Use of a non-structural protein 4 in improving the immune function of a recombinant rotavirus subunit vaccine
By expressing the NSP4 gene and VP8 antigen gene on norovirus P particles to form recombinant proteins and using 24-valent P particles as carriers, the immunogenicity and virus neutralization ability of the recombinant rotavirus subunit vaccine are enhanced, solving the problems of poor immune effect and intussusception risk of existing vaccines, and achieving more efficient immune protection.
Patent Information
- Application Number
- CN202210420398.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-04-21
- Publication Date
- 2025-10-14
- Estimated Expiration
- 2042-04-21
AI Technical Summary
The existing recombinant rotavirus subunit vaccines have weak immunogenicity and lack the ability to activate the host's natural immunity and acquired immune response. In addition, the live attenuated vaccines are not effective in developing countries and there is a risk of intussusception.
The rotavirus nonstructural protein 4 (NSP4) gene and rotavirus antigen gene were expressed in different surface loops of norovirus P particles to form recombinant proteins. 24-valent P particles were used as carriers, and immunogenicity was enhanced by presenting multivalent nanoparticle carriers and adding the immunostimulatory molecule NSP4 in parallel.
It improves the immune function of the recombinant rotavirus subunit vaccine, enhances the NSP4 and VP8 antigen-specific IgG antibody titers, improves the neutralization ability and protective effect against rotavirus, avoids the risk of intussusception in infants after vaccination, and has advantages in production.
Smart Images

Figure CN114767846B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of vaccine preparation, and particularly relates to application of rotavirus non-structural protein 4 in improving immune function of recombinant rotavirus subunit vaccine. BACKGROUND
[0002] Rotavirus is one of the most common viral pathogens causing infectious gastroenteritis, with high morbidity and mortality. Although in developed countries, commercial rotavirus vaccines, such as GlaxoSmithKline's Rotarix and Merck's Rotateq, live attenuated rotavirus vaccines are very effective (80-90%) in reducing rotavirus-related severe diseases, but in developing countries, they are less effective (40-70%). In addition, after the first vaccination of these live attenuated vaccines in infants over 3 months, the risk of small intestinal intussusception still exists (1:50,000 or less), which limits the flexibility of the immunization schedule. Therefore, there is an urgent need for a new and more effective rotavirus vaccine. Based on safety, effectiveness and practicality, non-enteral immunization with recombinant rotavirus subunit vaccine is a feasible solution. For rotavirus, among the G-type antigens (viral protein 7, VP7) and P-type antigens (VP4) located on the outer layer of rotavirus, the outermost subunit VP8 of the spike protein VP4 is responsible for the binding of the virus particle to the host receptor, which has been proven to be an effective vaccine target. Therefore, a recombinant vaccine containing rotavirus VP8 antigen is a good choice for preventing rotavirus gastroenteritis.
[0003] A common drawback of recombinant subunit vaccines containing simple protein antigens is their weak immunogenicity, because they have a lower valence and lack certain viral components required to activate host innate and adaptive immune responses. At present, this drawback can be rescued by the presentation of multivalent nanocarriers and the addition of immunostimulatory molecules. In fact, the P region of norovirus modified forms 24-valent subviral particles P24 nanoparticles, and three surface loops have been identified on the outermost surface of each P24 nanoparticle, which are excellent locations for displaying exogenous antigens that exhibit enhanced immunogenicity, and thus can be used for the development of new subunit vaccines. The insertion of VP8 antigen into loop 2 of subviral particles (PP-VP8) has shown potential as a recombinant rotavirus vaccine. In contrast, it remains to be verified whether the immune response of these candidate vaccines can be further enhanced by other viral components, especially those with immunostimulatory potential. Non-structural protein 4 (NSP4) is the first viral enterotoxin discovered and is the main virulence factor of rotavirus causing intestinal cell lysis, malabsorption, secretory and osmotic diarrhea, which has been proven to be a potential candidate antigen for rotavirus vaccine.
[0004] A common drawback of recombinant subunit vaccines containing simple protein antigens is their weak immunogenicity, because they have a lower valence and lack certain viral components required to activate host innate and adaptive immune responses. At present, this drawback can be rescued by the presentation of multivalent nanocarriers and the addition of immunostimulatory molecules. In fact, the P region of norovirus modified forms 24-valent subviral particles P24 nanoparticles, and three surface loops have been identified on the outermost surface of each P24 nanoparticle, which are excellent locations for displaying exogenous antigens that exhibit enhanced immunogenicity, and thus can be used for the development of new subunit vaccines. The insertion of VP8 antigen into loop 2 of subviral particles (PP-VP8) has shown potential as a recombinant rotavirus vaccine. In contrast, it remains to be verified whether the immune response of these candidate vaccines can be further enhanced by other viral components, especially those with immunostimulatory potential. Non-structural protein 4 (NSP4) is the first viral enterotoxin discovered and is the main virulence factor of rotavirus causing intestinal cell lysis, malabsorption, secretory and osmotic diarrhea, which has been proven to be a potential candidate antigen for rotavirus vaccine. SUMMARY
[0005] The present application aims to improve the immunogenicity, specificity and virus neutralization ability of the recombinant rotavirus subunit vaccine.
