DNA cleavage agent

Abstract

The present invention describes new bacterial nucleases of the CRISPR-Cas9 system from Clostridium cellulolyticum bacteria, and the use of said nucleases for generating strictly specific double-strand breaks in DNA molecules. The nucleases of the present invention exhibit unusual qualities and can be used as tools for introducing changes into strictly defined sites in the genomic DNA sequences of unicellular and multicellular organisms. Thus, the present invention increases the versatility of the available CRISPR-Cas9 systems, which enables the use of Cas9 nucleases from various organisms in order to cleave genomic DNA and plasmid DNA at a large number of specific sites and over a wide temperature range. The present invention also simplifies the editing of the genome of biotechnology-related Clostridium cellulolyticum bacteria.

Description

Technical Field

[0001] The present invention relates to the fields of molecular biology and microbiology, and in particular, it discloses novel bacterial nucleases of the CRISPR-Cas system. The present invention can be used as a tool for highly specific modification of DNA in various organisms. Background Art

[0002] Modification of DNA sequences is one of the hot issues in the field of biotechnology today. Editing and modifying the genomes of eukaryotes and prokaryotes, as well as manipulating DNA in vitro, requires targeted introduction of double-strand breaks into the DNA sequence. To solve this problem, the following techniques are currently used: artificial nuclease systems containing zinc finger domains, TALEN systems, and the bacterial CRISPR-Cas system. The first two techniques require laborious optimization of the nuclease amino acid sequence for recognition of specific DNA sequences. In contrast, when it comes to the CRISPR-Cas system, the structure that recognizes the DNA target is not a protein, but a short guide RNA. Cleavage of a specific DNA target does not require de novo synthesis of the nuclease or its gene, but is accomplished by using a guide RNA complementary to the target sequence. It makes the CRISPR Cas system a convenient and effective means for cleaving various DNA sequences. This technique allows simultaneous cleavage of DNA at several regions using guide RNAs of different sequences. This method is also used for simultaneous modification of several genes in eukaryotes.

[0003] By its nature, the CRISPR-Cas system is a prokaryotic immune system that can introduce breaks highly specifically into viral genetic material (Mojica F. J. M. et al. Intervening sequences of regularly spaced prokaryotic repeats derive from foreign genetic elements / / Journal of molecular evolution. – 2005. – Vol. 60 – No. 2 – pp. 174-182). The abbreviation CRISPR-Cas stands for "clustered regularly interspaced short palindromic repeats and CRISPR-associated genes" (Jansen R. et al. Identification of genes that are associated with DNA repeats in prokaryotes / / Molecular microbiology. - 2002. - Vol. 43 - No. 6 - pp. 1565-1575). All CRISPR-Cas systems consist of a CRISPR cassette and genes encoding various Cas proteins (Jansen R. et al., Molecular microbiology. - 2002. – Vol. 43 - No. 6 - pp. 1565-1575). The CRISPR cassette consists of spacers with unique nucleotide sequences each and repeated palindromic repeats (Jansen R. et al., Molecular microbiology. - 2002. - Vol. 43 - No. 6 - pp. 1565-1575). Transcription of the CRISPR cassette is then followed by its processing, resulting in the formation of guide crRNAs that, together with Cas proteins, form effector complexes (Brouns S. J. J. et al. Small CRISPR RNAs guide antiviral defense in prokaryotes / / Science. - 2008. - Vol. 321 - No. 5891 - pp. 960-964). Due to the complementary pairing between the crRNA and the target DNA site (which is called the protospacer), the Cas nuclease recognizes the DNA target and introduces a break highly specifically therein.

[0004] Depending on the Cas proteins included in the system, CRISPR-Cas systems with a single effector protein are grouped into six different types (types I-VI). The type II CRISPR-Cas9 system is characterized by its simple composition and mechanism of action, i.e., its function requires the formation of an effector complex consisting of only one Cas9 protein and two short RNAs as follows: crRNA and tracer RNA (tracrRNA). The tracer RNA complementary base pairs with the crRNA region derived from the CRISPR repeat to form the secondary structure necessary for the binding of the guide RNA to the Cas effector. The Cas9 effector protein is an RNA-dependent DNA endonuclease with two nuclease domains (HNH and RuvC), which introduce breaks into the complementary strands of the target DNA, thus forming double-stranded DNA breaks (Deltcheva E. et al. CRISPR RNA maturation by trans-encoded small RNA and host factor RNaseIII / / Nature. - 2011. – Vol. 471 – No. 7340 – p. 602).

[0005] To date, several CRISPR-Cas nucleases capable of targeting and specifically introducing double-strand breaks into DNA are known. One of the main features limiting the use of CRISPR-Cas systems is the PAM sequence, which flanks the DNA target from the 3' end and whose presence is necessary for the correct recognition of the DNA by the Cas9 nuclease. Various CRISPR-Cas proteins have different PAM sequences, which limit the potential for using the nuclease at any DNA region. The use of CRISPR-Cas proteins with new and diverse PAM sequences is necessary to enable the modification of any DNA region both in vitro and in the genomes of living organisms. The modification of eukaryotic genomes also requires the use of small-sized nucleases to provide delivery of the AAV-mediated CRISPR-Cas system into cells.

[0006] Although many techniques for cutting DNA and modifying genomic DNA sequences are known, there is still a need for new and effective means for modifying DNA in various organisms and at strictly specific sites in DNA sequences. The present invention provides many properties necessary for solving this problem.

[0007] The basis of the present invention is the CRISPR Cas system found in the bacterium Clostridium cellulolyticum ( Clostridium cellulolyticum )). The anaerobic bacterium Clostridium cellulolyticum ( Clostridium cellulolyticum ( C. cellulolyticum)) are capable of hydrolyzing lignocellulose without the addition of commercial cellulases to form lactic acid, acetic acid, and ethanol as end products (Desvaux M. Clostridium cellulolyticum: model organism of mesophilic cellulolytic clostridia. FEMS Microbiol Rev. 2005 Sep;29(4):741-64). This ability of these microorganisms makes them promising candidates for biofuel producers. The use of production bacteria such as Clostridium cellulolyticum in biotechnological production helps to make the raw material processing cycle more efficient, increase efficiency, and ultimately reduce the load on all components of the biosphere. Genetic engineering methods can significantly improve microbial metabolic parameters and shift the balance in favor of supporting the production of more butanol rather than lactic acid and acetic acid. For example, a double mutant of the lactate and malate dehydrogenase genes showed the absence of lactate formation and an increase in butanol yield (Li Y et al., Combined inactivation of the Clostridium cellulolyticum lactate and malate dehydrogenase genes substantially increases ethanol yield from cellulose and switchgrass fermentations. Biotechnol Biofuels. 2012 Jan 4;5(1):2). To date, no effective procedure has been developed for producing Clostridium cellulolyticum strains with mutations in the phosphotransacetylase and acetate kinase genes, which could reduce acetic acid production. The present invention can be used to modify the genomes of Clostridium cellulolyticum as well as the genomes of other living organisms. Summary of the Invention

[0008] An object of the present invention is to provide a new method for modifying genomic DNA sequences of single-celled or multi-celled organisms using the CRISPR-Cas9 system. Due to the specific PAM sequence that must be present at the 3' end of the DNA region to be modified, the current system has limited use. Searching for new Cas9 enzymes with other PAM sequences will expand the range of available means for forming double-strand breaks at desired stringent specific sites in DNA molecules of various organisms.

