Application of prdm15 gene in preparing environmentally sensitive mutant fish

Abstract

The present invention belongs to the field of molecular biology, and specifically relates to the application of the prdm15 gene in preparing environmentally sensitive mutant fish. The present invention uses CRISPR / Cas9 technology to knock out prdm15 Genetically constructed prdm15 Homozygous mutant zebrafish was discovered through genetic screening of aquatic germplasm resources at the genomic level. After gene knockout using CRISPR / Cas9 technology, it was found that under normal breeding conditions, prdm15 The gene can slightly reduce the survival rate of zebrafish; under low oxygen stress, prdm15 ‑ / ‑ The mortality rate of zebrafish increased significantly; at the same time, under the stress environment of pathogenic Aeromonas hydrophila, prdm15 ‑ / ‑ The mortality rate of zebrafish also increased significantly. The gene-edited fish prepared using the method of the present invention can be used in multiple directions such as fishery environmental assessment.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and particularly relates to application of a prdm15 gene in preparing an environmentally sensitive mutant fish. Background Art

[0002] There are many environmental stress factors in aquaculture, including stocking density, malnutrition, hunger, transportation, temperature, dissolved oxygen, and breeding environment. These biological and non-biological factors will break the balance of the organism and cause stress in the body. There are a large number of microorganisms in the living environment of fish. Studies have estimated the number of microorganisms in seawater through acridine orange direct counting method and electron microscope direct counting method, and found that the number of bacteria in seawater is about 10 5 -10 6 / mL (Azamet al 1983, Sogin et al 2006), the number of viruses is about 3×10 6 -10 8 / mL (Wilhelm and Suttle 1999, Suttle 2005), and with the increase of primary productivity, the number of microbial groups also increases. In the process of aquaculture production, the occurrence of fish diseases is closely related to the infection of pathogenic bacteria in the environment. Bacterial diseases are the most serious diseases that harm fish. There are many types of pathogens, a wide range of epidemic areas, and many types of aquaculture waters. Among them, Aeromonas hydrophila is the most common pathogen. The sepsis caused by it can cause large-scale deaths of fish. Oxygen is essential for the survival of fish. Even a short period of hypoxia can cause huge economic losses to aquaculture. The dissolved oxygen in water is affected by the partial pressure of oxygen in the air, water temperature, the contact area between the liquid surface and oxygen in the air, diurnal changes, oxygen-consuming sediments, water flow velocity, salinity, water depth, exchange of surface and bottom water, vertical distribution of water bodies, photosynthesis rate of aquatic plants and algae, and respiration intensity of aquatic organisms (Lushchak and Bagnyukova 2006, Nikinmaa and Rees 2005, Rimoldi et al 2012). Under the same partial pressure, the dissolved oxygen content in water is only 1 / 30 of that in air, and the diffusion rate of oxygen in water is only 1 / 10000 of that in air. The oxidation of sediments in water and the respiration of organic matter will also consume the dissolved oxygen in water. When a large amount of industrial wastewater and domestic sewage enter the water, it will cause serious deoxygenation of the water. Therefore, aquatic aerobic organisms, especially freshwater fish, are more susceptible to hypoxia stress (Dejours et al 1975, Nikinmaa et al 2001).

[0003] Fish began to be used in biological monitoring and early warning systems in 1929. Belding monitored the water environment based on the changes in fish respiration. Later, the swimming behavior, positive rheotaxis, and selection behavior of fish were successively applied in water environment monitoring. Japan's Zhengxing Company is also researching and developing a water quality monitoring system based on video image understanding using fish as test organisms. In addition, the European International Commission for the Exploration of the Sea (ICES) has used biomarkers as important indicators of heavy metal pollution in marine ecological health assessment. European scholars such as France and the United Kingdom proposed to use the synchronous response of multiple biomarkers (multi-biomarkers) to jointly indicate the level of marine pollution, and established a variety of comprehensive indexes for diagnosing marine pollution characteristics based on comprehensive statistical marker response information. The research and system construction of environmental biological monitoring in my country started late. It was only in the 1980s that biological monitoring technology was gradually introduced, and the monitoring system needs to be further strengthened and improved. However, biological monitoring of fishery environment has not yet been carried out due to the backwardness of related technology research and development.

