Recombinant corynebacterium glutamicum with high yield of tetrahydropyrimidine and application thereof
By inserting repressor protein binding sequences and overexpressing related genes into Corynebacterium glutamicum, recombinant strains were constructed, solving the problems of equipment corrosion and environmental pollution in tetrahydropyrimidine production and realizing efficient and low-cost food-safe tetrahydropyrimidine production.
Patent Information
- Application Number
- CN202210973252.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-15
- Publication Date
- 2026-02-24
- Estimated Expiration
- 2042-08-15
AI Technical Summary
Existing technologies for the industrial production of tetrahydropyrimidine suffer from problems such as high-salt culture media corroding equipment, increased environmental pollution risks, and slowed bacterial growth. Furthermore, the use of non-food-safe strains leads to increased complexity and cost in the production process.
By inserting repressor protein BetI and LmrA binding sequences into Corynebacterium glutamicum and overexpressing the tetrahydropyrimidine synthesis gene cluster ectBAC, the aspartate kinase gene lysCS301Y, and the aspartate semialdehyde dehydrogenase gene asd, recombinant Corynebacterium glutamicum was constructed, and fermentation conditions were optimized to increase tetrahydropyrimidine yield.
High-yield tetrahydropyrimidine production was achieved in food-safe strains, with a yield of 45.5 g/L and a glucose yield of 0.25 g/g, simplifying the production process and reducing costs.
Smart Images

Figure CN115786219B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a recombinant Corynebacterium glutamicum that produces high levels of tetrahydropyrimidine and its applications, belonging to the field of bioengineering technology. Background Technology
[0002] Tetrahydropyrimidine (ectoine, 1,4,5,6-tetrahydro-2-methyl-4-pyrimidinecarboxylicacid) acts as a cell protectant and stabilizer, accumulating in large quantities within the cells of moderately halophilic or halophilic bacteria. This accumulation helps them resist the impact of high osmotic pressure, representing a coping strategy for halophilic or halophilic microorganisms to adapt to high or hypersalt environments. With a molecular weight of 142.16, tetrahydropyrimidine is highly hydrophilic and belongs to the zwitterionic small organic molecule category. Numerous studies have shown that tetrahydropyrimidine enhances hydration of lipid membranes by assisting in the osmotic pressure balance between intracellular and extracellular environments, thereby improving lipid membrane fluidization, maintaining protein and nucleic acid structures, and enhancing the cell's ability to withstand extreme environments. This helps resist the effects of various adverse factors such as freezing, high temperature, high salinity, high pressure, drought, and radiation. In recent years, tetrahydropyrimidine, as an important secondary metabolite of halophilic microorganisms, has been widely used by researchers at home and abroad in biomedical fields such as digestive diseases, dry eye syndrome, rhinitis, allergic rhinitis, organ transplantation and organ preservation, skin trauma and health care and beauty. Its development into products such as digestive drugs, eye drops, nasal sprays, respiratory penetrants, skin trauma drugs and new bio-cosmetics has become a hot topic in biopharmaceutical research and development.
[0003] The presence of chiral carbon atoms in the chemical structure of tetrahydropyrimidine makes its chemical synthesis challenging, and the industrial production process is energy-intensive, posing potential environmental pollution risks. Currently, industrial production of tetrahydropyrimidine often employs the "bacterial milking" method. This involves using halophilic bacteria such as *Haloxylon ammodendron* to rapidly synthesize tetrahydropyrimidine in a high-salt environment, followed by rapid release of intracellular tetrahydropyrimidine in a low-salt environment. Repeated cycles of high and low salt environments effectively accumulate tetrahydropyrimidine. While the "bacterial milking" method has been successfully applied to the industrial production of tetrahydropyrimidine, the high-salt culture medium used in the process not only corrodes equipment but also increases the difficulty of downstream processing of tetrahydropyrimidine, raising environmental pollution risks. Furthermore, repeated high- and low-salt shocks slow down bacterial growth, leading to reduced tetrahydropyrimidine yield. In recent years, with the rapid development of synthetic biology and gene editing technologies, heterologous synthesis of tetrahydropyrimidine by model strains has become a research hotspot.
[0004] While methods for synthesizing tetrahydropyrimidine using recombinant Escherichia coli under low-salt conditions have been developed, avoiding some drawbacks of using high-salt culture media, the resulting strains are not food-safe strains. Therefore, developing a method to increase the tetrahydropyrimidine yield of the food-safe Corynebacterium glutamicum strain could simplify the production process, improve synthesis efficiency, and reduce production costs, which has significant practical implications for the application of tetrahydropyrimidine. Summary of the Invention
[0005] This invention provides a recombinant Corynebacterium glutamicum, wherein the recombinant Corynebacterium glutamicum has a BetI repressor protein binding sequence inserted downstream of the promoter of the dihydropyridine dicarboxylic acid synthase gene dapA in the host genome, and an LmrA repressor protein binding sequence inserted downstream of the promoter of the citrate synthase gene gltA; simultaneously, it overexpresses the tetrahydropyrimidine synthesis gene cluster ectBAC from Pseudomonas schlegelii, the repressor protein gene lmrA coupled with the 5'UTR sequence of the repressor protein LmrA, and the feedback-relieved aspartate kinase gene lysC from Corynebacterium glutamicum. S301Y The aspartate semialdehyde dehydrogenase gene asd from E. coli and the repressor protein gene betI, which is coupled with the 5'UTR sequence of the repressor protein BetI.
[0006] In one embodiment of the present invention, the nucleotide sequence of the BetI binding sequence of the repressor protein is shown in SEQ ID NO. 1.
[0007] In one embodiment of the present invention, the nucleotide sequence of the repressor protein LmrA binding sequence is shown in SEQ ID NO.2.
[0008] In one embodiment of the present invention, the nucleotide sequence of the tetrahydropyrimidine synthesis gene cluster ectBAC derived from *Pseudomonas schrenckii* is shown in SEQ ID NO.3.
[0009] In one embodiment of the present invention, the nucleotide sequence of the repressor protein gene lmrA derived from Bacillus subtilis is shown in SEQ ID NO.4.
[0010] In one embodiment of the present invention, the nucleotide sequence of the Escherichia coli-derived repressor protein gene betI is shown in SEQ ID NO.5.
[0011] In one embodiment of the present invention, the aspartate kinase gene lysC from Corynebacterium glutamicum encoding a serine kinase at position 301 mutated to tyrosine is described. S301Y The nucleotide sequence is shown in SEQ ID NO.6.
[0012] In one embodiment of the present invention, the nucleotide sequence of the aspartate semialdehyde dehydrogenase gene asd from Escherichia coli is shown in SEQ ID NO.7.
[0013] In one embodiment of the present invention, the recombinant Corynebacterium glutamicum uses Corynebacterium glutamicum K02 as the host.