[0009] To solve this problem, the authors characterized the type II CRISPR nuclease CcCas9 of Clostridium fibrolyticum predicted previously, which can be used to introduce directed modifications into the genomes of both the above-mentioned organisms and other organisms. The basic characteristics of the present invention are characterized as follows: (a) a short, two-letter PAM sequence different from other known PAM sequences; (b) the small size of the characterized CcCas9 protein, which is 1030 amino acid residues (a.a.r.), which is 23 a.a.r. less than the known Cas9 enzyme (SaCas9) from Staphylococcus aureus; (c) the wide operating temperature range of the CcCas9 nuclease, which is active at temperatures from 37°C to 65°C, with an optimal temperature at 45°C, which enables it to be used in organisms with various temperatures.

[0010] The problem is solved by using a protein comprising the amino acid sequence of SEQ ID NO: 1, or an amino acid sequence having at least 95% identity with the amino acid sequence of SEQ ID NO: 1 and differing from SEQ ID NO: 1 only in non-conserved amino acid residues, to form a double-strand break in a DNA molecule immediately preceding the nucleotide sequence 5'-NNNNGNA-3' in the DNA molecule. N is expected to refer to any one of the nucleotides (A, G, C, T). In some embodiments of the present invention, such use is characterized in that the double-strand break is formed in the DNA molecule at a temperature from 37°C to 65°C. In a preferred embodiment of the present invention, such use is characterized in that the double-strand break is formed in the DNA molecule at a temperature from 37°C to 55°C.

[0011] The problem is further solved by using a method for modifying the genomic DNA sequence of a unicellular or multicellular organism, the method comprising introducing an effective amount of the following into at least one cell of the organism: a) a protein comprising the amino acid sequence of SEQ ID NO: 1 or a nucleic acid encoding a protein comprising the amino acid sequence of SEQ ID NO: 1, and b) a guide RNA comprising a sequence that forms a duplex with a genomic DNA region of an organism directly adjacent to the nucleotide sequence 5'-NNNNGNA-3' and interacts with the protein after duplex formation, or a DNA sequence encoding the guide RNA, wherein the interaction of the protein with the guide RNA and the nucleotide sequence 5'-NNNNGNA-3' results in the formation of a double-strand break in the genomic DNA sequence immediately adjacent to the sequence 5'-NNNNGNA-3'.

[0012] A mixture of crRNA and tracer RNA (tracrRNA) that can form a complex with a target DNA region and the CcCas9 protein can be used as a guide RNA. In a preferred embodiment of the present invention, a hybrid RNA constructed based on crRNA and tracrRNA can be used as a guide RNA. Methods for constructing hybrid guide RNAs are known to those skilled in the art (Hsu PD et al., DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol. 2013 Sep;31(9):827-32).

[0013] The present invention can be used both for in vitro cleavage of target DNA and for modifying the genomes of some living organisms. The genome can be modified in a direct manner, i.e., by cleaving the genome at the corresponding site, and by inserting an exogenous DNA sequence via homologous repair.

[0014] Any region of double-stranded or single-stranded DNA from the genome of an organism other than for administration (or a combination of such regions and with other DNA fragments), can be used as an exogenous DNA sequence, wherein the region (or combination of regions) is expected to integrate into the double-strand break site in the target DNA induced by the CcCas9 nuclease. In some embodiments of the present invention, a double-stranded DNA region from the genome of the organism used for introducing the CcCas9 protein, but further modified by mutation (substitution of nucleotides) and by insertion or deletion of one or more nucleotides, can be used as an exogenous DNA sequence.

[0015] The technical result of the present invention is to increase the versatility of the available CRISPR-Cas9 system, enabling the use of Cas9 nuclease for cleaving genomic DNA or plasmid DNA at a large number of specific sites and over a wider temperature range. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 . Schematic diagram of the CRISPR locus in Clostridium fibriolysin.

[0017] Figure 2 . PAM determination by in vitro methods. Development of a system for cleaving DNA limited to the sequence NNNNGNA.

[0018] Figure 3 . Examination of the importance of each PAM position.

[0019] Figure 4 . Examination of protein activity when cleaving various DNA targets.

[0020] Figure 5. In vitro cleavage reaction of DNA fragments of the human grin2b gene.

[0021] Figure 6 . Study on the temperature range of CcCas9 activity.

[0022] Figure 7 . Schematic diagram of the interaction between guide RNA and the target DNA region.

[0023] Figure 8 . Alignment of Cas9 protein sequences from Staphylococcus aureus (SaCas9), Campylobacter jejuni (CjCas9), and CcCas9. The non-conserved regions of the sequences are underlined. Detailed implementation mode

[0024] As used in the description of the present invention, the terms "includes" and "including" should be construed to mean "including and so on". These terms are not intended to be construed as "consisting only of...". Unless otherwise defined, technical and scientific terms in this application have the typical meanings generally accepted in the scientific and technical literature.

[0025] As used herein, the term "percentage homology of two sequences" is equivalent to the term "percentage identity of two sequences". The identity of a sequence is determined based on a reference sequence. Algorithms for sequence analysis are known in the art, such as BLAST described in Altschul et al., J. Mol. Biol., 215, pp. 403-10 (1990). For the purposes of the present invention, to determine the identity and similarity levels between nucleotide sequences and amino acid sequences, a comparison of nucleotide sequences and amino acid sequences can be used, which is performed using the BLAST software package provided by the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / blast) with gapped alignment using standard parameters. The percentage identity of two sequences is determined by the number of positions of identical amino acids in these two sequences, taking into account the number of gaps to be introduced for the best comparison of the two sequences by alignment and the length of each gap. The percentage identity is equal to the number of identical amino acids at a given position considering the sequence alignment divided by the total number of positions and multiplied by 100.

