19019849, , cg22009488, cg15012484, cg20817483, cg21254450 and cg23134869.
[0008] In some embodiments, at least one of the following methylation biomarkers is selected:
[0009] cg23035715, cg26371731, cg04541368, and cg13973436.
[0010] A methylation biomarker combination for breast cancer detection comprises marker cg23035715 and at least one selected from the following markers: cg26371731, cg04541368, and cg13973436.
[0011] In some embodiments, the methylation biomarker combination for breast cancer detection includes marker cg23035715, and three of the following markers: cg26371731, cg04541368, and cg13973436.
[0012] In some embodiments, the methylation biomarker combination for breast cancer detection further comprises at least one selected from the following biomarkers: cg16304215, cg20072171, cg08402365, cg21501525, cg22778178, cg08599259, cg25566568, cg15634980, cg07458308, cg01348584, cg14140881, cg25756435 ... g00594560, cg08279008, cg09760908, cg18087672, cg14868703, cg17632299, cg18786873, cg20631750, cg25 924096, cg24615528, cg22889755, cg23524195, cg20861607, cg22435300, cg25504443, cg14351528, cg258245 43, cg23413809, cg24797187, cg26877715, cg01167274, cg12361223, cg04430835, cg27111970, cg22851944, cg23228540, cg26225694, cg07790615, cg14825633, cg11901043, cg24504927, cg21962423, cg14135814, cg01 070209, cg14841828, cg04947764, cg01397141, cg00436496, cg01832036, cg27125093, cg21319323, cg06916239, cg11667451, cg03355998, cg19019849, cg22009488, cg15012484, cg20817483, cg21254450, and cg23134869.
[0013] In some embodiments, the methylation biomarker combination for breast cancer detection includes markers cg23035715, cg26371731, cg04541368, cg13973436, cg16304215, cg20072171, cg08402365, cg21501525, cg22778178, cg08599259, cg25566568, cg15634980, cg07458308, cg01348584, cg14140881, cg25756435, cg00594560, cg08279008, cg09760908, cg18087672, cg14868703, cg17632299, cg18786 873, cg20631750, cg25924096, cg24615528, cg22889755, cg23524195, cg20861607, cg22435300, cg25504443, cg14 351528, cg25824543, cg23413809, cg24797187, cg26877715, cg01167274, cg12361223, cg04430835, cg27111970, cg22851944, cg23228540, cg26225694, cg07790615, cg14825633, cg11901043, cg24504927, cg21962423, cg14135 814, cg01070209, cg14841828, cg04947764, cg01397141, cg00436496, cg01832036, cg27125093, cg21319323, cg06916239, cg11667451, cg03355998, cg19019849, cg22009488, cg15012484, cg20817483, cg21254450, and cg23134869.
[0014] In some embodiments, the sequence of the marker cg23035715 is shown in SEQ ID NO.1, the sequence of cg26371731 is shown in SEQ ID NO.2, the sequence of cg04541368 is shown in SEQ ID NO.3, the sequence of cg13973436 is shown in SEQ ID NO.4, the sequence of cg16304215 is shown in SEQ ID NO.5, the sequence of cg20072171 is shown in SEQ ID NO.6, the sequence of cg08402365 is shown in SEQ ID NO.7, the sequence of cg21501525 is shown in SEQ ID NO.8, the sequence of cg22778178 is shown in SEQ ID NO.9, the sequence of cg08599259 is shown in SEQ ID NO.10, the sequence of cg25566568 is shown in SEQ ID NO.11, the sequence of cg15634980 is shown in SEQ ID NO. The sequence of cg07458308 is shown in SEQ ID NO. 12, the sequence of cg07458308 is shown in SEQ ID NO. 13, the sequence of cg01348584 is shown in SEQ ID NO. 14, the sequence of cg14140881 is shown in SEQ ID NO. 15, the sequence of cg25756435 is shown in SEQ ID NO. 16, the sequence of cg00594560 is shown in SEQ ID NO. 17, the sequence of cg08279008 is shown in SEQ ID NO. 18, the sequence of cg09760908 is shown in SEQ ID NO. 19, the sequence of cg18087672 is shown in SEQ ID NO. 20, the sequence of cg14868703 is shown in SEQ ID NO. 21, the sequence of cg17632299 is shown in SEQ ID NO. 22, and the sequence of cg18786873 is shown in SEQ ID NO. No. 23, the sequence of cg20631750 is shown in SEQ ID No. 24, the sequence of cg25924096 is shown in SEQ ID No. 25, the sequence of cg15321298 is shown in SEQ ID No. 26, the sequence of cg22889755 is shown in SEQ ID No. 27, the sequence of cg23524195 is shown in SEQ ID No. 28, the sequence of cg20861607 is shown in SEQ ID No. 29, the sequence of cg22435300 is shown in SEQ ID No. 30, the sequence of cg25504443 is shown in SEQ ID No. 31, the sequence of cg14351528 is shown in SEQ ID No. 32, the sequence of cg25824543 is shown in SEQ ID No. 33, and the sequence of cg23413809 is shown in SEQ ID No.34, the sequence of cg24797187 is shown in SEQ ID NO.35, the sequence of cg26877715 is shown in SEQ ID NO.36, the sequence of cg01167274 is shown in SEQ ID NO.37, the sequence of cg12361223 is shown in SEQ ID NO.38, the sequence of cg04430835 is shown in SEQ ID NO.39, the sequence of cg27111970 is shown in SEQ ID NO.40, the sequence of cg22851944 is shown in SEQ ID NO.41, the sequence of cg23228540 is shown in SEQ ID NO.42, the sequence of cg26225694 is shown in SEQ ID NO.43, the sequence of cg07790615 is shown in SEQ ID NO.44, the sequence of cg14825633 is shown in SEQ ID The sequence of cg01070209 is shown in SEQ ID NO. 50, the sequence of cg14841828 is shown in SEQ ID NO. 51, the sequence of cg04947764 is shown in SEQ ID NO. 52, the sequence of cg01397141 is shown in SEQ ID NO. 53, the sequence of cg00436496 is shown in SEQ ID NO. 54, the sequence of cg01832036 is shown in SEQ ID NO. 55, the sequence of cg27125093 is shown in SEQ ID NO. No. 56, the sequence of cg21319323 is shown in SEQ ID No. 57, the sequence of cg06916239 is shown in SEQ ID No. 58, the sequence of cg11667451 is shown in SEQ ID No. 59, the sequence of cg03355998 is shown in SEQ ID No. 60, the sequence of cg19019849 is shown in SEQ ID No. 61, the sequence of cg22009488 is shown in SEQ ID No. 62, the sequence of cg15012484 is shown in SEQ ID No. 63, the sequence of cg20817483 is shown in SEQ ID No. 64, the sequence of cg21254450 is shown in SEQ ID No. 65, and / or the sequence of cg23134869 is shown in SEQ ID No. 66.
[0015] Another object of the present invention is to use the above-mentioned methylation biomarker combination in the preparation of a kit for detecting breast cancer.
[0016] Another object of the present invention is to provide a kit for detecting breast cancer.
[0017] A kit for detecting breast cancer includes reagents for detecting the methylation status of the above-mentioned methylation biomarkers or their combination in a sample to be tested.
[0018] In some embodiments, the breast cancer is of different stages, including stages 0, I, II, III, and IV according to TNM.
[0019] In some embodiments, the detection method used in the kit is a reagent used in pyrophosphate sequencing, bisulfite conversion sequencing, methylation chip method, qPCR method, digital PCR method, second-generation sequencing method, third-generation sequencing method, whole-genome methylation sequencing method, DNA enrichment detection method, simplified bisulfite sequencing technology, HPLC method, MassArray, methylation-specific PCR, or a combination thereof.
[0020] In some embodiments, the test sample is plasma, serum or blood.
[0021] The present invention discloses plasma gene methylation markers or combinations thereof for early diagnosis of breast cancer. Specifically, the study obtained genomic fragments with obvious abnormal methylation modification patterns in breast cancer plasma cfDNA, namely cg23035715, cg26371731, cg04541368, cg13973436, cg16304215, cg20072171, cg08402365, cg21501525, cg22778178, cg08599259, cg25566568, cg15634 980, cg07458308, cg01348584, cg14140881, cg25756435, cg00594560, cg08279008, cg09760908, cg18087672, cg14868 703, cg17632299, cg18786873, cg20631750, cg25924096, cg24615528, cg22889755, cg23524195, cg20861607, cg224353 00, cg25504443, cg14351528, cg25824543, cg23413809, cg24797187, cg26877715, cg01167274, cg12361223, cg044308 35, cg27111970, cg22851944, cg23228540, cg26225694, cg07790615, cg14825633, cg11901043, cg24504927, cg2196242 3, cg14135814, cg01070209, cg14841828, cg04947764, cg01397141, cg00436496, cg01832036, cg27125093, cg21319323, cg06916239, cg11667451, cg03355998, cg19019849, cg22009488, cg15012484, cg20817483, cg21254450, and cg23134869. By studying the differences in methylation modification patterns of these genomic fragments in plasma cfDNA between patients with different stages of breast cancer and healthy controls, it was found that the above plasma genomic fragment combinations can be used as early diagnostic markers for breast cancer.Furthermore, the inventors' creative research revealed that the first methylation marker (cg23035715) or the combination of the first three methylation markers (cg26371731, cg04541368, and cg13973436) demonstrated similar diagnostic power to the 26 overlapping methylation marker combinations screened by the LASSO and Random Forest algorithms. This combined analysis of the co-methylation signature of multiple methylated cytosines across at least one genomic segment as a biomarker for breast cancer onset is far more accurate than other plasma biomarker assays, reducing the incidence of false positives and false negatives. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 2 is the ROC curve of the 26 methylation marker combinations in the training set in Example 2.
[0023] Figure 2 The ROC curves of the 26 methylation marker combinations in the independent validation set in Example 2 and the sensitivity and specificity of different breast cancer stages are shown.
[0024] Figure 3 3 is the ROC curve of the 42 methylation marker combinations screened by LASSO and 50 methylation marker combinations screened by Random Forest in the independent validation set in Example 2.
[0025] Figure 4 The sensitivity and specificity of the 42 (a) LASSO-screened and 50 (b) Random Forest-screened methylation marker combinations in different breast cancer stages in the independent validation set of Example 2 are shown.
[0026] Figure 5 The ROC curves (a) of the combination of markers SEQ ID NOs. 1-26 and X randomly selected markers from the independent validation set in Example 2, and the sensitivity and specificity for different breast cancer stages (b) are shown.
[0027] Figure 6 This is the ROC curve of the methylation marker combination of SEQ ID NO.1 or SEQ ID NO.1-4 in the independent validation set in Example 3.
[0028] Figure 7 The sensitivity and specificity of the random combination of methylation markers of SEQ ID NO. 1-4 in the independent validation set in Example 3 for different breast cancer stages are shown.
[0029] Figure 8The ROC curves (a) of the marker SEQ ID NO. 1 and X randomly selected markers from SEQ ID NO. 5-26 in the independent validation set in Example 3, and the sensitivity and specificity for different breast cancer stages (b) are shown.
[0030] Figure 9 The ROC curves (a) of the marker SEQ ID NO. 1 and X randomly selected markers SEQ ID NO. 27-66 in the independent validation set in Example 3, and the sensitivity and specificity (b) for different breast cancer stages are shown.
[0031] Figure 10 The ROC curves (a) of the markers SEQ ID NO. 1-4 and X randomly selected markers SEQ ID NO. 5-26 in the independent validation set in Example 3, and the sensitivity and specificity (b) of the markers for different breast cancer stages are shown.
[0032] Figure 11 The ROC curves (a) of the markers SEQ ID NO. 1-4 and X randomly selected markers SEQ ID NO. 27-66 in the independent validation set in Example 3, and the sensitivity and specificity for different breast cancer stages (b) are shown. DETAILED DESCRIPTION
[0033] Experimental procedures in the following examples, where specific conditions are not specified, generally followed conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. All commonly used chemical reagents used in the examples were commercially available.
[0034] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.
[0035] The terms "comprise," "comprising," and "having," and any variations thereof, are intended to cover non-exclusive inclusions. For example, a process, method, apparatus, product, or device comprising a series of steps is not limited to the listed steps or modules but may optionally include steps not listed, or other steps inherent to the process, method, product, or device.
[0036] In this application, "plurality" refers to two or more. "And / or" describes the relationship between related objects, indicating that three possible relationships exist. For example, "A and / or B" can mean: A exists alone, A and B exist simultaneously, or B exists alone. The character " / " generally indicates that the related objects are in an "or" relationship.
[0037] In some embodiments, the present invention relates to 66 methylation biomarkers associated with breast cancer screened, including cg23035715, cg26371731, cg04541368, cg13973436, cg16304215, cg20072171, cg08402365, cg21501525, cg22778178, cg08599259, cg25566568, cg15634980, cg07458308, cg01348584 , cg14140881, cg25756435, cg00594560, cg08279008, cg09760908, cg18087672, cg14868703, cg17632299, cg1878 6873, cg20631750, cg25924096, cg24615528, cg22889755, cg23524195, cg20861607, cg22435300, cg25504443, cg1 4351528, cg25824543, cg23413809, cg24797187, cg26877715, cg01167274, cg12361223, cg04430835, cg27111970 , cg22851944, cg23228540, cg26225694, cg07790615, cg14825633, cg11901043, cg24504927, cg21962423, cg14135 814, cg01070209, cg14841828, cg04947764, cg01397141, cg00436496, cg01832036, cg27125093, cg21319323, cg06916239, cg11667451, cg03355998, cg19019849, cg22009488, cg15012484, cg20817483, cg21254450, and cg23134869.
[0038] In some embodiments, at least one of the following methylation biomarkers is selected: cg23035715, cg26371731, cg04541368, and cg13973436.
[0039] The present invention provides a screening method for predicting differential methylation markers of ctDNA in breast cancer, which specifically comprises the following steps:
[0040] 1. Screening breast cancer-specific methylation markers based on TGCA data
[0041] 1.1 Download the methylation 450k chip (Illumina Human Methylation 450 BeadChip) data of breast cancer tissue and adjacent tissue from TCGA;
[0042] 1.2 Data preprocessing: Filter missing values, impute missing values, remove batch effects, remove unstable CpG sites, and select 3288 breast cancer-specific methylation sites as the final marker set;
[0043] 1.3 Sample grouping: Divide the samples into training set and test set: Randomly group them to ensure that the disease
[0044] The distribution of clinical stage, age, and follow-up time was consistent.
[0045] 1.4 3288 markers were verified to be consistently methylated in paired tissue and plasma samples, and further screening and filtering were performed to confirm the final 1996 methylated markers.
[0046] 1.5 1996 significant methylation sites were used to construct the subsequent classifier model.