[0006] To achieve the above-mentioned purposes, the present application provides the following technical solutions.
[0007] The present application provides an application of rotavirus non-structural protein 4 in improving the immunological function of the recombinant rotavirus subunit vaccine.
[0008] Preferably, the rotavirus non-structural protein 4 gene and the rotavirus antigen gene are expressed in different surface rings on the norovirus P particle to obtain a recombinant protein; the recombinant protein is the recombinant rotavirus subunit vaccine.
[0009] Preferably, the rotavirus antigen is VP8 antigen or rotavirus non-structural protein 4 antigen.
[0010] The present application also provides a recombinant rotavirus subunit vaccine.
[0011] Preferably, the particle size of the recombinant rotavirus subunit vaccine is 10-200 nm.
[0012] The present application also provides a vaccine preparation containing the recombinant rotavirus subunit vaccine.
[0013] Preferably, the vaccine preparation is a muscle injection.
[0014] The present application also provides a preparation method of the vaccine preparation, which mixes a solution of the recombinant rotavirus subunit vaccine with an immune adjuvant to obtain the vaccine preparation.
[0015] Preferably, the mass-volume ratio of the recombinant rotavirus subunit vaccine to the phosphate buffer in the solution of the recombinant rotavirus subunit vaccine is 10-100 μg: 25-250 μl.
[0016] Preferably, the immune adjuvant is an aluminum adjuvant; the volume ratio of the solution of the recombinant rotavirus subunit vaccine to the immune adjuvant is 25-250 μl: 25-250 μl.
[0017] The present application improves the immunological function of the recombinant rotavirus subunit vaccine by using NSP4 protein, and parallel expression of the NSP4 gene and the VP8 antigen gene or the NSP4 antigen gene can improve the specific IgG antibody titer of the NSP4 antigen and the VP8 antigen, improve the neutralization ability of the VP8 antigen to rotavirus, and improve the protective effect of the NSP4 antigen and the VP8 antigen on the diarrhea mice induced by the SA11 strain of rotavirus.
[0018] The present application selects 24-valent P particles with relatively low immunogenicity as the carrier of recombinant vaccine, and the particles have homogenous (i.e. VP8 of rotavirus) and heterogeneous (i.e. protruding domain of norovirus) antigens. The immunogenicity of the recombinant subunit vaccine can be enhanced by the presentation of the multivalent nanoparticle carrier and the parallel addition of the immunostimulatory molecule NSP4. Compared with attenuated live vaccine, the present application does not contain live virus, and can avoid the risk of intussusception after inoculation of infants. Considering the cycle length in the process of vaccine production, the subunit vaccine also has clear advantages in production compared with whole virus vaccine. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 Figure 1 is a photograph of sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE) electrophoresis and Western Blot analysis of Example 3; lane 1: PP-VP8; lane 2: PP-NSP4-VP8; lane 3: PP-VP8-NSP4; lane 4: PP-NSP4-NSP4;
[0020] Figure 2 Figure 2 is a photograph taken by transmission electron microscopy in Example 3; 1: PP-VP8; 2: PP-NSP4-VP8 (each small box marked on the 2 figure is 20 nm in size, and the total length is 200 nm); 3: PP-VP8-NSP4; 4: PP-NSP4-NSP4; the arrow indicates a typical subviral particle;
[0021] Figure 3 Figure 5 is the IgG reaction of each antigen in mice in Example 4, A: VP8-specific IgG reaction; B: NSP4-specific IgG reaction;
[0022] Figure 4 Figure 6 is the neutralization titer of serum of mice immunized with various antigens against rotavirus (WA strain) infection in Example 6; A is the 50% neutralization titer of mouse serum after treatment with different antigens determined by fluorescence plaque reduction method; B-F show representative images of the test serum at a dilution of 1:400;
[0023] Figure 5 Figure 7 is the passive protection of mouse serum after immunization with different antigens against diarrhea caused by rotavirus (SA11 strain) challenge in mice in Example 7; A is the diarrhea rate of mice treated with mouse serum after immunization with different antigens against rotavirus challenge; B is a representative image of a normal mouse; C is a representative image of a diarrhea mouse. DETAILED DESCRIPTION
[0024] The technical solutions provided by the present application will be described in detail below in conjunction with the examples, but they should not be understood as limiting the scope of protection of the present application.
[0025] Example 1
[0026] Four antigens were designed as follows. The expression vectors of the four antigens are loop2 and / or loop3 surface loops of the Norovirus VA387 (Genogroup II, Cluster 4 [GII.4]) protruding domain.
[0027] The partial nucleotide sequence of the Norovirus VA387 expression vector containing the loop2 and loop3 surface loops is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO: 2.