[0026] The term "specifically hybridizes" refers to the association between two single-stranded nucleic acid molecules or sequences that are sufficiently complementary to allow such hybridization under predetermined conditions commonly used in the art.

[0027] The phrase “ tight double-strand break located prior to the nucleotide PAM sequence” means that the double-strand break in the target DNA sequence is prepared at a distance of 0 to 25 nucleotides prior to the nucleotide PAM sequence.

[0028] A protein comprising a specific amino acid sequence is intended to mean a protein having an amino acid sequence consisting of the amino acid sequence and other sequences that may be linked to the amino acid sequence by peptide bonds. Examples of other sequences may be a nuclear localization signal (NLS), or other sequences that provide increased functionality to the amino acid sequence.

[0029] An exogenous DNA sequence introduced simultaneously with the guide RNA is intended to mean a DNA sequence specifically prepared for the specific modification of double-stranded target DNA at the cleavage site determined by the specificity of the guide RNA. Such a modification may be, for example, the insertion or deletion of certain nucleotides at the cleavage site in the target DNA. The exogenous DNA may be a DNA region from a different organism, or a DNA region from the same organism as the target DNA.

[0030] An effective amount of a protein and RNA introduced into a cell is intended to mean such an amount of the protein and RNA that, when introduced into the cell, is capable of forming a functional complex, i.e., a complex that specifically binds to the target DNA and produces a double-strand break at the site determined by the guide RNA and the PAM sequence on the DNA. The efficiency of this process can be evaluated by analyzing the target DNA isolated from the cell using conventional techniques known to those skilled in the art.

[0031] Proteins and RNAs can be delivered to cells by various techniques. For example, a protein can be delivered as: a DNA plasmid of a gene encoding the protein, an mRNA for translation of the protein in the cytoplasm, or a ribonucleoprotein complex comprising the protein and the guide RNA. The delivery can be carried out by various techniques known to those skilled in the art.

[0032] The components of a nucleic acid encoding system can be introduced into a cell directly or indirectly as follows: by cell transfection or transformation via methods known to those skilled in the art, by using recombinant viruses, by manipulation of the cell such as DNA microinjection, etc.

[0033] A ribonucleic acid complex consisting of a nuclease, a guide RNA, and an exogenous DNA (if required) can be delivered by transfecting the complex into the cell or by mechanically introducing the complex into the cell, for example, by microinjection.

[0034] Nucleic acid molecules encoding proteins to be introduced into cells can integrate into chromosomes or can replicate DNA extrachromosomally. In some embodiments, to ensure efficient expression of the protein gene from the introduced DNA in the cell, it is necessary to modify the sequence of the DNA according to the cell type in order to optimize codons for expression, due to the unequal occurrence frequencies of synonymous codons in the coding regions of various biological genomes. Codon optimization is necessary to increase expression in animal, plant, fungal, or microbial cells.

[0035] For a protein having a sequence with at least 95% identity to the amino acid sequence of SEQ ID NO: 1 to function in a eukaryotic cell, it is necessary for the protein to ultimately reach the nucleus of such a cell. Thus, in some embodiments of the present invention, a protein having a sequence with at least 95% identity to the amino acid sequence of SEQ ID NO: 1 and further modified by adding one or more nuclear localization signals at one or both ends is used to form a double-strand break in the target DNA. For example, a nuclear localization signal from the SV40 virus can be used. To provide efficient delivery to the nucleus, the nuclear localization signal can be separated from the main protein sequence by a spacer sequence, such as described in Shen B et al., "Generation of gene-modified mice via Cas9 / RNA-mediated gene targeting", Cell Res. 2013 May;23(5):720-3. Further, in other embodiments, different nuclear localization signals or alternative methods for delivering the protein into the cell nucleus can be used.

[0036] The present invention includes the use of a protein from the organism Clostridium cellulolyticum( C. cellulolyticum )) for introducing a double-strand break at a strictly specified position within a DNA molecule, the protein being homologous to the previously characterized Cas9 protein.

[0037] In metabolic engineering, editing the genome of Clostridium cellulolyticum is a daunting task due to the lack of efficient editing tools. Methods for targeted genome editing, such as recombineering, group II intron retrotransposition, and allelic exchange, have many obvious limitations. For example, procedures for allelic exchange that rely on recombination are quite time-consuming and have low efficiency. (Heap J. T. et al. Integration of DNA into bacterial chromosomes from plasmids without a counter-selection marker / / Nucleic acids research. – 2012. – Vol. 40 - No. 8 - pp. e59-e59). Insertion of long DNA fragments, such as metabolic pathway transfer, is difficult with current genome engineering tools, which require existing recombination sites and / or recombinases (Esvelt K. M., Wang H. H. Genome‐scale engineering for systems and synthetic biology / / Molecular systems biology. – 2013. – Vol. 9 - No. 1 - p. 641). A simple and effective method is required for successful genome manipulation and generation of mutants with predetermined properties.

[0038] Introducing targeted modifications into the genome using CRISPR nucleases has many advantages. First, the specificity of the activity of the system is determined by the crRNA sequence, which allows the use of one type of nuclease for all target loci. Second, the technology enables the delivery of several guide RNAs complementary to different gene targets into the cell at once, thus allowing several genes to be modified simultaneously at once.

[0039] In addition, the use of the native CRISPR-Cas9 system from Clostridium cellulolyticum bacteria makes the system for editing the genome of this organism simpler and more effective, because the procedure does not require the introduction of foreign genes into the cell, the maintenance and expression of foreign genes. Instead, procedures can be developed for introducing guide RNAs targeting the genes of interest into the bacteria, through which the CRISPR-Cas9 system in the host cell can recognize the corresponding DNA targets of the bacteria of biotechnological significance and introduce double-strand breaks therein.