[0004] PRDM15 is a member of the PRDM family. Several limited research reports in recent years have shown that the gene PRDM15 maintains the pluripotency of embryonic stem cells by regulating WNT and MAPK signals (Mzoughi et al., 2017); regulates forebrain development by regulating NOTCH and WNT / PCP signals (Mzoughi et al., 2020a); has 2% mutations in blood cancers, especially diffuse large B-cell lymphoma (Sorrentino et al., 2018), and maintains B-cell lymphoma by regulating metabolism (Mzoughi et al., 2020b); at the same time, it is one of the risk factors for chronic obstructive pulmonary disease (Hosgood III et al., 2020). At present, there is no report on the function of the prdm15 gene in fish. Summary of the invention

[0005] The purpose of the present invention is to provide an application of the prdm15 gene in preparing an environmentally sensitive mutant fish. The present invention constructs and screens a homozygous zebrafish strain with a prdm15 gene deletion through CRISPR / Cas9 technology, and the zebrafish strain is very sensitive to bacterial stress and hypoxia stress.

[0006] In order to achieve the above object, the present invention has taken the following measures:

[0007] The application of the prdm15 gene in preparing environmentally sensitive mutant fish includes: obtaining heterozygous zebrafish with prdm15 (gene ID: 566512) gene knockout by CRISPR / Cas9 technology, and screening and breeding the offspring to obtain heritable, homozygous prdm15 gene-deficient zebrafish (prdm15 - / - ).

[0008] For the prdm15 gene-deficient zebrafish described above, preferably, when using CRISPR / Cas9, the prdm15 target sequence is: GGGGCCTGTCGTCACAGTGA, and the homozygous prdm15 gene-deficient zebrafish finally obtained contains the sequence shown in SEQ ID NO.1.

[0009] The transgenic fish prepared by the method of the present invention can be used to prepare an environmentally sensitive fish model.

[0010] In the above applications, the environment is pathogenic bacteria stress and hypoxia stress.

[0011] Compared with the prior art, the present invention has the following advantages:

[0012] The prdm15 homozygous mutant zebrafish constructed by knocking out the prdm15 gene using CRISPR / Cas9 technology is a genetic screening of aquatic germplasm resources at the genomic level. After gene knockout using CRISPR / Cas9 technology, it was found that under normal breeding conditions, knocking out the prdm15 gene can slightly reduce the survival rate of zebrafish; under a hypoxic stress environment, prdm15 - / - The mortality rate of zebrafish increased significantly; at the same time, under the stress of pathogenic Aeromonas hydrophila, prdm15 - / - The mortality rate of zebrafish also increased significantly. The gene-edited fish prepared using the method of the present invention can be used in multiple directions such as fishery environmental assessment. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is a schematic diagram of the prdm15 gene mutation target sites.

[0014] Figure 2 Different concentrations of Aeromonas hydrophila were used to infect control (wild type) and prdm15 - / - Schematic diagram of the mortality rate of zebrafish larvae;

[0015] The AD is 10 9 CFU / mL, 10 8 CFU / mL, 10 7 CFU / mL, 10 6 CFU / mL concentration of Aeromonas hydrophila.

[0016] Figure 3 2% hypoxia stress control (wild type) and prdm15 - / - Schematic diagram of the survival rate of zebrafish larvae;

[0017] AC: wild type and prdm15 at 24 hpf, 48 hpf, and 72 hpf under 2% hypoxia and 21% normoxia, respectively. - / - Survival statistics of embryonic and larval fish. DETAILED DESCRIPTION

[0018] The technical solutions of the present invention are conventional methods in the art unless otherwise specified; the reagents or materials used are from commercial sources unless otherwise specified. The application method of the present invention is applicable not only to zebrafish, but also to other freshwater fish.

