Preparation method and application of TCR-T targeting SARS-Cov-2

Abstract

The invention relates to a method for preparing a TCR-T targeting SARS-Cov-2 and its application, comprising: 1) synthesizing a SARS-Cov-2 antigen peptide XG2; 2) stimulating the peripheral blood of volunteers with HLA-A*02:01 with antigen peptides to obtain SARS-Cov-2 specific T cells; 3) extracting total RNA of SARS-Cov-2 specific T cells, reverse transcribing to obtain cDNA, and performing NSG sequencing after multiple PCR to obtain an immune repertoire; 4) performing bioinformatics analysis on the immune repertoire to obtain a specific CDR3 sequence; 5) using the specific CDR3 sequence to clone and construct a TCR-T lentiviral vector, which is used to target and identify cells infected with SARS-Cov-2 and to kill them.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to a CDR3 sequence capable of targeting and recognizing a Spike protein from severe acute respiratory syndrome coronavirus 2 (SARS-Cov2) and an application thereof on a TCR-T. Background Art

[0002] SARS-CoV-2 is the causative pathogen of the 2019 novel coronavirus (COVID-19) pandemic. When a host is infected with SARS-CoV-2, it will cause corresponding damage to multiple organs including the lungs, liver, brain, kidneys and intestines. If a patient infected with SARS-Cov-2 has underlying diseases, even if they actively receive effective antiviral treatment, there is a high probability that they will develop into a severe case, which seriously threatens their life safety.

[0003] With the emergence of mutant strains such as SARS-CoV-2B.1.1.7 (alpha), B.1.351 (beta), P.1 (gamma), B.1.617.2 (delta) and B.1.1.529 (omicron), due to the restriction of their incubation period and the unclear symptoms, the infected people cannot be isolated in a timely and effective manner, and their infectiousness is greatly enhanced.

[0004] At present, the treatment options for patients infected with SARS-Cov-2 are single, mostly routine use of antiviral drugs, and the prognosis depends largely on the efficacy of the host immune system. Therefore, there is an urgent need for a therapeutic product that can enhance the function of SARS-Cov-2-specific T cells to target and kill SARS-Cov-2. Summary of the invention

[0005] The purpose of the present invention is to solve the above-mentioned problems in the prior art, provide a method for constructing a CDR3 sequence that can target the SARS-Cov-2 spike protein and a corresponding TCR-T lentiviral vector and its application, and solve the problem that antiviral drugs in the prior art cannot effectively kill SARS-Cov-2 infected cells.

[0006] In order to achieve the above object, the present invention adopts the following technical scheme:

[0007] The method for obtaining the CDR3 sequence targeting the SARS-Cov-2 spike protein comprises the following steps:

[0008] 1) Synthesize SARS-Cov-2 antigen peptide XG2;

[0009] 2) Stimulate the peripheral blood of volunteers with HLA-A*02:01 with antigen peptides to obtain SARS-Cov-2-specific T cells;

[0010] 3) Extract SARS-Cov-2 specific T cell total RNA, reverse transcribe to obtain cDNA, and perform multiplex PCR and NSG sequencing to obtain the immune repertoire;

[0011] 4) Perform bioinformatics analysis on the immune repertoire to obtain specific CDR3 sequences.

[0012] Alpha chain CDR3 amino acid sequence:CILQIYNFNKFYF

[0013] Beta chain CDR3 amino acid sequence:CASKDSDGIYGYTF

[0014] Alpha chain CDR3 nucleotide sequence:

[0015] TGCATCCTCCAGATATACAACTTCAACAAATTTTACTTT

[0016] Beta chain CDR3 nucleotide sequence:

[0017] TGTGCCAGTAAAGACTCGGACGGGATCTATGGCTACACCTTC

[0018] The construction and killing detection of TCR-T targeting SARS-Cov-2 spike protein includes the following steps:

[0019] 1) Using the specific CDR3 sequence clone to construct a TCR-T lentiviral vector;

[0020] 2) Extraction of endotoxin-free plasmids;

[0021] 3) Package the lentivirus, infect PBMC of healthy volunteers, and detect the killing function of the TCR-T against SARS-CoV-2 infected cells.

[0022] The present invention shows that the frequency of the alpha chain CDR3 sequence is as high as 34.9% and the frequency of the beta chain CDR3 sequence is as high as 28.7% in the immune repertoire obtained after stimulation with the antigen peptide XG2 derived from SARS-CoV-2. Based on this, this CDR3 sequence can be used to construct a TCR-T lentiviral vector targeting SARS-CoV-2 and its subsequent applications.