[0040] For Clostridium cellulolyticum H10For the biochemical characterization of the Cas9 protein, the CRISPR locus encoding the main system components (CcCas9, cas1, cas2 protein genes, and the CRISPR cassette and guide RNA) was cloned into the single-copy bacterial vector pACYC184. The effector ribonucleic acid complex, consisting of Cas9 and the crRNA / tracrRNA (trans-activating crRNA) duplex, requires the presence of a PAM (protospacer adjacent motif) on the DNA target for DNA recognition and subsequent hydrolysis, plus crRNA spacer-protospacer complementarity. (Mojica F. J. M. et al. Short motif sequences determine the targets of the prokaryotic CRISPR defence system / / Microbiology. – 2009. – Vol. 155. – No. 3. – Pp. 733-740). The PAM is a strictly defined sequence of several nucleotides that is located adjacent to or a few nucleotides away from the 3'-end of the protospacer on the non-target strand in type II systems. In the absence of the PAM, hydrolysis of the DNA bond with the formation of a double-strand break does not occur. The requirement for the presence of the PAM sequence on the target increases the recognition specificity but at the same time imposes a restriction on the choice of the target DNA region where the break is introduced.

[0041] To determine the sequence of the guide RNA of the CRISPR-Cas9 system, RNA sequencing of Escherichia coli ( E. coli ) DH5α bacteria carrying the generated pACYC184_CcCas9 construct was performed. The sequencing showed that the CRISPR cassette of the system was actively transcribed, as was the trans-activating crRNA ( Figure 1 ). Analysis of the crRNA and trans-activating crRNA sequences allowed consideration of their potential to form a secondary structure recognized by the CcCas9 nuclease.

[0042] Furthermore, the authors used bacterial PAM screening to determine the PAM sequence of the CcCas9 protein. To determine the PAM sequence of the CcCas9 protein, Escherichia coli DH5α cells carrying the pACYC184_CcCas9 plasmid were transformed with a plasmid library containing the spacer sequence 5'-TAAAAAATAAGCAAGCGATGATATGAATGC-3' of the CRISPR cassette of the CcCas9 system, flanked by random seven-letter sequences from the 5' or 3' end. Plasmids carrying sequences corresponding to the PAM sequence of the CcCas9 system were subjected to degradation under the action of a functional CRISPR-Cas system, while the remaining library plasmids were efficiently transformed into the cells, conferring resistance to the antibiotic ampicillin. After transformation and incubation of the cells on plates containing the antibiotic, the colonies were washed off the agar surface, and DNA was extracted from them using the Qiagen Plasmid Purification Midi kit. The region containing the randomized PAM sequence was amplified from the isolated plasmid library by PCR and then subjected to high-throughput sequencing on the Illumina platform. The resulting reads were analyzed by comparing the efficiency of transforming plasmids with unique PAMs included in the library into cells carrying pACYC184_CcCas9 or control cells carrying the empty vector pacyc184. The results were analyzed using bioinformatics methods. Thus, the PAM of the CcCas9 system could be identified, which is the two-letter sequence NNNNGNA( Figure 2 ).

[0043] Next, the PAM sequence was further determined by reproducing the cleavage reaction in vitro. To determine the PAM sequence of the CcCas9 protein, in vitro cleavage of a double-stranded PAM library was used. For this, it was necessary to obtain all components of the CcCas9 effector complex: the guide RNA and the recombinant form of the nuclease. Determining the guide RNA sequence by RNA sequencing enabled the in vitro synthesis of crRNA and tracrRNA molecules. The NEB HiScribe T7 RNA Synthesis Kit was used for the synthesis. The double-stranded DNA library was a 374 bp fragment containing a protospacer flanked by randomized heptanucleotides (5’ NNNNNNN 3’) from the 3' end:

[0044]

[0045] To cleave this target, a guide RNA with the following sequence was used:

[0046] tracrRNA:

[0047]

[0048] and crRNA:

[0049]

[0050] The bold indicates the crRNA sequence complementary to the preceding spacer sequence (target DNA sequence).

[0051] To obtain the recombinant CcCas9 protein, its gene was cloned into the plasmid pET21a. Escherichia coli Rosetta cells were transformed with the resulting plasmid CcCas9_pET21a. The cells carrying the plasmid were grown to an optical density of OD_600 = 0.6, and then the expression of the CcCas9 gene was induced by adding IPTG to a concentration of 1 mM. The cells were incubated at 25 °C for 4 hours, after which they were lysed. The recombinant protein was purified in two stages as follows: by affinity chromatography (NiNTA) and by protein size exclusion on a Superdex 200 column. The resulting protein was concentrated using an Amicon 30 kDa filter. Thereafter, the protein was frozen at -80 °C and used for in vitro reactions.

[0052] The in vitro reaction for cleaving the linear PAM library was carried out under the following conditions:

[0053] 1xCutSmart buffer

[0054] 400 nM CcSas9

[0055] 100 nM DNA library

[0056] 2 µM crRNA

[0057] 2 µM tracrRNA

[0058] The total reaction volume was 20 µl.

[0059] Clostridium fibrolyticum H10 is commonly found in compost and has an optimal division temperature of 45 °C, and accordingly, the reaction was carried out at this temperature for 30 minutes.

[0060] Cleavage caused a part of the library fragment to break into two parts with lengths of approximately 50 base pairs (bp) and 324 bp. As a control sample, a reaction without adding crRNA (an important component of the Cas effector complex) was used.

[0061] The reaction product was applied to a 1.5% agarose gel and subjected to electrophoresis. The uncut DNA fragment with a length of 374 bp was extracted from the gel and prepared for high-throughput sequencing using the NEB NextUltra II kit. The samples were sequenced on an Illumina platform, and then the sequences were analyzed using bioinformatics methods, where differences in nucleotide representation at each position of the PAM (NNNNNNN) were determined compared to the control samples ( Figure 3 ).

[0062] Thus, the authors were able to determine the PAM sequence of CcCas9 by an in vitro method: NNNNGNA, which exactly replicated the results obtained in experiments with bacteria.

[0063] Next, the importance of each position of the PAM sequence was examined. For this purpose, an in vitro reaction was carried out when cutting the following DNA fragments containing the DNA target 5'-gtgctcaatgaaaggagata-3' flanked by the PAM sequence GAGAGTA:

[0064]

[0065] The reaction was carried out under the following conditions:

[0066] 1xCutSmart buffer

[0067] 400 nM CcSas9

[0068] 20 nM DNA

[0069] 2 µM crRNA

[0070] 2 µM tracrRNA

[0071] The incubation time was 30 minutes and the reaction temperature was 45 °C. The experimental results confirmed that the PAM sequence of CcCas9 is NNNNGNA -3'. The most conserved amino acid is G at position 5 (see Figure 4 ).

[0072] The following exemplary embodiments of the method are presented for the purpose of disclosing the characteristics of the present invention and should not be construed as limiting the scope of the present invention in any way.