[0019] Embodiment 1:

[0020] The homozygous zebrafish strain lacking the prdm15 gene (prdm15 - / - Obtaining mutant zebrafish transgenic fish lines:

[0021] 1.1 Experimental Materials

[0022] Wild-type zebrafish (Danio rerio) and mutants were raised in the fish room of the College of Fisheries of Huazhong Agricultural University. The culture conditions were: water temperature of 28.5±0.5℃, light and dark time of 14h and 10h respectively, and Artemia was fed twice a day.

[0023] 1.2 Experimental methods Construction of prdm15 using CRISPR / Cas9 gene editing technology - / - Mutants

[0024] 1.2.1 Selection of gRNA targets

[0025] First, we searched the complete sequence of the prdm15 (daniorerio) gene (gene ID: 566512) through NCBI, and then created a separate CDS sequence file and submitted it to http: / / zifit.partners.org for target site prediction. After screening and comparison, we selected the prdm15 target sequence as: GGGGCCTGTCGTCACAGTGA. In this experiment, gRNA was designed on the second exon, and a pair of detection primers were designed upstream and downstream of the target gene, with an amplified fragment of 401 bp.

[0026] F:TTCCTACTATGGATGCTTATG

[0027] R:CTGGCCTTTGAAAACAGA

[0028] 1.2.2 In vitro synthesis of gRNA

[0029] gRNA was amplified by PCR using a conservative downstream primer (AAAAGCACCGACTCGGTGCC) and an upstream primer with the target site (GTAATACGACTCACTATAGGGGCCTGTCGTCACAGTGAGTTTTAGAGCTAGAAATAGC).

[0030] The amplification system is as follows:

[0031]

[0032] (1) Take 1 μL of PCR product for agarose gel electrophoresis and purify and recover it using a PCR clean kit;

[0033] (2) In vitro transcription was performed using the Thermo Transcript Aid T7 High Yield Transcription Kit. The transcription system was as follows:

[0034]

[0035] (3) Mix well and centrifuge, seal and incubate in a 37°C water bath for 2 h;

[0036] (4) Add 1 μL DNase and incubate at 37°C for 15 min to remove the DNA template;

[0037] (5) Add 1 μL EDTA, incubate at 60°C for 10 min to terminate the reaction;

[0038] (6) Add 30 μL DEPC water and 30 μL LiCl, mix well and precipitate at -80 °C for 4 h;

[0039] (7) Centrifugation at 14,000 g for 10 min at 4°C;

[0040] (8) Discard the supernatant, add 1 mL of 70% ethanol for washing, and centrifuge at 14,000 g for 10 min at 4°C;

[0041] (9) Repeat the previous step;

[0042] (10) After discarding the supernatant, dry it at room temperature, add 20 μL of RNase-free water to dissolve it, take 1 μL and measure the RNA concentration and quality using NanoDrop 2000 Nucleic Acid Quantification Instrument, dilute it to 80 ng / μL, and place it at -80°C for later use.

[0043] 1.2.3 Synthesis of Cas9 mRNA

[0044] (1) Cas 9 plasmid was kindly donated by Academician Gui Jianfang and Researcher Yin Zhan's laboratory at the Institute of Hydrobiology, Chinese Academy of Sciences. Preparation of Cas9 mRNA: Linearize Cas 9 plasmid by single restriction enzyme digestion with XbaI. Enzyme digestion reaction system:

[0045]

[0046]

[0047] (2) Take 1 μL of the digested product and perform agarose gel electrophoresis to confirm that the linearization is complete, then use a PCR purification kit to purify and recover the linearized product;

[0048] (3) Use Ambion's MAXIscript T7 Kit to transcribe Cas 9 mRNA in vitro. The transcription system is as follows:

[0049]

[0050] (4) Mix well and centrifuge, seal and incubate in a 37°C water bath for 2 h;

[0051] (5) Add 1 μL DNase and incubate at 37°C for 15 min to remove the DNA template;