[0047] First, using 3288 methylation biomarkers screened by the TCGA, we further verified the consistency of methylation levels across 40 paired tissue and plasma samples. We then screened 1996 gene methylation biomarkers relevant to breast cancer diagnosis. Cluster analysis was performed on the site data for the 3288 TGGA-derived and filtered 1996 methylation biomarkers in normal and breast cancer samples. These 1996 methylation biomarkers were identified as sites with the most significant abnormal methylation in both normal plasma and breast cancer samples. These 1996 methylation biomarkers were further screened using two algorithms, LASSO and RandomForest, respectively. The two algorithms overlapped for 26 methylation biomarkers, as listed in Table 1.
[0048] Calculation of methylation rates of 66 markers for specific regions of the genomic sequence
[0049] Table 1 26 methylation markers
[0050]
[0051] Table 2 Another 40 methylation markers associated with breast cancer
[0052]
[0053] Example 1
[0054] 1. Plasma cfDNA or tissue extraction and methylation library construction
[0055] 1.1 Extraction of blood cfDNA or tissue DNA.
[0056] Plasma DNA extraction was performed according to the instructions for Life Sciences' MagMAX™ Cell-Free DNA Isolation Kit. Tissue DNA extraction was performed according to the instructions for QIAGEN's DNeasy Blood & Tissue Kit.
[0057] 1.2 Conversion
[0058] Extracted cfDNA (10 ng) or tissue DNA (50 ng) was bisulfite-converted to deaminize unmethylated cytosine in the DNA into uracil, while methylated cytosine remained unchanged, to obtain bisulfite-converted DNA. The specific conversion procedures were performed according to the instructions of the Zymo Research EZ DNA Methylation-Lightning Kit.
[0059] 1.3 End Repair
[0060] 1.3.1 Add 17 μl of the converted sample to the following reagents for reaction:
[0061]
[0062] 1.3.2 Place the tube in a PCR instrument and perform the reaction according to the following procedure:
[0063] 37℃30min
[0064] 95℃5min
[0065] Heated cover 105℃
[0066] 1.3.3 When the second step of the PCR reaction (95°C) reaches 5 minutes, immediately remove the sample from the PCR instrument and directly insert it into ice for more than 2 minutes before proceeding to the next step.
[0067] 1.4 Connection I
[0068] 1.4.1 Prepare the following reaction solution
[0069]
[0070] 1.4.2 Place the tube in a PCR instrument and perform the reaction according to the following procedure:
[0071]
[0072] 1.5 Amplification I
[0073] 1.5.1 Prepare the following reaction solution
[0074]
[0075] 1.5.2 Place the tube in a PCR instrument and perform the reaction according to the following procedure:
[0076]
[0077]
[0078] 1.6 Purification I: Add 166 μl of 1:6 diluted Agencourt AMPure Beads (which must be equilibrated at room temperature for half an hour in advance) to purify the product after the Amplification I reaction and elute with 21 μl of EB. The specific purification steps are as follows:
[0079] 1.6.1 Take the reaction product from the previous step and centrifuge it. Add 166 μl of 1:6 diluted Agencourt AMPure Beads to each sample and mix thoroughly by pipetting.
[0080] 1.6.2 Incubate at room temperature for 5 minutes.
[0081] 1.6.3 Centrifuge and place on a magnetic rack for 5 minutes.
[0082] 1.6.4 Aspirate the supernatant.
[0083] 1.6.5 Add 200 μl of 80% EtOH, let stand for 30 seconds, and aspirate away the ethanol.
[0084] 1.6.6 Repeat step 5) once.
[0085] 1.6.7 Centrifuge, place the PCR tube on a magnetic rack, and remove the remaining ethanol.
[0086] 1.6.8 Open the lid and dry the magnetic beads for 2-3 minutes, being careful not to overdry them.
[0087] 1.6.9 Add 21 μl of EB for elution, mix thoroughly with a pipette, and let stand at room temperature for 3 minutes.
[0088] 1.6.10 Centrifuge and place the PCR tube on a magnetic rack and let it stand for 3 minutes.
[0089] 1.6.11 Pipette 20ul of supernatant into a new PCR tube.
[0090] 1.7 Connection II
[0091] 1.7.1 Prepare the following reaction solution:
[0092] Components Volume (ul) Previous step reaction volume 20 H2O 4 MSB1 Buffer 8 MSR1 Reagent 2 MSR5 Reagent 2 MSE1 Enzyme 2 MSE5 Enzyme 2 Total volume 40
[0093] 1.7.2 Place in PCR instrument and perform reaction according to the following procedure
[0094] temperature time Number of cycles 37℃ 30min 1 95℃ 5min 1 10℃ Hold 1
[0095] 1.8Indexing PCR:
[0096] 1.8.1 Prepare the following reaction solution:
[0097]
[0098]
[0099] 1.8.2 Place in PCR instrument and perform reaction according to the following procedure
[0100]
[0101] 1.9 Purification II
[0102] Add Agencourt AMPure Beads (need to be equilibrated at room temperature for half an hour in advance) to purify the product after the Indexing PCR reaction and elute with 41ul of EB. The specific purification steps are as follows:
[0103] 1.9.1 Take the reaction product from the previous step and centrifuge it. Add 71 μl of undiluted Agencourt AMPure Beads to each sample and mix thoroughly by pipetting.
[0104] 1.9.2 Incubate at room temperature for 5 minutes.
[0105] 1.9.3 Centrifuge and place on a magnetic rack for 5 minutes.
[0106] 1.9.4 Aspirate the supernatant.
[0107] 1.9.5 Add 200 μl of 80% EtOH, let stand for 30 seconds, and aspirate the ethanol.
[0108] 1.9.6 Repeat step 5) once.
[0109] 1.9.7 Centrifuge, place the PCR tube on a magnetic rack, and remove the remaining ethanol.
[0110] 1.9.8 Open the lid and dry the magnetic beads for 2-3 minutes, being careful not to overdry them.
[0111] 1.9.9 Add 41 μl of EB for elution, mix thoroughly with a pipette, and let stand at room temperature for 3 minutes.
[0112] 1.9.10 Centrifuge and place the PCR tube on a magnetic rack and let it stand for 3 minutes.
[0113] 1.9.11 Pipette 20ul of supernatant into a new PCR tube.
[0114] 1.10Qubit quantification:
[0115] Take 1 μl of the library and quantify it using the Qubit dsDNA HS Assay Kit.
[0116] 2. Perform oligonucleotide probe capture enrichment on the pre-library samples to obtain the final library for the specific region. The hybridization capture kit is IDT's xGen Lockdown Reagents, and the specific instructions are followed.
[0117] 3. Use Illumina's sequencer to sequence the sample after hybridization capture to obtain sequencing results.
[0118] 4. Data Analysis:
[0119] Conventional bioinformatics analysis and processing were performed on the raw data from the sequencer. Low-quality reads (such as low QC, short length, and too many N) were first filtered using fastp. The adapters, consensus sequences, and PolyA / T on both ends of the reads were then removed to obtain the ideal insert sequence (target interval). These reads were aligned to the corresponding positions in hg19 using bismark, and the reads were deduplicated based on the UMI to obtain the actual read data (bamfile) captured by the probe for each sample. The bam file was then statistically analyzed to obtain methylation data for subsequent data reanalysis.
[0120] The comethylation rate of a methylation marker referred to in this article is actually the sum of the individual methylation rates of all methylation combinations within a specific region of that marker. The P-value was obtained using the Wilcoxon test, with p < 0.001 considered statistically significant. We also calculated individual AUC values for all 26 markers. The AUC (area under the curve) represents the area under the ROC (Receiver Operating Characteristic) curve, which is used to assess the diagnostic ability of a combination for breast cancer. An AUC closer to 1 indicates superiority.
[0121] Example 2
[0122] This example discloses a methylation-specific biomarker combination for diagnosing breast cancer. Using plasma samples from 74 healthy individuals with no abnormalities on mammography or color Doppler ultrasound, and plasma samples from 155 breast cancer patients, the team screened 66 methylation biomarkers associated with breast cancer by leveraging differences in methylation levels across these groups. The differential methylation combination model was then validated using independent datasets of normal and breast cancer plasma samples. The specific process involved using LASSO and Random Forest algorithms for marker screening and model building in the training and test sets, respectively, including plasma cfDNA samples from 52 healthy individuals and 108 breast cancer patients. The LASSO method screened 42 methylation markers, while the Random Forest method screened 50 methylation markers, ultimately resulting in a total of 26 methylation markers. Finally, we validated the diagnostic capabilities of 42 (SEQ ID NO.1-42), 50 (SEQ ID NO.1-26, SEQ ID NO.27-SEQ ID NO.66), and 26 (SEQ ID NO.1-26) methylation markers in independent validation sets consisting of plasma cfDNA from 22 healthy subjects and 47 breast cancer patients, respectively.
[0123] The 66 methylation biomarkers (hereinafter referred to as sites or markers) are: cg23035715, cg26371731, cg04541368, cg13973436, cg16304215, cg20072171, cg08402365, cg21501525, cg22778178, cg08599259, cg25566568, cg15634980, cg07458308, cg01348584, cg141 40881, cg25756435, cg00594560, cg08279008, cg09760908, cg18087672, cg14868703, cg17632299, cg18786873, cg20631750, cg25924096, cg24615528, cg22889755, cg23524195, cg20861607, cg22435300, cg25504443, cg14351 528, cg25824543, cg23413809, cg24797187, cg26877715, cg01167274, cg12361223, cg04430835, cg27111970, cg 22851944, cg23228540, cg26225694, cg07790615, cg14825633, cg11901043, cg24504927, cg21962423, cg1413581 4, cg01070209, cg14841828, cg04947764, cg01397141, cg00436496, cg01832036, cg27125093, cg21319323, cg06916239, cg11667451, cg03355998, cg19019849, , cg22009488, cg15012484, cg20817483, cg21254450 and cg23134869. For specific sequences, see SEQ ID NOs. 1-66.
[0124] In a training set of 52 healthy individuals and 108 breast cancer patients, the intersection of the two algorithms was tested for 26 methylation biomarkers. At a specificity of 98.07% (51 / 52), the sensitivity for stage 0 was 60% (3 / 5), the sensitivity for stage I was 80% (32 / 40), the sensitivity for stage II was 95.45% (42 / 44), and the sensitivity for stage III was 94.74% (18 / 19). The overall sensitivity was 87.9% (95 / 108), and the AUC was 0.9839. For details, see [ 14 ]. Figure 1 .
[0125] Furthermore, 26 methylation biomarkers were independently validated in tissue samples from 22 healthy individuals with normal mammography and color Doppler ultrasound findings, as well as plasma samples from 47 breast cancer patients. At a specificity of 98% (22 / 22), the sensitivity for stage 0 was 66.67% (2 / 3), for stage I was 75% (9 / 12), for stage II was 95% (21 / 22), for stage III was 100% (8 / 8), and for stage IV was 100% (2 / 2). For all breast cancer samples, the overall sensitivity was 89.37% (42 / 47), with an overall AUC of 0.9816. Figure 2 In addition, we also screened 42 (SEQ ID NO.1-26 and SEQ ID NO.51-66), 50 (SEQ ID NO.1-SEQ ID 50) methylation biomarkers were independently validated. At a specificity of 98% (22 / 22), the sensitivity of detection for stage 0 was 66.67% (2 / 3) and 33.33% (1 / 3), for stage I was 66.67% (8 / 12) and 58.33% (7 / 12), for stage II was 95.45% (21 / 22) and 63.63% (14 / 22), for stage III was 100% (8 / 8) and 75% (6 / 8), and for stage IV was 100% (2 / 2) and 0% (0 / 2). For all breast cancer samples, the overall sensitivity was 87.23% (43 / 47) and 59.57% (28 / 47), with an overall AUC of 0.9709 and 0.9497, respectively. Figure 3 and Figure 4 .
[0126] To further validate the significance of the 26 methylation biomarkers, we performed independent validation analysis on the 26 markers (SEQ ID NO. 1-26) combined with cg22889755, cg23524195, and cg20861607, which were randomly selected from the other 40 methylation markers (SEQ ID NO. 27-66)) were selected. At a specificity of 98% (22 / 22), the detection sensitivity for stage 0 was 100% (3 / 3), the detection sensitivity for stage I was 83.33% (10 / 12), the detection sensitivity for stage II was 86.36% (19 / 22), the detection sensitivity for stage III was 87.5% (7 / 8), and the detection sensitivity for stage IV was 0% (0 / 2). For all breast cancer samples, the overall sensitivity of the test was 82.98% (39 / 47), and the overall AUC was 0.9797. Figure 5 a-5b. The overall sensitivity is lower, but the sensitivity for early breast cancer is higher than the combination of top 1-26 methylation markers.
[0127] Example 3
[0128] Using the information of 26 methylation markers (SEQ ID NO.1-26), 22 normal subjects with no abnormalities in mammography and color Doppler ultrasound and 47 plasma samples of breast cancer patients (including 3 cases in stage 0, 12 cases in stage I, 22 cases in stage II, 8 cases in stage III, and 2 cases in stage IV) were randomly combined for testing. The logistic regression model was used for modeling analysis, and 4 markers (cg23035715, cg26371731, cg04541368 and cg13973436) were further screened. The specific data analysis method was consistent with that in Example 2. Top1 (cg23035715) and Top1 / 2 / 3 / 4 (cg23035715, cg26371731, cg04541368 and cg13973436) were detected at stage 0 of the validation set at a specificity of 98% (22 / 22). The detection sensitivity of the three loci was 100% (3 / 3) and 100% (3 / 3), respectively. The detection sensitivity of breast cancer stage I was 91.67% (11 / 12) and 91.67% (11 / 12), the detection sensitivity of breast cancer stage II was 90.90% (20 / 22) and 90.91% (20 / 22), the detection sensitivity of stage III was 87.5% (7 / 8) and 87.5% (7 / 8), and the detection sensitivity of breast cancer stage IV was 50% (1 / 2) and 0% (0 / 2). For all breast cancer samples, the overall sensitivity of the detection was 91.49% (43 / 47) and 87.23% (41 / 47), respectively. The overall AUC was 0.9395 and 0.9796, respectively, indicating that these loci combinations are highly correlated with the early diagnosis of breast cancer. Figure 6 and Figure 7 a-7b.
[0129] The four biomarkers are: cg23035715, cg26371731, cg04541368 and cg13973436, among which the AUC of single marker cg23035715 is 0.9395, see Figure 6 ,and Figure 6 Four markers (cg23035715, cg26371731, cg04541368 and cg13973436) among the 26 co-methylated markers were combined with marker 1 (cg23035715) in terms of their ability to identify breast cancer. Figure 6 It can be seen that the AUC of the combination of the four methylation markers is very close to the AUC of the combination of the 26 markers, and the AUC of marker 1 is also 0.9395, which shows the importance of these four methylation markers, especially the marker 1, which has a strong ability to diagnose early breast cancer.