[0073] Example 1. Testing the activity of the СсCas9 protein in cutting various DNA targets

[0074] To examine the ability of CcCas9 to recognize various DNA sequences flanked by the NNNNGNA 3' sequence, an experiment on in vitro cleavage of DNA targets from the human grin2b gene sequence was carried out (see Table 1 below).

[0075] Table 1. DNA targets isolated from the human grin2b gene.

[0076] DNA target PAM ctacatcacgtaacctgtct tagaAgA gaacgagctctgctgcctga cacgGcc agaacgagctctgctgcctg acacGgc acggccaacaccaaccagaa cttgGgA tccgctctgggcttcatctt caactcg cgactccctgcaaacacaaa gaaagag atctacatcacgtaacctgt cttaGaA tatctcctttcattgagcac caaaccc

[0077] An in vitro DNA cleavage reaction was performed under conditions similar to the above experiment. As the DNA target, a human grin2b gene fragment of approximately 500 bp in size was used:

[0078]

[0079] The experimental results showed that CcCas9 in the complex with guide RNA was able to recognize various DNA targets containing the PAM sequence NNNNGNA ( Figure 5 ). In some cases of the targets, CcCas9 tolerated substitutions at position 7 of the PAM sequence.

[0080] Example 2. Temperature range of CcCas9 activity

[0081] To determine the temperature range of the CcCas9 protein, an experiment on in vitro cleavage of DNA targets was conducted under different temperature conditions.

[0082] For this purpose, target DNA flanked by the PAM sequence GAGAGTA was subjected to cleavage by the CcCas9 effector complex with the corresponding guide RNA at different temperatures ( Figure 6 ).

[0083] It was found that the CcCas9 protein had an activity with a wide temperature range. The maximum nuclease activity was achieved at a temperature of 45 °C, and the protein was sufficiently active in the range of 37 °C to 55 °C. Thus, CcCas9 in the complex with guide RNA is a new tool for cleavage (forming double-strand breaks) in DNA molecules limited to the sequence 5'-NNNNGNA-3', with a temperature range of 37 °C to 55 °C. A schematic diagram of the target DNA complexed with the crRNA and tracrRNA that together form the guide RNA is shown in Figure 7 .

[0084] Example 3.

[0085] Cas9 proteins from closely related organisms belonging to the genus Clostridium ( Clostridium ). So far, only one type II CRISPR Cas system has been found in Clostridium, which is from Clostridium perfringens ( Clostridium perfringens) of the Cas9 CRISPR Cas system (Maikova A et al., New Insights Into Functions and Possible Applications of Clostridium difficile CRISPR-Cas System . Front Microbiol. July 31, 2018; 9:1740).

[0086] The Cas9 protein from Clostridium perfringens bacteria has 36% identity with the CcCas9 protein (the degree of identity was calculated using BLASTp software with default parameters). The Cas9 protein from Staphylococcus aureus, which is comparable in size, has 28% identity with CcCas9 (BLASTp, default parameters).

[0087] Therefore, the CcCas9 protein is significantly different in amino acid sequence from other Cas9 proteins studied to date, including those found in related organisms.

[0088] Those skilled in the art of genetic engineering will understand that the CcCas9 protein sequence variants obtained and characterized by the applicant can be modified without altering the function of the protein itself (e.g., by site-directed mutagenesis of amino acid residues that do not directly affect functional activity (Sambrook et al., Molecular Cloning: A Laboratory Manual, (1989), CSH Press, pp. 15.3-15.108)). In particular, those skilled in the art will recognize that non-conserved amino acid residues can be modified without affecting the residues responsible for protein functionality (determining protein function or structure). Examples of such modifications include replacing non-conserved amino acid residues with homologous amino acid residues. Some regions containing non-conserved amino acid residues are shown in Figure 8 In some embodiments of the present invention, a protein can be used that comprises an amino acid sequence having at least 95% identity with the amino acid sequence of SEQ ID NO: 1 and differs from SEQ ID NO: 1 only in non-conserved amino acid residues to form a double-strand break immediately preceding the nucleotide sequence 5'-NNNNGNA-3' in a DNA molecule. Homologous proteins can be obtained by mutagenesis of the corresponding nucleic acid molecule (e.g., site-directed or PCR-mediated mutagenesis), and subsequently the modified Cas9 protein encoded thereby is tested for preservation of its function according to the functional analysis described herein.

[0089] Example 4. The CcCas9 system described in the present invention in combination with a guide RNA can be used to modify genomic DNA sequences of multicellular organisms including eukaryotes. To introduce the CcCas9 system in the form of a complex with a guide RNA into the cells (all cells or a part of the cells) of the organism, various methods known to those skilled in the art can be applied. For example, methods for delivering the CRISPR-Cas9 system to the cells of an organism have been disclosed in the sources (Liu C et al., Delivery strategies of the CRISPR-Cas9 gene-editing system for therapeutic applications. J Control Release. 2017 Nov 28;266:17-26; Lino CA et al., Delivering CRISPR: a review of the challenges and approaches. Drug Deliv. 2018 Nov;25(1):1234-1257), and in sources further disclosed within these sources.

[0090] For efficient expression of the CcCas9 nuclease in eukaryotic cells, it is desirable to optimize the codons of the amino acid sequence of the CcCas9 protein by methods known to those skilled in the art (e.g., the IDT codon optimization tool).

[0091] For efficient activity of the CcCas9 nuclease in eukaryotic cells, it is necessary to import the protein into the nucleus of the eukaryotic cell. This can be accomplished by using a nuclear localization signal from the SV40 T antigen (Lanford et al., Cell, 1986, 46: 575–582), which is linked to the CcCas9 sequence via a spacer sequence described in Shen B et al. "Generation of gene-modified mice via Cas9 / RNA-mediated gene targeting", Cell Res. 2013 May;23(5):720-3, or without a spacer sequence. Thus, the complete amino acid sequence of the nuclease to be transported inside the nucleus of the eukaryotic cell will be the following sequence: MAPKKKRKVGIHGVPAA-CcCas9-KRPAATKKAGQAKKKK (hereinafter referred to as CcCas9 NLS). At least two methods can be used to deliver the protein having the above amino acid sequence.

[0092] Gene delivery is achieved by preparing a plasmid that carries the CcCas9 NLS gene under the control of a promoter (e.g., CMV promoter), and a sequence encoding a guide RNA under the control of the U6 promoter. As the DNA target, a DNA sequence flanked by 5’-NNNNGNA-3’ is used, for example, the DNA sequence of the human grin2b gene:

[0093]

[0094] Thus, the crRNA expression cassette is as follows:

[0095]

[0096] The bold indicates the U6 promoter sequence, followed by the sequence required for target DNA recognition, while the direct repeat sequences are highlighted in capital letters.

