A method for preparing a brain organoid model of Kabuki syndrome and its application

Abstract

This invention belongs to the field of biomedicine and relates to a method for preparing a Kabuki syndrome brain organoid model and its application. This invention provides the application of GSK-3 inhibitors in the preparation of drugs for treating Kabuki syndrome. Currently existing Kabuki models include heterozygous mice, zebrafish, and 2D human cell models. However, the complexity of human brain development cannot be compared to animal models or single 2D cell models. In this invention, the inventors used CRISPR-CAS9 gene editing technology to knock out KMT2D and established a Kabuki syndrome brain organoid model using brain organoid technology. Studies have found that, compared to the wild type, the Kabuki syndrome brain organoid exhibits premature differentiation of excessive GABAergic neurons. Furthermore, by testing the dosage and time window of the small molecule chir99021, we found that this small molecule can restore the phenotype of abnormal neuronal differentiation in the Kabuki syndrome brain organoid. This discovery will provide new insights for the treatment of Kabuki syndrome.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and relates to a method for preparing a brain organoid model of Kabuki syndrome and its application. Background Technology

[0002] Kabuki syndrome is a rare dominant genetic disorder characterized by congenital multisystemic developmental defects. Patients with this condition experience varying degrees of neurodevelopmental delay and intellectual disability. However, there is a lack of treatment options, and the molecular mechanisms underlying the disease remain unclear. Type I Kabuki syndrome (KS1) accounts for approximately 70% of cases and is caused by the KMT2D mutation. KMT2D belongs to the histone methyltransferase family and methylates histone H3 at lysine 4 via the SET domain (H3K4me). Existing Kabuki models include heterozygous mice, zebrafish, and 2D human cell models. However, the complexity of human brain development cannot be compared to that of a single 2D cell model without considering animal evidence. Summary of the Invention

[0003] In some embodiments, the present invention provides the use of GSK-3 inhibitors in the preparation of drugs for treating Kabuki syndrome.

[0004] In some implementations, the drug contains an effective amount of a GSK-3 inhibitor.

[0005] In some implementations, the drug also includes a pharmaceutically acceptable pharmaceutical carrier.

[0006] In some embodiments, the pharmaceutical carrier includes one or more of a diluent, excipient, filler, binder, disintegrant, surfactant, and lubricant.

[0007] In some embodiments, the present invention provides the use of a GSK-3 inhibitor in the preparation of a drug for restoring GABAergic neurons.

[0008] In some implementations, the restored GABAergic neurons are restored GABAergic neurons from patients with Kabuki syndrome.

[0009] In some implementations, the GSK-3 inhibitor includes chir99021.

[0010] In some implementations, the structural formula of Chir99021 is shown in Formula 1:

[0011]

[0012] In some implementations, the GSK-3 inhibitor treats Kabuki syndrome by restoring GABAergic neurons.

[0013] In some implementations, the Kabuki syndrome is Kabuki syndrome caused by the KMT2D mutation.

[0014] In some embodiments, the Kabuki syndrome is Kabuki syndrome with KMT2D deficiency. In some embodiments, the inventors discovered during their research that chir99021 can achieve a preferred dosage.

[0015] In some embodiments, the present invention provides a vector comprising: (1) a DNA fragment homologous to the 5' end of the transformation region to be altered, i.e., a 5' arm, which is selected from a 1499 bp homologous sequence upstream of the SET region of the KMT2D gene functional domain; and (2) a second DNA fragment homologous to the 3' end of the transformation region to be altered, i.e., a 3' arm, which is selected from a 1657 bp homologous sequence downstream of the SET region of the KMT2D gene functional domain.

[0016] In some implementations, the 5' arm is terminated by a TAGTAATGA stop codon to stop transcription.

[0017] In some implementations, the 5' arm and 3' arm also contain a PGK-Puro or PGK-Hygro resistance screening marker.

[0018] In some embodiments, the sequence of the 5' arm is as shown in SEQ ID NO:11.

[0019] In some embodiments, the sequence of the 3' arm is as shown in SEQ ID NO:12.

[0020] In some implementations, the sequence of the vector containing PGK-Puro is shown in SEQ ID NO:21.

[0021] In some implementations, the sequence of the targeting vector containing PGK-Hygro is shown in SEQ ID NO:22.

[0022] In some implementations, the vector is used to knock out KMT2D.

[0023] In some implementations, the carrier is used to knock out the KMT2D-SET region.

[0024] In some implementations, the vector is a targeting vector.

[0025] In some embodiments, the present invention provides the application of the vector in knocking out the KMT2D gene.

[0026] In some embodiments, the present invention provides a cell comprising the aforementioned targeting vector.

[0027] In some embodiments, the present invention provides the use of the described cells in the preparation of brain organoids.

[0028] In some implementations, the brain organoid is an organoid of the brain of Kabuki syndrome.

[0029] In some implementations, the brain organoid is a mammalian brain organoid.

[0030] In some implementations, the mammal is a human.

[0031] In some implementations, the method includes knocking out biallelic KMT2D in embryonic stem cells by homologous recombination with a targeting vector, replacing biallelic KMT2D with two different selection markers.

[0032] In some implementations, the targeting vector is the targeting vector described above.

[0033] In some implementations, the two different screening markers are PGK-Puro and PGK-Hygro resistance screening markers.

[0034] In some implementations, the brain organoid is an organoid of the brain in Kabuki syndrome.

[0035] In some implementations, the brain organoid is a mammalian brain organoid.

[0036] In some implementations, the mammal is a human.

[0037] Existing Kabuki models include heterozygous mice, zebrafish, and 2D human cell models. However, the complexity of human brain development cannot be compared to animal models or single 2D cell models. In this invention, the inventors used CRISPR-CAS9 gene editing technology to knock out KMT2D and established a Kabuki syndrome brain organoid model using brain organoid technology. Studies found that, compared to the wild type, the Kabuki syndrome brain organoid exhibited premature differentiation of excessive GABAergic neurons. Furthermore, by testing the dosage and time window of the small molecule chir99021, we found that this small molecule can restore the abnormal neuronal differentiation phenotype in the Kabuki syndrome brain organoid. This discovery will provide new insights for the treatment of Kabuki syndrome.

[0038] In some implementations, the bi-equivalent KMT2D structural domain is replaced.

[0039] In some implementations, the structural domain is the region between exons 51 and 54.

[0040] In some implementations, the knockout also uses sgRNA.

[0041] In some implementations, the sgRNA targets the KMT2D gene.

[0042] In some implementations, the sgRNA targets the KMT2D-SET region.

[0043] In some embodiments, the sgRNA includes the sgRNA shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0044] In some embodiments, the present invention provides brain organoids prepared by the method.