[0130] Figure 7 As shown in c-7d, at a specificity of 98%, the detection sensitivity of the Top1 / 2 / 3 and Top1 / 2 / 4 methylation marker combinations in the validation set at phase 0 was 100% (3 / 3) and 33.33% (1 / 3), respectively, in phase I, 100% (12 / 12) and 66.67% (8 / 12), in phase II, 81.82% (18 / 22) and 63.63% (14 / 22), in phase III, 87.5% (7 / 8) and 75% (6 / 8), in phase IV, 50% (1 / 2) and 0% (0 / 2), respectively. The overall sensitivity of the overall detection was 85.11% (40 / 47) and 61.7% (29 / 47), respectively. Among them, Figure 6 The top1 / 2 / 3 represent the combination of cg23035715, cg26371731 and cg04541368, while the top1 / 2 / 4 represent the combination of three markers (cg23035715, cg26371731 and cg13973436), and so on.
[0131] To further verify the significance of top1 alone, at 98% specificity, top1 (SEQ ID NO. 1) was combined with cg23035715, cg16304215 and cg08599259 among random SEQ ID NO. 5-26 markers and with the remaining 40 markers (SEQ ID The detection sensitivities of the validation set for the randomly selected combinations of cg01167274, cg07790615, cg23134869 and cg01832036 were 100% (3 / 3) and 100% (3 / 3), 100% (12 / 12) and 83.33% (10 / 12) for phase 0, 95.45% (21 / 22) and 95.45% (21 / 22) for phase II, 100% (8 / 8) and 87.5% (7 / 8) for phase III, 0% (0 / 2) and 0% (0 / 2) for phase IV, and 93.61% (40 / 47) and 61.7% (29 / 47) for the overall detection, respectively. Figure 8 a-8b and Figure 9 a-9b.
[0132] Further validation and the significance of the top 1 / 2 / 3 / 4 combination, at 98% specificity, top 1-4 (SEQ ID NO.1-4) and randomly selected SEQ ID NO.5-26 markers cg16304215, cg20072171 and cg08402365 in combination and with the remaining 40 markers (SEQ ID The combination of cg22889755, cg23524195, cg14135814, cg15012484 and cg2081748 in the validation set (NO.27-66) showed a detection sensitivity of 100% (3 / 3) in phase 0, 91.67% (11 / 12) in phase I, 90.91% (20 / 22) in phase II, 87.5% (7 / 8) in phase III, 0% (0 / 2) in phase IV, and 87.23% (41 / 47) in the overall detection. The AUCs were 0.9739 and 0.9797, respectively. Figure 10 a-10b and Figure 11 a-11b.
[0133] The results of testing on plasma samples from the 22 normal subjects with no abnormalities in mammography and color Doppler ultrasound, as well as 47 breast cancer patients, showed that cg23035715 performed well in the diagnosis of early breast cancer. Its combination with cg26371731, cg04541368, and cg13973436 also showed diagnostic ability similar to the top 1-26 combinations. In addition, cg23035715 also showed good diagnostic ability in combination with cg23035715, cg16304215, and cg08599259 from the random SEQ ID NOs. 5-26 markers, as well as with cg01167274, cg07790615, cg23134869, and cg01832036 from the remaining 40 markers (SEQ ID NOs. 27-66). In addition, the top 1-4 (SEQ ID NO. 1-4) and top 1-26 (SEQ ID NO. 1-26) combinations were respectively combined with the remaining 40 markers (SEQ ID The combination of cg22889755, cg23524195, cg14135814, cg15012484, and cg2081748 and the combination of cg22889755, cg23524195, and cg20861607 in the samples of NO. 27-66 also showed very stable diagnostic capabilities, and the AUCs of the top 1 / 2 / 3 / 4 markers were also above 0.75. For example, the AUCs of cg2303571, cg26371731, cg04541368, and cg13973436 were 0.9395, 0.8020, 0.7701, and 0.7501, respectively, as shown in Table 3.1. This shows that the sites screened by this method have a very high correlation with the early diagnosis of breast cancer.
[0134] Table 3.1 Performance of 26 methylation marker fragments in breast cancer diagnosis - AUC.
[0135]
[0136]
[0137]
[0138] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0139] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims. Sequence Listing <110> Guangzhou Benchmark Medical Co., Ltd. <120> Methylation biomarkers or combinations and applications thereof for detecting breast cancer <160> 66 <170> SIPOSequenceListing 1.0 <210> 1 <211> 601 <212> DNA <213> Artificial Sequence <400> 1 ctgtccttgc ctttcatggt gtcagcctct tcatgcctcc ccaccattcc aggcactccg 60 ggctttctct tcaaaccctc tttcgacacc tccaagtgct gagcctcctt gcttttctag 120 cccatctgcc agcctcctgc acgtctacac ctgacggctg ggctcctgtc gcagaaacca 180 tgcgccaggc acattggggc ccacataaat gtgcagtgtc cgatacgcca tgtggtcagc 240 acgacttctc cacgtctcct ctttctcttc ttcctgcaga gtgagcccac cggttcacca 300 cgttgctctt gcccctagcc caccaggccc tggccctcag cagcggacct gccgcggttt 360 ctggactagg aaggccctgc tcccgaccga cccggagcgc gctgctgccc tctaccggtc 420 atccgtgcgg ccggacaccg tgtcaggccc gcgaggaggg ctctgccgca gtcccgggga 480 acagcaccca gcagcgccac tgggagagga aactggggtc agggaggtgt gactgggccc 540 caggcagtca cactcaggcc aacaaggtca gggagggagg gcagctcact cgtgcaaacg 600 t 601 <210> 2 <211> 601 <212> DNA <213> Artificial Sequence <400> 2 tgaaatggga ctgtgactcc tacctgtgcc gactggggtg ctgggggggt gaaatgtcgc 60 ccgaaccagt gaggtctctc tcctcctctt gtatcctctg gtgctggtca gtcctcgcgg 120 ctctagcccc tcgctcaagc ctctccctcc cgcccgtgag gccggctttc cccgggcccc 180 tctgcgcagt gtatggggtt atttttactt tcggttatct agctttatga agactccaca 240 ccactcatac agctagataa ccaaagataa caaccaaccc cgcctcctgg ctgctgtcgc 300 cgcctcttcc acgcagcctc ccggccgccg ccgccgccag cacctccgca gcttcccggt 360 cgcccgtcag cgggagtagg agggaaggga cacgagtgga gttgaggggg agggtgaaga 420 gagaaatgaa gtccgagaca aaacaacaac aaaaacctca gacacggaga tacagacacg 480 acagagaccg aaaaaggcgt ggaaaggacg cgatgacccg tggcgtcgaa gtcggggagt 540 tgaccccgat ccagacccaa aaagtttctg gtgccccatt tcccgctctc ccattcgggc 600 c 601 <210> 3 <211> 601 <212> DNA <213> Artificial Sequence <400> 3 ctttccaccc tttctcactc cagtcactcc cgaggacttg gggcacgact atcacacgca 60 actgggagat cctggaagac ggaggaaaaa cgaacaaggg gacatggccc tcactgcagt 120 gacagggctt tccttcagtc agtggccaca ataaatttaa ccaaggctaa aggagattaa 180 tttcccagca taatccaatt aaaagatttc taaagtaatc ttttgcgaaa atgaaaagtg 240 cgcgactaaa gaggggactg gttttgatga cagtgattta tcgcctcagc acagcacgca 300 cgggacgctg tctctccaag cgatttgacc agagcatccc gtcctcgcct cctgtccaaa 360 ccttcctctt cctgaaagac agccatctat cacgccaacc tgggcaggag agaatgtgca 420 aggggctggg gcggcttaca agcaccacag acctttttaa gtgctattag atttatggtc 480 tctttttcga cacccatcca gagtaattag cacatatgtt ctaaatagat gatagttttg 540 tgagcaataa agcaattacc catcgttgga gctgacagtt cctccaacta aactccaacc 600 a 601 <210> 4 <211> 601 <212> DNA <213> Artificial Sequence <400> 4 cgcgccagcg tgggctgtcg gccccggccc cgcggggcgg ccagagcggc gctgcccagg 60 [[ID=2))]]cgcgtctgcg ccactggaat ctcgtccacg gactctgccg acgccgagtg gtaggcgccg 120 gcagggccag cggcgtgcac agggctggcg tccgcggaat ccgtcgacga gctggagcgg 180 cggctggggg ccctaggccc tgcgcaaggg aagggaacat gagcccagtg gctgcggctc 240 gcttgtggct ctgccttccc ctccctcgag ttcccagagc aggacccgga cagggagagg 300 [[ID=)))]]cgctcacccg acgccggatc cgaggtctca gacgttcgca ctttatacac gcgcctcttc 360 ctctttttct gcagagacac gggggagcct gagggcccca catcgccaaa agaagcagag 420 It should be noted that there seems to be an error in the numbering in your original text. I've translated it as accurately as possible based on the provided content.gcgagcgcca gggtagaggc ttctttctat cccactccac ctggaccgga ggcccagcac 480 agtccctcct acctggggtc ggatccgggg aggcagggcg agagtgtctg gggaagaggg 540 tggtggaggt tccgcttggc cacgggtggc aagaaactgg gagggactga gggggaagca 600 g 601 <210> 5 <211> 601 <212> DNA <213> Artificial Sequence <400> 5 taccactttc ttcctgtggt ttctacccca ttttgcagat tgctgcgtat cccagtgtcg 60 gcgatggata aacaggtctc gtctcttccc agttgcagcc cgtgagctgg tggcacaacg 120 gattaatgag gcaacagggc tctagatggt gagtgggatc aatgagaccc aattgagctg 180 ttagcggtct taggcggaga gcatctctca ggaggaaagg aaggcacagc gagaagacct 240 aaggccgaaa gtcgctgtgc agcacccacc caaggctgga ctcgggggag gtagacggga 300 cggtgtctgt gactaaacgg ttcccacacc ttacacgccg caccgggatt atgttttgaa 360 aggtgtctta taaaatcaag accggttcct aacaacctgc aagtgccagt gaatcccgaa 420 atgtttgttt gaggagaggg agtgtgaggg aaggagcaga aaaaagaaag agggggagga 480 ttgcccagta gaatttcaat agaaaatgtg actaccagaa tggtttctga atctaggatc 540 tgctcaggca caggcggaaa agaacagctg ttaaagaact aaatattata gaaataatcg 600 g 601 <210> 6 <211> 601 <212> DNA <213> Artificial Sequence <400> 6 caaaggcttt cgccaggcca gcacgctctg caggcacaaa attatccaca cccaggtacg 60 tggcccccgg gtcgggccta gcccgcgcgc aacccccaga atcttagtga taacaccggg 120 gatacgatgg ccaaagatta tcccttaccc tctagggttg agtgggggtg ggggggatgt 180 cccttccagg tgttcccgag gtggcctctc cttactgtgc actcgcccct ttcctcagga 240 aaagccacat aaatgcaacc agtgcggcaa agcgttcaac cgcagctcca cgctcaacac 300 gcatatccgc atccacgcgg gctacaagcc cttcgtctgc gaattttgcg gcaaaggctt 360 tcaccaaaaa ggtaacgtgc caggcgaggc cttctcttct cacctcacct caggactcgg 420 gtcgcggctg gctggcagga aggcaaagag ggatctggag agagaaggcg aaatctgcag 480 gcgcgggcgc agcatttctt tagaatcggg ttgtgcctgg tgtaggggga agctctccta 540 gcggggttag tagaccacgc tgtatgcagg ctgggtgcac tgagagactc cgaattcgag 600 a 601 <210> 7 <211> 601 <212> DNA <213> Artificial Sequence <400> 7 gttcggattt ttcggcagac gtgcaaagtt cagatacaaa gatcactgta actgtcagag 60 aggtaaggac ctctgataca atggatttaa gaggtttttt actccaacag tcagggcaag 120 ggaaagagaa aaccgtgctt ctcttggaat ctcttccaac aagggggttt cctccagtcc 180 cctccagatg cgttgaccgc gctgggaaac cgagtccagg gccaggattt gtttttccaa 240 agccgcgcga ccccagcagg gcttcagatc cgagttccca gttgctcttc agtctccccc 300 gcgttcttcc aaacgctatc aggagccacg caggttaccg caccaccggt catttccctg 360 tttcttctaa aagttctcca gccaaatttc agcaatttat ttaaaaaggc accaggtcac 420 cgcgaccttc gggcggctcc tcaggcctca tggggtagtt tggtcaggat ctgcgcgccc 480 ctcgacgtga tcagaaccgt gtgctcgaac tgcgccgacc tgtaacacag cacccagccg 540 tcagaacgcg cacgcaagct ccggccgggc cacaagcgcg ccgtcggacc aatcttcctt 600 t 601 <210> 8 <211> 601 <212> DNA <213> Artificial Sequence <400> 8 caactctgaa gagtggggtg aaaagatttc tacacagtgt acattctaca gaattctagt 60 ttctccgcgg gcgcagactt ttccgccctc tagtctagcg tgaaaacagt tcgaccactg 120 gatgtgggcg gcgaagcccg caccctagag cgcggtgtct ccctgcagga gggagctcca 180 gcccgcgccg ccgcggccgc ttctggcctc ctcgggaacc gaaccgagca tacctcagtg 240 ctctcctaga agcggctcct tttccccttc ttactcgcga atggcgaaat gaatagccgc 300 gcgggatttt acccgtttgt gtagtggact ctgagggggc accaggtacc gagacggaaa 360 tctttgcggt aagaataaag tcaggtaaaa cgcctggtac agccgccctg cagatgtccc 420 aagagtaggt cccccgtaca ctcttcccat taagttctta gggggaggac agggaaggcc 480 ctttggtctg gctggattga tcagggaggt atgcgcatat gtttgccctc tggacatttg 540 gggaggggtt atgggggagt tgaaggcaag aggcaaaatc aggtagaaca aacaactaca 600 g 601 <210> 9 <211> 601 <212> DNA <213> Artificial Sequence <400> 9 cggagaatgg gcagtctgaa gagacctgcg tcccccctct