[0028] (1) PP-VP8: The VP8 antigen gene is inserted into the loop2 surface loop for expression, and the insertion site is between T369-D372 of the amino acid sequence shown in SEQ ID NO: 2.
[0029] (2) PP-NSP4-VP8 (tandem expression): The NSP4 gene and the VP8 antigen gene are both inserted into the loop2 surface loop for expression, and the insertion sites of the NSP4 gene and the VP8 antigen gene are between T369-D372 of the amino acid sequence shown in SEQ ID NO: 2, and the NSP4 gene is before the VP8 antigen gene.
[0030] (3) PP-VP8-NSP4 (parallel expression): The VP8 antigen gene is inserted into the loop2 surface loop for expression, and the NSP4 gene is inserted into the loop3 surface loop for expression, and the insertion site of the VP8 antigen gene is between T369-D372 of the amino acid sequence shown in SEQ ID NO: 2, and the insertion site of the NSP4 gene is between D389-N392 of the amino acid sequence shown in SEQ ID NO: 2.
[0031] (4) PP-NSP4-NSP4 (parallel expression): The NSP4 antigen gene is inserted into the loop2 surface loop for expression, and the NSP4 gene is inserted into the loop3 surface loop for expression, and the insertion site of the NSP4 antigen gene is between T369-D372 of the amino acid sequence shown in SEQ ID NO: 2, and the insertion site of the NSP4 gene is between D389-N392 of the amino acid sequence shown in SEQ ID NO: 2.
[0032] Among them, the VP8 antigen gene is from the Rotavirus Wa strain (P[8] genotype strain, preserved in the laboratory); the NSP4 gene is also a secretory NSP4 gene, also from the Rotavirus Wa strain. The nucleotide sequence of the VP8 antigen is shown in SEQ ID NO: 3, and the amino acid sequence is shown in SEQ ID NO: 4. The nucleotide sequence of the NSP4 gene is shown in SEQ ID NO: 5, and the amino acid sequence is shown in SEQ ID NO: 6.
[0033] The DNA sequences of the above four antigens were synthesized by Shengong Bioengineering (Shanghai) Co., Ltd. and cloned into the BamH I and Not I sites of the vector pGEX-4T-1 (GE Healthcare Life Sciences).
[0034] Example 2
[0035] Expression and purification of recombinant proteins
[0036] The expression vectors of the four antigens constructed in Example 1 were introduced into E. coli (BL21, DE3) to obtain transformed bacteria. Recombinant proteins were induced for expression in E. coli (BL21, DE3) using 0.4 mM isopropyl-β-D-thiogalactoside (IPTG) at 16°C overnight. The bacterial solution after induction was removed and centrifuged at 5000 rpm at 4°C for 15 min, and the supernatant was discarded. The precipitate was resuspended with 100 mL PBS, then ultrasonicated for 10 s, stopped for 50 s, and ultrasonicated for a total of 1.5 h. Then, the solution was centrifuged at 13000 rpm at 4°C for 1 h, and the supernatant was collected for purification. The recombinant proteins were purified using Pierce Glutathione Agarose (Thermo Fisher Scientific). 2 mL of the mixed GST Agarose was added to a purification column, and then 50 mL of the supernatant was added. The mixture was mixed and combined at room temperature for 2 h. After combination was completed, the flow-through was discharged. The GST gel was washed with PBS for 10 min each time, and the washing was performed 5 times. Meanwhile, the elution buffer was prepared: reduced glutathione was dissolved in 0.01 M PBS (pH 7.4) to a concentration of 20 mM. The proteins were eluted using the elution buffer, and each elution was allowed to stand for 5 min before the eluate was collected. The eluate was the purified recombinant protein, i.e., the recombinant rotavirus subunit vaccine. TM The eluate was the purified recombinant protein, i.e., the recombinant rotavirus subunit vaccine.
[0037] Example 3
[0038] Verification of purified antigens
[0039] 1. Polyacrylamide gel electrophoresis verification: different concentrations of bovine serum albumin (BSA) were diluted continuously and used for SDS-PAGE electrophoresis at the same time as the sample. The results are shown in the left graph of FIG. 1. Figure 1
[0040] 2. Western Blot analysis verification: after the protein was subjected to 10% SDS-PAGE electrophoresis, it was transferred to a PVDF membrane at 200 mA for 80 min. on PVD membrane (Millipore). Detection was performed with rabbit anti-GST antibody (1:5000, Rockland Immunochemicals, Inc., USA) and secondary antibody (1:5000, goat anti-rabbit IgG-HRP, Multi Sciences Biotech, China). After adding the enhanced chemiluminescence substrate (Multi Sciences Biotech, China), the corresponding software Image Lab 5.2.1 from Molecular ChemiDoc TM XRS+ imaging system. The results are shown in the right panel of Fig. Figure 1
[0041] 3. Transmission electron microscopy observation of the morphology of the purified antigens: The samples were adsorbed on carbon-coated copper grids, and negatively stained with 2% phosphotungstic acid. The grids were air-dried and examined under TEM (Hitachi, H-7650) at an accelerating voltage of 80 kV. The results are shown in Fig. Figure 2
[0042] The above verification results show that the four antigens expressed in E. coli are all soluble antigens. After purification by glutathione sepharose gel, SDS-PAGE shows specific bands of 72 kDa-95 kDa ( Figure 1 ), theoretically PP-VP8 (lane 1) is 78.5 kDa, PP-NSP4-VP8 (lane 2) is 86 kDa, PP-VP8-NSP4 (lane 3) is 86 kDa, and PP-NSP4-NSP4 (lane 4) is 77.1 kDa. Western Blot analysis with anti-GST antibody also confirms these antigens ( Figure 1 ). Transmission electron microscopy shows that the four purified antigens all form subviral particles with a diameter of about 20 nm ( Figure 2 ).