[0014] In one embodiment of the present invention, the recombinant Corynebacterium glutamicum is expressed using pXMJ19 plasmid and pEC-XK99E plasmid as expression vectors.
[0015] In one embodiment of the present invention, the pXMJ19 and pEC-XK99E plasmid expression vectors were both purchased from BioVector China Plasmid Vector Strains Cell Gene Preservation Center.
[0016] In one embodiment of the present invention, the nucleotide sequence of the 5'UTR sequence of the repressor protein BetI is shown in any one of SEQ ID NO. 8 to 14, and the nucleotide sequence of the 5'UTR sequence of the repressor protein gene lmrA is shown in any one of SEQ ID NO. 15 to 21.
[0017] In one embodiment of the present invention, the recombinant Corynebacterium glutamicum expresses the tetrahydropyrimidine synthesis gene cluster ectBAC and the repressor protein gene lmrA coupled with the 5'UTR sequence of the repressor protein LmrA using the pXMJ19 plasmid; simultaneously, it expresses the feedback-relieved aspartate kinase gene lysC derived from Corynebacterium glutamicum using the pEC-XK99E plasmid. S301Y The aspartate semialdehyde dehydrogenase gene asd from E. coli and the repressor protein gene betI, which is coupled with the 5'UTR sequence of the repressor protein BetI.
[0018] In one embodiment of the present invention, the nucleotide sequence of the 5'UTR sequence of the repressor protein BetI is shown in SEQ ID NO.12, and the nucleotide sequence of the 5'UTR sequence of the repressor protein gene lmrA is shown in SEQ ID NO.20.
[0019] The present invention also provides a method for constructing the above-mentioned recombinant Corynebacterium glutamicum, the method comprising the following steps:
[0020] (1) Using pK18mobsacB, a BetI repressor protein binding sequence was inserted into the promoter region of the dihydropyridine dicarboxylic acid synthase gene dapA in Corynebacterium glutamicum K02, and a LmrA repressor protein binding sequence was inserted into the promoter region of the citrate synthase gene gltA, resulting in the double mutant strain CGE01.
[0021] (2) The 5'UTR sequences of the tetrahydropyrimidine synthesis gene cluster ectBAC from *Pseudomonas stearothermica* and the repressor protein genes lmrA and LmrA from *Bacillus subtilis* were overexpressed using the pXMJ19 plasmid, respectively. The 5'UTR sequences of ectBAC and lmrA and LmrA were then synthesized using the SynUTR method. lmrA_variant1 ~SynUTR lmrA_variant7 Tandem expression was performed to prepare pXMJ19-ectBAC-SynUTR. lmrA_variant1 -lmrA~pXMJ19-ectBAC-SynUTR lmrA_variant7 -lmrA;
[0022] (3) The pEC-XK99E plasmid was used to overexpress the lysC gene, which is derived from Corynebacterium glutamicum and encodes an aspartate kinase with a serine mutated to tyrosine at position 301. S301Y The 5' UTR sequence (SynUTR) of the aspartate semialdehyde dehydrogenase gene (asd) and the repressor protein gene (betI) and the repressor protein (BetI) from *E. coli*. betI_variant1 ~SynUTR betI_variant7 They were then expressed in tandem to prepare pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant1 -betI~pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant7 -betI;
[0023] (4) The prepared recombinant plasmid pXMJ19-ectBAC-SynUTR lmrA_variant1 -lmrA~pXMJ19-ectBAC-SynUTR lmrA_variant7 Introduce any recombinant plasmid from -lmrA into CGE01, and simultaneously insert pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant1 -betI~pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant7 Recombinant Corynebacterium glutamicum was prepared by introducing any recombinant plasmid from -betI into CGE01.
[0024] The present invention also provides a method for producing tetrahydropyrimidine, wherein the method comprises preparing tetrahydropyrimidine by fermentation using the above-mentioned recombinant Corynebacterium glutamicum.
[0025] In one embodiment of the present invention, recombinant Corynebacterium glutamicum is inoculated into a seed culture medium to obtain a seed solution; the prepared seed solution is inoculated into a fermentation culture medium at an inoculation amount of 18-20% to prepare tetrahydropyrimidine by fermentation.
[0026] In one embodiment of the present invention, recombinant Corynebacterium glutamicum is inoculated into a seed culture medium to obtain a seed solution; the prepared seed solution is inoculated into a fermentation culture medium at an inoculation rate of 10% (v / v) to prepare tetrahydropyrimidine by fermentation.
[0027] In one embodiment of the present invention, recombinant Corynebacterium glutamicum is inoculated into a seed culture medium for cultivation under the following conditions: 28–32°C, and the initial pH of the seed culture medium is controlled to be 7.0–7.2.
[0028] In one embodiment of the present invention, recombinant Corynebacterium glutamicum is inoculated into a seed culture medium, and the culture conditions are: 30°C, 200 rpm, and the initial pH of the fermentation medium is controlled at 7.0.
[0029] In one embodiment of the present invention, the method is to prepare tetrahydropyrimidine by fermentation in a 5L fermenter. The method is as follows: recombinant Corynebacterium glutamicum is inoculated into a seed culture medium for culture to obtain a primary seed solution; the primary seed solution is transferred to a seed culture medium at an inoculation rate of 10% (v / v) for culture to obtain a secondary seed solution; the obtained secondary seed solution is inoculated into a fermentation culture medium at an inoculation rate of 20% (v / v) for fermentation to prepare tetrahydropyrimidine.
[0030] In one embodiment of the present invention, the seed liquid is inoculated into the fermentation medium, and the fermentation conditions are: temperature 30-32℃, rotation speed 500-700rpm, and aeration rate 3.0-4.0L / min.
[0031] In one embodiment of the present invention, the fermentation medium consists of 120 g / L glucose, 30 g / L ammonium sulfate, 10 mL / L corn steep liquor, 10 g / L yeast extract, 1 g / L dipotassium hydrogen phosphate, 1 g / L potassium dihydrogen phosphate, 0.5 g / L magnesium sulfate heptahydrate, 0.02 g / L manganese sulfate monohydrate, and 0.02 g / L ferrous sulfate heptahydrate, with an initial pH of 7.0.
[0032] In one embodiment of the present invention, the seed culture medium consists of 50 g / L glucose, 30 mL / L corn steep liquor, 20 g / L ammonium sulfate, 0.5 g / L potassium dihydrogen phosphate, and 0.5 g / L anhydrous magnesium sulfate, with an initial pH of 7.0.
[0033] In one embodiment of the present invention, the glucose content in the fermentation broth is maintained by adding 80% glucose by mass, so that the glucose concentration in the fermentation broth is between 20 and 40 g / L.
[0034] In one embodiment of the present invention, the stirring speed in the 5L fermenter is set to 600 rpm, the temperature is set to 30°C, the aeration rate is set to 3L / min, and the fermentation time is 72h.