[0023] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0024] The present invention constructs a TCR sequence targeting SARS-Cov-2 spike into a lentiviral vector and then transfers it into the patient's T cells, so that the genetically modified T cells can target and recognize cells infected by SARS-Cov-2 and kill them, achieving a good antiviral effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the double restriction enzyme digestion map for synthesizing the plasmid with the target TCR and the lentiviral vector plasmid.

[0026] Figure 2 This is the TCR-T vector plasmid map.

[0027] Figure 3 This is a diagram showing the killing effect of TCR-T of the present invention on target cells. DETAILED DESCRIPTION

[0028] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention clearer and more understandable, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments.

[0029] Part I:

[0030] The method for obtaining the specific SARS-Cov-2 TCR of the present invention is described

[0031] 1. Preliminary preparation

[0032] (1) Ficoll separation of peripheral mononuclear cells from HLA-A*02:01 healthy volunteers after vaccination;

[0033] (2) The amino acid SLSSTASAL of 937-945 of the SARS-CoV-2 Spike protein was synthesized and named XG-2, which is the antigenic peptide used in the present invention.

[0034] 2. Acquisition of antigen-specific T cells

[0035] (1) Using the above-mentioned SARS-CoV-2XG2 antigen peptide at a final concentration of 10 μg / mL to culture PBMCs from COVID-19 vaccine donors in vitro for 7 days to stimulate the proliferation of SARS-CoV-2-specific cytotoxic T cells;

[0036] (2) Collect cells for flow cytometry analysis and sort SARS-CoV-2 specific CD3 + or CD8 + T cells;

[0037] (3) Extract the mRNA of SARS-CoV-2-specific T cells, reverse transcribe it into cDNA, and use multiplex PCR to obtain the PCR products of TCR α chain and β chain for NGS sequencing.

[0038] Part II:

[0039] Describe the method for constructing the specific SARS-Cov-2 TCR-T lentiviral vector of the present invention

[0040] 1. Raw materials

[0041] Original vector pCDH-EF1a-spike

[0042] Xba I and BspE I endonucleases: purchased from New England Biolabs (Beijing) LTD.

[0043] 2. Construction of vector

[0044] (1) The nucleotide sequences of the TCR α and β chains that can recognize SARS-Cov-2 specific T cells are connected using P2A to synthesize a fusion gene. When synthesizing this gene, Xba I and BspE I restriction sites are included at both ends, respectively, and loaded on a pUC57 vector;

[0045] (2) The synthetic plasmid and the original vector plasmid were double-digested with Xba I and Sal I, and the target fragment was recovered from the synthetic plasmid and the vector fragment was recovered from the original vector plasmid. Figure 1 As shown;

[0046] (3) Use T4 DNA ligase to connect the recovered target fragment and the vector fragment to obtain a lentiviral vector. The plasmid map is shown in Figure 2 shown.

[0047] Part III:

[0048] The specific SARS-Cov-2 TCR-T of the present invention is described to kill SARS-Cov-2

[0049] The killing effect of the prepared TCR-T cells and peripheral blood lymphocytes was compared. The specific experimental steps are as follows:

[0050] (1) Use 4 μM CFSE to culture target cells at 37°C and 5% CO2 for 15 min, wash and set aside;

[0051] (2) The labeled target cells were divided into 1*10 5 100 μg / well were plated in a 96-well plate, and TCR-T cells or peripheral blood lymphocytes were added according to the appropriate E:T ratio, with 3 duplicate wells in each group;

[0052] (3) After culturing at 37°C and 5% CO2 for 4 h, PI (1 mg / ml) staining was performed for 10 min, and the percentage of target cells lysed was analyzed by flow cytometry. The results were as follows: Figure 3 shown.

Claims

1. A method for preparing a TCR-T targeting SARS-Cov-2, characterized in that The following steps are involved: 1) Synthesis of SARS-Cov-2 antigen peptide XG2; 2) Stimulate the peripheral blood of volunteers with HLA-A*02:01 with antigen peptides to obtain SARS-Cov-2-specific T cells; 3) Extract SARS-Cov-2 specific T cell total RNA, reverse transcribe to obtain cDNA, and perform multiplex PCR and NSG sequencing to obtain the immune repertoire; 4) Analyze the bioinformatics of the immune repertoire to obtain specific CDR3 sequences; Alpha chain CDR3 amino acid sequence: CILQIYNFNKFYF Beta chain CDR3 amino acid sequence: CASKDSDGIYGYTF Alpha chain CDR3 nucleotide sequence: TGCATCCTCCAGATATACAACTTCAACAAATTTTACTTT Beta chain CDR3 nucleotide sequence: TGTGCCAGTAAAGACTCGGACGGGATCTATGGCTACACCTTC 5) Using the specific CDR3 sequence clone to construct a TCR-T lentiviral vector.

Images