ccgatttgac ttttcctgaa 60 atttggaatt attgcgcctc tttttctctt tctgatcgag catttagtgc tggcgcaagc 120 cgggcagccg actggttact gagcccacgg ccagcccggc cttgtgcttc catttgcgct 180 cacctcagca agcccctgag cgctttctca gggattggag ttccccctca tttcccaaat 240 aaccctggag aagctcccgg gggaggagga ggggagaggt cttggggtca gcaccacttc 300 gatcccagca ctgcagtggg gctccccacg cccgtctccc gctccaccat cggcgacgct 360 ctcccggagt cttctttgca ttacttgcaa atttcagcct ctgctcagga aaagtctatt 420 tgagattagc tgggatgttt tatgcacaca ctaaacatgt taaaaacaaa actaggaaaa 480 attcttggga cacggggtgg ggggacggag gaagagagag agagacagag agagagagag 540 agagaaaacg gttaacaaaa aatgaggcgg ttttgagggt gtcttggagg caggctgcgc 600 c 601 <HSEQ> 10 <HSEQ> 601 <HTYP> DNA <HSEQ> Artificial Sequence <SEQ> 10 aagcgcatga cccctgcggc cggcgcgggc cacccgccca tggacgatgt atacgcgcct 60 ggggagctag ggcctggcgg gggcggcgca tcgccaccct ccgcgccccc accgcccccg 120 ccggcggcgc tgcaccacca ccaccaccac acactgcccg gctcagtgca gtgaccccgc 180 gggccgggcc cccgccggcg cgctgcaggg cgcgggcgcg cagcccgccc gcgcggcctg 240 gactcttttt gttcggttgc tttggatttt acaaaaaaaa aaaaaagccc agaaactttc 300 gaacaaaacc aaacacccgg acgaccctct ccggtgagcg gcgaagacag cccggtaggc 360 tgcgtcgccc gagccccggg agagaggagc gaagatccgg aactcgccaa ctcaccccgg 420 gcatcctgcc cgccgcctgc tctctgcccc catcccctcg acgacccccg cccctgcccc 480 cccgggctgt tcggggccgg atcccggcag cggcctcccc aaagcgacag gtaacgcagt 540 gcggggttag ggattccccg ggagagagga cgaagcgagg agagttctcc atcccctctc 600 c 601 <210> 11 <211> 601 <212> DNA <213> Artificial Sequence <400> 11 cttgtcccag gcagtttccg gtggccgcag tatcgacccc aggccattgg ggtgggtgtg 60 agggaagggt ggagggggaa tctccgaggc ccaatgtttt ctgggacttg agggaggctg 120 aattctccct cgctgcctag gacttggggt ctgaaggttg cagaccgagg cgatccgcag 180 cgccctcttc cggcggccgt ctggagaact gcagctttag agcggtctcg gggaagcttt 240 gctactagtt tccggctagg gaaaactggt ggtggtcgga gactggtagt acatcatcca 300 cgcattcgct cattctaact gtccgcccga ccatacgtca ggctgtctat cggtccaccc 360 aaagccaata taagttatga ttgactcttt gaatcaccca gtctccttgc acctgctatt 420 tgaaagagcc caggtgtaga tcagggcttg gaagctgctc ttgtacctaa aaccctcttt tattatgct ttgcttcgga attttgttat gcgaatgtcc tgtccaagtc agagggcatt tggaggcata tttggtgacc aatggagtag cttgcacttt ctgcatgtcc tttctggagg 600 a 601 <210> 12 <211> 601 <212> DNA <213> Artificial Sequence <400> 12 tacccctgca gtgtagggca tagaataa atggtaaata aaccagggtc actgctcctc ggaggctggc tgtcactgtg aggataaact gagataatag gtgggaaagc ctgtttaggg aaacgattgt tgttaagatg father ttattacgtt ggggtagggt attcaagata tacccacagg aaaatgcaga ttacaattca gtctgcaatt agggaccaga tagcagccaa ctctcaggtg atccatgcag ggattctgag cattcgtcgg cgcctcccca ggggctgctg 300 cgccccctgc ttcccgcgcg cccaccacgc accctgctct gggagcaggg ccggcggcgc 360 cgccgcctcg cagcgattgg ttgaaccgga ggttgttgct aggctaccag tgcgccctga 420 gcctggggcc ccgcagtccc atcctctgtg gcagatccat ccctcactgc agacctaatt 480 ccggtaccct gtgaacggca tcctcagcag cttaaattat cagccccaac tgcccgcctt 540 tctatgattt ttcatttcgc aagaggccat gtggagttgg ggaagagaag ccttctgttt 600 t 601 <210> 13 <211> 601 <212> DNA <213> Artificial Sequence <400> 13 cctaggctgc ctctctggca ggttaggaaa ttgactcatt aggatttcat ccaccttttc 60 actggctacc tctcccgctc cccacccccg ccctagactg cctcactaag tcaacactgc 120 aatctctctg gctcagctaa gtggtcccta gtgaggagca ggcctgagcg ccgggtaacc 180 gaggaactcg gaggcacctg gccgccggca tgctcacctg cagcgctcta ggatggggtg 240 cgcagtgggc agccaagcgc cccccaccca gacggaggag gggcgggagg ccctgttccc 300 gacctgtcaa tcactgcccg gcccgcagct gcgctctccg cagccccagc gcgctgttcc 360 tctgagggag ataaacatcg agaaatccaa tccagcgccg cttcagagat aaacagatgt 420 gcggccctct tcggtcagga gataacgccc ctgccccgcc ccacgcgccc gcccggcctg 480 cacctgcctg aggcgacagg gacgcgcctc tcgggaggca ggttgcgtcc cccagcctgg 540 agaaatggtc tccagagctg cgggtggggg tggggttgga gaagaaagaa gctcggtttg 600 t 601 <210> 14 <211> 601 <212> DNA <tggcactcag cgacaacaca gacctgccac ccgcctgcca gctccatcgc agcactgggg 480 gcaggagggc agcccaccac gccgccaggt ggccagggct gcaggttcct ctgtcgctca 540 agccacatcc acactcctgg acggccacac catccccaca ccaccctccc acacacacac a 601 <210> 15 <211> 601 <212> DNA <213> Artificial Sequence <400> 15 gaaagcgaat gtgtaagagg ggggtttcgt gtggggaagcg aaccccacat ggaggtatgg ctgtaccggg gcatgggggc ccttacccgg ccgaaagaaa aggagggcgc tggtgaggta 120 gctaaccacc tccttgatct gatgcttttc caaatactcc gcggcttgga gctccctgct gctggtctcc atcgctccgc gtcccgctgt tgctagcga ctgcctggcg tctcagccgt 240 gcgactctgt ctccctctac ccggcgcggt cacgtgacac gcctgactgc cctgtggctg 300 cgacccggac ctggaattc tagagctcac ggttcagggc aagcctgggg catgtagcag 360 ggcagagagg gcaggtgagg tgtggaccaa cgtcactgtc cgcgatccag gcttagggct 420 gggcccaggt gcctttttcc atctctctct agcacctagc tcggtacttg ttgatccaat 480 gattaacaag gcttgaagtg ctggcatcac aactcagcat gaactaataa cagaaggaac 540 ttgtgcaatt ttgagggtgc ccagtggaga gttcttttta ttattattat ttaagacctt 600 t 601 <210> 16 <211> 601 <212> DNA <213> Artificial Sequence <400> 16 cgtttctcca gaaaacatca gagaaacctc tctgcctccc ccagtttcac caaaggccca 60 tagaaaattc atttaaggac accccagaaa ccctaagaga cccttggaaa gaaacctgag 120 attcctcccc ttgagaaaca gccctagtcg tcctccccca cctcggggac caagagtccc 180 tcgataggca tcgcgcaatc tgcgcttgcg cacgtcatct tggctgcccc gtcctgttgc 240 tatggaaaca cctggccagg agagcaaggc tcggagagac taagaccccg cgcccagggc 300 gcacgcgctt tcgacctgcc gcaaagggag ccccaccgcc ttccccgttc cagatcggcg 360 attggacccc gccttcttat aggccccgcc ccgaaggcta ggcgctcctt cccgctgaga 420 ccttggggca ctcgctggtc ccctcaggcc ccagctcggg tgcaattagg aggagaacag 480 atggcggccc agacagtggt tggggagggt ctgcccaggg ttctggggcc ctggagggga 540 gggactcacc ttcggggagg ggcaaacgag aagtgggcgg gggtgttggg ggagaagttt 600 c 601 <210> 17 <211> 601 <212> DNA <213> Artificial Sequence <400> 17 ttatcgtttt agccctgttt aaaaaaatgg ctgattaagt tgagtgcgca tgtctttgtg tgtctattcc cgatatgcac tctgggaatg rich gcgagggaga 120 gaggggggag agagaggtgt aattagtgag gtgatcaaca ttccccagac tgcaaatgac gcgcagcccg gactcagagc agctccggag cctcacggct tccaaagctc ccagcgctgc 240 ggctggagcc ccggatgcgg cgaccgcgga gaggacaggg gatggggacc tccgggtctc 300 360. gcaccctacg cgcccctgcg cgcgactccc aaacttcatt agacacacac gcgctcttac acacaaacac agacacacac agagcaaga ggggaaaga ataaaacata throwccgcca aagcatggcc ctttaaccat tcgagatttt ttttttattt taatgaggca aagtaattat 480 tatcggacca gagatttgtt tactagggag ctttaagcag aaatatgagt tagggtaatg 540 aagagctttt ctctgcctag tttattctgc tgtgcacatg aatgcacttt aatggcgaaa 600 t 601 <210> 18 <211> 601 <212> DNA <213> Artificial Sequence <400> 18 ccctgattcc cccagttggg gatgccttct gccttccctg cctcttttgg tgaccaggac 60 ttgtggagaa cgtaggaggg aaggaggtga gaaggcagaa tgaatggctg gtgagtaagt 120 ggtaggcatg tgaccagtgt gccagttttc ctggaggtgc aatttgccct tctatggttt 180 tgccaagagc aggggaacta acggcccaca gtgactgcct tctcaaggtt gtgcagctca 240 cctgaatgta gcaacagaaa gggaacagga ggggcagggg cagagaagcc tcccgtccca 300 cgtaaataat tacaaacaga gcacatgacc cctggcggtt tctgaacgcg cctggcaaca 360 gctccaccac ctgctgtttg gaaagtcaga ttcacagaag ctacaattac agactgtcag 420 ctgggtcttt tcatggctgg ggaccggagg ccaaaactta cagcccctaa ctcctagctc 480 agtgctcttt ccacttcatc tcccctgcca cctgccagac aatttacaca aacagcccat 540 gtgatgggtg ccagtgcaga gatctggggg gccttctacg cttgtatatc tctacctagg 600 g 601 <210> 19 <211> 601 <212> DNA <213> Artificial Sequence <400> 19 aatgagaatg cattctggag gaagaaggga aaaaaaaaaa aaaaaaaaaa acaagcgctg 60 attgtccctt taagccattt caatcacagt ctcgcagtta aaataatgct cacctactgc 120 gcttccaact gggccatcta ccttttccgc cgggtcaggc ccagtcaagc ctgaggaggc 180 ggccgcggcc ctcgtgagcc cgctctaggc ccggttacac ctgtttatca ccaagtcgct 240 tcatttccct tcccctcctc cctgcttgaa aaggagcatt aattaaaccg gtaaacaagc 300 cggctcccat tctaaatcag agctgcaggc aaaggagaga taacttaggc tccggagaag 360 agggattttc agttaattta tggaatccac cgtcacactc tctccgagca gccagctccc 420 cgcttaacgg ggaaattgaa gcagacagcc tttgtctaaa cacttctttt gcccagaata 480 tcttaatttt cctatttgaa tgtttaataa ggtttggggt gcagcagctt ccttttaatt 540 gtgacggtgc ggccgcttgg gcgtgatccc ttggctgggg ctgcaggggg cccgtcctcc 600 a 601 <210> 20 <211> 601 <212> DNA <213> Artificial Sequence <400> 20 tctccgtttc tctatatttt tactgtggag gactcagaag agagctgagg ctattgtccg 60 gggaggaaag gaattcgggc aaatttgtgg gtaggggccc agacccaaga cccgtgtttc 120 tcctgcgtgg gttggagtct gtctcaggtc gctccaggga catcaagagc ccgcgccgcc 180 gagagcccgc gccgccgtcc agcgggaagc agcggaccca caggggcctc cagccgcctc 240 cccgctcccg ccccgtgttt ctcctgggcc tccagctccg tggagagagc tgagagttct 300 cggcccgcgg gcttcctcac caaatcccca aaaaccgacg caggcacaga gggctgactg 360 tgttttgagt aatgcacgcg aggcagtcca atccggcgag atggcccgaa gcggggccca 420 gcggtcgggg gtgtgggtct ggagagagag ggtctcccca cttccttcct ccggctgctc 480 ggtcacccat cgactacccg ggcggaagcg gggcgcagag gggcgcagag ggaggcattg 540 ccctccagga gtatctattc ccatcggggt atggtgaatg ccatctaggc ccatgctcca 600 t 601 <210> 21 <211> 601 <212> DNA <213> Artificial Sequence <400> 21 agctctctcc atgagaaagg cccggctggg ccccagcccc gtgtatgaca aaaagaagcc 60 ggggccggct ccaggagccg ggagaaccgc gctgacgcag cttcagggcg cagagggggc 120 gcgggggtgg gggaatccaa tctgggctgg ctgggctgga gaaggggagc gaagtgtggg 180 gcgtggggca acttctgcaa gttccaggga tggcgaaggg ggcaggggta cctcccggac 240 taggccttgg aacccgtgac ccccaaatat ttgtgaggag aaagagagag gaagagagac 300 gcaattttcg tttcgcgctg cccccgcccc gtcagcccca aactggaagg taaatactta 360 cttagcctcc gaaccaggta caagctaata ctcaacaata ctgatgcctt gttttttttg 420 ctctgtccgg acagcaacgc tgtagccaat ttagatatgc tataaattta agaggttgcc 480 atggccacgg tgcgcccatt ggccgctggg ccccctacgt gcagcgccac gtcaccaaat 540 ctgaataagg atgcgcgaat tacgcggcga ccagacaaag atgaggatcc ggaccgcttg 600 a 601 <210> 22 <211> 601 <212> DNA <213> Artificial Sequence <400> 22 tggctaggtc acaaaaaaac cttctgaaag gcaaaaattc cttcccaatg ggtctgaata 60 tgggtctgaa tattcctcca ctatctttgt cctggatttt aaacccacag cctttcttag 120 cagggacagg ccttagagat cgtccagttc cattttttcc cttcaggacg agtacactga 180 ggccaaaagg tgacgtgcct tccccacggt cgcgccactg cttagtggga gatgagccga 240 gaacggcctt tctcggaccg tccactacat tctcccctac tctacgcttc aatcttctcc 300 cgtgaaacct tcacttgctt ttctacaacg ttgacctaag gcggaaagcc gcgtgccaga 360 gtgggatggg agaggggagc tcacgctggg cccgaggggc ccgccggcag ccgcgcgccc 420 ctcgccggcc cgcgctcggg ctccccctag gggcaccatg ggcgacacgg gggtccccgc 480 gcgccgccct ctggacttac gtgactgtcg ctccccttcc agaagtagaa ggccccgatg 540 gccccaaaga gcagcagcac agctcccgaa atgaggacca cggctcccac cttgagcagc 600 c 601 <210> 23 <211> 601 <212> DNA <213> Artificial Sequence <400> 23 gaatatatca aaatgagaac aagggggtaa gaaaattaac gatttcagtt gaacggagga 60 caggccaaac gaaagggagg caggcgggtg cgagcagagc ctggtagaga tcctggcggc 120 cgctagcctc tggcgctctt gccggtgttc aacgggctgc cagcgtccct gcggcagagc 180 ggacctcggc gcagcgcggc gcgcggtgga gcctggctgc ttgaggacag tcagccccca 240 