[0035] The present invention also provides the application of the above-mentioned recombinant Corynebacterium glutamicum or the above-mentioned method in the preparation of products containing tetrahydropyrimidine.
[0036] Beneficial effects
[0037] (1) This invention utilizes the overexpression of aspartate kinase Lyc, which is relieved by feedback inhibition. S301Y The addition of aspartate semialdehyde dehydrogenase (Asd) increases the supply of the precursor aspartate semialdehyde. This invention significantly reduces the content of the byproduct L-lysine in the fermentation broth by inserting a BetI-binding sequence into the promoter region of the dihydropyridine dicarboxylic acid synthase gene (dapA) and simultaneously overexpressing BetI. This invention also addresses the imbalance between cell growth and acid production during fermentation by inserting a repressor protein (LmrA) binding sequence into the promoter region of the citrate synthase gene (gltA) and simultaneously overexpressing LmrA, thereby increasing the supply of precursors oxaloacetate and acetyl-CoA and significantly improving the yield of tetrahydropyrimidine.
[0038] (2) This invention provides a recombinant Corynebacterium glutamicum CGE01 / pXMJ19-ectBAC-SynUTR that can produce high levels of tetrahydropyrimidine. lmrA_variant6 -lmrA / pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant5 -betI.
[0039] When this recombinant Corynebacterium glutamicum was inoculated into a 5L fermenter and fermented for 72 hours, the yield of tetrahydropyrimidine reached 45.5 g / L, and the yield of glucose reached 0.25 g / g. Attached Figure Description
[0040] Figure 1 : Schematic diagram of constructing a repressor sublibrary to downregulate competitive metabolic flux.
[0041] Figure 2 The effect of the repressor library on the production of tetrahydropyrimidine.
[0042] Figure 3 Recombinant Corynebacterium glutamicum K02 / pXMJ19-ectBAC / pEC-XK99E-lysCS301Y -asd fermentation process curve.
[0043] Figure 4 Recombinant Corynebacterium glutamicum CGE01 / pXMJ19-ectBAC-SynUTR lmrA_variant6 -lmrA / pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant5 -betI fermentation process curve. Detailed Implementation
[0044] The present invention will be further described below with reference to specific embodiments.
[0045] The following examples involve Corynebacterium glutamicum K02, purchased from the China Industrial Microbiology Information Center, catalog number CICIM B1031.
[0046] The culture media involved in the following examples are as follows:
[0047] Corynebacterium glutamicum competent culture medium (1L): 10g NaCl, 10g tryptone, 5g yeast extract, 3g glycine, 7g glucose, 1mL Tween-80.
[0048] BHI liquid culture medium: 38.5g brain heart extract broth powder dissolved in 1L distilled water.
[0049] BHI solid medium: Add 2% agar powder to BHI liquid medium.
[0050] LB solid medium (1L): 10g NaCl, 10g tryptone, 5g yeast extract, 20g agar powder.
[0051] The detection methods involved in the following embodiments are as follows:
[0052] Cell density OD was measured using an ultraviolet spectrophotometer. 600 ;
[0053] The glucose content in the fermentation broth was determined using a biosensor analyzer (SBA-40ES, Shandong Academy of Sciences Institute of Biology); the tetrahydropyrimidine content was determined by HPLC (Thermo Fisher Scientific) using a Platisil NH2 column, with a mobile phase of 75% acetonitrile aqueous solution, a flow rate of 1 mL / min, and a column temperature of 30℃. Quantitative detection was performed at a UV wavelength of 210 nm.
[0054] The formula for calculating glucose conversion rate is as follows:
[0055]
[0056] In the formula: η: glucose conversion rate; C 四氢嘧啶 C0: Concentration of tetrahydropyrimidine in the fermentation broth after fermentation, g / L; C0: Initial glucose concentration in the fermentation broth, g / L; C0: Concentration of tetrahydropyrimidine in the fermentation broth after fermentation. 葡萄糖 V1: Glucose concentration in the fermentation broth after fermentation, g / L; V1: Volume of 80% glucose solution consumed, L; V: Volume of fermentation broth after fermentation, L.
[0057] Example 1: Construction of recombinant Corynebacterium glutamicum CGE01
[0058] The specific steps are as follows:
[0059] (1) Construction of the integration plasmid pK18mobsacB-P BetI -dapA
[0060] The promoter sequence of the dapA gene, a dihydropyridine dicarboxylic acid synthase, was determined from the NCBI website of the Corynebacterium glutamicum ATCC 13032 genome. The insertion site of the BetI repressor protein (nucleotide sequence shown in SEQ ID NO.1) was also determined. Gene fragments of 750 bp before and after the insertion site were selected as upstream and downstream homologous arms, as shown in SEQ ID NO.22 and SEQ ID NO.23.
[0061] The upstream and downstream homologous arm fragments (containing the BetI repressor binding sequence) of the insertion site were amplified from the genome of Corynebacterium glutamicum K02 using primers P1 / P2 and P3 / P4. The primer sequences involved are as follows:
[0062] P1: 5'-aggaaacagctatgacatgattacgaattcatgttgagggcgcggaagc-3';
[0063] P2: 5'-ttatattgaacgtccaatcaatggtttttacggctgtcttttacagc-3';
[0064] P3: 5'-attgattggacgttcaatataatcttgctcatgtcaattgttcttatcggaa-3';
[0065] P4: 5'-ttgtaaaacgacggccagtgccaagcttgatccgcccaaagcaagc-3';
[0066] The PCR program was as follows: 95℃, 10 min; 95℃, 30 s; 58℃, 30 s; 72℃, 1 min; 72℃, 10 min, 30 cycles. After purification, the two fragments were amplified by overlap extension PCR using primers P1 / P4 to obtain a fusion fragment. This fusion fragment was then purified and ligated to the linearized plasmid pK18mobsacB (EcoR I / Hind III) using the ClonExpress II One Step Cloning Kit (Novizan). The fusion fragment was then transformed into E. coli JM109 competent cells to obtain transformants. These transformants were then inoculated into LB broth containing 50 μg / mL kanamycin. Positive transformant colonies were picked and PCR was performed to verify the correct band size. The plasmid was extracted and sequenced by Genewiz. If the sequencing was correct, then pK18mobsacB-P... BetI -dapA plasmid construction successful.
[0067] (2) Construction of the integration plasmid pK18mobsacB-P LmrA -gltA
[0068] The citrate synthase gene gltA sequence from the Corynebacterium glutamicum ATCC 13032 genome published on the NCBI website was used to determine the promoter sequence location of the gltA gene and the insertion site of the repressor protein LmrA binding sequence (nucleotide sequence shown in SEQ ID NO.2). Gene fragments of 750 bp before and after the insertion site were taken as upstream and downstream homologous arms, and the sequences are shown in SEQ ID NO.24 and SEQ ID NO.25.