[0045] In some implementations, the brain organoid is a mammalian brain organoid.

[0046] In some implementations, the mammal is a human.

[0047] In some implementations, there is overexpression of GABAergic neurons in the brain organoids.

[0048] In some embodiments, the present invention provides the use of the described brain organoids in drug discovery screening, toxicity assays, drug or gene expression studies of brain or neurological diseases, studies of mechanisms of brain or neurological injury and repair, studies of pathogenic mechanisms, studies of the etiology of brain cancer, or in recombinant gene expression.

[0049] In some embodiments, the present invention provides the use of the described brain organoids in the preparation of medicaments for treating neurological disorders, neurological conditions, or neurological or brain diseases, or in the preparation of medicaments for regenerative medicine. Attached Figure Description

[0050] Figure 1 A schematic diagram of the knockout strategy for the Kabuki brain-like model.

[0051] Figure 2 This is a gel image of the pX330 plasmid vector after enzyme digestion. Lane 1 and Lane 2 are gel images before and after enzyme digestion, respectively, and M is the reference band.

[0052] Figures 3A-3B Sequencing results were constructed for sgRNA. (A) sgRNA1, (B) sgRNA2.

[0053] Figure 4 This is a graph showing the sgRNA cleavage efficiency. The solid boxes represent the cleavage results of pX330-sgRNA1 and pX330-sgRNA2, respectively.

[0054] Figures 5A-5B Genotyping sequencing results of HN4 embryonic stem cells with KMT2D knockout. (A) Puro sequence starting site, (B) Hygro sequence starting site.

[0055] Figure 6 Schematic diagram of the cerebral organoid culture strategy and culture status diagrams corresponding to different stages.

[0056] Figure 7 Immunofluorescence identification of cerebral organoids. Upper panel: Protein expression of SOX2 (red) and TUJ1 (green), and lower panel: Protein expression of PAX6 (red) and FOXG1 (green).

[0057] Figure 8 Overexpression of GABAergic neurons in the KMT2D double-knockout cerebral organoid model. The upper panel shows wild-type cerebral organoids; the lower panel shows KMT2D double-knockout cerebral organoids. Neural progenitor cell marker: SOX2 (red); GABAergic neuron marker: GABA (green); Nucleus marker: DAPI (blue).

[0058] Figures 9A-9B It shows that 1 μM chir99021 restored the expression of GABAergic neuron markers DLX1 and DLX2. C0 represents the concentration of chir99021 given as 0, and C1 represents the administration of 1 μM chir99021. KMT2D- / - #15 and #19 are two cell lines with KMT2D knockout. HN4 represents cerebral organoids without KMT2D knockout. Specific Embodiments

[0059] The technical solutions of the present invention are further illustrated by the following specific embodiments. The specific embodiments do not represent limitations on the protection scope of the present invention. Some non-essential modifications and adjustments made by others based on the concept of the present invention still fall within the protection scope of the present invention.

[0060] Unless otherwise defined, all technical and scientific terms used herein have the same definitions as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to the described content can be applied to the methods of the present invention. Preferred methods and materials are described in the specific embodiments.

[0061] As used herein, "a" and "an" refer to the interpretation of the indefinite article in grammar, meaning "one", "a kind of" or "multiple", "multiple kinds" (i.e., "at least one", "at least one kind"). For example, "an element" refers to one or a kind of element.

[0062] The term "fragment" will be understood to refer to a nucleotide sequence that is shorter than a reference nucleic acid and contains the same nucleotide sequence as the reference nucleic acid in its common portion. Where appropriate, such nucleic acid fragments according to the invention may be contained within a larger polynucleotide, the fragment being a component of that larger polynucleotide. Such fragments comprise, or optionally consist of, oligonucleotides in the range of at least 6, 8, 9, 10, 12, 15, 18, 20, 21, 22, 23, 24, 25, 30, 39, 40, 42, 45, 48, 50, 51, 54, 57, 60, 63, 66, 70, 75, 78, 80, 90, 100, 105, 120, 135, 150, 200, 300, 500, 720, 900, 1000, or 1500 consecutive nucleotides of length of the nucleic acid of the invention.

[0063] In this description, unless the context otherwise requires, the words "comprising" or "including" will be understood to mean including the steps or elements or the set of steps and elements described, but not excluding any other steps or elements or the set of steps and elements; that is, an open-ended limitation.

[0064] The term "downstream" refers to the nucleotide sequence located at the 3' end of a reference nucleotide sequence. Specifically, downstream nucleotide sequences typically involve sequences following the transcription start site. For example, the translation start codon of a gene is located downstream of the transcription start site.

[0065] The term "upstream" refers to the nucleotide sequence located at the 5' end of a reference nucleotide sequence. Specifically, upstream nucleotides typically involve sequences located 5' to the side of a coding sequence or transcription start site. For example, most promoters are located upstream of the transcription start site.

[0066] A promoter is a DNA sequence that controls the expression of a coding sequence or functional RNA. Generally, the coding sequence is located at the 3' end of the promoter sequence. Promoters can originate entirely from a natural gene, or consist of different elements derived from different naturally discovered promoters, or even include synthetic DNA fragments. Those skilled in the art should understand that different promoters can direct gene expression in different tissues or cell types, at different stages of development, or in response to different environmental or physiological conditions. Promoters that cause gene expression in most cell types at most times are generally called "constitutive promoters." Promoters that cause gene expression in specific cell types are generally called "cell-specific promoters" or "tissue-specific promoters." Promoters that cause gene expression at specific developmental or cell differentiation stages are generally called "development-specific promoters" or "cell differentiation-specific promoters." Promoters that are induced to express genes after cells have been exposed to promoter-inducing agents, biomolecules, chemicals, ligands, light, or similar substances, or treated with these substances, are generally called "inducible promoters" or "regulatory promoters." It should also be recognized that, because the precise boundaries of regulatory sequences are not fully defined in most cases, DNA fragments of different lengths may have the same promoter activity.

[0067] The term "vector" refers to a nucleic acid molecule that can transfer a linked nucleic acid molecule. One type of vector is the "plasmid," which is a circular double-stranded DNA loop into which other DNA segments can be ligated. Another type of vector is the viral vector, in which other DNA segments can be ligated into the viral genome. Some vectors can self-replicate in host cells where they have been introduced (such as bacterial vectors with a bacterial origin of replication and free-living mammalian vectors). Other vectors (such as non-free-living mammalian vectors) can integrate into the host cell's genome after introduction and thus replicate with the host genome. Furthermore, some vectors can direct the expression of genes they are operatively linked to.