gggccgcaca gcctacttgg tgggaagtgg cgggcgaaga gggaacccgc cttatttccc 300 ggtttttaaa ataaccggct cggagcgttt ccagtccaca cgagtgagcg cgcagctgcg 360 ccccatctgc ggcgcgatct ttcacgaggc tgggcagttg cgcgccccag agcctggcgc 420 acctcgctct tctcccgcct gcagtccgcc gcccgcgcag ccccaggccg ccctttgctg 480 agagcgccca gccttgctct gaacccaggc tgcgtgctgg cgctgccagc cactctcgcg 540 ccgtccgcgc ttggctagtc tgtcccgagt ttggctctga cgtcgaaaca cgccctcggc 600 a 601 <210> 24[[ID=⑨]] <211> 601 <212> DNA <213> Artificial Sequence <400> 24 cctcccgcct cagcctccca aagtggtgct gggattacag gcgtgagcca ctgtgccctg 60 ccgctagtct tctattttaa gtatttagtg gtaggtcccg ggccggcaga atctattttc 120 agcatttacc acgtgtggcg cgcaaaccac aggttttggc gattgggttg cgcgggatct ①80 cagagctgac gccgcggggg cggctggggg tcccggtttc cgactggagc cgcgacgacc 240 ccggcgacgc gagcctgggg ctgcagcgag ggccggggag ctccccctcc atatgtgcgc 300 gcacattctc cagacttgct caaactaacc ccccggcagc gccagcgcgc tgcgggactg 360 atgatcaaat atttggtttc cgagataaca caccccgata gcgctgtttc ctgagccgct 420 It should be noted that there may be some inaccuracies in the original text, especially in the "⑨" which seems to be an incorrect tag. This translation is based on the best understanding of the provided content.ttcattctac ttgtgtaact tgctgcgaaa acccgaacca agtcaagaca gcaaactcac 480 gcccacgggc gctgtgtcaa catggaaata atgatactga agccccacgc tgggcacctg 540 gggcgtggac tgggggcgcg ggggaagcgc agatccgcct tcatgcttcc ccctcctgat 600 a 601 <210> 25 <211> 601 <212> DNA <213> Artificial Sequence <400> 25 aatctccttt acaataaagc caaggggaga gaattaaaaa tctttgaagt agatcaaggc 60 tcaaaggaat cagccaagta gacttaaagt agtcacttat ttcccaaaac tggtttgtcg 120 gggaacaata aaaggaagta aaatttatgg agaaattata cagtggattt gtcacttaaa 180 atatcgtaac tgtctggagg acaatacccc atgctgagga ttaatggtcc cgccggacct 240 ttgattcacc agtgcctttt cttcgccctt gacaaattgg atttttagga atgggaaggt 300 cgcctggacc attgtgtgct agccattcag cggcctcgat tatgcagggg gctgagggaa 360 ccactccatg tgaccctctc gggtgggact ctgcagctgc ttcgcagcgc aactctctca 420 ccaaactccg cgcccttgcg ctagcggtgc caaaaggctc ccgccccgat tgaaaaggcg 480 cagtgcatgc ccgcccgcgt cactccgcgg gcggaggacg cacgtcgggg cgcggctctc 540 tggctagcgc gcagctccag ctctgtcact cgcgcccttc caaggacctg gagcacccga 600 g 601 <210> 26 <211> 601 <212> DNA <213> Artificial Sequence <400> 26 tcgggacggg accggagctc gggcgcagac ggtgccacgg gagcgcgcag aaccctgagg 60 gatgctgccg ggcggaactg aaacccctcg caatgaactt tgaggaaagg ctttagcggt 120 tgaaatccac aaaagccttt aatatcctcc ctgaggcgcg caagagacaa aaatgacttt 180 agagcgactc cgacccgatt tcatcaccca cagacacaca aaaaccaacc acacagaaaa 240 agtacaaaac ccaatccgtg ctctttgtga aacactcatt taagacaata aagaagcagc 300 gctcagatgg gagaaaagat ttgcaaaaca atgaagtgaa atgatctcct ggaaaggatg 360 ggaagcagga gacaggagga gtgaaacgtc aggacttttc tccgcgcttc ggctccaccc 420 gggtgaccaa agccccacac ggctcagcgg gaagctccgc agtttcccct gcgcggcga 480 caccggtgtc ctcggcattc cgtcgccagg tcccggtccc aaaggcgctg gctgagggcc 540 ccacgttgat tcattgcatt ctggctctgc ttctgctgca ggactgtccc tggacggcgc 600 g 601 <210> 27 <211> 601 <212> DNA <213> Artificial Sequence <400> 27 ctgcggtttt cacagtgtaa aacggatcag agggaagct ccagcccctc tcgactttcg cttgcggttt gcaacccctg gggtgggtct gaccccgcgc ggcacttgcc caggcgagct 120 tccctcgtcg cggcccgacc cgcgcgcgga ctcggcttcc ccaggtcagg acccactagg 180 tgggccgctc ggccccaagc ctggcagggc ggagcctagg ccgcgcgccc cggggttgga 240 ggttcccacg gagccggga actgcgcgcc ccaggtccgc aggccgcctc ccttccctcg 300 cgccctcgca cccgccctct gctctgccgc tcccggtcct gggtgtgcgg gagtcccggg 360 ggtccctctc ctggacgcag aggaggatt tggagcaaaa ggaggatt ttactgcgga tggcaccgga acctgaattg acttgtgcgt ttcctgctct gggcacgtag gtttccccta 480 ggaatctgga gttcgctgag gacacttaat tccaagagat gatgggttca cataaacata 540 ccatttagtt aagaaaaata tttaaaataa agaaaaaaga aaaactgaac ttcgatcttc 600 t 601 <210> 28 <211> 601 <212> DNA <213> Artificial Sequence <400> 28 gggcaccgaa gtctacactg ggtcgggaga ccggtctagg agccagccgg cagtgctcgg 60 gatctttgct gatgtccaag ttcatctctc ggggagaccg agtttgaatc aaatctgcgt 120 gcgcccagct gtcaaatctg caaacctatc acgccagaca atgggccgcc gcggaggaca 180 gacaagaatg gctcattttg atcgaggggg gtaaattgaa aagggcacgg gctttggttg 240 aagtttgagg cccgggtgtc agggcgggga gaagaagagg aggaaggagg agggttgggc 300 cgctctccat tcaaccacac atcagccagg cgcgcccctc ggctgcagcg gctgcttgca 360 ggcgggctgc atattgtgtg gagtcgccaa agagggtctg cgcctcgggg cgcgccccaa 420 acccggggga catcctacgg atccgcactt ctcttgtgct gtacgcgtgt tcctccaggg 480 taagtatgag gagacggacg ccctcatcag acacccctcc tccaacacac acacacccat 540 agccacatca ttcagggata ctctagttca gtgtatcagt ttacacttgg ttgttgagta 600 a 601 <210> 29 <211> 601 <212> DNA <213> Artificial Sequence <400> 29 gaggcgtctg gctggcgctg gccgcgtcgc tcctgcacgg taaagccact gcctccccgc 60 cctccactcc tccgtgggat cccgggcaca tcccgggcgc ctctgtgcgc cccgcgcctg 120 ggccaggttt gggatctccc cgccgccggg gaggggcagc gggggcgctg cgggggctgc 180 ttgtctgggc tgcaccgggt gggcggcggg ggacgccggc aggagggagt cgggggtacc 240 cccgccggcc tgccctgagc cccctgcccg ggtcttctct ccttaagtgt ccctgcaagg 300 cgagttccag aggaagcttt acaaggagct ggtcaagaac tacaatccct tggagaggcc 360 cgtggccaat gactcgcaac cactcaccgt ctacttctcc ctgagcctcc tgcagatcat 420 ggacgtggtg agtcccgcct ggctacaggg ctgccctctc cccttcctgg gctccgaggg 480 gctttttaga cagcgtcggg cggccaggcg gtggagctcg gctggggcac tctagttggc 540 cccaagctag gcagggccat gctctgagtc tgtccccagc ctgccctctc ctgagtgtct 600 c 601 <210> 30 <211> 601 <212> DNA <213> Artificial Sequence <400> 30 atcttcgtgg tgggggatta tggggtggaa atgcactctc ccagtcggat cacatcccac 60 tactcaccag cgttatatcc cgtcgcggct tcacatatat tacttacctg gcccgggtgg 120 cattttactt tgcatccttg attgggagtc tcaggggcta cgaacaaacg ttttaccccc 180 gggtagcagg cgggtgagga gcgagtattc gcggagcggg ataagtgggg atgtcgctgc 240 gccctcgtcc cttcatctcc gggggacggc cactctcagg gttcccgagg agccggctcc 300 gtgcacctag gccctaggtc ggctcccaag cccgggcccg ccgctacacc agccgtttct 360 tacccgcagc tacaaatctg acacagacac cagctcctca tactcttggc tcccatgctt 420 tcctccaccg cgcctcagca cttgcagctt ctccactccc acagcgcccg ccgtagtcaa 480 ggcaacagag ggatgcccgg tgacagactc ggcgccggct tccggcggcg tcagagacgt 540 gcgggtgaaa ggtcgagcga cagccggccc cgccccctgg cgcgcgggcg tgtcggaccc 600 g 601 <210> 31 <211> 601 <212> DNA <213> Artificial Sequence <400> 31 gaattatttg cagcatatat tattgactcg aattgcctcg atataaaaaa gcactttttt 60 tttttcgaaa ctctattgca caagctggag tgcagtgagg caatctcggc tcactgcaag 120 ctccgcctcc cgggttcacg ccattctcct gcctcagcct cctgagtagc tgggattaca 180 ggcgcccacc gtgcgggttt caccgtgtta gccaggatga tagtctcgat ctcctgacct 240 cttgatccgc ccgcctcggc ctcccaaagt gctggtatta caggcgtgag ccaccgcgcc 300 cggcctattg tcagactctt aatcaagcct gacttttggg tttagctctg gctccagcag 360 agcaactctg gcggttggtt ctttctcttc cttatctcct tgtccccaag catccaccag 420 aggacgcagc tcccccaaaa ctttccaccc agtgcttggc tggaggaact cagtccacgc 480 ttctctgcta gtctaggccg gcggttaagt caatgtaacc ggagacccgg ctgcccgttg 540 ccatggggac ggaaagctat gatgtcacca ccgtccgggt gggtgtgctg gggttcaccc 600 t 601 <210> 32 <211> 601 <212> DNA <213> Artificial Sequence <400> 32 cctataatgg taaatgttga attaaaaact tacagtgctg gcgaacaggg acttagcgtg 60 cctaggaact caagtgcaaa aacaaaacaa catccacccc caaaaattgc cctttttttt 120 tttcgaagtt tgcagttata ctattctgtg acttaaaagg gaggggaaag aaagtatgca 180 attcagattt cgcccccaac gcaaaactac cgaaacgaaa atctccccag gaaaatgtgg 240 cttgatttat agacgaaaaa gaaaaatatt gttcctcttg gcaaagtctt tttgcatcac 300<00%0866>gtgtatttgc agcctagtat aaacttgctt tgccgtgtgt ggatgtgtga gtgagaggga 360 acgagagtaa gagaaagaaa gaagtgaggg gatgtaaact cgaataaatt tcaaagtgcc 420 tccgagggat gcaacgggca aaaactgaac tgttcaggct tcagattgta actgacgatc 480 tgaggaaaaa tgaggtgctc gatgaatttt cgtttgtatt ttttggcgag gcgggggagg 540 tgttgagatt tttttttttt cccctcgggg tgggtgcgag ggggatgcat cctagcctgc 600 c 601 <210> 33 <211> 601 <212> DNA <213> Artificial Sequence <400> 33 gccgagaaat ccctttatca cgcaccccca cccccaacaa gcccctcatc actcccccaa 60 agccagccgc cccttcctga ccctacagaa cccccactgc taatattccc aatcacttca 120 gcgtccagta agcgacatag gcttagatcc acttaacaac agaagctaaa tggtcgctct 180 aggccacttc cggtttgggt tacattcccg ttaggatttc cgtaggcgct gttgaaccgc 240 gcgcatgccc actaacactt ttgaagctac gctccgccaa cagttatcat ggcgtataac 300 ggcgtacctt tattccgcgg ttcattcaac ttcagaaact tggtagggag gacggcatgg 360 ccgcacccat acggattatg atattggagg ccgccatcgt caaagggctt ttattccgta 420 cagccaagga caaatggaat gtcacagagt aaaagtcttg ggtcctacat tggcagggga 480 cctattcaat acttgtgtat atatatttct aggagaaact gacatgtatt ctgaaaaata 540 ctttttctct atatttttcc ctctgattta aagacttttt tttcctgaat tgctgaacaa 600 c 601 <210> 34 <211> 601 <212> DNA <213> Artificial Sequence <400> 34 gttccttaac ctgctagccc cacatctacc cagcaaacct ggcttgtgga gcctagagtg 60 atctgaaaat ccaggcatcg tctcttcctc ccggctcacc ccacaacttc agggaaccct 120 gttctcctgc acctctgttc ctgaaaagaa atattgggga aggggggaaa gaggaaatat 180 agaaaagata ttgatgagat tgacagcatg agaggtgggg acgataaggg cagaggggca 240 agagaaattg ggtgttgaga gatggagaga acgggcagaa aggagaaccc agaccaggtc 300 gaggaaatgg tagaaaccga aaacacccgc aggccacaag cccgggatct gtctcccgag 360 gctggtggct ggctctgact gtgactgaga tggcgctggg tggtctcgat gtccctgctg 420 accccgctgc tttgctcccg cacttgcagg gagaacaacg agaactccaa ttctaacagc 480 cacaacccgc tgaatggcag cggcaagtcg gtgttaggca gctcggagga tgagaagact 540 ccatcgggga cgccagacca ctcatcatcc agccccgcac tgctcctcag cccgccgccc 600 c 601 <210> 35 <211> 601 <212> DNA <213> Artificial Sequence <400> 35 taagtcccat attggaataa tacactaaat gacaataata tgattatata agatagaata 60 ctgatatata aataagtata caaaatatta taggaaataa taaaatgatg gcacctattc 120 ccagcatagt gtttttgttg tttataatga tggcacctat tcccagcata gtgtttttgt 180 tgtttataaa gtacattcat gtttgtgact ttagtggagc tgcttatagt tcagtaacat 240 caggtggcag cgtcgtcctt tccgcagagc ggggctcgcc cgcgaagcag tgaaggctgc 300 gtactagagc tacctcgcgc ctctcgtgga gagacagcgc cctctcgtgg tggaagaagg 360 aagcggccgg cccctgtgac ccaacagagt gattcaccta atgctgtaaa attatctagt 420 gataaatgta tttatggaat accttcttgg aattttgaat tctatttttg gacaaaagat 480 gttccctcac agacattata tgcacgtata gaaagatttc ctatgtagaa acaaggtatt 540 gttattgagt accttagaac aacaacaaaa atgtttaagt cttgtttgcg cacgacgcac 600 t 601 <210> 36 <211> 601 <212> DNA <213> Artificial Sequence <400> 36 gggagacatc cattatcagc gaggcagcgg agctcctctg ccgccctccg gctccaagga 60 ccaggtggga ggtggtggcg aattcggggg ccacgacaag cccaaaatca cggcgtggga 120 ggcaggctgg aacgtgacca acgccatcca ggtaagcgcg ggattcccag ttctgcctgt 180 cctcccccct cccagctcag cgtgccgggc tctgcccccg acagtcgccc ggtgatctcg 240 gcctggagac cccctcctgt acccaggaat ctccctttct ccatccctcc cagccctgcg 300 cggggaccta cgcccccagg cggtgttttc cgccctaacc cacgctccct cccaacggca 360 ccagctgcaa gaccgctagg ctgaagttcg gtctgagaca cctgtccgga gacactgcaa 