[0052] (6) Add 1 μL EDTA, incubate at 60°C for 10 min to terminate the reaction;

[0053] (7) Add 30 μL DEPC water and 30 μL LiCl, mix well and precipitate at -80 °C for 4 h;

[0054] (8) 4°C, 14,000 rpm, 10 min;

[0055] (9) Discard the supernatant, add 1 mL of 70% ethanol, wash at 4°C, 14,000 rpm, 10 min;

[0056] (10) Repeat the previous step;

[0057] (11) After discarding the supernatant, dry it at room temperature, add 20 μL of RNase-free water to dissolve it, take 1 μL and measure the RNA concentration and quality using NanoDrop 2000 Nucleic Acid Quantification Instrument, dilute it to 500 ng / μL, and store it in aliquots at -80°C for later use.

[0058] 1.2.4 Microinjection

[0059] 500ng / μL Cas 9mRNA and 80ng / μL gRNA were mixed in equal volumes, and the experimental samples were injected into 1-cell stage zebrafish embryos using a Picoliter Microinjector (Warner, USA), while some embryos were kept as controls. After the injection, the zebrafish embryos were cultured with methylene blue culture medium and placed in a 28°C light-controlled incubator.

[0060] 1.2.5F0 target mutation efficiency detection and heritable screening

[0061] (1) Take 20 embryos from the injection group and the control group respectively, add 100 μL NaOH (50 mM) lysis solution using the alkaline lysis method, lyse at 95°C for 20 min, add 10 μL Tris-HCl (pH 8.0 50 mM) for equilibrium, and store at 4°C as a PCR template for later use;

[0062] (2) Detection is performed using conservative upstream and downstream primers for target amplification detection, and conventional PCR is performed using the above products as templates to amplify the sequence near the target.

[0063] F:TTCCTACTATGGATGCTTATG

[0064] R:CTGGCCTTTGAAAACAGA

[0065] PCR amplification system:

[0066]

[0067] (3) Take 5 μL of PCR product and perform 2% agarose gel electrophoresis. After detection, the heterozygous F0 with double bands near the PCR product is selected and cultured to adult fish. The mutation rate of 20 embryos is 40%.

[0068] 1.2.6 Screening of F1 heterozygous adult fish carrying target site mutations

[0069] F0 and normal wild type were used to breed F1 individuals, and F1 embryonic DNA was extracted as described above. PCR products were amplified using target detection primers, and 2% agarose gel electrophoresis was used to screen out mutant heterozygous F1. Target amplification sequencing primers (seq F: 5'TTCCTACTATGGATGCTTATG; seq R: 5'CTGGCCTTTGAAAACAGA) were used to amplify the sequence near the target site, and 5 μL of PCR product was taken for 2% agarose gel electrophoresis. The product with the correct size of the single band target fragment was sent to the company for sequencing (Qingke Biotechnology Co., Ltd., Wuhan). The sequence of each individual was analyzed and compared with the wild normal gene sequence to analyze the mutant target sequence.

[0070] 1.2.7 Screening of F2 adult fish carrying target site mutations

[0071] The obtained F1 individuals of the same mutation type were cultured to adult fish, and the heterozygous F1 was self-fertilized to produce the F2 generation with three genotypes: homozygous, heterozygous, and wild type. Genotyping was performed to determine the gene mutation sequence of the homozygous F2 generation, that is, the desired zebrafish homozygous gene deletion mutant model was obtained, and the homozygous prdm15 gene deletion zebrafish finally obtained contained the sequence shown in SEQ ID NO.1: GGGGCCTGTCGTCACAGGGACTCGTTTGTT, specifically as follows Figure 1 shown.