[0068] Some vectors, referred to in this invention as "recombinant expression vectors" (or simply "expression vectors"), are vectors, plasmids, or media designed to enable the expression of an inserted nucleic acid sequence after transformation into a host. Generally, expression vectors used in recombinant DNA technology are often in plasmid form. The terms "plasmid" and "vector" are used interchangeably in this specification because plasmids are the most commonly used form of vector. However, this invention is intended to include other forms of such expression vectors, such as viral vectors (e.g., replication-defective retroviruses, adenoviruses, and adeno-associated viruses), which serve an equivalent function.

[0069] The term "plasmid" refers to extrachromosomal elements that often carry genes that are not part of the cell's central metabolism and are often in the form of circular double-stranded DNA molecules. Such elements can be autonomously replicating sequences, genome-integrated sequences, bacteriophages, or nucleotide sequences from any source, linear, circular, or supercoiled, single-stranded or double-stranded DNA or RNA, many of which have been ligated or recombined into a unique structure capable of introducing promoter fragments and DNA sequences targeting selected gene products, along with suitable 3' untranslated sequences, into the cell.

[0070] A "targeting vector," also known as a "knockout vector," is a DNA construct containing a sequence that is homologous to an endogenous chromosomal nucleic acid sequence adjacent to the desired genetic modification. The flanking homologous sequence (called a "homologous arm") guides the targeting vector to a specific chromosomal location in the genome through the homology between the homologous arm and the corresponding endogenous sequence, and introduces the desired genetic modification through a process called "homologous recombination." "Targeting vector" and "knockout vector" can sometimes be used interchangeably. Targeting vectors are used to introduce insert nucleic acids into target loci of rat, eukaryotic, non-rat eukaryotic, mammalian, non-human mammalian, human, rodent, non-rat rodent, mouse, or hamster nucleic acids. The targeting vector contains the insert nucleic acid and further includes 5' and 3' homologous arms flanking the insert nucleic acid. The homologous arms flanking the insert nucleic acid correspond to regions within the target loci of rat, eukaryotic, non-rat eukaryotic, mammalian, non-human mammalian, human, rodent, non-rat rodent, mouse, or hamster nucleic acids. For ease of reference, the corresponding homologous genomic region within the target genomic locus is referred to herein as the “target site.” For example, a targeting vector may contain a first insert nucleic acid flanked by a first homologous arm and a second homologous arm complementary to the first and second target sites. Thus, the targeting vector thereby facilitates the integration of the insert nucleic acid into the target locus of rat, eukaryotic, non-rat eukaryotic, mammalian, non-human mammalian, human, rodent, non-rat rodent, mouse, or hamster nucleic acid via homologous recombination events occurring between the homologous arms and the complementary target sites within the cell's genome.

[0071] As used herein, homologous arms and target sites (i.e., homologous genomic regions) are complementary to each other when two regions share a sufficient level of sequence identity, thus acting as substrates for homologous recombination reactions. "Homology" refers to the identical or shared sequence identity of a DNA sequence with a corresponding or "complementary" sequence. Sequence identity between a given target site and a corresponding homologous arm found on a targeting vector can be any level of sequence identity that allows homologous recombination to occur. For example, the amount of sequence identity shared between a homologous arm (or a fragment thereof) of the targeting vector and a target site (or a fragment thereof) can be at least 51%, 53%, 57%, 60%, 65%, 70%, 75%, 80%, 83%, 85%, 87%, 89%, 91%, 93%, 95%, 97%, 98%, 99%, or 100% sequence identity, thus allowing said sequence to undergo homologous recombination. Furthermore, the homologous complementary regions between the homologous arm and the complementary target site can have any length sufficient to promote homologous recombination at the cleavage recognition site. Therefore, homologous arms possess sufficient homology to their corresponding target sites within the cell's genome for homologous recombination. For ease of reference, homologous arms are referred to herein as 5' homologous arms and 3' homologous arms. This term refers to the relative position of the homologous arm to the inserted nucleic acid within the targeting vector.

[0072] In some embodiments, the homologous arm of the targeting vector may have any length sufficient to promote homologous recombination events with the corresponding target site, including, for example, at least 5-10 kb, 5-15 kb, 10-20 kb, 20-30 kb, 30-40 kb, 40-50 kb, 50-60 kb, 60-70 kb, 70-80 kb, 80-90 kb, 90-100 kb, 100-110 kb, 110-120 kb, 120-130 kb, 130-140 kb, 140-150 kb, 150-160 kb, 160-170 kb, 170-180 kb, 180-190 kb, 190-200 kb or longer. As further detailed below, the targeting vector may employ a targeting arm of even greater length. In one particular embodiment, the sum of the 5' and 3' homologous arms is at least 10 kb, or the sum of the 5' and 3' homologous arms is at least about 16 kb to about 100 kb or about 30 kb to about 100 kb. In other embodiments, the sum of the 5' and 3' homologous arms of the ACE2 is about 10 kb to about 150 kb, about 10 kb to about 100 kb, about 10 kb to about 75 kb, about 20 kb to about 150 kb, about 20 kb to about 100 kb, about 20 kb to about 75 kb, or about 30 kb to about 150 kb. 0kb, approximately 30kb-approx. 100kb, approximately 30kb-approx. 75kb, approximately 40kb-approx. 150kb, approximately 40kb-approx. 100kb, approximately 20kb-approx. 40kb-approx. 60kb, approximately 60kb-approx. 80kb, approximately 80kb-approx. 100kb-approx. 120kb, or approximately 120kb-approx. 150kb.

[0073] In this invention, the term "recovery" in "restored GABAergic neurons" refers, for example, to the restoration of the overexpression of GABAergic neurons in double-knock brain organoids to the level of wild-type brain organoids after the addition of Chir99021.

[0074] In the following embodiments of this invention, a schematic diagram of the Kabuki brain-like model knockout strategy is shown below. Figure 1 As shown, in human embryonic stem cells, homologous recombination using a targeting vector, with PGK-Puro or PGK-Hygro resistance as selection markers, replaced the SET domain of biallelic KMT2D, specifically the region between exons 51 and 54. Figure 1 (KMT2D was knocked out using CRISPR-CAS9 gene editing technology). Sequencing confirmed successful knockout.

[0075] Chir99021, also known as "CT99021," is a GSK-3 inhibitor with the chemical structural formula IUPAC: 6-[2-[[4-(2,4-dichlorophenyl)-5-(5-methyl-1H-imidazol-2-yl)pyrimidin-2-yl]amino]ethylamino]pyridine-3-carbonitrile(6-[2-[4-(2,4-dichlorophenyl)-5-(4-methyl-1H-imidazol-2-yl)pyrimidin-2-ylamino]ethylamino]pyridine-3-carboxynitrile; C25H18Cl2N8); its structural formula is shown in Formula 1:

[0076]

[0077] The chir99021 used in the following embodiments of the present invention is sourced from Chembest.