420 aagtgaagga aatgggggga gggagcagga agcgatgaga aagaaagaaa atcaggattg 480 gagggcacgg tttggtcttg gactctggaa cggattcaca gctgcatttt tgggaggaaa 540 gaagaagggg aaatcgctga ggtcggagtc tcctcccccc gcacacacgc atagacacgc 600 a 601 <210> 37 <211> 601 <212> DNA <213> Artificial Sequence <400> 37 cccagcccct gagctggccc cagagctctg gcctggagcc tgatcaccct gaggccctcc 60 ctgctgcccc acactggggg caggtgccct cctcattctc caaggccctc cctgctgccc 120 cacaccaggg gcgggtgccc tcctcatcct ccagctctgg acatccccca tctaagggcg 180 ggcgggtccc cttaccaaga cctaaggtgc aaaacccaaa gctgaggctg cttaggaatc 240 cacagcccca caggcctctc agaaccttgc atcagagtcg cccttgacct caaccctgcc 300 cgagaaggaa gtgctggtgc aaccccagcc cagctgcagg aagtggtacc tgtcaccaag 360 tcccctgcac aggggaagca gggggctgag ggggcaggac cagggggacg aggtcatcct 420 tccccggaga acccctcagg ggccgggcgc ccttccctcc cgggcaccaa atggacacag 480 ctaacaagaa ccacacttca cggtgagcaa agctctgaac attcaggctc tgagacacga 540 aagcggcgtc agaagagacc tgcagcagat ccgggccaaa tcacacacac cctttcacag 600 a 601 <210> 38 <211> 601 <212> DNA <213> Artificial Sequence <400> 38 agagctgtgt ttacatgtgg gtagggttcg ttcggaggcc ttcctggaag tggtagccaa 60 actcccacac cagactaaat cccgtcaggg ctggcgctga aaagtgggat cctgggtggc 120 ttccaatgcc caccccccac cccccacccc tcccaccacc caacctcttc tccttccttc 180 ctttccaaag gaagggcctc aggctataag tttgatcttc ctttagactt tcgaagtaag 240 cttccaattc ctttacctca ctctcccccc tcctcacttt tttctgcttt gccaacatcc 300 gaatccaaga aaatggctca aataggatgc agattaactt catagttccc attccaaagt 360 ctgggaagcc acggtgatca cctcagtttg tgtgttcctc attcctaaga aaattatggg 420 gagaagtgct gatgaattta ccgggaataa caaggctctg cagttgcgat tacaggagag 480 ggaaggatcc atgagggggc aaggttgaga gtgaccaggc tcttctagtt ttccccagtt 540 gtggtacgga atgggagggg ttggaatgaa tatattcgtc cttatattca aaagccacag 600 g 601 <210> 39 <211> 601 <212> DNA <213> Artificial Sequence <400> 39 gccgggttcg ggaagccaga ggggaggtgc cctgggccgc agccgccgcg cctcatccgc 60 cgtcccgcgc ggtctcctgg ctccccagca gccgcctgag cccggccata gataccctgg 120 cgattattaa acaaaccttg acgtggacgg gttggctgcc agggacgcgc gcggcccgcg 180 tcgtggcaac gcccgcgccg ccccgccctg ggtgacagcc gcgcgcccca ggggtggact 240 gagacgcgca gccgcgcggg ctggagggca gcagggcgtc tacagcattc ctccccattc 300 ggggttctgg gtgcccacgc gtgtccagaa aagcagaagt taagtctcta tagaagtttg 360 gggctaggct ctcaggagat cacctctttg gcccctttat tctttcgcct ttcattcctt 420 tattcttca tttgtagcgc cttgggttta cctgtatgaa acttgtaact aaaatttcag tacttcttac ttctagcttt tactttgttc cttgacccac tgggtgggta cccaagttaa 540 taggtttag ctccaggatg ttcacaaatt aaagttaatc cctcaggttt ggataagatt t 601 <210> 40 <211> 601 <212> DNA <213> Artificial Sequence <400> 40 ctggctgcag gtttttgggt gagtgtggag tttctttttg attgttgcat gtggggaagg gcagagtcga cgggaacagt cactgcgggc accctagcc tggtgcgtct actgtcctct 120 gctcggctcc ccccatcggt gagtgcgccc gcccgcccga ctgtgcgggg ctgcggttgg 180 ggggagggggg gaggggatc atctgaggcc agagccactg ccgtgtgtgc ggggagggggg 240 agcggcggga gagagagggg agggacaggc taggtgtctg ctgctccacg ccactgctgc 300 cggcgccccg acctcatccc cagcagcccc ctctgcagct aagggttacc accgcaccac 360 ctctcttctt tgcctgcctc agcggccaag gctctgcggt agggacaac ccagccggggt 420 ggcgggtggg cctgtctagg tttgggtttg ggtcttgctg aggcccgcat gagagggggt 480 ggccgtgact cggtgtcccc tctttgcagg gggctctgct gcgccgcgca ggcccctcct 540 cctacatcct ctttgggggg tcactggaaa gcagagctta ggcccactct ctgtgcttag 600 t 601 <210> 41 <211> 601 <212> DNA <213> Artificial Sequence <400> 41 aaagagttac caggtgttaa ctcaccagcc ccgcaagctg agaggcgtgc agccccggcg 60 cgcacttttg cgcggaccgc gcacccctcc aagctcgcag ggcgccgggg gagacaggcg 120 ggagtggcgg ctgaccgtgc ctccatcgtc atcatcatct ccgtggcaag ctactgtggg 180 gaggtaatgc agagaccact accacacatt ggccctccct tcaccctccc gcggctaaaa 240 ataaaaataa agaagagaag aaatgaaagc acaaggagtt ctttaaaagc cccaggagac 300 gacagagcag tgagcagatc agaatccacg gagcccaccg ccaggcagag cgaaccgcct 360 gtttacatcc ggctgcctgg gagcggatac caggcaacca agagagatgg ggaatcttac 420 caaatcttaa tacatgtgtg gttccttgag aatatccaat ccacagtaaa cagagcagga 480 gtttaacggt gcgcctgaag actggattac ttagaatcgg gaaaataatc ttcatggtgt 540 ttctgtgccc acacgcacgg cacccacttc cccgatctag cgttcggctc ctgggttcgg 600 g 601 <210> 42 <211> 601 <212> DNA <213> Artificial Sequence <400> 42 ttatctattt atatatttat aattacatat tgcacttgga ccagcaaggc ttgcagagtc 60 attcacggta gaagttaata aagttaaata gatgggaatc tttgtaagta caattgatct 120 cctctggttt ggaaacgaat ctcctcgtcg ttgtaaagtg ttctcgcggg gtgggacaga 180 gagaggagca ttgcgagggg gaagcagaga cagagagcac tgagggcagg ggtcgccttc 240 ccggggcccg ctccccccgg gagcgcgcct ttcccagact cgcacctcca aggtcaggac 300 gcggtggttc cacataagcg gctcgcggtc accacttctt tcaggtcact ctcgggtttc 360 ccggccacca taaagggcca cgtctgcggg aaagaagagg gtggaggagg taagtggccg 420 tggcggaggg ggtggggtgg actcggggcc tgagatgaaa ggaagggggg cggtgggggc 480 aggcggtgct ctggagagac cggttatctc tgcaatttac tcccggtcct agcgcaccct 540 gcggctgcat aaagcaaata gctgctttgg cgccaagtca cagctcgagg tggtggtggt 600 g 601 <210> 43 <211> 601 <212> DNA <213> Artificial Sequence <400> 43 cgcggctgga ctgggaccga gcgcatccct gtgtctcagg gggtttgctt tgtgcaggat 60 gggaccttat tatttttaga cagtggggca aacgtgtctt ttaaagagat ccgaagggtg 120 aaactaatga aaaaggaaat gaattactag aaaagccgtg aagggataaa accgggagca 180 gcaggaagtt gaaggaagga cgaccgaagc taggtgtatc tgcacctgcc tcttgacacg 240 ccaaaaacaa aggggggtta aggcaagaat gtagactaaa tgctgtgagg attagggtaa 300 cgcgagccct caagacgtct cggagaccgc ctacagggct gcaaatacca gggtccattt 360 ttaaaaatcg agtgctccta gaggtggggt gggggtggga gagccgggaa accagcaaag 420 caatttcttt ccattgagta gacaaaaact tgggccacag gggcatcttg tattttgaac 480 agtgacccga tgaccccgct ggccaggtgt agacagcctc aagtcctaaa tatttgcatt 540 gtcctaactt cccagttgcc tcggatttta atgccctttc actctgcgtt acagtcaatt 600 a 601 <210> 44 <211> 601 <212> DNA <213> Artificial Sequence <400> 44 cagctgagcc ggggttagtg cagcggtggg ggtggggtgt gggggcgggc ggggaggagc 60 tcggcggctc cccgctgctg caggtaatcc gcagcccgct cctccgggcc gccaaacccg 120 aggcccagcg ccacttactg gctgcgctgg gaatcggggc cggagcgcac ccggcgagcg 180 cacagcctcc tacctgcgcc ccgctggggt ccctgggctc attcccctgc cccttccgag 240 cttaaaaccg ccggcacgac gccccttcct cctggactgg gctagggcac taacttccac 300 ggcacttcgg atcgcacgga agaatgatat ctttcacctg ggcgcacggg gtggctaatc 360 tccaagtaga gattacgcaa cacctggtat tttaaacgtg gattacctct attcatgatc 420 aaatgggaat tcttcaagat ctagttttag tgtaccatgc ttttcgcaga taatcgatgc 480 aaagtgcacg gttttggtgc acagaacttt aacattcaac aaatatacag tgagcgccta 540 tgccagacaa tgtggtacaa gacagaccca gaagtgtgta gtctgtattc gaagtgcaag 600 c 601 <210> 45 <211> 601 <212> DNA <213> Artificial Sequence <400> 45 agtcacctcc cctctcagtg tccttctctg taaaatggga attacaatag aatttatctc 60 cgagttgttt tagggaacaa aggaaatata atccatgcaa agtgcctggt ccacaggaag 120 cgctttcgca ttgtcagtgt tggaggtgat gtttgctttg cagggctgtt caatcccctg 180 cccacttcta aacacattta actttgggga ggggcctctt ggggaggaca aaagaaggag 240 gctggggctt ccgctgccct ctgcagacct ggtgtgcgat gacgctgcag cgggggaccg 300 cggttttaaa ggcatcatcg gtagaaacgg cctcacgcat ttccataatt cactctgcat 360 caattaatct ttcactgtcg ataggaacct gcggctgaat tccctccccg ggaggactcg 420 ccattctcaa gctctgaggg gtttcttct cggctggcat catgctaatt tccctcgagt 480 acccctggaa agaggtttta gaacaagacg tggtgcttgg caggaatttg acatctgaaa 540 caactgtcgc tcagggagga gggggttgtg acatttgcta attgccaatc gagcactaat 600 g 601 <210> 46 <211> 601 <212> DNA <213> Artificial Sequence <400> 46 acgctgcttc aaacccctgc cggtgcactt gagctacctt caaaacaccg acttcctaca 60 ctgtcttaag atgtaaattt caaacccgga cgcagaactc ctaaaaaaaa gtaaagagta 120 acaaaaatta agcagataga aaactacttc ttgaacatac aagaattgtc tacaagaaag 180 gcggtaataa taactcctaa taataataac tcctttcact gtttccagtt gatttgagta 240 ggagacggca gttttgaagt aaaactggaa acctgatccc caccccttca cttctcgagc 300 cgggcctcgt cccttaattc tagaaatagc gatcgcgaaa gctaagtgcc gagaagtgcg 360 agagagtgcg agggcgtttt tggatagcag aaatgttagc tcaaaatcga caacttacag 420 ttattcctaa aaatgtttaa atggcattca tgtaaaagac acggattcac ttactccgat 480 gacagttttc ctcccctagg cgaagcacgc agtgcgccgg aacggattat ttttagggtg 540 gtgggagacc agctgctgcc tcctatcgag tttctaaatt gcacagactg ctctgggccg 600 g 601 <210> 47 <211> 601 <212> DNA <213> Artificial Sequence <400> 47 caagggacgg ctagatgatc catctgccaa catcaatatt tggagggaaa gcttaaaata 60 tgctgttttt ccaagggtta aactttaaag gggtgaaaac acaactgatg aaatgttagc 120 atcaaatcgg ttaaccacta actcctttcc atattcgtcg tcgaggctct tttaagtttc 180 catgagaagc gaaacttcat tctctttgct cagaatagag actcctccac ctatgcgcgt 240 ttaaccacag agttgttctt gattgtaagg gacttcgccc acttggttga agtggagagc 300 cggtcctcat tccagacgtc ccgcacggca gtcgctcatg gctccctcca ggccgggagc 360 caggaaggtg gtccttcacc gaggtgcgca ccaagcggcg gtccacccag gcaatggggt 420 gcaccaattt gcctccaaaa atttgctgcg cacacaacct gttcacagtt cctgatcaga 480 aagggctaac gagatgtctg tctacagctg tctctgggcg agggcgcagg ctttgggaag 540 tggttcagcg cgatcgggga caccgcttgc agcccttggt cctgcacccc taggaggggt 600 g 601 <210> 48 <211> 601 <212> DNA <213> Artificial Sequence <400> 48 cctggctcct cttaaagcat cctctccttc gaacggccgg gagtggcagc tttattggga 60 aacgcgcgct ctgggggccc aggtggctgg ggggaccgga gaggcgcgcg ctttgcccac 120 ttctcttggt ggcatcttgt gcgacccagc ccgtcctctc ccgacttcga tcattaccgc 180 tcccacccca acacgcatac ttcccccacc ccacccccaa gagccagcgc ggctttaaca 240 ttaaacaaac gcagcgagcg cctccgagct gcgctctcgg ccgggtctgc gcggcggcgg 300 cggcgttaca aattgtaaat ttaaattgct cgccggattc attacctccc ctctttgatt 360 tcagccagcc gtgaaaaatt atactggtgt accactgaga aactgttttg ccgcaaagag 420 cctacgccta atcactggct ttctccctcc gacaaaagtg taattatttt gtttggggtg 480 taaatatagg ccgcgcctcg cacacacact cagcgtcccg cagcgccgca gagcaccgcc 540 cgccgccgga aggaatcggg cccccgagta ggagcgggcg tgaaggctga gccccgctgt 600 c 601 <210> 49 <211> 601 <212> DNA <213> Artificial Sequence <400> 49 gaggagaggg gcctgggaag caggatctcc tgcctggcgc agattggggt gccaggatgg 60 cttctcagag ggatcagcgc tgcaactcgg tcgccgcggg gccctggtga caggcgcacg 120 ccccgccctt tctcctccca agacctgcgg gcttttgtta tgcagatggc ggcaggaggc 180 tgagcctgag gaggaggggg ttggtgggga ggaggagaga cggagagggg ggaggaaagt 240 gcagctcgcg cgaccagcct cctcttccaa cgtcacattg tgcgagagac aaaacccggg 300 cgcgccggag ctcacacgcg cacgcacaca catccgaccc cgtcgcctct tctctcctgg 360 tgctgcccag aaagccagcc ctcccttccc ttcttggggc gcagaggctc agccagctca 420 gagcgcagcc tggagccgac ccagaagggc gaagaaagcc cagcggacga gcctcctttc 480 tctgctgcct gcccgggctg gggcgtccca tcccccgccc tgaactccga tctctcccac 540 cccacccctc tctgggtttc acccggacag agccgggagc tgggtgtcgc ccccgtttgg 600 a 601 <210> 50 <211> 601 <212> DNA <213> Artificial Sequence <400> 50 ggagaggggc ctgggaagca ggatctcctg cctggcgcag attggggtgc caggatggct 60 tctcagaggg atcagcgctg caactcggtc gccgcggggc cctggtgaca ggcgcacgcc 120 ccgccctttc