[0097] The tracer RNA expression cassette is as follows:

[0098]

[0099] The bold indicates the U6 promoter sequence, followed by the sequence encoding the tracer RNA.

[0100] The plasmid DNA was purified and transfected into human HEK293 cells using Lipofectamine2000 reagent (Thermo Fisher Scientific). The cells were incubated for 72 hours, after which genomic DNA was extracted from them using a genomic DNA purification column (Thermo Fisher Scientific). The target DNA site was analyzed by sequencing on an Illumina platform in order to determine the number of insertions / deletions in the DNA at the target site due to a directed double-strand break, followed by its repair.

[0101] Amplification of the target fragment was performed using primers flanking the pseudo-site where the break was introduced, for example, the following primers for the grin2b gene locus mentioned above:

[0102]

[0103] After amplification, samples were prepared according to the reagent sample preparation protocol of the Ultra II DNA Library Prep Kit for Illumina (NEB) for high-throughput sequencing. Then sequencing was performed on an Illumina platform, 300 cycles, direct reads. The sequencing results were analyzed by bioinformatics methods. Insertion or deletion of several nucleotides in the target DNA sequence was considered as cleavage detection.

[0104] Delivery as a ribonucleoprotein complex was performed by incubating recombinant CcCas9 NLS with guide RNA in CutSmart buffer (NEB). The recombinant protein was generated from bacterial production cells by purification via affinity chromatography (NiNTA, Qiagen) and size exclusion (Superdex 200).

[0105] The protein and RNA were mixed at a ratio of 1:2:2 (CcCas9 NLS: crRNA: tracrRNA), the mixture was incubated at room temperature for 10 minutes, and then transfected into cells.

[0106] Next, the DNA extracted therefrom was analyzed for insertions / deletions at the target DNA site (as described above).

[0107] The CcCas9 nuclease from Clostridium cellulolyticum bacteria characterized in the present invention has many advantages over previously characterized Cas9 proteins.

[0108] CcCas9 has a short two-letter PAM that is different from other known Cas nucleases and is required for the system to function. According to the authors, the short PAM GNA located 4 nucleotides away from the protospacer is sufficient for CcSas9. Further, a G at position +5 is critical, while the importance of position +7 is lower, and in vitro cleavage was detected not only in the presence of A or T, but also in the presence of a C at position +7, although with slightly lower efficiency.

[0109] Most Cas nucleases known to date that are capable of introducing double-strand breaks into DNA have complex multi-letter PAM sequences, limiting the selection of sequences suitable for cleavage. Among the Cas nucleases studied that recognize short PAMs, only CcCas9 is capable of recognizing sequences limited to GNA nucleotides.

[0110] A second advantage of CcCas9 is its small protein size (1030 a.a.r., which is 23 a.a.r. less than SaCas9). To date, it is the only small-sized protein studied with a two-letter PAM sequence.

[0111] A third advantage of the CcCas9 system is its broad temperature range of activity: the nuclease is active at temperatures from 37°C to 65°C, with an optimal temperature at 45°C.