[0078] Y27632 (i.e., Y-27632dihydrochloride) is an inhibitor of the ROCK-1 signaling pathway, which can reduce apoptosis of stem cells during single-cell culture.

[0079] HN4 cells are human embryonic stem cells.

[0080] This invention has discovered that GABAergic neurons are overexpressed in double-knockout brain organoids. In some embodiments of this invention, further research has shown that GSK-3 inhibitors can restore the expression of GABAergic neurons to the expression levels of wild-type brain organoids, i.e., they have a "reversal" effect. Therefore, GSK-3 inhibitors could potentially be used to treat Kabuki disease.

[0081] Example 1: Construction of KMT2D gene sgRNA and pX330-sgRNA plasmid

[0082] The sgRNA1 sequence 5'-CACCGATGGAAGAACAACGTGTACC-3' (SEQ ID NO:1) and the sgRNA2 sequence 5'-CACCGTAAGAAGCTTTGAGGCTACC-3' (SEQ ID NO:2) recognizing the target site were synthesized. ABsI restriction enzyme sites were introduced to synthesize upstream and downstream annealing primers for subsequent annealing experiments.

[0083] The upstream and downstream single-stranded primer sequences for synthesizing sgRNA1 are as follows:

[0084] Upstream (PF): 5'-CACCGATGGAAGAACAACGTGTACC-3 (SEQ ID NO:3);

[0085] Downstream (PR): 5'-AAACGGTACACGTTGTTCTTCCATC-3' (SEQ ID NO:4).

[0086] The upstream and downstream single-stranded primer sequences for synthesizing sgRNA2 are as follows:

[0087] Upstream (PF): 5'-CACCGTAAGAAGCTTTGAGGCTACC-3' (SEQ ID NO:5);

[0088] Downstream (PR): 5'-AAACGGTAGCCTCAAAGCTTCTTAC-3' (SEQ ID NO:6).

[0089] pX330 plasmid was obtained from the Miaoling plasmid platform (catalog number P0123). The annealed sgRNA product was ligated into the BBSI-linearized pX330 plasmid after annealing (enzyme digestion results are shown in the figure). Figure 2 The expression vector pX330-sgRNA1 was obtained. The specific ligation reaction system is shown in Table 1.

[0090] Table 1 Connection Reaction System

[0091]

[0092] The reaction conditions were as follows: ligation at 16℃ for more than 30 min, transformation into 30 μL of E.coli DH5α competent cells, then 200 μL was spread on an Amp-resistant plate, cultured at 37℃ for at least 12 hours, and then two clones were selected and inoculated into LB medium (5 mL) containing Amp resistance, and cultured at 37℃ and 250 rpm for at least 12 hours.

[0093] After plasmid extraction, randomly selected clones were sent to a sequencing company for sequencing verification. The sequencing results are as follows: Figure 3A and 3B As shown, the correct expression vector pX330-sgRNA was selected for subsequent experiments.

[0094] Example 2: Identification of pX330-sgRNA cleavage efficiency

[0095] Two μg of the pX330-sgRNA plasmid prepared in Example 1 was transfected into 293T cells using Lipofectamine 3000 (Invitrogen, catalog number L3000001). Simultaneously, an equal amount of GFP plasmid was transfected separately to observe transfection efficiency. Specific transfection procedures were performed according to the Lipofectamine 3000 reagent instructions. 293T cells were collected 36 hours after transfection, repeatedly pipetted with NP40 lysis buffer, and incubated at 56°C for 2 hours and 99°C for 10 minutes. Subsequently, PCR primers (PF1: 5'-GCTTGCGGAAAACTTCCCAG-3' (SEQ ID NO: 7); PR1: 5'-GCTTTCCTCCTGCTCTCCTG-3' (SEQ ID NO: 8); PF2: 5'-CCTGCCAGGTGAGAGATGAC-3' (SEQ ID NO: 9); PR2: 5'-GGCCCATATCCCCCTCAAAC-3' (SEQ ID NO: 10)) were designed flanking the genomic cleavage site to perform PCR reactions on the extracted genome (using Phanta Max Super-Fidelity DNA Polymerase). The cleavage efficiency of pX330-sgRNA was then verified using T7 endonuclease I (T7EI) (Biolabs, M0302L). The presence of a clearly cleaved fragment indicates successful sgRNA design. The principle is that T7 endonuclease I can recognize and cleave incompletely paired DNA.

[0096] The specific steps for the T7EI experiment are as follows: Genomic DNA was extracted from cells transfected with pX330-sgRNA1 and pX330-sgRNA2. The PCR products amplified using the PF+PR primers were recovered (Magen, D2111-03). 1 μg of the product was used for annealing, as shown in the following system:

[0097] Table 2. Annealing reaction system

[0098] PCR products 1μg Buffer 2 2μL H2O Add to 20μL

[0099] Table 3. Gradient Annealing Reaction Conditions

[0100] temperature Time / Gradient 95℃ 10min 95-85℃ Ramp: 2.0℃ / sec 85℃-25℃ Ramp: 2.0℃ / sec 16℃ forever

[0101] Then, 0.5 μL of T7 endonuclease I was added to the annealed product and reacted at 37°C for 30 min before direct gel electrophoresis for verification. The gel electrophoresis results are as follows: Figure 4 As shown.

[0102] from Figure 4As can be seen, both sgRNA1 and sgRNA2 were cleaved, proving that these two sgRNAs have sufficient cleavage efficiency. Ctrl represents the PCR fragment that was not cleaved by T7 endonuclease I, serving as a control.

[0103] Example 3: Design of the Knockout Carrier

[0104] The human KMT2D-SET domain was knocked out using the CRISPR-Cas9 method. The knockout vector mainly consists of two parts: an sgRNA expression vector targeting the KMT2D-SET domain and a donor. The main components of the donor are hKMT2D-5arm, PGK-Puro or Hygro resistance selection marker, and hKMT2D-3arm.

[0105] KMT2D-5'arm is a 1499bp homologous sequence upstream of the hKMT2D gene functional domain SET domain (SEQ ID NO: 11), followed by a TAGTAATGA stop codon to terminate transcription. hKMT2D-3'arm is a 1657bp homologous sequence downstream of the hKMT2D gene functional domain SET domain (SEQ ID NO: 12). The knockout vector uses the replacement of hKMT2D-SET domain as an antibiotic resistance selection marker.