[0072] Example 2: Aeromonas hydrophila stress experiment

[0073] (1) Aeromonas hydrophila was inoculated into LB medium at 0.1% v / v and cultured in a 28°C incubator with a shaker at 220 rpm;

[0074] (2) After 8 hours of culture, the concentration of Aeromonas hydrophila has reached a relatively high level. At this time, the concentration of Aeromonas hydrophila is tested by spreading the plate. Dilute the Aeromonas hydrophila stock solution with sterile deionized water by 10 6 times, take 100 μL of the diluted bacterial solution and spread it on LB plates, three times in parallel, and culture it in a 28°C incubator. Count the number of single colonies the next day and take the average value to get the actual concentration of the bacterial solution;

[0075] (3) Dilute Aeromonas hydrophila with sterile deionized water, adjust the concentration of Aeromonas hydrophila, and prepare Aeromonas hydrophila bacterial solutions with different concentration gradients. In this experiment, we prepared Aeromonas hydrophila bacterial solutions with four different concentration gradients, with the concentrations being: 1×10 9 CFU / mL, 1×10 8 CFU / mL, 1×10 7 CFU / mL, 1×10 6 CFU / mL. Fertilized wild type and prdm15 - / - Zebrafish embryos, zebrafish fry homozygous mutants of the sequence shown in SEQ ID NO.1 prepared in Example 1 grown to 68 hpf were respectively stressed in bacterial solutions of Aeromonas hydrophila at different concentrations;

[0076] (4) Count the mortality of zebrafish fry every 12 h for 3 days (days post infection);

[0077] (5) Organize the mortality rate of zebrafish fry and draw a line graph.

[0078] The results showed that the mutant had a higher mortality rate than the wild type.9 CFU / mL( Figure 2 Middle A), 10 8 CFU / mL( Figure 2 B) and 10 7 CFU / mL( Figure 2 C) Under bacterial stress, the mortality rate of mutants was high and significantly different. 6 CFU / mL( Figure 2 Under the stress of medium (D), the mutant had more deaths than the wild type, but there was no significant difference. The possible reason is that low concentrations of Aeromonas hydrophila cannot cause strong stress to the larvae, and their own immunity enables them to adapt to the current environment.

[0079] The lethality rate of each repetition (%) = (number of deaths in each repetition / total number of each repetition (50)) * 100%

[0080] Average lethality rate of each group (%) = (lethality rate of repeat 1 + lethality rate of repeat 2 + lethality rate of repeat 3) / 3

[0081]

[0082] Example 3: Hypoxia stress experiment

[0083] 20 wild-type zebrafish embryos and 20 homozygous mutant embryos containing the sequence shown in SEQ ID NO.1 prepared in Example 1 at the same period were collected and placed in a 90mm culture dish, and 30mL of circulating water was added. Five replicates were performed for each test group. When the development reached a specific time, 5 groups of wild-type embryos and 5 groups of mutant embryos were placed in a hypoxic chamber with an oxygen concentration of 2%, and the remaining 5 groups of wild-type embryos and 5 groups of mutant embryos were also cultured under normal oxygen concentrations, and statistics were counted every two hours. According to this method, we obtained the following results: Figure 3 As shown in Figure A, in the hypoxic chamber 24hpf treatment group, the mutant had a higher mortality rate than the wild type, and at 18h, none of the mutants survived, while there was no significant difference in the embryos cultured in normoxic conditions. Next, we repeated the treatment to explore the extent of the effect of low concentrations of oxygen on the mutants. At the same time, we also performed hypoxia treatment when the embryos developed to 48hpf and 72hpf, and the results are as follows ( Figure 3 B and C): It can be concluded that under hypoxic treatment, the survival rate of the mutant is low; while under normoxic conditions, there is no significant difference.

[0084]

Claims

1. Knockout prdm15 The application of the gene in preparing an environmentally sensitive mutant fish, wherein the environment is pathogenic bacteria stress and / or hypoxia stress, the fish is zebrafish, and the prdm15 The gene ID of the gene is 566512, and the knockout is achieved by CRISPR / Cas9. prdm15 The target sequence is: GGGGCCTGTCGTCACAGTGA.

2. The mutant fish used in the application of claim 1 is used to prepare an environmentally sensitive fish model.

Images