tcctcccaag acctgcgggc ttttgttatg cagatggcgg caggaggctg 180 agcctgagga ggagggggtt ggtggggagg aggagagacg gagagggggg aggaaagtgc 240 agctcgcgcg accagcctcc tcttccaacg tcacattgtg cgagagacaa aacccgggcg 300 cgccggagct cacacgcgca cgcacacaca tccgaccccg tcgcctcttc tctcctggtg 360 ctgcccagaa agccagccct cccttccctt cttggggcgc agaggctcag ccagctcaga 420 gcgcagcctg gagccgaccc agaagggcga agaaagccca gcggacgagc ctcctttctc 480 tgctgcctgc ccgggctggg gcgtcccatc ccccgccctg aactccgatc tctcccaccc 540 cacccctctc tgggtttcac ccggacagag ccgggagctg ggtgtcgccc ccgtttggaa 600 t 601 <210> 51 <211> 601 <212> DNA <213> Artificial Sequence <400> 51 atacacagaa ttattgtttc agtgatgacg ggggtgggaa agggaaggat gtggggggat 60 gggtcccagg ctcttaaaat cgtgtgccac caacgtcaca accgccatca tgatgtgtac 120 gcatgtttac aagaaatgtt cagcatccat ccgcccgagc tctgcatccg actggagact 180 ttacacctgc ttcctacgaa gagggagctc ttgccagcga gcccatgctt acccataatc 240 tacgaagaga tcttttcatc tcctctccgt gaacacttgg ggaggggctg ggactccagg 300 cgacacggaa acgccaccac acgcacactc gacggagcac aacactttct gagctgccat 360ggtggagggg gagagagcag gaatcaattc ttggtggaga aaataatcta tgactagatg 480 acgcttaaag gcacgacaag agattttatg aagttcccct aacggaggga ataatgaagt 540 gcctggcaga gaaggaaatg gagataagag ggaggctggt gtcaggagga tgtccacagg 600 g 601 <210> 52 <211> 601 <212> DNA <213> Artificial Sequence <400> 52 agagagcaca ttttgaataa gcaaagtgga gatctcactg acaaaacaca aaggctaccc 60 cagcatcctc aggcaggggg cgcatacctg ggccccctat gcccaaggtc tcctcctgga 120 atcccctgct gtcctcgggc acccagagcg ggaacgccag gttttcccca tcacgcaagt 180 gcaggcggcg cgggggttcc ggaggctgtg agtgtcaatc acctaccctt atcagttctc 240 cgtccaacac ttacagtcac aaagctgggc tggaaaagtg ataaggggac gtgactggcc 300 ggcaaagaag ttttgatgaa gctttgcagg acaagatgta aatggacgtt tgatttcccg 360 gcgagccctc cccgccccct ctctgcagtt cctcctctgc ctcaaattca aagcccctct 420 gtgcccttct actttgctct ggcctctcgc cccagtctct ccctctgaca cctggagagt 480 cacttatgtt tctgcacaca gaaattcaga catgcagctc tggacagcta tggaaagtaa 540 taggttcttt gcattaaaaa aaatcaatta aaaatagaaa ttaatttaaa ttttaaaatt 600 a 601 <210> 53 <211> 601 <212> DNA <213> Artificial Sequence <400> 53 acccagtcgc agagagcaca ttttgaataa gcaaagtgga gatctcactg acaaaacaca 60 aaggctaccc cagcatcctc aggcaggggg cgcatacctg ggccccctat gcccaaggtc 120 tcctcctgga atcccctgct gtcctcgggc acccagagcg ggaacgccag gttttcccca 180 tcacgcaagt gcaggcggcg cgggggttcc ggaggctgtg agtgtcaatc acctaccctt 240 atcagttctc cgtccaacac ttacagtcac aaagctgggc tggaaaagtg ataaggggac 300 gtgactggcc ggcaaagaag ttttgatgaa gctttgcagg acaagatgta aatggacgtt 360 tgatttcccg gcgagccctc cccgccccct ctctgcagtt cctcctctgc ctcaaattca 420 aagcccctct gtgcccttct actttgctct ggcctctcgc cccagtctct ccctctgaca 480 cctggagagt cacttatgtt tctgcacaca gaaattcaga catgcagctc tggacagcta 540 tggaaagtaa taggttcttt gcattaaaaa aaatcaatta aaaatagaaa ttaatttaaa 600 t 601 <210> 54 <211> 601 <212> DNA <213> Artificial Sequence <400> 54 cgttttttaa gcccaacttc aataaatctt gacgaggcct ggaattcaga gagtatccca 60 ggcggctgag ggagagggtt gtccaggccg gggctgggga tggagctgga cgtggcgggg 120 cgatatccca tccgcccgag aagggagcct gggcccggat ccactatctc tgcagaggcc 180 ctcagaagac cctctctagg aggccaggtc tgtcccacgg ccgcccttgc ccactctcaa 240 acctattaga gaaagagggt cctccgctgc agtcgctctc ctgccagggg cacagtccac 300 gcgggctcac acatttctag ggtctgcgac cacccgcctg gaaccggccc tcagcccctg 360 ctagaccctc ccacccccca atcaaccctc cgcccggaaa gcctcctttc ccacaacttg 420 ggcgtgcaaa agcagcaagt tctgcccaag tccagcgggg ttcgcattcc gccctcccca 480 ccgcgcccca gctccgctcg ggcccgcgca aaccccggcg cagcccctgc attaatgagc 540 gcgagaactg accgaggtct gtaaagaccg tcctcttccc atccccctat accattcaaa c 601 <210> 55 <211> 601 <212> DNA <213> Artificial Sequence <400> 55 actgcgtgtg ctggaaacgc tggtttaggt gctgcagctg caggctggag tagatggtcc tcggcttgcg gagctttttg gcggggggcct gaggcgccg ctcggagggt tccggggaca 120 gccgcggctt ctccgagtct ggtgggcagc acaacacggt gtagggggcg aggagggagc 180 gagggggtag gacggacagt ttcataagct tatttgcatc tcgtctgcat gccgtcggca 240 gcaaatagca aaaagcgcag ccaccaggat cgcccccttg gcccctgccc tctaccttcc 300 gcgtggagcg tttcaacccc cacgttcacc gcgccaggtg atacaagacg cagttctgct 360 cccagggagc tcccactcgt atgggtcctg tgaccctagg aagaaagcgc cgagggccac 420 agccagggta ccgcggcgcc tgcggtggga ggtcggagtt cagccacggg cggtggcgcc 480 agcttggggt agggcggggc agaaaggcta ggtccagggc tgagccgagg cctagagatg 540 acagaggaag gacattgcag gcagaggctc agagcaatgc tcagaggctt gagacggtgt 600 c 601 <210> 56 <211> 601 <212> DNA <213> Artificial Sequence <400> 56 ccgccgcctg ctgaagacgg tgctgatgat cctgctggcc ttcctggtgt gctggggccc 60[[ID=第十九]] actcttcggg ctgctgctgg ccgacgtctt tggctccaac ctctgggccc aggagtacct 120 gcggggcatg gactggatcc tggccctggc cgtcctcaac tcggcggtca accccatcat 180 ctactccttc cgcagcaggg aggtgtgcag agccgtgctc agcttcctct gctgcgggtg 240 tctccggctg ggcatgcgag ggcccgggga ctgcctggcc cgggccgtcg aggctcactc 300 cggagcttcc accaccgaca gctctctgag gccaagggac agctttcgcg gctcccgctc 360 gctcagcttt cggatgcggg agcccctgtc cagcatctcc agcgtgcgga gcatctgaag 420 It should be noted that there may be some inaccuracies in the translation as the original text seems to be a DNA sequence with some unclear or potentially incorrect formatting in the numbers and tags. This translation is based on the best understanding of the provided content.ttgcagtctt gcgtgtggat ggtgcagcca ccgggtgcgt gccaggcagg ccctcctggg 480 gtacaggaag ctgtgtgcac gcagcctcgc ctgtatgggg agcagggaac gggacaggcc 540 cccatggtct tcccggtggc ctctcggggc ttctgacgcc aaatgggctt cccatggtca 600 c 601 <210> 57 <211> 601 <212> DNA <213> Artificial Sequence <400> 57 cctggcaggc ggtgtcggcg ccggcggggg actcggcgcc cagggcccct tccaggccct 60 ccctcgccgg gctccccacc agctccggag gtggcggcga tgcggaccga gtgagcggcg 120 gtggggccag gccgggcgcc gggcgggagc cgaggccgcg gcggactccg caatcccgca 180 gccggtgact ggagcccacc tctgcagaga caaaggttag aaaaagaggg ggtgaggctc 240 tgggaaagca gaatgcgggg ggaaattcgc cggggaaatc aggaaaaagg ccgtgaaggc 300 gagcggcgcc tgcacatgac cagccgcagc caatgacgac cgcaaatagg tcataaaaag 360 gtctattacc aagttgtaaa ttttcttcaa acaaaaagga atttactgca attccttgcg 420 gattttgcac atacagctcg caagcgccat gttttttcct cttctgcttt ctctctcccc 480 cgcctcctct cttccttctc ctcctcctct ctctctccat tctctctctc cttcctccct 540 tctctttctc tgtccctctt cacctttccc tttttcttcc cttcgtggtt cttccctccc 600<000127l>t 601 <210> 58 <211> 601 <212> DNA <213> Artificial Sequence <400> 58 cgggggcgat gagcatctct gctggggcgc cctaacctgg aaaaccattg aaaacggctc 60 aggcttgcaa gacttcctgc ctccccggga ttcccagaat cttcaagtgg acggaaaggc 120 gattcctaaa caagttatag aaacttctag atgctatttg agatacatag aattctaatt 180 tatttaatta ttctaaaaat tccaatcaca atggcgcggc gttagccacc acaactttgc 240 agggcaaaaa aaaaaaaata cttcctgaac taacatatgt ttcacaagtg tgggcgcagc 300 cgggacaatt tcgagacaac ttcgagacaa tttcgaatgg acaaattgcg gagaagttgc 360 ttctgccgct cagaagccgg ttcacctcct tctccaccgc ggcatttcca aaacaacagg 420 It should be noted that there may be an error in the tag "58 " in your original text. It might be more appropriate to check and correct it to ensure the accuracy of the translation in the context of patent text. Also, the tag "<000127l>" in the original might be a misspelling, and it should be " ". The above translation is based on the best understanding of the provided content.gacaagtctc cccggctcgc cgcaggcctg accgcccagc tccgccagga tttgcagaga 480 gcagcgcgct ccatttgcag aaaggaaatc gagtaggtcc tcgcccccga ctggtgcttc 540 ttggggtgtg gggtgcccag ggaatgggct tcctggaagc accaaaggag cctgcggagc 600 c 601 <210> 59 <211> 601 <212> DNA <213> Artificial Sequence <400> 59 tggcgggcgc ggcggcggcg gcggcggctc ccgcgggcag tgcctgggcg ggcggcgggt 60 gggagccagt gtgcgagcgg gactgcgagc gcggggggcg ggccgggggc ggtgcccagacgcggcgtgg gtgcgggggg aagaggaagg tggtgacagg accactttgg agatgggtgc 480 tgccttacct ggggggacgc aggccagcgc cggaggatgc tcttagcatg cccgccccct 540 cctcgtctca ctgatctgag tcagcttgac agccccccct ggagattgcc gcgcttaaac 600 t 601 <210> 60 <211> 601 <212> DNA <213> Artificial Sequence <400> 60 gtgccagtgg tccccttgag ggtacttgct acccggtcgc tggaggtaca gttctcatct 60 gtctgccccc tggactcacg cacttacccc actccacctg ttgccaggat cgcctcattt 120 ctgcacatca tttcggggtg gctgagaggg gaccacaaac ccctccaagc ctctcttttg 180 tggttccagc gaggcggtca tccttcactt ctccttttcc agctttcagg aagcagttag 240 ggaatgtatg atgaagcaga aatgagccgt caggatgata ttttaatggc ttatatgtca 300 cgttggtgca tgtggctttg aactggagcc gttcgcgttt cctgcagaga gcgccgcaaa 360 tcccacttga taacttctac aacccacaac tttttttttt ctcacattca ctcttaccct 420 gtatatttgg atgtgtttcc taaaaatacc ctcttgtcaa cgtccccgtt ggattttcca 480 cggactggag aggagagac tgacttttct tttttgaga attattttcc ctctccccct 540 cccaacagct acccttcccc ccttaggtcc cctcccttgt tgtgtgtgtg tgtgtgcgcc 600 c 601 <210> 61 <211> 601 <212> DNA <213> Artificial Sequence <400> 61 ttggaggttt gctgcccagg gagaagga agcagctctc aggccctttc ggcaacttct cggcttccct tgcatctctg aacgttagtg atccggacct cagatccggt ttccgagggc 120 gccagggtcc tagggctgag gtccattcaa atgcttaggc gactctgccg caggcctccg 180 gaagaggccc ggtcgttaag aaagggggcg gggtaaggag gaacggctag cacctagc 240 tggggcctgg cctctgcccc cccgccctg cctttggcaa ccagcgaatc aggactgaaa cgtagggaca cagagggaca gagactaagt ccaggatagc gacgatcagt caggcagaca tggagacaga gagatagtga catggcctta ggatcggcag ccacgaaaag cgctcttaca aacatctgat attccagtga ccttccttca ctaactccct aaataatact gcgcctcaca 480 ggcgctaatc cgcagcatat tttatttttc ttttggcact gccatttctt gtctcccact 540 agactgtaaa ctccaccaag cgggcaatct ttcttctctg catccctggc acagagtagg 600 c 601 <210> 62 <211> 601 <212> DNA <213> Artificial Sequence <400> 62 gcaaaacaaa ggagaagtgt ggggcgcctc cgaggtggca aagccagcgg agatgagggt 60 ggcgcaggca tgagctctcc atgcctaggg cgccagggag gcacctaggg gactcatttt 120 atttttagta ttttttaaaa tcgaacaaga acacgccgca gttaaaaaaa atggagataa 180 acagcgatat taaaaggaaa aaatggggga aggaaggtag gtttatttaa aaaagaaagg 240 gaaaaaaatt agcttggtgg ttcccggcaa aggcgagccg gggctggggg tccccagcac 300 gaggccaccg cctcccaccc ggcccccgcc gcactggctc cgccgtccct tcgtttcctt 360 gggtcattcc cagcccgcag gcacaggttc ggccaaatca gaatagctcc cgtcctttca 420 ttttgtttag atttcacctt aagtcgacgc cacggtgtgt atctaaatac ctgtattttt 480 aaaggacgcg cggaagccgc aggtttcacc gctgactcgg aaacatcacg cggtcccgcg 540 cgggagtagc accgtcttcc ccgcagcgcc cgcccctcgc atcctccggg aagcattccg 600 a 601 <210> 63 <211> 601 <212> DNA <213> Artificial Sequence <400> 63 agcaggctgg gcatgtgaag cccaaagaac tccgtttgga aactgcactg ctgtctctgc 60 agtgtggcca cagtgactgc ccgcccacca agcatctaga gcccagaggc aggggtgttg 120 ctgcatggat gtgtccacct ggatacgcac gttttcattt catttaaatg gcaaacaaag 180 gtcttgggca gatttcgaaa agcactggtg agctgcggag acatttccga gcaggagctg 240 atgtggaggg ttttcagcgc cgggtgaggg tcccgcagcc acagcgatgt tctagcctcc 