[0106] Primers were designed on both sides of the cleavage site in the genome sequence (5armF:CCCTGGGGAGGTAATGGGTA(SEQ ID NO:13); 5armR:GCTGGTGCTGTTCAGGGTAT(SEQ ID NO:14); 3armF:GGATGAGGGGGAAGAGAGGT(SEQ ID NO:15); 3armR:CCTCACCCACCCCTTACCTA(SEQ ID NO:16)), and then PCR amplification was performed to obtain 5'arm and 3'arm, respectively.

[0107] Based on the principle that the inserted fragment cannot contain the subsequent restriction site sequence, the vectors containing PGK+Puro and PGK+Hygro, namely Donor-Puro and Donor-Hygro, were used as the original vectors. A two-step method was used to replace the 3'arm and 5'arm of the original vectors with homologous recombination.

[0108] Primers were designed to specifically amplify the 3' arm and 5' arm fragments (5armHR-F: AAAACGACGGCCAGTGAATTCCCCTGGGGAGGTAATGGGTA (SEQ ID NO: 17); 5armHR-R: CGAGTTATGATATCCTCGAGTCATTACTAGCTGGTGCTGTTCAGGGTAT (SEQ ID NO: 18); 3armHR-F: GCTATTACGAAGTTATGTCGACGGATGAGGGGGAAGAGAGAGGT (SEQ ID NO: 19); 3armHR-R: GATTACGCCAAGCTTGGATCCCCTCACCCACCCCTTACCTA (SEQ ID NO: 20)) using the HN4 (human embryonic stem cell) genome as a template. The PCR reaction system (using Phanta Max Super-Fidelity DNA Polymerase) and conditions are as follows:

[0109] Table 4. PCR reaction system

[0110]

[0111] Table 5. PCR reaction conditions

[0112]

[0113] Donor-Puro and Donor-Hygro were digested with Sal1 and BamH1 enzymes, and the target fragment was recovered and homologously recombinated with the 3' arm to obtain recombinant plasmids Donor-KMT2D-3'arm-Puro and Donor-KMT2D-3'arm-Hygro. The plasmids obtained in the previous step were then modified using the same method, replacing their 5' arm. Finally, two recombinant plasmids, Donor-KMT2D-KO-Puro (SEQ ID NO:21) and Donor-KMT2D-KO-Hygro (SEQ ID NO:22), containing homologous arms at both ends of the hKMT2D SET Domain and different antibiotic resistances, were obtained.

[0114] Example 4: Obtaining KMT2D knockout HN4 embryonic stem cells

[0115] When the HN4 cells (CAS Stem Cell Bank No. SCSP-303) in the 6-well plate reached a confluence of 70%-80%, electroporation was performed according to the Lonza electroporation kit instructions (Amaxa™ human stem cell nucleoside). TMKit2 (Lonsa, VPH-5022, electroporation program B-016), plasmid ratios for electroporation were pX330-sgRNA1:pX330-sgRNA2:Donor-KMT2D-KO-Puro:Donor-KMT2D-KO-Hygro: 3ug:3ug:2ug:2ug. 48 hours after electroporation, 1ug / mL Puro and 200ug / mL Hygro were added for three consecutive days of selection. After reaching a suitable cell density, single cells were digested and cultured in two wells of 12-well plates at densities of 3000, 3500, and 4000 cells per well. The cells were cultured in mTeSR (STEMCELL) + Y27632 medium. Once single cells aggregated to form clones, the Y27632 medium was removed, and single clones were transferred to 48-well plates for further culture. After the clones reached confluence, the cells were scraped off, a portion was passaged, and the remaining cells were genotyped. Sequence alignment revealed the correct sequences following the PGK promoter as Puro and Hygro (SEQ ID NO:23 and SEQ ID NO:24, respectively). The Query nucleic acid sequence #2089 (the stained portion of SEQ ID NO:23) and Query nucleic acid sequence #2082 (the stained portion of SEQ ID NO:24) represent the start sequences of the two genes. Figure 5A and Figure 5B The study confirmed that homologous recombination, which met the experimental objectives, had occurred, and double knockout of alleles was achieved, resulting in the hKMT2D- / - cell line.

[0116] Human ES cell culture method: Matrigel (BD Biosciences) plate, mTeSR medium (STEMCELL).

[0117] SEQ ID NO:23

[0118] TACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACATCCCCCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAGGCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCCGGGCCTTTCGACCTGCAGCCCAAGCTAGCTTACCATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCC

[0119] SEQ ID NO:24

[0120] TACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACATCCCCCGGTAGGCGCCAACCGGCTCCCGTTCTTTGGTGGC CCCTTCGCGCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGC CTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAGGCCCGGCATTCTGCACGCTT CAAAAGCGCACGTCTGCCGCGCTGTTCCTCTTCCTCATCTCCGGGCCTTTCGACCTGCAGCCCAAGCTAGCATGAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGTTCGACAGCGTCTCCGACCTGAT

[0121] Example 5: Construction and Detection of Brain Organoid Models

[0122] A schematic diagram of brain-like organoid culture strategies is shown below. Figure 6 As shown.

[0123] HN4 cells and hKMT2D- / - cells obtained in Example 4 were cultured on a CF-1 feeder for 4 passages. When the cells reached 70-80% confluence, they were washed once with DPBS and digested with 1 mg / mL Dispase until the clones curled up, with only the middle adhering to the wall. The clones were then gently tapped to detach. The Dispase solution was discarded, and the cells were resuspended in KSR medium containing 4 ng / mL bFGF (20% KSR [Gibco], 1% NEAA [Sigma], 1% GlutaMax [Invitrogen], 0.1 mM β-Me [Sigma], 4 ng / mL bFGF [Peprotech]). After settling for 1 min, the supernatant was discarded, and the process was repeated once. 1 mL of 0.05% trypsin / EDTA was added, and the cells were digested at 37°C for 2 min. 1 mL of trypsin inhibitor was added, and the cells were centrifuged at 270 g for 5 min. Discard the supernatant and resuspend the cells in KSR medium containing 4 ng / mL bFGF and 50 μM Y27632. Count the cells and seed them into 9000 cells per well in a low-absorption 96-well plate. Change the medium every other day until D6, replacing it with KSR medium without bFGF and Y27632 after D4. On D6, use a 1 mL pipette tip (with the tip cut off) to transfer the cells into a low-absorption 24-well plate and culture in neuroepithelial induction medium (DMEM-F 12 [Gibco], 1% N2 [Gibco], 1% NEAA [Sigma], 1% GlutaMax [Invitrogen], 1 μg / mL heparin [Sigma]) until the outer surface of the embryoid sphere becomes translucent, forming neuroectodermal tissue.Dissolve Matrigel [BD Biosciences] on ice 1-2 hours in advance. Once completely dissolved, use a 200µL pipette tip (with the tip cut off) to transfer the neural ectoderm tissue onto a pre-pressed sealing film. Discard excess culture medium, add 30µL Matrigel, and incubate at 37°C for 20 minutes. Then, use neural differentiation medium I (DMEM-F12 [Gibco], 50% Neurobasal [Gibco], 2.5% Insulin [Sigma], 0.5% N2 [Gibco], 1% B27 [without Vitamin C]) Gently blow off the neuroectodermal tissue using a medium containing 0.5% NEAA (Sigma), 1% GlutaMax (Invitrogen), and 1% Penicilin-streptomycin (Sigma). Transfer the tissue to a 6cm culture dish and change the medium every other day. After 4 days of culture to form neuroepithelial buds, transfer the tissue to a shaking incubator for further culture. Change the medium to neural differentiation medium II (DMEM-F12 (Gibco), 50% Neurobasal (Gibco), 2.5% Insulin, 0.5% N2 (with Vitamin A, Gibco), 1% B27 (Gibco), 0.5% NEAA (Sigma), 1% GlutaMax (Invitrogen), and 1% Penicilin-streptomycin (Sigma)). Change the medium every 2-3 days.