[0069] The upstream and downstream homologous arm fragments (containing the LmrA repressor protein binding sequence) of the insertion site were amplified from the genome of Corynebacterium glutamicum K02 using primers P5 / P6 and P7 / P8. The primer sequences involved are as follows:
[0070] P5: 5'-ggaaacagctatgacatgattacgaattccaaacttggaggagaactcaccg-3';
[0071] P6: 5'-aaatatagtgactggtctattatcggcattaaaaatcccacaataagtggact-3';
[0072] P7: 5'-gataatagaccagtcactatatttttaaaggccagcattttcaccct-3';
[0073] P8: 5'-ttgtaaaacgacggccagtgccaagcttcgaatctcgtcgttaaacttgtgaag-3';
[0074] The PCR program was as follows: 95℃, 10 min; 95℃, 30 s; 58℃, 30 s; 72℃, 1 min; 72℃, 10 min, 30 cycles. After purification, the two fragments were amplified by overlap extension PCR using primers P5 / P8 to obtain a fusion fragment. This fusion fragment was then purified and ligated to the linearized plasmid pK18mobsacB (EcoR I / Hind III) using the ClonExpress II One Step Cloning Kit (Novizan). The fusion fragment was then transformed into E. coli JM109 competent cells to obtain transformants. These transformants were then inoculated into LB broth containing 50 μg / mL kanamycin. Positive transformant colonies were picked and PCR was performed to verify the correct band size. The plasmid was extracted and sequenced by Genewiz. If the sequencing was correct, then pK18mobsacB-P... LmrA The -gltA plasmid was successfully constructed.
[0075] (3) Preparation of competent cells: C. glutamicum K02 cells were picked and inoculated into 10 mL of BHI liquid medium and cultured in a shaker at 30 °C for 18 h. The cultured bacterial solution was then transferred to 100 mL of liquid LBG medium containing 3 g / L glycine and 0.1% Tween-80, so that the initial cell OD 600 Cells were cultured at 0.3°C and 30°C at 200 rpm until the OD value reached 0.3. 600 The concentration reached 0.9. After cell culture, the bacterial culture was pre-cooled for 30 min, and then the cells were collected by centrifugation. The cells were washed three times with pre-cooled 10% glycerol, and finally resuspended in 0.2 mL of 10% glycerol. The cells were then dispensed into 1.5 mL tubes, with each tube containing 60 μL, for direct electroporation.
[0076] Electroporation: Electroporate at 1.8kV for 5ms, then add 800μL of BHI medium and incubate at 30℃ and 200rpm for 1-2h.
[0077] Recombinant bacteria obtained:
[0078] The recombinant plasmid pK18mobsacB-P prepared in step (1) is used. BetI-dapA was transformed into C. glutamicum K02 competent cells to obtain transformants. The transformants were plated on BHI solid medium containing 50 μg / mL kanamycin resistance and incubated at 30°C. Positive colonies were picked, and single colonies were verified by Taq DNA polymerase using P1 / P4 primers. Positive single colonies with the target band size were inoculated into vials containing BHI liquid medium and incubated for 12 h. Then, they were transferred to BHI liquid medium containing 20% (m / v) sucrose and incubated for another 12 h. The colonies were streaked onto BHI-free plates and incubated for 24 h. Colony PCR was then performed to verify that the amplified fragment was smaller than the wild-type fragment, indicating a positive clone. Positive clones were inoculated into BHI vials and incubated overnight at 30°C. The bacterial genome was extracted and sent to Genewiz for sequencing to verify successful sequence insertion.
[0079] The strain in which the BetI binding sequence of the repressor protein was inserted into the promoter region of the dihydropyridine dicarboxylic acid synthase gene dapA in Corynebacterium glutamicum K02 was named CGQ00.
[0080] (4) Preparation of competent cells: C. glutamicum CGQ00 competent cells were prepared according to the method described in step (3).
[0081] Recombinant bacteria obtained: The recombinant plasmid pK18mobsacB-P prepared in step (2) was used... LmrA -gltA was transformed into C. glutamicum CGQ00 competent cells to obtain transformants. The transformants were plated on BHI solid medium containing 50 μg / mL kanamycin resistance and incubated at 30°C. Positive colonies were picked, and single colonies were verified by Taq DNA polymerase using P5 / P8 primers. Positive single colonies with the target band size were inoculated into vials containing BHI liquid medium and incubated for 12 h. Then, they were transferred to BHI liquid medium containing 20% (m / v) sucrose and incubated for another 12 h. The colonies were streaked onto BHI-free plates and incubated for 24 h. Colony PCR was then performed to verify that the amplified fragment was smaller than the wild-type fragment, indicating a positive clone. Positive clones were inoculated into BHI vials and incubated overnight at 30°C. The bacterial genome was extracted and sent to Genewiz for sequencing to verify successful sequence insertion.
[0082] The strain in which the citrate synthase gene gltA promoter region of Corynebacterium glutamicum CGQ00 was inserted into the repressor protein LmrA binding sequence was named CGQ01.
[0083] Example 2: Recombinant Corynebacterium glutamicum K02 / pXMJ19-ectBAC / pEC-XK99E-lysC S301Y-asd construction
[0084] The specific steps are as follows:
[0085] (1) Based on the whole genome nucleic acid sequence of Pseudomonas stutzeri A1501 (ectBAC, nucleotide sequence as shown in SEQ ID NO.3), the whole genome nucleic acid sequence of Corynebacterium glutamicum 13032 (lysC, nucleotide sequence as shown in SEQ ID NO.6), and the whole genome nucleic acid sequence of Escherichia coli BL21(DE3) (asd, nucleotide sequence as shown in SEQ ID NO.7) in NCBI, PCR primers P9 / P10 for the tetrahydropyrimidine synthesis gene cluster, PCR primers P11 / P12 for the aspartate kinase gene, and PCR primers P13 / P14 for the aspartate semialdehyde dehydrogenase gene were designed.
[0086] P9: 5'-gcatgcctgcaggtcgactctagaggatccaaaggaggacaaccatgaagaccttcgaactgaa-3';
[0087] P10: 5'-tccataactcatgacggttgtagtcctttgtcaactcttaatggtgatggtg-3';
[0088] P11: 5'-caggaaacagaccatggaattcaaaggaggacaaccatggccctggtcgtacagaaatatgg-3';
[0089] P12: 5'-tgcaggtcgactctagaggatccttagcgtccggtgcctgcataaac-3';
[0090] P13: 5'-tcacacaggaaacagaccatggaattcaaaggaggacaaccatgtctgaaggctggaacattgc-3';
[0091] P14: 5'-ttagtacagatactcctgcaccagtttct-3';
[0092] (2) Cloning of the tetrahydropyrimidine synthesis gene cluster, aspartate kinase gene, and aspartate semialdehyde dehydrogenase gene.