[0043] Example 4
[0044] Animal immunization: 6-week-old female BALB / c mice (14-17 g) were provided by the Experimental Animal Center of the Institute of Medical Biology, Chinese Academy of Medical Sciences, and were randomly divided into 6 groups, 6 mice in each group, and were raised under SPF conditions with free access to food and water. The purified antigen of Example 2 was dissolved in phosphate buffer (PBS, pH 7.4) at a mass-volume ratio of 10 μg:25 μl to prepare a 10 μg / mouse / needle injection. An equal volume of aluminum adjuvant (Thermo Fisher Science) was added to the injection before immunization to prepare a vaccine preparation. Intramuscular injection was performed in the thigh muscle of the mice, 50 μl / mouse, and the blank group (Blank) was injected with an equal amount of diluted aluminum adjuvant (25 μl aluminum adjuvant + 25 μl phosphate buffer). Injection was performed three times every two weeks. Two weeks after the last immunization, blood was collected by heart puncture after intraperitoneal injection of tri- bromoethanol anesthesia, and the serum was collected after centrifugation at 3000 rpm for 10 minutes at 4°C overnight.
[0045] Example 5
[0046] DNA sequences encoding VP8 and NSP4 antigens were synthesized by GenScript Biotech (Shanghai) Co., Ltd. and cloned into the BamH I / Not I sites of the vector PET24b (Novagen) to express recombinant proteins (His tag). The recombinant proteins were induced for expression in Escherichia coli (BL21, DE3) using 0.4 mM IPTG, and the induction conditions were 16°C overnight. The recombinant proteins were purified using HisPur TM Cobalt resin (Thermo Fisher Science) according to the manufacturer's instructions, and the BSA (Bio-Rad) was used as a standard for quantification by SDS-PAGE electrophoresis. The purified VP8 and NSP4 proteins were used as capture antigens to detect the VP8 and NSP4-specific antibody titers of the immune serum prepared in Example 4. The results are shown in Figure 3
[0047] The results show that the parallel expression of NSP4 and VP8 on the norovirus subviral particles can increase the NSP4 and VP8-specific IgG titers.
[0048] For VP8-specific immunoglobulin titers, Figure 3 In the middle A), when NSP4 was not present, VP8 was presented on the loop 2 of norovirus subviral particles (PP-VP8) and induced VP8-specific IgG titers around 45000, when NSP4 was expressed in tandem on the same loop (PP-NSP4-VP8), VP8-specific IgG titers rose to around 75000, but the difference was not significant (p=0.5104). When VP8 and NSP4 were presented in parallel on different loops (PP-VP8-NSP4), VP8-specific IgG titers were 128000, which was significantly higher than that of PP-VP8 (p=0.0158<0.05).
[0049] For NSP4-specific immunoglobulin titers Figure 3 In the middle B), NSP4 was presented on both loop 2 and loop 3 of p particles (PP-NSP4-NSP4) and induced NSP4-specific immunoglobulin titers of about 160000, which was much higher than the NSP4-specific IgG titers induced by co-expression of VP8 and NSP4 (IgG titers of PP-VP8-NSP4 and PP-NSP4-VP8 were about 26000 and 18000, respectively). Although NSP4 presented in parallel (PP-VP8-NSP4) induced slightly higher NSP4-specific IgG titers than that presented in tandem (PP-NSP4-VP8), the difference was not statistically significant (p=0.9719).