[0124] Frozen sections and immunofluorescence analysis of brain-like organoids cultured to day 35 revealed the formation of multiple neural tube structures with high specific expression of SOX2, TUJ1, PAX6, and FOXG1 within them. Figure 7 Furthermore, during this process, immunofluorescence and qPCR revealed that GABAergic neurons were overexpressed in KMT2D knockout brain-like organoids. Figure 8 ).

[0125] Example 6: Intervention of Small Molecules on Brain-like Organoid Models

[0126] Following the method in Example 5, the hKMT2D- / - cell line obtained in Example 4 was induced to differentiate into an hKMT2D- / - brain organoid model. 1 μM chir99021 [Chembest] was added to the hKMT2D- / - brain organoids during days 10-14 of culture, and the culture continued until day 21. Subsequently, qPCR was performed to detect GABAergic neuron markers (normalized using Actin). It was found that the expression of GABAergic neurons in the hKMT2D- / - model was restored after chir99021 treatment. Figure 9A ,9B).

[0127] in Figure 9A and Figure 9B In the diagram, C0 represents a chir99021 concentration of 0, and C1 represents a chir99021 concentration of 1 μM. KMT2D- / -#15 and #19 represent two cell lines with KMT2D knockout.

[0128] HN4: refers to the brain organoid group (wild type) of hKMT2D that has not been knocked out.

[0129] KMT2D- / -15 and KMT2D- / -19 refer to two brain-like organoids obtained from CRISPR / CAS9 replication experiments.

[0130] Table 6. qPCR Primers

[0131]

[0132]

[0133] Table 7. qPCR system and conditions (10uL system)

[0134] SYBR 5ul H2O 1.7ul (RNAase-free water) cDNA 2.5ul (dilute 30-fold after reverse transcription) PF+PR 0.8ul (2.5uM)