[0093] Using total DNA templates from *Pseudomonas stutzeri* A1501, *Corynebacterium glutamicum* 13032, and *Escherichia coli* BL21(DE3), PCR amplification was performed using the aforementioned primers. The amplification conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 90 s, 30 cycles; and a final extension at 72℃ for 5 min. The PCR amplification system consisted of 1 μL template, 1 μL each of forward and reverse primers, 22 μL sterile double-distilled water, and 25 μL 2×Phanta Max Master Mix. The PCR products were purified and recovered using a gel extraction kit, and the concentration of the recovered products was determined. The recovered products were stored in 1.5 mL centrifuge tubes at -20℃ for later use.
[0094] (3) Construction of the aspartate kinase mutant S301Y
[0095] Based on the lysC gene sequence in the whole genome nucleic acid sequence of Corynebacterium glutamicum 13032 in NCBI, PCR primers P15 / P16 and P17 / P18 were designed for the aspartate kinase mutant S301Y.
[0096] P15: 5'-tctattctgtagaagacggcaccaccg-3';
[0097] P16: 5'-caggaaacagaccatggaattcaaaggaggacaaccatggccctggtcgtacagaaatatgg-3';
[0098] P17: 5'tgcaggtcgactctagaggatccttagcgtccggtgcctgcataaac-3';
[0099] P18: 5'-gccgtcttctacagaatagacgttctgca-3';
[0100] Fusion PCR was performed using primers P15 / P16 and P17 / P18, with the recombinant plasmid pEC-XK99E-lysC as a template for site-directed mutagenesis. The fusion PCR amplification conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 8 cycles; followed by the addition of primers P15 and P18, 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 90 s, 30 cycles; and a final extension at 72℃ for 5 min. The PCR amplification system consisted of 2 μL of the upper and lower primer segments, 1 μL each of P15 and P18 primers, 19 μL of sterile double-distilled water, and 25 μL of 2×PhantaMax Master Mix. The PCR products were purified and recovered using a gel extraction kit, and the concentration of the recovered products was determined. The recovered product was stored in 1.5 mL centrifuge tubes at -20°C for later use.
[0101] (4) Recombinant plasmids pXMJ19-ectBAC and pEC-XK99E-lysC S301Y -asd construction
[0102] The plasmid pXMJ19, preserved in E. coli JM109, was extracted and double-digested with BamHI and EcoRI. After recovery using a gel extraction kit, it was ligated with the tetrahydropyrimidine gene cluster in (2). The ligation system was: 2 μL of Exnase II, 4 μL of 5×CE II Bμffer, and the vector and fragment were added according to the Exnase II ligase instructions. The total volume was brought up to 20 μL with sterile double-distilled water. The enzyme was then ligated at 30°C for 30 min.
[0103] The aspartate semialdehyde dehydrogenase gene asd from (2) was fused with the gene fragment obtained from (3) by fusion PCR to obtain a tandem fragment. The plasmid pEC-XK99E, which was stored in E. coli JM109, was extracted and double-digested with BamHI and EcoRI. After being recovered using a gel extraction kit, it was ligated with the tandem fragment. The ligation system was: 2 μL of Exnase II, 4 μL of 5×CEII Bμffer, and the vector and fragment were added according to the Exnase II ligase instructions. The total volume was brought up to 20 μL with sterile double-distilled water. The enzyme was then ligated at 30℃ for 30 min.
[0104] The ligated recombinant plasmids were transformed into E. coli JM109 competent cells, and positive transformants were screened using LB solid medium supplemented with chloramphenicol at a concentration of 10 μg / mL.
[0105] Correctly identified transformants were picked and inoculated into 10 ml of LB broth containing 10 μg / mL chloramphenicol resistance. After overnight incubation at 37°C with a shaker, plasmids were extracted. Following enzyme digestion verification and sequencing, the correct recombinant strains *Escherichia coli* JM109 / pXMJ19-ectBAC and *Escherichia coli* JM109 / pEC-XK99E-lysC were obtained. S301Y -asd, and extracted the recombinant plasmids: pXMJ19-ectBAC and pEC-XK99E-lysC. S301Y -asd.
[0106] (5) Recombinant plasmids pXMJ19-ectBAC and pEC-XK99E-lysC S301Y -asd conversion of C.glutamicum K02
[0107] Competent cell preparation: C. glutamicum K02 competent cells were prepared according to the method described in step (3) of Example 1.
[0108] Recombinant bacteria were obtained by transforming the recombinant plasmid pXMJ19-ectBAC prepared in step (4) into C. glutamicum K02 competent cells to obtain transformants. The transformants were then spread on solid medium containing chloramphenicol-resistant BHI at a concentration of 10 μg / mL and cultured at 30°C. Positive colonies were picked, and plasmids were extracted and digested to verify the results, thus obtaining the recombinant bacteria C. glutamicum K02 / pXMJ19-ectBAC.
[0109] Competent state preparation:
[0110] C. glutamicum K02 / pXMJ19-ectBAC competent cells were prepared according to the method described in step (3) of Example 1.
[0111] Recombinant bacteria were obtained by: The recombinant plasmid pEC-XK99E-lysC prepared in step (4) was then... S301Y -asd was transformed into C. glutamicum K02 / pXMJ19-ectBAC competent cells to obtain transformants. These transformants were then plated on BHI solid medium containing 50 μg / mL kanamycin and 10 μg / mL chloramphenicol-resistant cells and incubated at 30°C. Positive colonies were picked, and plasmids were extracted and digested to confirm the recombinant strain C. glutamicum K02 / pXMJ19-ectBAC / pEC-XK99E-lysC. S301Y -asd.
[0112] Example 3: Recombinant Corynebacterium glutamicum CGE01 / pXMJ19-ectBAC-SynUTR lmrA_variant1-7 -lmrA / pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant1-7 -betI's construction
[0113] The specific steps are as follows:
[0114] (1) Based on the whole genome nucleic acid sequence of Bacillus subtilis 168 (nucleotide sequence as shown in SEQ ID NO.4) and the whole genome nucleic acid sequence of Escherichia coli BL21(DE3) (nucleotide sequence as shown in SEQ ID NO.5) in NCBI, the 5'UTR sequence gene fragment SynUTR of the repressor protein gene lmrA was designed. lmrA_variant1 -lmrA~SynUTR lmrA_variant7 Using PCR primers P19-1-7 / P20 for lmrA (nucleotide sequence as shown in SEQ ID NO. 15-21), a 5' UTR sequence gene fragment SynUTR of the repressor protein BetI was designed. betI_variant1 -betI~SynUTR betI_variant7 PCR primers P21-1-7 / P22 for -betI (nucleotide sequence as shown in SEQ ID NO. 8-14).