[0112] Although the present invention has been described with reference to the disclosed embodiments, those skilled in the art will understand that the specific embodiments described in detail are provided for the purpose of illustrating the invention and should not be construed as limiting the scope of the invention in any way. It should be understood that various changes can be made without departing from the spirit of the invention. <110> JSC "BIOCAD" <120> DNA Cleaving Agent <130> 417252 <150> RU 2018141524 <151> 2018-11-26 <160> 2 <170> BiSSAP 1.3.6 <210> 1 <211> 1021 <212> PRT <213> Clostridium cellulolyticum <400> 1 Met Lys Tyr Thr Leu Gly Leu Asp Val Gly Ile Ala Ser Val Gly Trp 1 5 10 15 Ala Val Ile Asp Lys Asp Asn Asn Lys Ile Ile Asp Leu Gly Val Arg 20 25 30 Cys Phe Asp Lys Ala Glu Glu Ser Lys Thr Gly Glu Ser Leu Ala Thr 35 40 45 Ala Arg Arg Ile Ala Arg Gly Met Arg Arg Arg Ile Ser Arg Arg Ser 50 55 60 Gln Arg Leu Arg Leu Val Lys Lys Leu Phe Val Gln Tyr Glu Ile Ile 65 70 75 80 Lys Asp Ser Ser Glu Phe Asn Arg Ile Phe Asp Thr Ser Arg Asp Gly 85 90 95 Trp Lys Asp Pro Trp Glu Leu Arg Tyr Asn Ala Leu Ser Arg Ile Leu 100 105 110 Lys Pro Tyr Glu Leu Val Gln Val Leu Thr His Ile Thr Lys Arg Arg 115 120 125 Gly Phe Lys Ser Asn Arg Lys Glu Asp Leu Ser Thr Thr Lys Glu Gly 130 135 140 Val Val Ile Thr Ser Ile Lys Asn Asn Ser Glu Met Leu Arg Thr Lys 145 150 155 160 Asn Tyr Arg Thr Ile Gly Glu Met Ile Phe Met Glu Thr Pro Glu Asn 165 170 175 Ser Asn Lys Arg Asn Lys Val Asp Glu Tyr Ile His Thr Ile Ala Arg 180 185 190 Glu Asp Leu Leu Asn Glu Ile Lys Tyr Ile Phe Ser Ile Gln Arg Lys 195 200 205 Leu Gly Ser Pro Phe Val Thr Glu Lys Leu Glu His Asp Phe Leu Asn 210 215 220 Ile Trp Glu Phe Gln Arg Pro Phe Ala Ser Gly Asp Ser Ile Leu Ser 225 230 235 240 Lys Val Gly Lys Cys Thr Leu Leu Lys Glu Glu Leu Arg Ala Pro Thr 245 250 255 Ser Cys Tyr Thr Ser Glu Tyr Phe Gly Leu Leu Gln Ser Ile Asn Asn 260 265 270 Leu Val Leu Val Glu Asp Asn Asn Thr Leu Thr Leu Asn Asn Asp Gln 275 280 285 Arg Ala Lys Ile Ile Glu Tyr Ala His Phe Lys Asn Glu Ile Lys Tyr 290 295 300 Ser Glu Ile Arg Lys Leu Leu Asp Ile Glu Pro Glu Ile Leu Phe Lys 305 310 315 320 Ala His Asn Leu Thr His Lys Asn Pro Ser Gly Asn Asn Glu Ser Lys 325 330 335 Lys Phe Tyr Glu Met Lys Ser Tyr His Lys Leu Lys Ser Thr Leu Pro 340 345 350 Thr Asp Ile Trp Gly Lys Leu His Ser Asn Lys Glu Ser Leu Asp Asn 355 360 365 Leu Phe Tyr Cys Leu Thr Val Tyr Lys Asn Asp Asn Glu Ile Lys Asp 370 375 380 Tyr Leu Gln Ala Asn Asn Leu Asp Tyr Leu Ile Glu Tyr Ile Ala Lys 385 390 395 400 Leu Pro Thr Phe Asn Lys Phe Lys His Leu Ser Leu Val Ala Met Lys 405 410 415 Arg Ile Ile Pro Phe Met Glu Lys Gly Tyr Lys Tyr Ser Asp Ala Cys 420 425 430 Asn Met Ala Glu Leu Asp Phe Thr Gly Ser Ser Lys Leu Glu Lys Cys 435 440 445 Asn Lys Leu Thr Val Glu Pro Ile Ile Glu Asn Val Thr Asn Pro Val 450 455 460 Val Ile Arg Ala Leu Thr Gln Ala Arg Lys Val Ile Asn Ala Ile Ile 465 470 475 480 Gln Lys Tyr Gly Leu Pro Tyr Met Val Asn Ile Glu Leu Ala Arg Glu 485 490 495 Ala Gly Met Thr Arg Gln Asp Arg Asp Asn Leu Lys Lys Glu His Glu 500 505 510 Asn Asn Arg Lys Ala Arg Glu Lys Ile Ser Asp Leu Ile Arg Gln Asn 515 520 525 Gly Arg Val Ala Ser Gly Leu Asp Ile Leu Lys Trp Arg Leu Trp Glu 530 535 540 Asp Gln Gly Gly Arg Cys Ala Tyr Ser Gly Lys Pro Ile Pro Val Cys 545 550 555 560 Asp Leu Leu Asn Asp Ser Leu Thr Gln Ile Asp His Ile Tyr Pro Tyr 565 570 575 Ser Arg Ser Met Asp Asp Ser Tyr Met Asn Lys Val Leu Val Leu Thr 580 585 590 Asp Glu Asn Gln Asn Lys Arg Ser Tyr Thr Pro Tyr Glu Val Trp Gly 595 600 605 Ser Thr Glu Lys Trp Glu Asp Phe Glu Ala Arg Ile Tyr Ser Met His 610 615 620 Leu Pro Gln Ser Lys Glu Lys Arg Leu Leu Asn Arg Asn Phe Ile Thr 625 630 635 640 Lys Asp Leu Asp Ser Phe Ile Ser Arg Asn Leu Asn Asp Thr Arg Tyr 645 650 655 Ile Ser Arg Phe Leu Lys Asn Tyr Ile Glu Ser Tyr Leu Gln Phe Ser 660 665 670 Asn Asp Ser Pro Lys Ser Cys Val Val Cys Val Asn Gly Gln Cys Thr 675 680 685 Ala Gln Leu Arg Ser Arg Trp Gly Leu Asn Lys Asn Arg Glu Glu Ser 690 695 700 Asp Leu His His Ala Leu Asp Ala Ala Val Ile Ala Cys Ala Asp Arg 705 710 715 720 Lys Ile Ile Lys Glu Ile Thr Asn Tyr Tyr Asn Glu Arg Glu Asn His 725 730 735 Asn Tyr Lys Val Lys Tyr Pro Leu Pro Trp His Ser Phe Arg Gln Asp 740 745 750 Leu Met Glu Thr Leu Ala Gly Val Phe Ile Ser Arg Ala Pro Arg Arg 755 760 765 Lys Ile Thr Gly Pro Ala His Asp Glu Thr Ile Arg Ser Pro Lys His 770 775 780 Phe Asn Lys Gly Leu Thr Ser Val Lys Ile Pro Leu Thr Thr Val Thr 785 790 795 800 Leu Glu Lys Leu Glu Thr Met Val Lys Asn Thr Lys Gly Gly Ile Ser 805 810 815 Asp Lys Ala Val Tyr Asn Val Leu Lys Asn Arg Leu Ile Glu His Asn 820 825 830 Asn Lys Pro Leu Lys Ala Phe Ala Glu Lys Ile Tyr Lys Pro Leu Lys 835 840 845 Asn Gly Thr Asn Gly Ala Ile Ile Arg Ser Ile Arg Val Glu Thr Pro 850 855 860 Ser Tyr Thr Gly Val Phe Arg Asn Glu Gly Lys Gly Ile Ser Asp Asn 865 870 875 880 Ser Leu Met Val Arg Val Asp Val Phe Lys Lys Lys Asp Lys Tyr Tyr 885 890 895 Leu Val Pro Ile Tyr Val Ala His Met Ile Lys Lys Glu Leu Pro Ser 900 905 910 Lys Ala Ile Val Pro Leu Lys Pro Glu Ser Gln Trp Glu Leu Ile Asp 915 920 925 Ser Thr His Glu Phe Leu Phe Ser Leu Tyr Gln Asn Asp Tyr Leu Val 930 935 940 Ile Lys Thr Lys Lys Gly Ile Thr Glu Gly Tyr Tyr Arg Ser Cys His 945 950 955 960 Arg Gly Thr Gly Ser Leu Ser Leu Met Pro His Phe Ala Asn Asn Lys 965 970 975 Asn Val Lys Ile Asp Ile Gly Val Arg Thr Ala Ile Ser Ile Glu Lys 980 985 990 Tyr Asn Val Asp Ile Leu Gly Asn Lys Ser Ile Val Lys Gly Glu Pro 995 1000 1005 Arg Arg Gly Met Glu Lys Tyr Asn Ser Phe Lys Ser Asn 1010 1015 1020 <210> 2 <211> 3066 <212> DNA <213> Clostridium cellulolyticum <400> 2 atgaaatata cattaggtct tgatgttgga attgcttctg taggttgggc ggtaattgat 60 aaggataata ataaaattat tgacttagga gttagatgtt ttgataaagc agaggaatct 120 aaaacgggtg agtcacttgc aacagctaga aggatagcta gaggtatgag aagaagaatt 180 tcgagaagat cccaaaggct acgtttagtt aaaaaactgt ttgttcaata tgaaattatt 240 aaagattcaa gtgaatttaa ccggatattt gacacttcgc gggatgggtg gaaagatcct 300 tgggaattaa ggtataatgc tttatcaaga atacttaaac cttatgaact tgttcaggta 360 cttacacata ttactaagag aagaggcttt aaaagtaaca gaaaggaaga cttgtctact 420 acaaaagaag gtgtagttat aactagtatt aaaaacaatt ctgagatgct tcgtacgaaa 480 aattaccgta ctattggaga aatgattttt atggagactc ctgaaaatag taacaaaagg 540 aataaggtag acgagtatat tcacactatt gccagagaag atcttctcaa tgaaataaaa 600 tatatattta gtatacaaag aaagcttgga agcccctttg taactgaaaa attagaacat 660 gactttttga atatatggga atttcaacgt ccttttgcca gtggtgatag tatactttca 720 aaagtgggaa agtgtaccct gctaaaggag gagttgagag caccgacttc ctgttacaca 780 tcagaatatt ttggattact tcaatcgatt aacaatctag ttttggttga agataacaat 840 acattaacat taaataatga tcaaagagca aaaataatag aatatgctca tttcaagaat 900 gaaatcaagt attctgaaat aagaaaatta ttagatattg aacctgaaat tttattcaaa 960 gcacataatt tgacacacaa aaatccctca ggaaacaatg agagcaaaaa gttttatgaa 1020 atgaagtctt atcataaact gaaaagcaca ttacctacag acatctgggg gaaattgcat 1080 tctaacaagg aatctcttga taatcttttt tactgcctta cggtctataa aaacgataac 1140 gaaataaagg actatttaca agcgaataat cttgattatt taattgaata tatagcaaaa 1200 ttgccaactt tcaacaaatt taaacatcta tctttagttg ccatgaaaag gattattccg 1260 tttatggaaa aagggtataa atatagtgat gcctgtaata tggcggaatt agattttaca 1320 ggttccagca aacttgaaaa gtgtaataag ttaactgttg aaccaattat tgagaatgta 1380 actaatccag ttgtaataag ggctctgacg caagcaagga aagttataaa tgcgattata 1440 cagaagtatg gtctcccgta tatggtaaat atagaacttg cacgtgaagc gggaatgaca 1500 cgtcaggata gagataattt aaaaaaagaa catgaaaaca accgaaaagc aagggaaaaa 1560 atatcagacc taatacgcca aaatggtaga gttgcaagtg gtctggatat actgaaatgg 1620 cgtctttggg aagaccaggg cggaagatgt gcttattccg gcaaaccaat tcctgtttgt 1680 gatttattga atgactcact gactcagata gatcacattt atccgtatag tagaagtatg 1740 gacgattcat atatgaataa agttttagtt ttaaccgacg aaaatcaaaa taaaagaagt 1800 tatacgccat atgaagtatg ggggtcaact gaaaaatggg aggattttga ggcaagaata 1860 tattctatgc atttacctca aagtaaagaa aaaaggcttt tgaacagaaa ctttattaca 1920 aaagatttgg actcatttat ttcaagaaat cttaacgata ctaggtatat atcaaggttt 1980 ttaaaaaact atatagaatc gtatctgcag tttagtaatg attcacctaa gtcttgtgtg 2040 gtctgcgtta atggtcagtg taccgctcag cttagaagta gatgggggtt aaataaaaat 2100 cgagaagagt cagacctgca tcatgccctt gatgcagcag taattgcgtg tgcagataga 2160 aaaataatta aagaaataac aaactattat aatgaaagag aaaaccataa ttataaagtt 2220 aaatatcctt tgccttggca ttcgtttagg caagatttaa tggaaacgtt agcaggtgtt 2280 ttcatatccc gggcacccag aagaaaaatt accgggccag cccatgatga gacaatcaga 2340 tctcccaagc attttaacaa aggtttaact tcggtaaaaa taccgttaac aacagtgacg 2400 ttggaaaaac ttgagacaat ggtaaaaaat acaaaagggg gaatttcaga taaggcagta 2460 tataacgttc taaaaaatag attaatagag cataataata agccattaaa agcttttgct 2520 gaaaaaatat ataaaccact aaaaaatggt acaaacggtg caataattag gagtattcga 2580 gttgagacac catcatatac aggagtattc agaaatgaag gaaaggggat atctgataat 2640 tccttaatgg ttagggttga tgtatttaag aaaaaagata agtattacct tgtgccaata 2700 tatgtagcac atatgataaa aaaagagtta ccttcgaaag ctatagttcc tctgaaacct 2760 gaatctcaat gggagttaat tgatagtact catgaatttc ttttttcact ataccaaaat 2820 gattaccttg ttataaaaac taaaaagggt ataactgagg gctattatag atcttgccac 2880 aggggtaccg gtagcctgag cctaatgcct cattttgcta ataataagaa tgttaaaata 2940 gatattggag ttaggacagc aataagtatt gaaaaatata atgtggatat acttggtaat 3000 aaaagcatag taaaaggaga accaagacgt gggatggaga aatataatag tttcaaatcc 3060 aactaa 3066