[0050] Example 6
[0051] Rotavirus strain Wa was added to Dulbecco's modified Eagle's medium (DMEM) containing 10 μg / mL trypsin at 37°C for 20 min. The serum collected in Example 5 was diluted 25, 50, 100, 200, 400, 800, 1600, 3200, 6400 times, respectively, to obtain antigen serum of different dilution concentrations. The trypsin-digested rotavirus (Wa strain) (10 6PFU / mL) with different dilution concentrations of antigen serum were mixed at a volume ratio of 1:1, and after incubation at 37°C for 1 h, the mixed virus solution was added to a 96-well plate containing a monolayer of MA104 cells, 100 μL / well, and incubated at 37°C for 1 h, and then washed with DMEM. 100 μL of DMEM medium was added to each well and incubated at 37°C, 5% CO2 for 16 h. Then washed with phosphate buffer (PBS), and then 50 μL / well of 80% (v / v) acetone was pre-cooled at -20°C for 10 min, and then 2% (w / v) skimmed milk was added at 50 μL / well and incubated at 37°C for 1 h. After washing with PBS for 3 times, goat anti-rotavirus antiserum (1:1000, self-made method: immunize goats with rotavirus (WA strain), and then separate the antiserum after taking blood) was added and incubated at 37°C for 1 h. The bound antibody was detected with fluorescein isothiocyanate (FITC)-labeled rabbit anti-goat IgG antibody (1:250, Jackson ImmunoResearch Inc.). Incubate at 37°C for 1 h. Image with Cytation 1 imager reader (Bio-Tek Instruments, Inc.). Count the rotavirus-infected cells in the form of fluorescent plaques with GEN5 imager software. The 50% neutralization titer of mouse serum was defined as the maximum dilution of serum that reduced the fluorescent plaques by at least 50%. The results are shown in Figure 4 The results show that the combined expression of NSP4 and VP8 can improve the neutralization ability against rotavirus, but the expression of NSP4 alone has no effect on the neutralization of rotavirus.
[0052] Consistent with the results of VP8-specific IgG titers, the tandem expression of NSP4 and VP8 on the surface loop of Loop2 (PP-NSP4-VP8) can increase the 50% rotavirus neutralization titer from 266.7 (PP-VP8) to 400; the parallel expression of NSP4 and VP8 can further increase the 50% rotavirus neutralization titer to 533.3, which is 2 times of PP-VP8, but there is no significant difference compared with PP-VP8 (p=0.1318). It is worth noting that although the NSP4-specific IgG titer of the PP-NSP4-NSP4 group is very high Figure 3 Middle B), but the specific antibodies of the PP-NSP4-NSP4 group have no effect on the neutralization of rotavirus Figure 4 Middle A).
[0053] Example 7
[0054] A 4-day-old BALB / c mouse model of mammalian diarrhea rotavirus challenge was established to observe the passive protection of mouse serum after immunization with different rotavirus antigens.
[0055] 2 x 10 5Plaque forming units (PFU) of simian rotavirus (SA11 strain) were pre-incubated for 1 h with four mouse sera (diluted at 1 :20 dilution, 20 μL) obtained from immunization of Example 5, and then orally administered to suckling mice (n = 5-7). Diarrhea was monitored daily for three days post-challenge by gently pressing the abdomen of the mice to check for diarrhea symptoms. Diarrhea was defined as more or less liquid stool compared to the normal solid stool of other mice. The results are shown in Table A. Figure 5 The results show that the parallel expression of NSP4 gene and VP8 antigen gene on the norovirus subviral particles presents a better protection in the rotavirus challenge model of suckling mice.
[0056] The diarrhea rate of the blank control serum-treated group (Blank) was 100% (5 / 5) on day 1, 100% (5 / 5) on day 2, and 60% (3 / 5) on day 3 post-challenge (Table A). Figure 5 The serum of PP-VP8 (VP8 alone in loop 2 of P particle) showed a slight protection starting on day 2, with a diarrhea rate of 100% (6 / 6) on day 1, 83.3% (5 / 6) on day 2, and 66.7% (4 / 6) on day 3. The protection of the serum of PP-NSP4-VP8 (NSP4 and VP8 in tandem in loop 2 of P particle) was even earlier, with a diarrhea rate of 83.3% (5 / 6) on day 1, 50% (3 / 6) on day 2, and 33.3% (2 / 6) on day 3. The serum of PP-VP8-NSP4 (VP8 in loop 2 and NSP4 in loop 3 of P particle in parallel) showed the highest protection against rotavirus challenge, with a diarrhea rate of 57.1% (4 / 7) on day 1, 28% (2 / 7) on day 2, and 28% (2 / 7) on day 3. In addition, NSP4 in parallel in loop 2 and loop 3 of P particle (PP-NSP4-NSP4) induced only high titers of NSP4-specific antibodies, which had no effect on in vitro neutralization of rotavirus and showed moderate but stable protection in the suckling mouse rotavirus challenge model, with a diarrhea rate of 60% (3 / 5) on day 1 to day 3 (Table A). Figure 5
[0057] From the above examples, it can be seen that the parallel expression of NSP4 and VP8 on the norovirus subviral particles can increase the titers of NSP4 and VP8 specific IgG antibodies, and in cell experiments, the combined expression of NSP4 and VP8 can improve the neutralization ability to rotavirus, although the parallel expression of NSP4 and NSP4 has no effect on the neutralization of rotavirus. However, like PP-VP8-NSP4 parallel expression, it shows earlier and higher protection for rotavirus SA11 strain induced diarrhea mice. The main function of the recombinant antigen PP-NSP4-NSP4 is to induce antibodies that block the invasion of rotavirus into the intestinal wall, rather than neutralizing antibodies. For recombinant rotavirus vaccine, the antibodies induced by PP-NSP4-NSP4 cannot directly neutralize the virus, but have a strong protective effect in vivo, which may be achieved by blocking the intestinal wall invasion of enterotoxin.