[0115] The primer sequences involved are as follows:
[0116] P19-1: 5'-tcacacaggaaacagaccatggaattcgacttgacaaaggaggacaaccgtcatg-3';
[0117] P19-2: 5'-tcacacaggaaacagaccatggaattc gagttgacaaaggaggacaaccgtc atg-3;
[0118] P19-3: 5'-tcacacaggaaacagaccatggaattc gacatgacaaaggaggacaaccgtc atg-3';
[0119] P19-4: 5'-tcacacaggaaacagaccatggaattc gagttgacaaaggagtacaaccgtc atg-3';
[0120] P19-5:5’-tcacacaggaaacagaccatggaattc gacttgacaaaggactacaaccgtc atg-3’;
[0121] P19-6:5’-tcacacaggaaacagaccatggaattc gagttgacaaaggactacaaccgtc atg-3’;
[0122] P19-7:5’-tcacacaggaaacagaccatggaattc gacatgacaaaggacgacaaccgtc atg-3’;
[0123] P20:5’-aaaacagccaagctgaattcttatctcttcagcaggtcaggaatgc-3’;
[0124] P21-1:5’-gaaactggtgcaggagtatctgtactaaaggaatataaaggaggacaacccgaatgccca-3’;
[0125] P21-2:5’-gaaactggtgcaggagtatctgtactaaaggaatataaaggaggacaacccgaatgccca-3’;
[0126] P21-3:5’-gaaactggtgcaggagtatctgtactaaaggaatataaaggaggacaacccgaatgccca-3’;
[0127] P21-4:5’-gaaactggtgcaggagtatctgtactaaaggaatataaaggaggacaacccgaatgccca-3’;
[0128] P21-5:5’-gaaactggtgcaggagtatctgtactaaaggaatataaaggaggacaacccgaatgccca-3’;
[0129] P21-6:5’-gaaactggtgcaggagtatctgtactaaaggaatataaaggaggacaacccgaatgccca-3’;
[0130] P21-7: 5'-gaaactggtgcaggagtatctgtactaaaggaatataaaggaggacaacccgaatgccca-3';
[0131] P22: 5'-catgcctgcaggtcgactctagaggatccttaatcggtgggtaaatgctgagtaataaag-3';
[0132] (2) SynUTR gene fragment lmrA_variant1 -lmrA~SynUTR lmrA_variant7 -lmrA and SynUTR betI_variant1 -betI~SynUTR betI_variant7 -betI clone
[0133] Using total DNA from Bacillus subtilis 168 and Escherichia coli BL21(DE3) as templates, PCR amplification was performed using the primers described above. The amplification conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 90 s, 30 cycles; and a final extension at 72℃ for 5 min. The PCR amplification system consisted of 1 μL template, 1 μL each of forward and reverse primers, 22 μL sterile double-distilled water, and 25 μL 2×PhantaMax Master Mix. The PCR products were purified and recovered using a gel extraction kit, and the concentration of the recovered products was determined. The recovered products were stored in 1.5 mL centrifuge tubes at -20℃ for later use.
[0134] (3) Recombinant plasmid pXMJ19-ectBAC-SynUTR lmrA_variant1 -lmrA~pXMJ19-ectBAC-SynUTR lmrA_variant7 -lmrA and pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant1 -betI ~ pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant7 -betI's construction
[0135] plasmids pXMJ19-ectBAC and pEC-XK99E-lysC, preserved in E. coli JM109, were extracted. S301Y-asd was used with primers P23 / P24 and P25 / P26 for full plasmid PCR. The amplification conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 2 min, 30 cycles; 72℃ final extension for 5 min. PCR amplification system: template 1 μL, forward and reverse primers 1 μL each, sterile double-distilled water 22 μL, 2×PhantaMax Master Mix 25 μL. After recovery using a gel extraction kit, it was compared with the gene fragment SynUTR in (2). lmrA_variant1 -lmrA~SynUTR lmrA_variant7 -lmrA and SynUTR betI_variant1 -betI~SynUTR betI_variant7 -betI, perform ligation, ligation system: Exnase II 2μL, 5×CE II Bμffer 4μL, vector and fragment added according to the Exnase II ligase instructions, and sterile double-distilled water to make up the total volume to 20μL, then ligate at 30℃ for 30min.
[0136] P23: 5'-tccataactcatgacggttgtagtcctttgtcaactcttaatggtgatggtg-3';
[0137] P24: 5'-gaattcagcttggctgttttggcg-3';
[0138] P25: 5'-ttagtacagatactcctgcaccagtttct-3';
[0139] P26: 5'-ggatcctctagagtcgacctg-3';
[0140] The ligated recombinant plasmids were transformed into E. coli JM109 competent cells, and positive transformants were screened using LB solid medium supplemented with chloramphenicol at a concentration of 10 μg / mL or kanamycin at a concentration of 50 μg / mL.
[0141] Correctly identified transformants were picked and inoculated into 10 ml LB broth containing 10 μg / mL chloramphenicol or 50 μg / mL kanamycin resistance. After overnight incubation at 37°C with a shaker, plasmids were extracted. Following enzyme digestion verification and sequencing, the correct recombinant strain *Escherichia coli* JM109 / pXMJ19-ectBAC-SynUTR was obtained. lmrA_variant1 -lmrA~pXMJ19-ectBAC-SynUTR lmrA_variant7-lmrA and Escherichia coli JM109 / pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant1 -betI ~ pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant7 -betI, and extracted 14 groups of recombinant plasmids:
[0142] pXMJ19-ectBAC-SynUTR lmrA_variant1 -lmrA~pXMJ19-ectBAC-SynUTR lmrA_variant7 -lmrA and pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant1 -betI ~ pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant7 -betI.
[0143] (4) Construction of recombinant bacteria
[0144] Competent cell preparation: C. glutamicum CGE01 competent cells were prepared according to the method described in step (3) of Example 1.
[0145] Recombinant bacteria were obtained by: The seven recombinant plasmids pXMJ19-ectBAC-SynUTR prepared in step (3) were respectively... lmrA_variant1 -lmrA~pXMJ19-ectBAC-SynUTR lmrA_variant7 -lmrA was transformed into C. glutamicum CGE01 competent cells to obtain transformants. The transformants were then plated on solid medium containing 10 μg / mL chloramphenicol-resistant BHI and incubated at 30°C. Positive colonies were picked, and plasmids were extracted and digested for verification, yielding 7 recombinant bacteria: C. glutamicum CGE01 / pXMJ19-ectBAC-SynUTR. lmrA_variant1 -lmrA~C.glutamicum CGE01 / pXMJ19-ectBAC-SynUTR lmrA_variant7 -lmrA.
[0146] Competent cell preparation: Seven competent cells were prepared according to the method described in step (3) of Example 1: C. glutamicum CGE01 / pXMJ19-ectBAC-SynUTR lmrA_variant1-lmrA~C.glutamicum CGE01 / pXMJ19-ectBAC-SynUTR lmrA_variant7 -lmrA.