Claims

1. The non-therapeutic use of a protein for forming a double-strand break located 0 to 25 nucleotides before the nucleotide sequence 5'-NNNNGNA-3' in a DNA molecule, wherein the protein is as shown in the amino acid sequence of SEQ ID NO:1, characterized in that The double-strand break is formed in the DNA molecule at a temperature of 37°C to 65°C.

2. A non-therapeutic method for generating a double-strand break in the genomic DNA sequence of a unicellular or multicellular organism immediately adjacent to the sequence 5'-NNNNGNA-3', comprising introducing an effective amount of the following into at least one cell of said organism: a) a protein as shown in the amino acid sequence of SEQ ID NO:1 or a nucleic acid encoding a protein as shown in the amino acid sequence of SEQ ID NO:1, and b) a guide RNA comprising a sequence that forms a duplex with a nucleotide sequence of a genomic DNA region of the organism immediately adjacent to the nucleotide sequence 5'-NNNNGNA-3' and interacts with the protein after duplex formation, or a DNA sequence encoding said guide RNA, wherein the interaction of the protein with the guide RNA and the nucleotide sequence 5'-NNNNGNA-3' results in the formation of a double-strand break in the genomic DNA sequence at 0 to 25 nucleotides before the sequence 5'-NNNNGNA-3'.

3. The method according to claim 2, further comprising introducing an exogenous DNA sequence simultaneously with the guide RNA.

Images