[0058] In addition, the present application selects 24-valent P particles with relatively low immunogenicity as the carrier of the recombinant vaccine, which has homologous (i.e. VP8 of rotavirus) and heterologous (i.e. protruding domain of norovirus) antigens, and the immunogenicity of the recombinant subunit vaccine can be enhanced by the presentation of the multivalent nanoparticle carrier and the parallel addition of the immunostimulatory molecule NSP4. The present application does not contain live viruses relative to attenuated live vaccines, which can avoid the risk of intussusception after vaccination in infants. Considering the length of the cycle in the vaccine production process, subunit vaccines also have clear advantages in production compared to whole virus vaccines.
[0059] The above only describes the preferred embodiments of the present application, and it should be noted that those skilled in the art can make several improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered within the scope of protection of the present application. SEQUENCE LISTING <110> Institute of Medical Biology, Chinese Academy of Medical Sciences <120> Use of rotavirus non-structural protein 4 in improving the immune function of recombinant rotavirus subunit vaccine <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1614 <212> DNA <213> Norovirus VA387 <400> 1 atggcgtcga atgacgccag cccatctgat gggtccacag ccaacctcgt cccagaggtc 60 aacaatgagg ttatggcttt ggagcccgtt gttggtgccg ctattgcggc acctgtggcg 120 ggccaacaaa acgtaattga cccctggatt aggaataatt ttgtacaagc ccctggtgga 180 gagtttacag tatcccctag aaacgctcca ggtgagatac tatggagcgc gcccttgggc 240 cctgatttga acccctacct ttctcatttg gccagaatgt acaatggtta tgcaggtggt 300 tttgaagtgc aggtaatcct cgcggggaac gcgttcaccg ccgggaaagt catatttgca 360 gcagtcccac caaattttcc aactgaaggc ttgagcccca gccaggttac tatgttcccc 420 catataatag tagatgttag gcaattggaa cctgtgttga tccccttacc tgatgttagg 480 aataacttct atcattacaa tcaatcaaat gattctacca ttaaattgat agcaatgctg 540 tatacaccac ttagggctaa taatgctggg gatgatgtct tcacagtctc ttgtcgagtc 600 ctcacgaggc catcccccga ttttgatttc atattcttgg tgccacccac agttgaatca 660 agaactaaac cattcaccgt cccgatctta actgttgagg aaatgtccaa ctcaagattc 720 cccattcctt tggaaaagtt gtacacgggt cccagcagtg cttttgttgt ccaaccacaa 780 aatggcaggt gcacgactga tggcgtgctc ttaggcacta cccagctgtc tgctgtcaat 840 atctgcacct tcagagggga tgtcacccac attgcaggca gtcatgacta tataatgaat 900 ttggcatctc aaaattggaa caattatgac ccaacagaag aaatcccagc ccctctggga 960 actccagatt tcgtgggaaa gatccaaggc atgctcaccc aaaccacaag agaggatggc 1020 tcgacccgcg cccacaaagc tacagtgagc actggaactg tccacttcac tccaaagttg 1080 ggcagtgttc aatacaccac tgacacaaac aatgattttc aaactggcca aaacacgaaa 1140 ttcaccccag tcggcgtcat ccaggatggt aataaccacc aaaatgaacc ccagcaatgg 1200 gtactcccaa attactcagg tagaactggt cataatgtgc acctagctcc tgccgttgcc 1260 cccactttcc caggcgagca acttctcttc tttaggtcca ctatgcccgg gtgtagcggg 1320 tatcccaaca tgaatctgga ttgcctactc ccccaggaat gggtgcagca cttctaccaa 1380 gaagcagctc cagcacaatc tgatgtggct ctgctgagat ttgtgaatcc agacacaggt 1440 agggttctgt ttgagtgcaa gctccataaa tcaggctatg tcacagtggc tcacactggc 1500 GTTTCTACACACTTGCCCCCATGGGAAATGGAGC GGGCGCAGACGTGCATTATAA 1614 GTTTCTACACACTTGCCCCCATGGGAAATGGAGC GGGCGCAGACGTGCATTATAA 1614 <210> 2 <211> 537 <212> PRT <213> Norovirus VA387 (norovirus VA387) <400> 2 Met Ala Ser Asn