[0147] 49 recombinant bacteria were obtained:
[0148] The seven recombinant plasmids pEC-XK99E-lysC prepared in step (3) were respectively... S301Y -asd-SynUTR betI_variant1 -betI ~ pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant7 -betI was transformed into 7 competent cells: C. glutamicum CGE01 / pXMJ19-ectBAC-SynUTR lmrA_variant1 -lmrA~C.glutamicumCGE01 / pXMJ19-ectBAC-SynUTR lmrA_variant7 Transformants were obtained from -lmrA and spread onto BHI solid medium containing 50 μg / mL kanamycin and 10 μg / mL chloramphenicol-resistant bacteria. The medium was incubated at 30°C, and positive colonies were picked. Plasmids were extracted and digested for verification, yielding 49 recombinant bacteria.
[0149] C.glutamicum CGE01 / pXMJ19-ectBAC-SynUTR lmrA_variant1-7 -lmrA / pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant1-7 -betI.
[0150] Example 4: Production of Tetrahydropyrimidine by Recombinant Corynebacterium glutamicum Shake-flask Fermentation
[0151] The specific steps are as follows:
[0152] (1) Preparation of culture medium:
[0153] Seed culture medium: glucose 50 g / L, corn steep liquor 30 mL / L, ammonium sulfate 20 g / L, potassium dihydrogen phosphate 0.5 g / L, anhydrous magnesium sulfate 0.5 g / L, initial pH 7.0;
[0154] Fermentation medium: glucose 120 g / L, ammonium sulfate 30 g / L, corn steep liquor 10 mL / L, yeast extract 10 g / L, dipotassium hydrogen phosphate 1 g / L, potassium dihydrogen phosphate 1 g / L, magnesium sulfate heptahydrate 0.5 g / L, manganese sulfate monohydrate 0.02 g / L, ferrous sulfate heptahydrate 0.02 g / L, calcium carbonate 25 g / L, initial pH 7.0.
[0155] (2) The constructed recombinant bacteria C. glutamicum K02 / pXMJ19-ectBAC / pEC-XK99E-lysC were respectively... S301Y -asd, 49 recombinant bacteria C. glutamicum CGE01 / pXMJ19-ectBAC-SynUTR prepared in Example 3 lmrA_variant1-7 -lmrA / pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant1-7 After activation by streaking BHI solid medium, single colonies were picked and inoculated into the seed culture medium prepared in step (1), and cultured for 24 h to prepare seed solutions.
[0156] (3) The prepared seed liquid was transferred to a shake flask containing 30 mL of fermentation medium prepared in step (1) at a transfer volume of 10% (v / v), and cultured in a reciprocating shaker at 30°C and 150 rpm for 96 h. IPTG was added after 12 h of fermentation culture, with a final concentration of 0.5 mM.
[0157] After fermentation was complete, the fermentation broth was collected, and the tetrahydropyrimidine content was determined by HPLC, while the lysine content was determined by a biosensor analyzer. The results are as follows: Figure 2 As shown, L1 to L7 represent the 5' UTR sequence SynUTR containing the repressor protein gene lmrA. lmrA_variant1 ~SynUTR lmrA_variant7 B1–B7 represent the SynUTR sequence containing the 5' UTR of the repressor protein BetI. betI_variant1 ~SynUTR betI_variant7 .
[0158] The results showed that the recombinant strain C. glutamicum CGE01 / pXMJ19-ectBAC-SynUTR lmrA_variant6 -lmrA / pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant5 -betI( Figure 2 Under the above fermentation process and conditions, CB5L6 can accumulate a maximum yield of 23.2 g / L and lysine of 0.72 g / L, which is higher than that of C. glutamicum K02 / pXMJ19-ectBAC / pEC-XK99E-lysC. S301Y ( Figure 2The yield of tetrahydropyrimidine from K02 (pECT / pLA) was increased by 38.9% (16.7 g / L), while the lysine content (6.45 g / L) decreased to 11.2% of the original level. The increase in tetrahydropyrimidine yield and the decrease in byproduct content were achieved by using a repressor library strategy to downregulate the competitive metabolic pathway.
[0159] Example 5: Production of tetrahydropyrimidine by fermentation of recombinant Corynebacterium glutamicum in a fermenter
[0160] The specific steps are as follows:
[0161] (1) Preparation of culture medium:
[0162] Seed culture medium: glucose 50 g / L, corn steep liquor 30 mL / L, ammonium sulfate 20 g / L, potassium dihydrogen phosphate 0.5 g / L, anhydrous magnesium sulfate 0.5 g / L, initial pH 7.0;
[0163] Fermentation medium: glucose 120 g / L, ammonium sulfate 30 g / L, corn steep liquor 10 mL / L, yeast extract 10 g / L, dipotassium hydrogen phosphate 1 g / L, potassium dihydrogen phosphate 1 g / L, magnesium sulfate heptahydrate 0.5 g / L, manganese sulfate monohydrate 0.02 g / L, ferrous sulfate heptahydrate 0.02 g / L, initial pH 7.0.
[0164] (2) The constructed recombinant bacteria C. glutamicum K02 / pXMJ19-ectBAC / pEC-XK99E-lysC were respectively... S301Y -asd and C.glutamicum CGE01 / pXMJ19-ectBAC-SynUTR lmrA_variant6 -lmrA / pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant5 - After activation by streaking BHI solid medium, single colonies were picked and inoculated into 30mL / 250mL seed medium prepared in step (1), and cultured at 30℃ and 200rpm for 24h to obtain primary seed liquid;
[0165] The primary seed culture was transferred to the seed culture medium prepared in step (1) at a transfer volume of 10% (v / v) and cultured in a shaker at 30°C and 200 rpm for 20 h to prepare the secondary seed culture.
[0166] (3) The secondary seed culture prepared in step (1) was transferred to 2L / 5L of the fermentation medium prepared in step (1) at a transfer rate of 20% (v / v), and fermented for 72h at 30℃, 600rpm, aeration rate of 3L / min, and pH 7.0. IPTG with a final concentration of 0.5mM was added at 12h of culture for induction.
[0167] (4) After fermentation, the fermentation broth was collected, and the tetrahydropyrimidine content was detected by HPLC. The recombinant Corynebacterium glutamicum K02 / pXMJ19-ectBAC / pEC-XK99E-lysC S301Y -asd fermentation process curve as shown Figure 3 As shown, recombinant Corynebacterium glutamicum CGE01 / pXMJ19-ectBAC-SynUTR lmrA_variant6 -lmrA / pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant5 -betI fermentation process curve as shown in the figure Figure 4 As shown.