[0135] Table 8. qPCR conditions

[0136] sequence list <110> Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences <120> A method for preparing a brain organoid model of Kabuki syndrome and its application <160> twenty four <170> SIPOSequenceListing 1.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Synthesize sgRNA1 sequences that recognize target sites <400> 1 caccgatgga agaacaacgt gtacc 25 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Synthesize sgRNA2 sequences that recognize target sites <400> 2 caccgtaaga agctttgagg ctacc 25 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> upstream single-stranded primer sequence for synthesizing sgRNA1 <400> 3 caccgatgga agaacaacgt gtacc 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Downstream single-stranded primer sequence for synthesizing sgRNA1 <400> 4 aaacggtaca cgttgttctt ccatc 25 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> upstream single-stranded primer sequence for synthesizing sgRNA2 <400> 5 caccgtaaga agctttgagg ctacc 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Downstream single-stranded primer sequence for synthesizing sgRNA2 <400> 6 aaacggtagcctcaaagcttcttac 25 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primers PF1 designed flanking the genome cleavage site <400> 7 gcttgcggaa aacttcccag 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primers PR1 designed flanking the genome cleavage site <400> 8 gctttcctcc tgctctcctg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primers PF2 designed flanking the genome cleavage site <400> 9 cctgccaggt gagagatgac 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PCR primers PR2 designed flanking the genome cleavage site <400> 10 ggcccatatc cccctcaaac 20 <210> 11 <211> 1499 <212> DNA <213> Natural sequence <220> <223> KMT2D‐5'arm <400> 11 ccctggggag gtaatgggta aactggtgaa attttatgaa atatataagg gacttggtca 60 cctctttctt cctctgtttt acttctgggg gagggcctgt gattctccca aacctcagat 120 accccatggg tgctagggtc accttccctt ccccatgagt gttggtgtca aaaataaata 180 gttagagata tatagaaaa ataataaaac cttacatttg tatagcactt tatacttttt 240 ttttcaaagc gttttcacat ccattatctc atttgatcct cacaacaacc ttatgaggta 300 ggtagggcag gtggtatgac ccccatttta cagctgagaa aactgagacc cagaaagatt 360 aaatgactag gcaaaggtca cacagctggg accagaccct tacttcttca ctgcaggtcc 420 ttgttctttc tgtgtaccag ggaccttagt ccctgggtag agggaggcag aatctgtggt 480 agcagggctt tctcgaaggt ctttggtggc tcctaggctg ttgtagaatg tcagagactc 540 tccatcccta gccagccttg tccttgatgc cctgcaatgg tggttttcaa actgtgagtg 600 cctgtgttcc aaaaagtcct ggatcactta aactgatggg ttgaactttt ccttcccatg 660 catatctctt ccttccccaa attggattaa accagaagag ctccattgtc atctagttta 720 tgtattggag ttccagtcaa cattttgtta aagaaaaaag caaagatttc tgctaaataa 780 aaaaagaacc agaaacgttt gaaaaccact gctctgggat ggcaagaatt tggctggtgc 840 cctaaggtgg taaaaggcat cctgccaggc agccgtcatt cccctgcact gagccatctg 900 cacagagccc aatgttatgt cagagaaggg gacagtccga agaaaggata ccacctttag 960 gctgtgagtt cacagccagt tttaattcaa atctagccca gcgtggtagg cacagtcccc 1020 attttcaggg cttccagtat gtgcaggagg taggattcag acattcaagc aaaccatcag 1080 cttaaattct aggcctgggc tgcttgcgga aaacttccca gaggagcatg gccttgagaa 1140 tggtttggca ggagagtggt aggaagtggg agatgggaga acaggctcag tgtaggggaa 1200 ttggtgcccc ccatctccct ccacacccca cccctcaccc tgggctctct gtgccaccca 1260 gggtgtcaga agggtccctg tagctagttg cttcctcacc agagctgaga cccagttgcc 1320 tctactcctt tcccaaggct gcacttccag tgcttgccag cagcacacgc ccctaactgg 1380 tgtgttgcac atcccaggag gtggcagagg aggtgggtgg tatgtacttg gtctgaggga 1440 gagctgtctt gtcatggatt atatcacctc ccaggcccca taccctgaac agcaccagc 1499 <210> 12 <211> 1657 <212> DNA <213> Natural sequence <220> <223> hKMT2D‑3'arm <400> 12 ggatgagggg gaagagaggt agcagccaga gccaggaccc agggttgggg ctgccggctg 60 acccggagcc cctggagcag gaggctgggg cagagggccc taggccaagc ccaccctggg 120 caccagggac aatcctcttc cccaccaccg gccctcaggc tggcatctct gcccccagct 180 ccaggagggg ccagacagaa gcagccattg ggcatctcag gtttgagggg gatatgggcc 240 gggaactacc cagaagcatc tgggaggcag cagggtgggg gaagaggatg tgtggccggg 300 cctcacagcc ctgctgctcc cactgacctc tccggcccaa ctcacggctg caaagagact 360 tgactaagct tgacaatccc aaaggccggg tcccacacct ggccctgcct gccgggtcct 420 gccccccaccc tcacccccat ccccctccct cttgatctgt ctctgtttcc ctcttttcct 480 ctgtgtttct gtctctctat gggttgtgtt tccttgtttt ccactctgac aaatgcaaca 540 tgaacgggaa agaggcgccc agctgcctag gagggcaagc tgggcaagcc gggcaaggag 600 accccgcacc cacacctacc tcatttaagt gttggatttt ttgctgtttt gaaatgtgag 660 accctctcca agccccctac tgcccccaacc ctctccccca cctcactgcc ctcttctgag 720 tgggtggaag gggggtagga ggaggaagaa aaacaacaac aaaaaatcca tctttgtttt 780 taattatggg catgggatgg tggttgaggc aaatgatgat gaagattggg gatgactggc 840 ccctagttgc tctaggactt ccttctccat ctggacatgg gggcaggagg gagctaaacc 900 taggaccagg atatctccct cctgttttcc caacctcatc atgagcctgt ttgccctcca 960 gcccctggac gggttgggtg gggggtaggg tgaggggctat ccctgagtgg catgcccata 1020 cctagtgagg cagggtgtgg cccggagctc ccactttccc tcagtcacca aactgctgct 1080 ggtctggtgg gaaggggtgg tgatgtgggg gtgggggagc ttagtgtcag cgcggggagg 1140 gtggggggta tttatctatt tatacatggg attgtacata gtcttgtggg gcatggggga 1200 gccggctgga ggtgagaacc ctcccctctc cccccacccc ccggggagag caaatgtaaa 1260 actactaatt tttgtgcttt atatattcta tataaatata tctattttct ttttacaaaa 1320 ccagtttata aatggtaggg gggtgtgggg cggacacatg gagctcccct tgtggggggg 1380 ccccctccat tacccgacct accgcccttt tcctcacccc ccaccccact ccccaccccc 1440 tggctgtgac tgctgtaaga tgggggtata gaggctgggc aattcccacc ccctgttgta 1500 tagttggact atgttataac gcacaaaaga gagctgaccc cagggggagc cagagggtga 1560 tgggttcctt gcctcccttt ccttcccctt tctgcccaag cttgtgctgc agttgaacct 1620 cttcctgggg gtgggagtag gtaaggggtg ggtgagg 1657 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5armF <400> 13 ccctggggag gtaatgggta 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5armR <400> 14 gctggtgctg ttcagggtat 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3armF <400> 15 ggatgagggg gaagagaggt 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3armR <400> 16 cctcacccac cccttaccta 20 <210> 17 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> 5armHR-F <400> 17 aaaacgacgg ccagtgaatt cccctgggga ggtaatgggt a 41 <210> 18 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> 5armHR-R <400> 18 cgaagttatg atatcctcga gtcattacta gctggtgctg ttcagggtat <210> 19 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> 3armHR‐F <400> 19 gctatacgaa gttatgtcga cggatgaggg ggaagagagg t <210> 20 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> 3armHR‐R <400> 20 gattacgcca agcttggatc ccctcaccca ccccttacct a <210> 21 <211> 1124 <212> DNA <213> Artificial Sequence <220> <223> PGK‑Puro                         <400> 21 gggtagggga ggcgcttttc ccaaggcagt ctggagcatg cgctttagca gccccgctgg gcacttggcg ctacacaagt ggcctctggc ctcgcacaca ttccacatcc cccggtaggc 120 gccaaccggc tccgttcttt ggtggcccct tcgcgccacc ttctactcct cccctagtca 180 ggaagttccc ccccgccccg cagctcgcgt cgtgcaggac gtgacaaatg gaagtagcac 240 gtctcactag tctcgtgcag atggacagca ccgctgagca atggaagcgg gtaggccttt 300 ggggcagcgg ccaatagcag ctttgctcct tcgctttctg ggctcagagg ctgggaaggg 360 gtgggtccgg gggcgggctc aggggcgggc tcaggggcgg ggcgggcgcc cgaaggtcct 420 ccggaggccc ggcattctgc acgcttcaaa agcgcacgtc tgccgcgctg ttctcctctt 480 cctcatctcc gggcctttcg acctgcagcc caagctagct taccatgacc gagtacaagc 540 ccacggtgcg cctcgccacc cgcgacgacg tccccagggc cgtacgcacc ctcgccgccg 600 cgttcgccga ctaccccgcc acgcgccaca ccgtcgatcc ggaccgccac atcgagcggg 660 tcaccgagct gcaagaactc ttcctcacgc gcgtcgggct cgacatcggc aaggtgtggg 720 tcgcggacga cggcgccgcg gtggcggtct ggaccacgcc ggagagcgtc gaagcggggg 780 cggtgttcgc cgagatcggc ccgcgcatgg ccgagttgag cggttcccgg ctggccgcgc 840 agcaacagat ggaaggcctc ctggcgccgc accggcccaa ggagcccgcg tggttcctgg 900 ccaccgtcgg cgtctcgccc gaccaccagg gcaagggtct gggcagcgcc gtcgtgctcc 960 ccggagtgga ggcggccgag cgcgccgggg tgcccgcctt cctggagacc tccgcgcccc 1020 gcaacctccc cttctacgag cggctcggct tcaccgtcac cgccgacgtc gaggtgcccg 1080 aaggaccgcg cacctggtgc atgacccgca agcccggtgc ctga 1124 <210> 22 <211> 1545 <212> DNA <213> Artificial Sequence <220> <223> Targeting vector of PGK-Hygro <400> 22 gggtagggga ggcgcttttc ccaaggcagt ctggagcatg cgctttagca gccccgctgg 60 gcacttggcg ctacacaagt ggcctctggc ctcgcacaca ttccacatcc cccggtaggc 120 gccaaccggc tccgttcttt ggtggcccct tcgcgccacc ttctactcct cccctagtca 180 ggaagttccc ccccgccccg cagctcgcgt cgtgcaggac gtgacaaatg gaagtagcac​​​​​gtgggtccgg gggcgggctc aggggcgggc tcaggggcgg ggcgggcgcc cgaaggtcct 420 ccggaggccc ggcattctgc acgcttcaaa agcgcacgtc tgccgcgctg ttctcctctt 480 cctcatctcc gggcctttcg acctgcagcc caagctagca tgaaaaagcc tgaactcacc 540 gcgacgtctg tcgagaagtt tctgatcgaa aagttcgaca gcgtctccga cctgatgcag 600 ctctcggagg gcgaagaatc tcgtgctttc agcttcgatg taggaggcg tggatatgtc 660 ctgcgggtaa atagctgcgc cgatggtttc tacaaagatc gttatgttta tcggcacttt 720 gcatcggccg cgctcccgat tccggaagtg cttgacattg gggagttcag cgagagcctg 780 acctattgca tctcccgccg tgcacagggt gtcacgttgc aagacctgcc tgaaaccgaa 840 ctgcccgctg ttctgcagcc ggtcgcggag gccatggatg cgatcgctgc ggccgatctt 900 agccagacga gcgggttcgg cccattcgga ccgcaaggaa tcggtcaata cactacatgg 960 cgtgatttca tatgcgcgat tgctgatccc catgtgtatc actggcaaac tgtgatggac 1020 gacaccgtca gtgcgtccgt cgcgcaggct ctcgatgagc tgatgctttg ggccgaggac 1080 tgccccgaag tccggcacct cgtgcacgcg gatttcggct ccaacaatgt cctgacggac 1140 aatggccgca taacagcggt cattgactgg agcgaggcga tgttcgggga ttcccaatac 1200 gaggtcgcca acatcttctt ctggaggccg tggttggctt gtatggagca gcagacgcgc 1260 tacttcgagc ggaggcatcc ggagcttgca ggatcgccgc ggctccgggc gtatatgctc 1320 cgcattggtc ttgaccaact ctatcagagc ttggttgacg gcaatttcga tgatgcagct 1380 tgggcgcagg gtcgatgcga cgcaatcgtc cgatccggag ccgggactgt cgggcgtaca 1440 caaatcgccc gcagaagcgc ggccgtctgg accgatggct gtgtagaagt actcgccgat 1500 agtggaaacc gacgccccag cactcgtccg agggcaaagg aatag 1545 <210> 23 <211> 600 <212> DNA <213> Artificial Sequence <220> <223> PGK-Puro Identification Sequencing Results <400> 23 taccgggtag gggaggcgct tttcccaagg cagtctggag catgcgcttt agcagccccg 60 ctgggcactt ggcgctacac aagtggcctc tggcctcgca cacattccac atcccccggt 120 aggcgccaac cggctccgtt ctttggtggc cccttcgcgc caccttctac tcctccccta 180 gtcaggaagt tcccccccgc cccgcagctc gcgtcgtgca ggacgtgaca aatggaagta 240 gcacgtctca ctagtctcgt gcagatggac agcaccgctg agcaatggaa gcgggtaggc 300 ctttggggca gcggccaata gcagctttgc tccttcgctt tctgggctca gaggctggga 360 aggggtgggt ccgggggcgg gctcaggggc gggctcaggg gcggggcggg cgcccgaagg 420 tcctccggag gcccggcatt ctgcacgctt caaaagcgca cgtctgccgc gctgttctcc 480 tcttcctcat ctccgggcct ttcgacctgc agcccaagct agcttaccat gaccgagtac 540 aagcccacgg tgcgcctcgc cacccgcgac gacgtcccca gggccgtacg caccctcgcc 600 <210> 24 <211> 600​​​​​​​​​​​​​​​aggcgccaac cggctccgtt ctttggtggc cccttcgcgc caccttctac tcctccccta 180 gtcaggaagt tcccccccgc cccgcagctc gcgtcgtgca ggacgtgaca aatggaagta 240 gcacgtctca ctagtctcgt gcagatggac agcaccgctg agcaatggaa gcgggtaggc 300 ctttggggca gcggccaata gcagctttgc tccttcgctt tctgggctca gaggctggga 360 aggggtgggt ccgggggcgg gctcaggggc gggctcaggg gcggggcggg cgcccgaagg 420 tcctccggag gcccggcatt ctgcacgctt caaaagcgca cgtctgccgc gctgttctcc 480 tcttcctcat ctccgggcct ttcgacctgc agcccaagct agcatgaaaa agcctgaact 540 caccgcgacg tctgtcgaga agtttctgat cgaaaagttc gacagcgtct ccgacctgat 600

Claims

1. The application of GSK-3 inhibitors in the preparation of drugs for treating Kabuki syndrome, characterized in that, The GSK-3 inhibitor is selected from Chir99021.

2. The application as described in claim 1, characterized in that, The structural formula of Chir99021 is shown in Formula 1:

3. The application as described in claim 1, characterized in that, The Kabuki syndrome mentioned is Kabuki syndrome caused by the KMT2D mutation.

4. The application as described in any one of claims 1-3, characterized in that, The Kabuki syndrome mentioned is Kabuki syndrome with KMT2D deficiency.

5. The application as described in any one of claims 1-3, characterized in that, The drug contains an effective amount of GSK-3 inhibitor.

6. The application as described in any one of claims 1-3, characterized in that, The drug also includes pharmaceutically acceptable pharmaceutical carriers.

7. The application as described in claim 6, characterized in that, The pharmaceutical carrier includes excipients.

8. The application as described in claim 6, characterized in that, The pharmaceutical carrier includes one or more of the following: diluent, filler, binder, disintegrant, surfactant, and lubricant.

9. The application as described in any one of claims 1-3, characterized in that, The drug restores GABAergic neurons in patients with Kabuki syndrome.

Images