Asp Ala Ser Pro Ser Asp Gly Ser Thr Ala Asn Leu 1 5 10 15 Val Pro Glu Val Asn Asn Glu Val Met Ala Leu Glu Pro Val Val Gly 20 25 30 Ala Ala Ile Ala Ala Pro Val Ala Gly Gln Gln Asn Val Ile Asp Pro 35 40 45 Trp Ile Arg Asn Asn Phe Val Gln Ala Pro Gly Gly Glu Phe Thr Val 50 55 60 Ser Pro Arg Asn Ala Pro Gly Glu Ile Leu Trp Ser Ala Pro Leu Gly 65 70 75 80 Pro Asp Leu Asn Pro Tyr Leu Ser His Leu Ala Arg Met Tyr Asn Gly 85 90 95 Tyr Ala Gly Gly Phe Glu Val Gln Val Ile Leu Ala Gly Asn Ala Phe 100 105 110 Thr Ala Gly Lys Val lie Phe Ala Ala Val Pro Pro Asn Phe Pro Thr 115 120 125 Glu Gly Leu Ser Pro Ser Gin Val Thr Met Phe Pro His lie lie Val 130 135 140 Asp Val Arg Gin Leu Glu Pro Val Leu lie Pro Leu Pro Asp Val Arg 145 150 155 160 Asn Asn Phe Tyr His Tyr Asn Gin Ser Asn Asp Ser Thr lie Lys Leu 165 170 175 lie Ala Met Leu Tyr Thr Pro Leu Arg Ala Asn Asn Ala Gly Asp Asp 180 185 190 Val Phe Thr Val Ser Cys Arg Val Leu Thr Arg Pro Ser Pro Asp Phe 195 200 205 Asp Phe lie Phe Leu Val Pro Pro Thr Val Glu Ser Arg Thr Lys Pro 210 215 220 Phe Thr Val Pro lie Leu Thr Val Glu Glu Met Ser Asn Ser Arg Phe 225 230 235 240 Pro lie Pro Leu Glu Lys Leu Tyr Thr Gly Pro Ser Ser Ala Phe Val 245 250 255 Val Gin Pro Gin Asn Gly Arg Cys Thr Thr Asp Gly Val Leu Leu Gly 260 265 270 Thr Thr Gin Leu Ser Ala Val Asn lie Cys Thr Phe Arg Gly Asp Val 275 280 285 Thr His lie Ala Gly Ser His Asp Tyr lie Met Asn Leu Ala Ser Gin 290 295 300 Asn Trp Asn Asn Tyr Asp Pro Thr Glu Glu lie Pro Ala Pro Leu Gly 305 310 315 320 Thr Pro Asp Phe Val Gly Lys lie Gin Gly Met Leu Thr Gin Thr Thr 325 330 335 Arg Glu Asp Gly Ser Thr Arg Ala His Lys Ala Thr Val Ser Thr Gly 340 345 350 Thr Val His Phe Thr Pro Lys Leu Gly Ser Val Gin Tyr Thr Thr Asp 355 360 365 Thr Asn Asn Asp Phe Gin Thr Gly Gin Asn Thr Lys Phe Thr Pro Val 370 375 380 Gly Val lie Gin Asp Gly Asn Asn His Gin Asn Glu Pro Gin Gin Trp 385 390 395 400 Val Leu Pro Asn Tyr Ser Gly Arg Thr Gly His Asn Val His Leu Ala 405 410 415 Pro Ala Val Ala Pro Thr Phe Pro Gly Glu Gin Leu Leu Phe Phe Arg 420 425 430 Ser Thr Met Pro Gly Cys Ser Gly Tyr Pro Asn Met Asn Leu Asp Cys 435 440 445 Leu Leu Pro Gln Glu Trp Val Gln His Phe Tyr Gln Glu Ala Ala Pro 450 455 460 Ala Gln Ser Asp Val Ala Leu Leu Arg Phe Val Asn Pro Asp Thr Gly 465 470 475 480 Arg Val Leu Phe Glu Cys Lys Leu His Lys Ser Gly Tyr Val Thr Val 485 490 495 Ala His Thr Gly Pro His Asp Leu Val Ile Pro Pro Asn Gly Tyr Phe 500 505 510 Arg Phe Asp Ser Trp Val Asn Gln Phe Tyr Thr Leu Ala Pro Met Gly 515 520 525 Asn Gly Ala Gly Arg Arg Arg Ala Leu 530 535 <210> 3 <211> 477 <212> DNA <213> Artificial Sequence <400> 3 ttagatggtc cttatcaacc tactacattt acaccaccta ctgattactg gatacttatt 60 aattcaaata caaatggagt agtatacgag agtacaaata atagtgactt ttggactgca 120 gtcattgctg ttgaaccgca cgtcaatcca gtagatagac aatataatgt atttggtgaa 180 aataaacaat ttaatgtaag aaatgattca gataaatgga agtttttaga aatgtttaga 240 ggcagtagtc aaaatgactt ttataataga cgtacactaa cttctgatac tagactcgtg 300 ggaatattaa aatatggtgg aagaatatgg acatttcatg gtgaaacacc gagggctact 360 actgatagct caaacactgc aaatttgaac ggtatatcaa ttacaattca ttcagaattt 420 tatattattc caaggtccca agagtctaag tgtaatgaat atattaacaa cggtcta 477 <210> 4 <211> 159 <212> PRT <213> Artificial Sequence <400> 4 Leu Asp Gly Pro Tyr Gln Pro Thr Thr Phe Thr Pro Pro Thr Asp Tyr 1 5 10 15 Trp Ile Leu Ile Asn Ser Asn Thr Asn Gly Val Val Tyr Glu Ser