[0168] Depend on Figure 3 and Figure 4 The results showed that the cell growth trends were basically the same, but different from those of strain C. glutamicum K02 / pXMJ19-ectBAC / pEC-XK99E-lysC S301Y Compared to strain -asd, C. glutamicum CGE01 / pXMJ19-ectBAC-SynUTR lmrA_variant6 -lmrA / pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant5 -betI exhibits lower biomass during the stationary phase. This may be because, after induction, strain C. glutamicum CGE01 / pXMJ19-ectBAC-SynUTR... lmrA_variant6 -lmrA / pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant5 The expression of the repressor in -betI exerted an inhibitory effect and suppressed cell growth, and both strains entered the stationary phase within approximately 24 hours; 12 hours after IPTG induction, cells began to rapidly produce tetrahydropyrimidine.
[0169] After 72 hours of fermentation, C. glutamicum K02 / pXMJ19-ectBAC / pEC-XK99E-lysC S301Y -asd produces 25.4 g / L tetrahydropyrimidine, with a yield of 0.19 g / g glucose.
[0170] In contrast, C. glutamicum CGE01 / pXMJ19-ectBAC-SynUTR lmrA_variant6 -lmrA / pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant5 -betI strain produced 45.5 g / L tetrahydropyrimidine, with a yield of 0.25 g / g glucose.
[0171] Compared to the shake flask scale of Example 4 (1.38 times), the *C. glutamicum* CGE01 / pXMJ19-ectBAC-SynUTR in a 5-L bioreactor... lmrA_variant6 -lmrA / pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant5 -betI's tetrahydropyrimidine yield ratio is higher than that of C. glutamicum K02 / pXMJ19-ectBAC / pEC-XK99E-lysC S301Y -asd is 1.79 times higher.
[0172] The final strain is C. glutamicum CGE01 / pXMJ19-ectBAC-SynUTR. lmrA_variant6 -lmrA / pEC-XK99E-lysC S301Y -asd-SynUTR betI_variant5 -betI showed the highest glucose conversion rate in Corynebacterium glutamicum.
[0173] These results indicate that applying the repression sublibrary strategy ( Figure 1 Fine-tuning the competitive metabolic flux of tetrahydropyrimidine in Corynebacterium glutamicum can effectively increase tetrahydropyrimidine yield and reduce byproduct synthesis. This advantage is even more pronounced at larger-scale fermentation levels, giving the strain greater industrial production potential.
[0174] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. A recombinant Corynebacterium glutamicum, characterized in that, In the host Corynebacterium glutamicum ( Corynebacterium glutamicum The dihydropyridine dicarboxylic acid synthase gene on the K02 genome dapA The BetI repressor protein binding sequence is inserted downstream of the promoter and into the citrate synthase gene. gltA A repressor protein LmrA binding sequence was inserted downstream of the promoter; simultaneously, the tetrahydropyrimidine synthesis gene cluster derived from *Pseudomonas schlegelii* was overexpressed. ectBAC The repressor protein gene coupled with the 5'UTR sequence of the repressor protein LmrA lmrA Aspartate kinase gene with feedback inhibition deprivation from Corynebacterium glutamicum lysC S301Y Aspartate semialdehyde dehydrogenase gene from E. coli asd And the repressor protein gene coupled with the 5'UTR sequence of the repressor protein BetI betI ; The nucleotide sequence of the BetI binding sequence of the repressor protein is shown in SEQ ID NO.1, and the nucleotide sequence of the LmrA binding sequence of the repressor protein is shown in SEQ ID NO.
2. The nucleotide sequence of the 5' UTR of the repressor protein BetI is shown in either SEQ ID NO. 12 or 13, and the repressor protein gene is described. lmrA The nucleotide sequence of the 5'UTR is shown in any one of SEQ ID NO. 19-21; the tetrahydropyrimidine synthesis gene cluster ectBAC The nucleotide sequence is shown in SEQ ID NO.3, and the repressor protein gene is described. lmrA The nucleotide sequence is shown in SEQ ID NO.4, and the repressor protein gene is described. betI The nucleotide sequence is shown in SEQ ID NO.5, and the aspartate kinase gene is described. lysC S301Y The nucleotide sequence of the gene is shown in SEQ ID NO.6, the aspartate semialdehyde dehydrogenase gene. asd The nucleotide sequence is shown in SEQ ID NO.
7.
2. The recombinant Corynebacterium glutamicum as described in claim 1, characterized in that, The recombinant Corynebacterium glutamicum was expressed using pXMJ19 or pEC-XK99E plasmids.
3. The recombinant Corynebacterium glutamicum as described in claim 2, characterized in that, The recombinant Corynebacterium glutamicum was expressed using the pXMJ19 plasmid to express the tetrahydropyrimidine synthesis gene cluster. ectBAC The repressor protein gene coupled with the 5'UTR sequence of the repressor protein LmrA lmrA Simultaneously, the feedback inhibition-relieved aspartate kinase gene derived from Corynebacterium glutamicum was expressed using the pEC-XK99E plasmid. lysC S301Y Aspartate semialdehyde dehydrogenase gene from E. coli asd And the repressor protein gene coupled with the 5'UTR sequence of the repressor protein BetI betI .
4. The recombinant Corynebacterium glutamicum as described in claim 3, characterized in that, The nucleotide sequence of the 5'UTR of the repressor protein BetI is shown in SEQ ID NO. 12, and the repressor protein gene is described. lmrA The nucleotide sequence of the 5'UTR is shown in SEQ ID NO.
20.
5. A method for producing tetrahydropyrimidine, characterized in that, The method involves preparing tetrahydropyrimidine by fermentation using any one of the recombinant Corynebacterium glutamicum as described in claims 1 to 4.
6. The method as described in claim 5, characterized in that, The method involves inoculating recombinant Corynebacterium glutamicum into a seed culture medium to obtain a seed solution; then inoculating the prepared seed solution into a fermentation culture medium at an inoculation rate of 18-20% to ferment and prepare tetrahydropyrimidine.
7. The method as described in claim 5 or 6, characterized in that, Recombinant Corynebacterium glutamicum was inoculated into seed culture medium and cultured under the following conditions: 28-32 ℃, with the initial pH of the seed culture medium controlled at 7.0-7.
2.
8. The method as described in claim 5 or 6, characterized in that, Recombinant Corynebacterium glutamicum was inoculated into seed culture medium and cultured to obtain primary seed solution; The primary seed culture was transferred to the seed culture medium at an inoculation rate of 10% and cultured to obtain the secondary seed culture. The prepared secondary seed liquid was inoculated into the fermentation medium at an inoculation rate of 20% to prepare tetrahydropyrimidine.
9. The use of the recombinant Corynebacterium glutamicum according to any one of claims 1 to 4, or the method according to any one of claims 5 to 8, in the preparation of a product containing tetrahydropyrimidine.
Citation Information
Patent Citations
Coryneform bacteria which produce chemical compounds ii
CN101126075A
Tetrahydropyridine high-yield Corynebacterium glutamicum and application thereof
CN110699310A