300 gccgcggaac tcacagaggt tcccccgcca tagcctcccg cgtgcgctcc tgcgcttcca 360 ccagacctta tttataagtc tgttgatttc gcaggccgca ccttgcaagg ggcacacggt 420 ccgtcttatt atttcataat cacttcttct ctttttgttt tccacccggc ctggctctgt 480 gtctaggact cagcgtgcat tccctgggct cggcctgccc cgcctgccta agaatcccac 540 aaatcattga cagcgtgggg gaggggagat tgcctgtagc agggaaatgg cgccctagaa 600 a 601 <210> 64 <211> 601 <212> DNA <213> Artificial Sequence <400> 64 agcacccttg ccccagagtg agcatcaaca ccgtgatcac ggttattacc tgggaggtct 60 cctgcccagg atccaggcgg tgaggctgcc ctggaggcag gctcgctccg ccacaggcgc 120 gcgggcagca gcggccaagc cgaggatggc agggcctgcg ggtgaccagg cctccggcca 180 agggcacgcg acccccagcg cttcccaggt gctcccctga agcccgggac gcgtgggcac 240 cggcgcgggg cggtgccggg gaaacgcagc catcgcctca gggcacgcca gccaatgggc 300 ggcctcaccg atgcggtaat gccccaacgc ggcgtttcat tggccagctc tctttcaggc 360 tccaactatt tattagattt tttttttttt ttaagaaatt gcaaataggc ctaaacaaaa 420 tccagaggag agggaaggga tgcctgagca cagatgggtg ggagaacacg ccccgaggtg 480 cagcgttggc acgagaagcc ctgtctgcga gccccgagga ggagatgcct ccccaagccc 540 tgtgcagaca gaagagtccg cccctccctc tcccgcacct gctgaacttt ggggtcagca 600 g 601 <210> 65 <211> 601 <212> DNA <213> Artificial Sequence <400> 65 gctgcctgcg cggaaggagc cgcctccctc ctttcagcga acgcattcgg ggttcccccc 60 tcccgccaag tcctttgtct ggaaggggac tggcaggctc tgtcgtcgcc gtgtgccccc 120 ctcctttccc cagcctctac cccctccaac taactttcct ttcttccctt ctcttttctt 180 ccctctctgg atgggtaatc acaggctccg ctgccaagcg cgctgcgagg agccgctgcc 240 cgttcccgtc ggtgcccctc cccgcggcag cctggccgag tccgcccagc ctgcctagga 300 cgtccctgac ccgcgcgctc agtttcattc agtggccgtg ggatgttgca tctgagtttt 360 tcctttaggc caaaactttg tcccgaggtt tttctgagag ggttttattc tccaacagca 420 acaacaacat gcgaattctt aaaactagta tttatttcga ttcaggcagt cagggaaatg 480 gcagaatcac cagccgtttg cagaattcta cgctcgccaa ggcaagtact attagtatat 540 tttctcccaa cgttttcgtt gtaaaataca catgacaaaa tttgccctct taaccatttt 600 a 601 <210> 66 <211> 601 <212> DNA <213> Artificial Sequence <400> 66 tagccctgtt taaaaaaatg gctgattaag ttgagtgcgc atgtctttgt gtgtctattc 60 ccgatatgca ctctgggaat gagagaggag agcgagggag agggagaggg agagggggga 120 gagagaggtg taattagtga ggtgatcaac attccccaga ctgcaaatga cgcgcagccc 180 ggactcagag cagctccgga gcctcacggc ttccaaagct cccagcgctg cggctggagc 240 cccggatgcg gcgaccgcgg agaggacagg ggatggggac ctccgggtct cgcaccctac 300 gcgcccctgc gcgcgactcc caaacttcat tagacacaca cgcgctctta cacacaaaca 360 cagacacaca cagagcaaga aggggaaaga aataaaacat agataccgcc aaagcatggc 420 cctttaacca ttcgagattt tttttttatt ttaatgaggc aaagtaatta ttatcggacc 480 agagatttgt ttactaggga gctttaagca gaaatatgag ttagggtaat gaagagcttt 540 tctctgccta gtttattctg ctgtgcacat gaatgcactt taatggcgaa atgcgggggc 600 c 601
Claims
1. A methylation biomarker or a combination thereof for breast cancer detection, characterized in that: Including biomarker cg23035715, cg26371731, cg04541368, and cg13973436; The sequence of the biomarker cg23035715 is shown in SEQ ID NO.1, the sequence of cg26371731 is shown in SEQ ID NO.2, the sequence of cg04541368 is shown in SEQ ID NO.3, and the sequence of cg13973436 is shown in SEQ ID NO.
4.
2. The methylation biomarker or combination thereof for breast cancer diagnosis according to claim 1, characterized in that: Also included is at least one of the following biomarkers: cg16304215, cg20072171, cg08402365, cg21501525, cg22778178, cg08599259, cg25566568, cg15634980, cg07458308, cg01348584, cg22778178 g14140881, cg25756435, cg00594560, cg08279008, cg09760908, cg18087672, cg14868703, cg17632299, cg18786873, cg20631750, cg25924096, cg15321298; The sequence of cg16304215 is shown in SEQ ID NO.5, the sequence of cg20072171 is shown in SEQ ID NO.6, the sequence of cg08402365 is shown in SEQ ID NO.7, the sequence of cg21501525 is shown in SEQ ID NO.8, the sequence of cg22778178 is shown in SEQ ID NO.9, the sequence of cg08599259 is shown in SEQ ID NO.10, the sequence of cg25566568 is shown in SEQ ID NO.11, the sequence of cg15634980 is shown in SEQ ID NO.12, the sequence of cg07458308 is shown in SEQ ID NO.13, the sequence of cg01348584 is shown in SEQ ID NO.14, the sequence of cg14140881 is shown in SEQ ID NO.15, the sequence of cg25756435 is shown in SEQ ID NO. The sequence of cg00594560 is shown in SEQ ID NO.16, the sequence of cg00594560 is shown in SEQ ID NO.17, the sequence of cg08279008 is shown in SEQ ID NO.18, the sequence of cg09760908 is shown in SEQ ID NO.19, the sequence of cg18087672 is shown in SEQ ID NO.20, the sequence of cg14868703 is shown in SEQ ID NO.21, the sequence of cg17632299 is shown in SEQ ID NO.22, the sequence of cg18786873 is shown in SEQ ID NO.23, the sequence of cg20631750 is shown in SEQ ID NO.24, the sequence of cg25924096 is shown in SEQ ID NO.25, The sequence of cg15321298 is shown as SEQ ID NO.
26.
3. The methylation biomarker for breast cancer diagnosis according to claim 1 or a combination thereof, characterized in that: Also includes at least one of the following biomarkers: cg22889755, cg23524195, cg20861607, cg22435300, cg25504443, cg14351528, cg25824543, cg23413809, cg24797187, cg26877715, cg01167274, cg12361223, cg04430835, cg27111970, cg22851944, cg23228540; The sequence of cg22889755 is shown in SEQ ID NO. 27, the sequence of cg23524195 is shown in SEQ ID NO. 28, the sequence of cg20861607 is shown in SEQ ID NO. 29, the sequence of cg22435300 is shown in SEQ ID NO. 30, the sequence of cg25504443 is shown in SEQ ID NO. 31, the sequence of cg14351528 is shown in SEQ ID NO. 32, the sequence of cg25824543 is shown in SEQ ID NO. 33, the sequence of cg23413809 is shown in SEQ ID NO. 34, the sequence of cg24797187 is shown in SEQ ID NO. 35, the sequence of cg26877715 is shown in SEQ ID NO. 36, the sequence of cg01167274 is shown in SEQ ID NO. 37, the sequence of cg12361223 is shown in SEQ ID NO. The sequence of cg04430835 is shown in SEQ ID NO.38, the sequence of cg04430835 is shown in SEQ ID NO.39, the sequence of cg27111970 is shown in SEQ ID NO.40, the sequence of cg22851944 is shown in SEQ ID NO.41, and the sequence of cg23228540 is shown in SEQ ID NO.
42.
4. The methylation biomarker for breast cancer diagnosis according to claim 1 or a combination thereof, characterized in that: Also included is at least one of the following biomarkers: cg26225694, cg07790615, cg14825633, cg11901043, cg24504927, cg21962423, cg14135814, cg01070209, cg14841828, cg04947764, cg01397141 ... g00436496, cg01832036, cg27125093, cg21319323, cg06916239, cg11667451, cg03355998, cg19019849, cg22009488, cg15012484, cg20817483, cg21254450, and cg23134869; The sequence of cg26225694 is shown in SEQ ID NO.43, the sequence of cg07790615 is shown in SEQ ID NO.44, the sequence of cg14825633 is shown in SEQ ID NO.45, the sequence of cg11901043 is shown in SEQ ID NO.46, the sequence of cg24504927 is shown in SEQ ID NO.47, the sequence of cg21962423 is shown in SEQ ID NO.48, the sequence of cg14135814 is shown in SEQ ID NO.49, the sequence of cg01070209 is shown in SEQ ID NO.50, the sequence of cg14841828 is shown in SEQ ID NO.51, the sequence of cg04947764 is shown in SEQ ID NO.52, The sequence of cg01397141 is shown in SEQ ID NO.53, the sequence of cg00436496 is shown in SEQ ID NO.54, The sequence of cg01832036 is shown in SEQ ID NO.55, the sequence of cg27125093 is shown in SEQ ID NO.56, the sequence of cg21319323 is shown in SEQ ID NO.57, the sequence of cg06916239 is shown in SEQ ID NO.58, the sequence of cg11667451 is shown in SEQ ID NO.59, the sequence of cg03355998 is shown in SEQ ID NO.60, the sequence of cg19019849 is shown in SEQ ID NO.61, the sequence of cg22009488 is shown in SEQ ID NO.62, the sequence of cg15012484 is shown in SEQ ID NO.63, the sequence of cg20817483 is shown in SEQ ID NO.64, and the sequence of cg21254450 is shown in SEQ ID NO. The sequence of cg23134869 is shown in SEQ ID NO.65 and / or the sequence of cg23134869 is shown in SEQ ID NO.
66.
5. The methylation biomarker or combination thereof for breast cancer diagnosis according to claim 4, characterized in that: Including markers cg23035715, cg26371731, cg04541368, cg13973436, cg16304215, cg20072171, cg08402365, cg21501525, cg22778178, cg08599259, cg25566568, cg15634980, cg07458308, cg01348584, cg14140881, cg25756435, cg00594560, cg08279008, cg097609 08, cg18087672, cg14868703, cg17632299, cg18786873, cg20631750, cg25924096, cg24615528, cg2288 9755, cg23524195, cg20861607, cg22435300, cg25504443, cg14351528, cg25824543, cg23413809, cg247 97187, cg26877715, cg01167274, cg12361223, cg04430835, cg27111970, cg22851944, cg23228540, cg2 6225694, cg07790615, cg14825633, cg11901043, cg24504927, cg21962423, cg14135814, cg01070209, cg 14841828, cg04947764, cg01397141, cg00436496, cg01832036, cg27125093, cg21319323, cg06916239, cg11667451, cg03355998, cg19019849, cg22009488, cg15012484, cg20817483, cg21254450, and cg23134869.
6. Use of a reagent for detecting the methylation status of the methylation biomarker according to any one of claims 1 to 5 or a combination thereof in the preparation of a breast cancer diagnostic kit.
7. A kit for diagnosing breast cancer, characterized in that: The invention comprises a reagent for detecting the methylation status of the methylation biomarker according to any one of claims 1 to 5 or a combination thereof in a test sample.
8. The kit for breast cancer diagnosis according to claim 7, wherein: The breast cancer is breast cancer of different stages.
9. The kit for breast cancer diagnosis according to claim 7, wherein: The reagents are selected based on whether they are pyrophosphate sequencing, bisulfite conversion sequencing, methylation chip method, qPCR method, digital PCR method, second-generation sequencing method, third-generation sequencing method, whole-genome methylation sequencing method, DNA enrichment detection method, simplified bisulfite sequencing technology, HPLC method, MassArray, methylation-specific PCR, or a combination thereof.
10. The kit for diagnosing breast cancer according to any one of claims 7 to 9, characterized in that: The sample to be tested is blood fluid, serum or plasma.
Citation Information
Patent Citations
Reagent kit for identifying breast cancer states or breast precancerous lesion and application of reagent kit
CN109082467A
Application of specific methylation site as diagnostic marker for breast cancer recurrence
CN108531593A
Application of specific methylation sites as breast cancer molecular subtype diagnosing markers
CN108676879A