Thr 20 25 30 Asn Asn Ser Asp Phe Trp Thr Ala Val Ile Ala Val Glu Pro His Val 35 40 45 Asn Pro Val Asp Arg Gln Tyr Asn Val Phe Gly Glu Asn Lys Gln Phe 50 55 60 Asn Val Arg Asn Asp Ser Asp Lys Trp Lys Phe Leu Glu Met Phe Arg 65 70 75 80 Gly Ser Ser Gln Asn Asp Phe Tyr Asn Arg Arg Thr Leu Thr Ser Asp 85 90 95 Thr Arg Leu Val Gly Ile Leu Lys Tyr Gly Gly Arg Ile Trp Thr Phe 100 105 110 His Gly Glu Thr Pro Arg Ala Thr Thr Asp Ser Ser Asn Thr Ala Asn 115 120 125 Leu Asn Gly Ile Ser Ile Thr Ile His Ser Glu Phe Tyr Ile Ile Pro 130 135 140 Arg Ser Gln Glu Ser Lys Cys Asn Glu Tyr Ile Asn Asn Gly Leu 145 150 155 <210> 5 <211> 206 <212> DNA <213> Artificial Sequence <400> 5 gtcgacatga tcgacaaact gaccacccgt gaaatcgaac aggttgaact gctgaaacgt 60 atccacgaca acctgatcac ccgtccggtt gacgttatcg acatgtctaa agaatttaac 120 cagaaaaaca tcaaaaccct ggacgaatgg gaatctggta aaaacccgta cgaaccgtct 180 gaagttaccg cttctatggc ggccgc 206 <210> 6 <211> 64 <212> PRT <213> 人工序列(Artificial Sequence) <400> 6 Met Ile Asp Lys Leu Thr Thr Arg Glu Ile Glu Gln Val Glu Leu Leu 1 5 10 15 Lys Arg Ile His Asp Asn Leu Ile Thr Arg Pro Val Asp Val Ile Asp 20 25 30 Met Ser Lys Glu Phe Asn Gln Lys Asn Ile Lys Thr Leu Asp Glu Trp 35 40 45 Glu Ser Gly Lys Asn Pro Tyr Glu Pro Ser Glu Val Thr Ala Ser Met 50 55 60
Claims
1. A use of rotavirus nonstructural protein 4 in the preparation of a recombinant rotavirus subunit vaccine with enhanced immune function, characterized in that: The rotavirus nonstructural protein 4 gene and the rotavirus VP8 gene are expressed in different surface loops on the norovirus P particle, and the resulting recombinant protein is a recombinant rotavirus subunit vaccine; The rotavirus VP8 gene is inserted into the loop2 surface loop for expression, and the rotavirus nonstructural protein 4 gene is inserted into the loop3 surface loop for expression; The amino acid sequence of the rotavirus VP8 is shown in SEQ ID NO: 4; The amino acid sequence of the wheel-shaped nonstructural protein 4 is shown in SEQ ID NO:
6.
2. A recombinant rotavirus subunit vaccine obtained by the application of claim 1.
3. The recombinant rotavirus subunit vaccine according to claim 2, wherein The particle size of the recombinant rotavirus subunit vaccine is 10-200 nm.
4. A vaccine preparation comprising the recombinant rotavirus subunit vaccine according to claim 2 or 3.
5. The vaccine preparation according to claim 4, wherein The vaccine preparation is for intramuscular injection.
6. A method for preparing the vaccine preparation according to claim 4 or 5, characterized in that: The solution of the recombinant rotavirus subunit vaccine is mixed with an immune adjuvant to obtain the vaccine preparation.
7. The preparation method according to claim 6, wherein The mass volume ratio of the recombinant rotavirus subunit vaccine to the phosphate buffer in the recombinant rotavirus subunit vaccine solution is 10-100 μg:25-250 μl.
8. The preparation method according to claim 6 or 7, characterized in that The immune adjuvant is an aluminum adjuvant; the volume ratio of the recombinant rotavirus subunit vaccine solution and the immune adjuvant is 25-250 μl:25-250 μl.
Citation Information
Patent Citations
Bacterial polysaccharide-protein conjugate vaccine and preparation method thereof
CN101972475A
Human rotavirus vaccine and preparation method thereof
CN104258387A